Spaces:
Runtime error
Runtime error
| # credit: https://huggingface.co/spaces/simonduerr/3dmol.js/blob/main/app.py | |
| from typing import Tuple | |
| import os | |
| import sys | |
| from urllib import request | |
| import gradio as gr | |
| import requests | |
| from transformers import AutoTokenizer, AutoModelForMaskedLM, EsmModel, AutoModel | |
| import torch | |
| import progres as pg | |
| import esm | |
| import msa | |
| tokenizer_nt = AutoTokenizer.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-1000g") | |
| model_nt = AutoModelForMaskedLM.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-1000g") | |
| model_nt.eval() | |
| tokenizer_aa = AutoTokenizer.from_pretrained("facebook/esm2_t12_35M_UR50D") | |
| model_aa = EsmModel.from_pretrained("facebook/esm2_t12_35M_UR50D") | |
| model_aa.eval() | |
| tokenizer_se = AutoTokenizer.from_pretrained('sentence-transformers/all-mpnet-base-v2') | |
| model_se = AutoModel.from_pretrained('sentence-transformers/all-mpnet-base-v2') | |
| model_se.eval() | |
| msa_transformer, msa_transformer_alphabet = esm.pretrained.esm_msa1b_t12_100M_UR50S() | |
| msa_transformer = msa_transformer.eval() | |
| msa_transformer_batch_converter = msa_transformer_alphabet.get_batch_converter() | |
| def nt_embed(sequence: str): | |
| tokens_ids = tokenizer_nt.batch_encode_plus([sequence], return_tensors="pt")["input_ids"] | |
| attention_mask = tokens_ids != tokenizer_nt.pad_token_id | |
| with torch.no_grad(): | |
| torch_outs = model_nt( | |
| tokens_ids,#.to('cuda'), | |
| attention_mask=attention_mask,#.to('cuda'), | |
| output_hidden_states=True | |
| ) | |
| last_layer_CLS = torch_outs.hidden_states[-1].detach()[:, 0, :][0] | |
| return last_layer_CLS | |
| def aa_embed(sequence: str): | |
| tokens = tokenizer_aa([sequence], return_tensors="pt") | |
| with torch.no_grad(): | |
| torch_outs = model_aa(**tokens) | |
| return torch_outs[0] | |
| def se_embed(sentence: str): | |
| encoded_input = tokenizer_se([sentence], return_tensors='pt') | |
| with torch.no_grad(): | |
| model_output = model_se(**encoded_input) | |
| return model_output[0] | |
| def msa_embed(sequences: list): | |
| inputs = msa.greedy_select(sequences, num_seqs=128) # can change this to pass more/fewer sequences | |
| msa_transformer_batch_labels, msa_transformer_batch_strs, msa_transformer_batch_tokens = msa_transformer_batch_converter([inputs]) | |
| msa_transformer_batch_tokens = msa_transformer_batch_tokens.to(next(msa_transformer.parameters()).device) | |
| with torch.no_grad(): | |
| temp = msa_transformer(msa_transformer_batch_tokens,repr_layers=[12])['representations'] | |
| temp = temp[12][:,:,0,:] | |
| temp = torch.mean(temp,(0,1)) | |
| return temp | |
| def go_embed(terms): | |
| pass | |
| def download_data_if_required(): | |
| url_base = f"https://zenodo.org/record/{pg.zenodo_record}/files" | |
| fps = [pg.trained_model_fp] | |
| urls = [f"{url_base}/trained_model.pt"] | |
| #for targetdb in pre_embedded_dbs: | |
| # fps.append(os.path.join(database_dir, targetdb + ".pt")) | |
| # urls.append(f"{url_base}/{targetdb}.pt") | |
| if not os.path.isdir(pg.trained_model_dir): | |
| os.makedirs(pg.trained_model_dir) | |
| #if not os.path.isdir(database_dir): | |
| # os.makedirs(database_dir) | |
| printed = False | |
| for fp, url in zip(fps, urls): | |
| if not os.path.isfile(fp): | |
| if not printed: | |
| print("Downloading data as first time setup (~340 MB) to ", pg.progres_dir, | |
| ", internet connection required, this can take a few minutes", | |
| sep="", file=sys.stderr) | |
| printed = True | |
| try: | |
| request.urlretrieve(url, fp) | |
| d = torch.load(fp, map_location="cpu") | |
| if fp == pg.trained_model_fp: | |
| assert "model" in d | |
| else: | |
| assert "embeddings" in d | |
| except: | |
| if os.path.isfile(fp): | |
| os.remove(fp) | |
| print("Failed to download from", url, "and save to", fp, file=sys.stderr) | |
| print("Exiting", file=sys.stderr) | |
| sys.exit(1) | |
| if printed: | |
| print("Data downloaded successfully", file=sys.stderr) | |
| def get_pdb(pdb_code="", filepath=""): | |
| if pdb_code is None or pdb_code == "": | |
| try: | |
| with open(filepath.name) as f: | |
| return f.read() | |
| except AttributeError as e: | |
| return None | |
| else: | |
| return requests.get(f"https://files.rcsb.org/view/{pdb_code}.pdb").content.decode() | |
| def molecule(pdb): | |
| x = ( | |
| """<!DOCTYPE html> | |
| <html> | |
| <head> | |
| <meta http-equiv="content-type" content="text/html; charset=UTF-8" /> | |
| <style> | |
| body{ | |
| font-family:sans-serif | |
| } | |
| .mol-container { | |
| width: 100%; | |
| height: 600px; | |
| position: relative; | |
| } | |
| .mol-container select{ | |
| background-image:None; | |
| } | |
| </style> | |
| <script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/3.6.3/jquery.min.js" integrity="sha512-STof4xm1wgkfm7heWqFJVn58Hm3EtS31XFaagaa8VMReCXAkQnJZ+jEy8PCC/iT18dFy95WcExNHFTqLyp72eQ==" crossorigin="anonymous" referrerpolicy="no-referrer"></script> | |
| <script src="https://3Dmol.csb.pitt.edu/build/3Dmol-min.js"></script> | |
| </head> | |
| <body> | |
| <div id="container" class="mol-container"></div> | |
| <script> | |
| let pdb = `""" | |
| + pdb | |
| + """` | |
| $(document).ready(function () { | |
| let element = $("#container"); | |
| let config = { backgroundColor: "black" }; | |
| let viewer = $3Dmol.createViewer(element, config); | |
| viewer.addModel(pdb, "pdb"); | |
| viewer.getModel(0).setStyle({}, { cartoon: { color:"spectrum" } }); | |
| viewer.addSurface("MS", { opacity: .5, color: "white" }); | |
| viewer.zoomTo(); | |
| viewer.render(); | |
| viewer.zoom(0.8, 2000); | |
| }) | |
| </script> | |
| </body></html>""" | |
| ) | |
| return f"""<iframe style="width: 100%; height: 600px" name="result" allow="midi; geolocation; microphone; camera; | |
| display-capture; encrypted-media;" sandbox="allow-modals allow-forms | |
| allow-scripts allow-same-origin allow-popups | |
| allow-top-navigation-by-user-activation allow-downloads" allowfullscreen="" | |
| allowpaymentrequest="" frameborder="0" srcdoc='{x}'></iframe>""" | |
| def str2coords(s): | |
| coords = [] | |
| for line in s.split('\n'): | |
| if (line.startswith("ATOM ") or line.startswith("HETATM")) and line[12:16].strip() == "CA": | |
| coords.append([float(line[30:38]), float(line[38:46]), float(line[46:54])]) | |
| elif line.startswith("ENDMDL"): | |
| break | |
| return coords | |
| def update_st(inp, file): | |
| pdb = get_pdb(inp, file) | |
| return (molecule(pdb), pg.embed_coords(str2coords(pdb))) | |
| def update_nt(inp): | |
| return str(nt_embed(inp or '')) | |
| def update_aa(inp): | |
| return str(aa_embed(inp)) | |
| def update_se(inp): | |
| return str(se_embed(inp)) | |
| def update_go(inp): | |
| return str(go_embed(inp)) | |
| def update_msa(inp): | |
| return str(msa_embed(msa.read_msa(inp.name))) | |
| demo = gr.Blocks() | |
| with demo: | |
| with gr.Tabs(): | |
| with gr.TabItem("PDB Structural Embeddings"): | |
| with gr.Row(): | |
| with gr.Box(): | |
| inp = gr.Textbox( | |
| placeholder="PDB Code or upload file below", label="Input structure" | |
| ) | |
| file = gr.File(file_count="single") | |
| gr.Examples(["2CBA", "6VXX"], inp) | |
| btn = gr.Button("View structure") | |
| gr.Markdown("# PDB viewer using 3Dmol.js") | |
| mol = gr.HTML() | |
| emb = gr.Textbox(interactive=False) | |
| btn.click(fn=update_st, inputs=[inp, file], outputs=[mol, emb]) | |
| with gr.TabItem("Nucleotide Sequence Embeddings"): | |
| with gr.Box(): | |
| inp = gr.Textbox( | |
| placeholder="ATCGCTGCCCGTAGATAATAAGAGACACTGAGGCC", label="Input Nucleotide Sequence" | |
| ) | |
| btn = gr.Button("View embeddings") | |
| emb = gr.Textbox(interactive=False) | |
| btn.click(fn=update_nt, inputs=[inp], outputs=emb) | |
| with gr.TabItem("Amino Acid Sequence Embeddings"): | |
| with gr.Box(): | |
| inp = gr.Textbox( | |
| placeholder="AAGQCYRGRCSGGLCCSKYGYCGSGPAYCG", label="Input Amino Acid Sequence" | |
| ) | |
| btn = gr.Button("View embeddings") | |
| emb = gr.Textbox(interactive=False) | |
| btn.click(fn=update_aa, inputs=[inp], outputs=emb) | |
| with gr.TabItem("Sentence Embeddings"): | |
| with gr.Box(): | |
| inp = gr.Textbox( | |
| placeholder="Your text here", label="Input Sentence" | |
| ) | |
| btn = gr.Button("View embeddings") | |
| emb = gr.Textbox(interactive=False) | |
| btn.click(fn=update_se, inputs=[inp], outputs=emb) | |
| with gr.TabItem("MSA Embeddings"): | |
| with gr.Box(): | |
| inp = gr.File(file_count="single", label="Input MSA") | |
| btn = gr.Button("View embeddings") | |
| emb = gr.Textbox(interactive=False) | |
| btn.click(fn=update_msa, inputs=[inp], outputs=emb) | |
| with gr.TabItem("GO Embeddings"): | |
| with gr.Box(): | |
| inp = gr.Textbox( | |
| placeholder="", label="Input GO Terms" | |
| ) | |
| btn = gr.Button("View embeddings") | |
| emb = gr.Textbox(interactive=False) | |
| btn.click(fn=update_go, inputs=[inp], outputs=emb) | |
| if __name__ == "__main__": | |
| download_data_if_required() | |
| demo.launch() |