text
stringlengths 8
5.77M
|
|---|
19 Dairy-Free Recipes Your Kids Will Actually Want to Eat
If your kid is dairy-free (or happens to be a picky eater), finding meals they actually can and want to eat is no easy task. But there is hope. We rounded up 19 totally delicious recipes the little ones will be excited about—even without the milk, butter and cheese.
|
AR.OUND CITY HALL P OPULAR predictions last year that hIstory would remember the nineteen-eighties as a Republican decade, in which the Democrats could only hunker down and repent their sins, have now been stashed away by many Americans, along with such dated items as WIN buttons and alleg- edly authentic splinters from Amy Carter's tree house. However, in the face of a faltering economy and other developments that many believe have ominous implications for the Grand Old Party, Washington continues, for the short run at least, to be a Republi- can show. Or, at any rate, that is the word from local politicians who regu- larly travel back and forth between N ew York and the capital. This inter- city traffic is naturally nowhere near as heavy as it was in the era when Presi- dent Carter was eager to reward New York political leaders for having pro- vided the decisive bloc of electoral votes that put him over in 1976. Four years later, he was even more eager to have the favor repeated, and during some weeks in the summer and early fall of 1980 it would have been a chal- lenge to try to locate aNew York poli- tician of any importance-a Demo- crat, that is-who had not recently had a meal of some kind at the White House. Nowadays, the people invited to break bread at 1600 Pennsylvania Avenue are likely to be Republicans from the Sun Belt, leaving most Democrats feeling out of things, even as they scheme to improve their party's position in this fall's congres- sional and gubernato- rial elections. Last month, when Connect- icut Senator Christo- pher Dodd was seen serving as a gofer, fetching a drink for New York producer Joseph Papp at the Washington opening of Papp's "Pirates of Penzance," Dodd ex- plained, "There's not much of anything bet- ter or more important for me to do these days. I'm a Democrat" If he had been urged to had been "puffing" -as he described it-some of his credentials; specifical- ly, he had told reporters that during the Vietnam W ar he had been drafted and had ultimately served as a second lieutenant, whereas Pentagon records revealed that he had never been in the Army. Caputo eventually said that he was sorry "if I misspoke," resorting to a term that has been put to frequent use lately by White House aides trying to account for the President's occa- sionally imaginative use of figures Caputo's misspeaking was deemed to be beyond political indulgence, but it took so long for him to realize this that one local political pollster com- mented, "He's actually dead, but he's like a soldier shot in the middle of a charge who takes a few steps before he falls on his face," indicating the de- gree to which some people in the poli- ticians' world come to think of their trade in life-and-death terms-but failing to acknowledge the irony of knocking off the unfortunate Caputo metaphorically in a military setting. On March 12th, four days after Caputo finally withdrew, State Comp- troller Edward Regan, who had had the strong backing of State Chairman Clark in seeking the Republican nomi- nation for Governor, took himself out of that race, saying that he would prefer to run for reëlection to his pres- ent office. Regan, an attractive, easy- going Irish-American from upstate Erie County, had been routinely re- ferred to as the front-runner among the Republican guber- natorial candidates since he had entered that race, on Decem- ber 30th, and recent polls had shown that he would do better than any other Repub- lican against Mayor Edward Koch, who, from the time he an- nounced that he would be a candidate for Gov- ernor, on February 22nd, had been treated by most political com- mentators as if he had the Democratic nomi- nation locked up. Regan had said that he would "relish" the prospect of running against the Mayor, but he now gave as the ma10r reason for his wi hdrawal the drying CASTING PR.OBLEMS be serious, Dodd would probably have added, "Wait till next year." U NDER the circumstances, it is a matter for particular astonish- ment here-and, one would think, at the Republican National Committee- that in the second-most-populous American state, which Reagan carried in 1980, the President's party and its plans for this fall's elections should currently present a spectacle of footless disorder that one Democratic district leader happily described the other day as "pitiful." Sudden shifts in personae or plot can, of course, turn a political scene on end overnight. At the mo- ment, it seems that for N ew York Republicans almost any change could only be a big improvement. As of last week, the Republican state chairman, George Clark, had not come up with a senatorial candidate to run against Daniel Patrick Moynihan, the Democratic incumbent, who is up for reëlection this year, although it was over a month since Clark's origi- nal choice for the nomination, former New York Representative Bruce Caputo, had pulled out of the race. Caputo had had the backing of fifty- three of the state's sixty-two Republi- can county leaders, but this support had fallen to almost nothing late in February after it was revealed that he LEISURE T/M 85
|
Will Parrish: Is Premier Pacific Vineyards Dead?
Some of the wealthiest and best-connected land speculators in the western hemisphere came together for a conference two months ago in Miami, from October 19-21, to discuss their accelerating feeding frenzy, more like a hoarding frenzy. Land speculation booms throughout much of the world, even with the torpid state of the global economy, which seems frequently on the verge of an even worse downturn. Persian Gulf states are working out land deals in Africa, Asia, and Eastern Europe; China is buying up large tracts throughout Africa; and 33 million hectares of the Amazon have been licensed to petroleum companies.
In 1976, economist Susan George noted that only .23 percent of landowners own more than half of all the world’s land (never mind those who own no land at all), a trend that has likely only worsened in the interceding 35 years.
“The Agriculture Investment Summit Americas is a three-day senior-level conference for US, Canadian, and Latin American investors to access global agribusiness and farmland opportunities,” the conference web site reads. The confab was designed as an opportunity not only to gain advice, but as a place to “benefit from intensive networking opportunities” with, for example, potential investors.
One of the featured speakers in this gathering of the global “.23 percent” was Richard Wollack, co-chairman of Premier Pacific Vineyards (PPV) based in Napa. He was the only Northern California resident on the program. Few people in our region understand land speculation as Wollack does.
Premier Pacific, which Wollack operates 50-50 with long-time vineyard developer William Hill, claims to own the largest vineyard portfolio in the country with acreage in Washington and Oregon, and holdings running up California’s coastal zones from Santa Barbara to a massive 30-square-mile (20,000 acre) slice of the Gualala River watershed on the Sonoma-Mendocino border — a project known euphemistically as “Preservation Ranch.” The company owns three large vineyard estates in Anderson Valley, including the parcel of the so-called “Big Dig,” a notorious large pond off Anderson Valley Way.
PPV’s largest project is the one that has given it greatest notoriety. Preservation Ranch would involve clear-cutting roughly 1,700 acres of redwood forest and ripping out the roots, installing more than 80 miles of six-foot high fencing that would fragment wildlife habitat across the majority of the parcel, building 90 miles of road. There would also be a gravel mining operation, and of course the various industrial-scale water diversions necessary to fill the project’s proposed 40 reservoirs. At various turns, Premier Pacific has touted a large subdivision as part of the project.
The Gualala River has already been battered by years of industrial logging and, more recently, intensive wine-grape cultivation. The destruction of so much redwood forest would damage the watershed further, on a massive scale.
In the past year, the Associated Press, New York Times, Los Angeles Times, Santa Rosa Press Democrat, North Bay Bohemian, Huffington Post, and most of all this fine publication have featured stories on Preservation Ranch. Friends of the Gualala River, the local non-profit with members primarily based in Annapolis and Gualala, has helped collect nearly 100,000 signatures on a petition opposing both Preservation Ranch and a proposal by Spanish wine giant Codorniu to convert around 170 acres of redwoods to grapes on a nearby parcel. A petition calling on Codorniu to withdraw its proposal to clear-cut in Annapolis circulates in Spain, having collected 34,000 signatures.
It seems as though the heightened public scrutiny has finally caught up with Premier Pacific, as it may soon with Codorniu. A few weeks prior to Wollack’s dispatch to the Miami confab, the company’s biggest funder indicated they may sever ties with the project. The California Public Employees Retirement System (CALPERS), which had made $200 million in investments in the company, announced they were removing Premier Pacific Vineyards from their previous position as managers of the investment fund. In other words, while the pension maintains its investment in PPV, PPV is no longer manages the investment.
Next month, CALPERS announces the new manager of the fund. Speculation abounds that said new manager will drop PPV entirely, which would spell a dismal fate for the company, being that the pension counts for at least half its investment dollars.
Lewis Purdue, editor of Wine Industry Insight, led off a recent story on the subject thusly: “The CalPERS (California Public Employees Retirement System) decision to fire Premier Pacific Vineyards (PPV) as the manager of its poorly performing vineyard real estate portfolio has left PPV’s 130+ employees — from tractor drivers to executives — energetically networking, knocking on doors and handing out resumes — all of them fearing their jobs will be gone by Jan. 1, 2012.”
Over the summer, I received personal confirmation when a prominent state-level government staff member e-mailed me to ask for an update on the project. Let’s just say this staff person seemed to be carrying out her or his investigation independent of Premier Pacific, implying that certain influential elements of California state government are not on friendliest of terms with the company. It would make sense for CALPERS to shed an investment like that in PPV, given that the pension has faced considerable scrutiny of its own for its investment practices in the last few years.
PPV has several other investors, the largest being Connecticut-based endowment adviser Commonfund Realty, which is in for $50 million. CB Richard Ellis, the global real estate firm of which Wollack is former chairman, invested $1 million when PPV was first getting going in 2002.
Dallas real estate mogul Stuart Hall plopped an undisclosed amount into PPV in 2003. His previous history doesn’t necessarily inspire confidence in his judgment, however. Hall built a $4 billion real estate empire in the 1980s. Then, in the 1990s, he declared bankruptcy as the market crashed. Hall owns several of his own vineyards, including a 230-acre site on the Silverado Trail in Napa and the other in Alexander Valley, entitled Iron Horse Vineyards. His wife, Kathryn Hall, a former US ambassador in the Clinton administration, grew up in Mendocino County, where she managed a 63-acre vineyard owned by her family, the Walts.
With so much money backing them, Premier Pacific has been able to hire some of the cream of the local crop to carry out its proposals. One of their legal advisers is Eric Koenigshofer, who was campaign manager for Sonoma County Supervisor Efren Carrillo, in whose district Preservation Ranch is located. Koenigshofer himself is a former supervisor in the district, and he also has strong connections with the Sonoma County Planning Commission, which will rule on Premier Pacific’s proposal if even makes it to a vote.
SoCo’s Permit and Resource Management Department has lately been working with PPV on producing a draft environmental impact report. This document will cost about $1.5 million and will reportedly be ready by early 2012. Both the Planning Commission and CALFIRE, the state-level so-called “lead agency” in this matter, will then vote on whether to grant PPV a permit for the project.
It seems as though things are coming to head in the fight to protect the redwood forest and the Gualala River from the wine industry’s biggest land speculator. One way of reading Richard Wollack’s high-profile appearances at global land investment conferences (he was scheduled for a similar conference in London the same month, though he had to pull out of the engagement at the last minute) is that he is making a bid for back-up investors in case CALPERS really does withdraw from the proposal next month.
We’ll continue our coverage in the AVA in the coming weeks, including a full-on biography of Wollack and Hill, the latter being one of the most ecologically destructive men in Wine Country across the past 30 years.
~~
Feeds: Mendo Island & Independent News
Sea Chantey (Oxford, 1861) There is an insect that people avoid (Whence is derived the verb “to flee”). Where have you been by it most annoyed? In lodgings by the sea. If you like your coffee with sand for dregs, A decided hint of salt in your tea, And a fishy taste in the very […]
Today, a new psychological repression hides in plain sight. It is the servant of a modern ideology, a religion really, that says the material world is soulless and merely fodder for economic growth. This repression prevents most from seeing our ecological predicament and therefore from understanding it or acting in response to it. This repression is of the v […]
Global Coal Boom Ends As China — And World — Wakes Up To Reality Of Carbon Pollution | It's not Climate Change - It's Everything Change | Hillary Clinton has a renewable energy plan, but she still needs one for fossil fuels | Study: We've wiped out half the world's wildlife since 1970 | Against Forgetting...
In an interview during the 40-hour standoff in Portland, Luke Strandquist describes what it’s like on the front line of standing up to Shell Oil.By Katherine Bagley Cloaked in early morning darkness, 13 Greenpeace volunteers climbed over the edge of the St. Johns Bridge in Portland, Ore. on Wednesday and rappelled down climbing ropes so they could hover 100 […]
Hundreds of corporate giants have rallied to urge governors to see the upcoming regulations as a boost for the economy.By Katherine Bagley Three hundred sixty-five companies and investors sent letters on Friday to more than two dozen governors supporting the Environmental Protection Agency's plans to significantly reduce carbon emissions from power plan […]
(Houston Chronicle)Shell launched Arctic drilling on Thursday by sending a specialized bit spinning into the bottom of the Chukchi Sea, as critics protested against the campaign. The company now has until Sept. 28 to drill the top portions of up to two wells at its Burger prospect about 70 miles northwest of the Alaska coastline, but after fixing a damaged i […]
The Texas Public Policy Foundation is proposing an interstate compact to defy federal law and "shield" states from the EPA's imminent Clean Power Plan.By Naveena Sadasivam With the Obama administration poised to issue its sweeping rules to cut carbon pollution from power plants, a Texas-based conservative think tank is making a far-fetched bid […]
According to this permanently-smiling Christian, the Large Hadron Collider is a horrible idea because God did away with the Tower of Babel.So, you know, logic.The video gets really "interesting" around the 5:05 mark.
Fr. Dwight Longenecker, who thinks atheists are missing out because we don’t have cool hats like other religious people, says there are some Protestants who believe in a childish version of faith… [According to atheists, religious people] are also supposed to believe in a God who answers prayers here below and gives us goodies if [Read More...]
This is a neat project.Matt Cubberly wrote a book introducing children to evolution via poetry and neat illustrations by May Villani. It's called Evolutionary Tales and they're raising funds for it on Kickstarter:
Small is beautiful, when small is skilled and dedicated. ~Gene Logsdon
Morality is doing right, no matter what you are told. Religion is doing what you are told, no matter what is right. ~H L Mencken
I've observed that people tend to live at one of two extremes in the spectrum of life: those who live on the edge, and those who avoid the edge. Those who live on the edge are hanging out in the most dangerous and unstable places — yet they're also often the most powerful agents of change, because the edge is where change is happening; away from the edge, things are naturally unchanging. ~Thom Hartmann
Come on. You just can’t come up with anything more ridiculous than someone who honestly thinks that all human woes stem from an incident in which a talking snake accosted a naked woman in a primeval garden and talked her into eating a piece of fruit. ~Keith Parsons
Life is not a problem to be solved, nor a question to be answered. Life is a mystery to be experienced. ~Alan Watts
What is not worth doing, is not worth doing well. ~Abraham Maslow
Society is like a stew: If you don't stir it up every now and then, the scum rises to the top.~Edward Abbey
You never change things by fighting the existing reality. To change something, build a new model that makes the existing model obsolete. ~Buckminster Fuller
How thoughtful of God to arrange matters so that, wherever you happen to be born, the local religion always turns out to be the true one. ~ Richard Dawkins
I’m not saying there isn’t a god, but there isn’t a god who cares about people. And who wants a god who doesn’t give a shit? ~Robert Munsch
Give a man a fish, and you'll feed him for a day; Give him a religion, and he'll starve to death
while praying for a fish. ~ Anon
When you understand why you dismiss all the other gods, you will understand why I dismiss yours. ~ Stephen Roberts
Life is without meaning. You bring the meaning to it. The meaning of life is whatever you ascribe it to be. Being alive is the meaning. ~ Joseph Campbell
I sang as one / Who on a tilting deck sings / To keep men's courage up, though the wave hangs / That shall cut off their sun. ~C. Day Lewis
Transition Tools (Basic)
Stoics/Freethought
Zeno Stoics
Local Organic Family Farms
THE SMALL ORGANIC FARM greatly discomforts the corporate/ industrial mind because the small organic farm is one of the most relentlessly subversive forces on the planet. Over centuries both the communist and the capitalist systems have tried to destroy small farms because small farmers are a threat to the consolidation of absolute power.
Thomas Jefferson said he didn’t think we could have democracy unless at least 20% of the population was self-supporting on small farms so they were independent enough to be able to tell an oppressive government to stuff it.
It is very difficult to control people who can create products without purchasing inputs from the system, who can market their products directly thus avoiding the involvement of mercenary middlemen, who can butcher animals and preserve foods without reliance on industrial conglomerates, and who can’t be bullied because they can feed their own faces. ~Eliot Coleman
What is a fact beyond all doubt is that we share an ancestor with every other species of animal and plant on the planet. We know this because some genes are recognizably the same genes in all living creatures, including animals, plants and bacteria. And, above all, the genetic code itself — the dictionary by which all genes are translated — is the same across all living creatures that have ever been looked at. We are all cousins. Your family tree includes not just obvious cousins like chimpanzees and monkeys but also mice, buffaloes, iguanas, wallabies, snails, dandelions, golden eagles, mushrooms, whales, wombats and bacteria. All are our cousins. Every last one of them. Isn't that a far more wonderful thought than any myth? And the most wonderful thing of all is that we know for certain it is literally true...
The whole world is made of incredibly tiny things, much too small to be visible to the naked eye — and yet none of the myths or so-called holy books that some people, even now, think were given to us by an all-knowing god, mentions them at all! In fact, when you look at those myths and stories, you can see that they don't contain any of the knowledge that science has patiently worked out. They don't tell us how big or how old the universe is; they don't tell us how to treat cancer; they don't explain gravity or the internal combustion engine; they don't tell us about germs, or anesthetics. In fact, unsurprisingly, the stories in holy books don't contain any more information about the world than was known to the primitive peoples who first started telling them! If these 'holy books' really were written, or dictated, or inspired, by all-knowing gods, don't you think it's odd that those gods said nothing about any of these important and useful things? -Richard Dawkins
If you have a garden and a library, you have everything you need. ~ Cicero
|
Determinants of the eradicability of filarial infections: a conceptual approach.
Lymphatic filariasis and onchocerciasis are subject to major intervention programs by the WHO. The Onchocerciasis Control Programme in West Africa was launched 30 years ago and has led to considerable insights into the control of this infection. The Global Alliance to Eliminate Lymphatic Filariasis is a relatively recent control program with ambitious targets concerning its efficacy and its schedule. These expectations, however, are based on certain assumptions about the density-dependent processes of limitation and facilitation which determine eradicability: the levels of transmission thresholds and breakpoints. Here, we review these processes operating in filarial infections and show their impact on the persistence of the parasite, as well as pointing out those issues where more information is required to develop sound predictions about the eradicability of these infections.
|
xt term in 217940, 217949, 217958, 217967?
217976
What is next in 1312839, 5251420, 11815721, 21005742, 32821483, 47262944, 64330125?
84023026
What is next in 198803087, 198803087, 198803077, 198803051, 198803003, 198802927, 198802817, 198802667?
198802471
What is the next term in 820, 3499, 8066, 14605, 23200, 33935, 46894?
62161
What is the next term in -577118, -1154275, -1731432, -2308589?
-2885746
What is the next term in -1977, -3991, -6403, -9411, -13213, -18007, -23991, -31363?
-40321
What is next in 661964, 661966, 661968, 661970, 661972, 661974?
661976
What is next in 302485, 302479, 302473, 302467, 302461, 302455?
302449
What comes next: -359494, -718882, -1078270, -1437658, -1797046?
-2156434
What is the next term in -724192, -724180, -724168, -724156, -724144, -724132?
-724120
What is the next term in 450087941, 450087943, 450087945, 450087947?
450087949
What is the next term in 7819, 13167, 18515, 23863, 29211?
34559
What comes next: 3962544, 3962549, 3962554, 3962559?
3962564
What comes next: -39726, -39740, -39764, -39804, -39866, -39956?
-40080
What is the next term in -111705, -111660, -111583, -111474, -111333?
-111160
What is the next term in 4899, 19978, 45257, 80736?
126415
What is the next term in 16414287, 65657214, 147728759, 262628922, 410357703?
590915102
What is next in -48615926, -48615927, -48615928, -48615929?
-48615930
What is next in -3359487, -3359475, -3359463?
-3359451
What is the next term in 111936626, 223873240, 335809854, 447746468, 559683082, 671619696?
783556310
What is the next term in 4691, -19991, -61127, -118717?
-192761
What comes next: -9661, -9692, -9763, -9892, -10097, -10396, -10807?
-11348
What is next in 318359, 318479, 318597, 318713?
318827
What is the next term in 39104, 42097, 45088, 48077, 51064, 54049?
57032
What comes next: 29804, 29560, 29298, 29018, 28720?
28404
What comes next: 31298, 30197, 28362, 25793, 22490, 18453, 13682?
8177
What comes next: 57310, 229257, 515844, 917077, 1432962?
2063505
What is the next term in 30093, 38185, 46273, 54357, 62437, 70513?
78585
What comes next: 428, -1443, -6528, -16435, -32772, -57147, -91168?
-136443
What is next in 3031041, 3031046, 3031051?
3031056
What is the next term in 298, 889, 1874, 3253, 5026, 7193?
9754
What comes next: -2218017, -8872088, -19962193, -35488320, -55450457, -79848592, -108682713?
-141952808
What comes next: 51386, 51509, 51700, 51959, 52286?
52681
What is the next term in 7881204, 7881366, 7881528, 7881690, 7881852?
7882014
What is next in 51692132, 51692127, 51692110, 51692075, 51692016, 51691927, 51691802?
51691635
What comes next: 7298609, 14597218, 21895827, 29194436?
36493045
What is next in 1005, 1016, 925, 708, 341?
-200
What is the next term in -64936, -66742, -69738, -73912, -79252, -85746?
-93382
What is next in 191555, 766011, 1723371, 3063635, 4786803, 6892875?
9381851
What comes next: -424754, -849415, -1274076, -1698737, -2123398, -2548059?
-2972720
What comes next: 15094, 121010, 408462, 968218, 1891046, 3267714?
5188990
What is the next term in -398, -1814, -4234, -7658, -12086, -17518, -23954?
-31394
What comes next: -12133, -11213, -10293?
-9373
What is next in 5748, 9495, 13242, 16989, 20736?
24483
What comes next: 2854, 10031, 21524, 37333, 57458, 81899, 110656?
143729
What comes next: -1359121, -1359090, -1359025, -1358914, -1358745, -1358506?
-1358185
What is next in 11153, 10622, 10091?
9560
What is the next term in 1226, 10466, 36110, 86540, 170138, 295286, 470366, 703760?
1003850
What is the next term in -2113649, -4227271, -6340893?
-8454515
What is the next term in -394425, -394380, -394315, -394236, -394149, -394060, -393975, -393900?
-393841
What is next in -9646559, -9646557, -9646553, -9646547, -9646539, -9646529?
-9646517
What is the next term in -1611, -3503, -5695, -8187?
-10979
What is next in -312467, -1249814, -2812039, -4999142, -7811123?
-11247982
What comes next: -840, -5466, -13162, -23922, -37740, -54610?
-74526
What is next in 9563954, 9563962, 9563970, 9563978, 9563986, 9563994?
9564002
What is the next term in -115761, -231833, -348181, -464799, -581681, -698821, -816213, -933851?
-1051729
What is next in -887418, -1774801, -2662186, -3549573, -4436962, -5324353, -6211746?
-7099141
What is next in -1939052, -1939046, -1939040, -1939034?
-1939028
What comes next: -91318, -182005, -272114, -361639, -450574, -538913, -626650?
-713779
What is the next term in -19733, -38453, -57173, -75893, -94613?
-113333
What is the next term in 1976, 9506, 22072, 39686, 62360, 90106, 122936?
160862
What comes next: -5216617, -20866454, -46949511, -83465788?
-130415285
What is the next term in 11652646, 11652647, 11652648, 11652649?
11652650
What is the next term in -517349, -2069436, -4656249, -8277788, -12934053?
-18625044
What comes next: -5331888, -5331883, -5331876, -5331867?
-5331856
What is next in 17513, 30344, 43175, 56006, 68837?
81668
What comes next: -2047, 1499, 5045?
8591
What comes next: 2175, 17523, 59271, 140625, 274791?
474975
What comes next: -360, -2801, -7310, -13893, -22556, -33305, -46146, -61085?
-78128
What is next in 80726535, 161453068, 242179601?
322906134
What comes next: -10703, -42462, -95393, -169496, -264771?
-381218
What is next in 3016, 23234, 77442, 182422, 354956, 611826, 969814, 1445702?
2056272
What is the next term in 879249, 879431, 879613?
879795
What is next in 28316, 115758, 261494, 465524, 727848, 1048466, 1427378?
1864584
What is next in 12163, 12578, 13271, 14242, 15491, 17018?
18823
What comes next: -64133, -63870, -63607?
-63344
What is the next term in 15695, 15966, 16415, 17036, 17823, 18770, 19871, 21120?
22511
What is next in -2269079, -2268660, -2268251, -2267858, -2267487?
-2267144
What comes next: -14548, -55855, -124700, -221083, -345004?
-496463
What comes next: 339212, 678282, 1017352, 1356422, 1695492?
2034562
What is the next term in -11634, -23195, -34756?
-46317
What is next in -1217903, -1217888, -1217873, -1217858?
-1217843
What is the next term in 92, -183, -1226, -3433, -7200, -12923, -20998, -31821?
-45788
What is next in 3130, 2474, 1818, 1162, 506?
-150
What comes next: -577130, -577149, -577166, -577181, -577194?
-577205
What comes next: 22653, 90742, 204297, 363312, 567781, 817698, 1113057, 1453852?
1840077
What is next in -125468, -501726, -1128776, -2006612, -3135228?
-4514618
What comes next: 209, 274, 391, 572, 829?
1174
What comes next: 60987, 121968, 182949, 243930, 304911?
365892
What is next in -112402, -224341, -335406, -445159, -553162?
-658977
What comes next: -1286, -9794, -32872, -77804, -151874, -262366, -416564, -621752?
-885214
What is the next term in -318272, -318436, -318600, -318764, -318928?
-319092
What comes next: 86062, 86047, 86032?
86017
What is the next term in -19548727, -39097455, -58646183, -78194911?
-97743639
What is the next term in -954908, -1910396, -2865884?
-3821372
What is next in -274099, -272177, -268983, -264523, -258803, -251829, -243607?
-234143
What is next in -243760, -487463, -731166, -974869, -1218572, -1462275?
-1705978
What comes next: -284101, -566950, -849779, -1132582, -1415353, -1698086, -1980775?
-2263414
What is the next term in -7033864, -7033838, -7033812?
-7033786
What is the next term in -22468, -29755, -37042?
-44329
What comes next: -8423672, -16847341, -25271010?
-33694679
What is next in 6408, 6522, 6756, 7146, 7728, 8538, 9612?
10986
What comes next: 31888, 63746, 95592, 127420, 159224?
190998
What comes next: 322, 498, 790, 1198, 1722?
2362
What comes next: -12746, -13063, -13380, -13697, -14014?
-14331
What is the next term in 4726, 12058, 24610, 44992, 75814, 119686, 179218, 257020?
355702
What is next in 3240, 3087, 2920, 2745, 2568, 2395, 2232?
2085
What comes next: -66645, -66663, -66681?
-66699
What comes next: 5639416, 11278840, 16918268, 22557700, 28197136?
33836576
What is next in 10283616, 10283618, 10283620, 10283622, 10283624?
10283626
What comes next: -1594, -1959, -2326, -2695?
-3066
What comes next: 28824, 57610, 86390, 115170, 143956?
172754
What comes next: -1142, -2101, -3288, -4817, -6802, -9357, -12596, -16633?
-21582
What is the next term in 65024, 64804, 64588, 64376, 64168, 63964?
63764
What comes next: 455972, 911949, 1367930, 1
|
Dreams That End With a Gunshot to the Head
From time to time, I wake in my bed after visiting someone else’s life, in a place so real you could touch it. I stumble through a doorway and find people I know and love, only I forgot that I’d forgotten them. It is a vision that beckons, shimmers, then slams the door in my face.
As my bedroom comes back into focus, I have this sense of being stretched like a strand of hot glass, suspended between two dimensions. For a languid moment, the streets in this other world are more real than the ones I live on now. Their names are on the tip of my tongue, the contours of the hills in the distance are so familiar I must have walked them my whole life. There is a person there, waiting. But the connection cools and snaps, and the faces freeze and vanish.
These places are not always easy to visit. Even when the scenery is bucolic, there is almost always an undertone of war. Most times, the only way I can escape is by accepting my own death. Sometimes death doesn’t come as needed, and I have to put a gun to my head. Sometimes I wake with relief, sometimes loss, but always with the ache of loneliness that comes with amnesia, with questions that are not meant to be answered.
Last night I visited Europe during the occupation. I guess. I don’t have the words for where I was. I wore a long skirt, with an old gun hidden in my coat.
My life was all about my people. I had people. I don’t know what the hell that means because I have nothing like that in this life, I have no people. But there I was surrounded by brothers, cousins, extended family all around. Our hair was dark, our skin was white, the men wore undershirts and dark pants all the same shade of beige, gray, black. I walked through the dim city streets, grit crackling under my boots, sooty fire escapes overhead, fear in my heart. Still, I wanted to fight, like an alley cat that bristles and hisses before the miscreants stone it to death. I wanted to fight because it was my in my blood, and because pride helped obscure the reality of my inevitable doom.
My boys, my young men who were as close as brothers, all around me. We whispered as we passed each other.
Tonight, I said.
Tonight, they nodded back, as if our every move was being watched.
There was this calculated façade of calm, as if we all knew what was coming: a chance.
We collected in the street as if for some harmless family gathering, sitting at makeshift benches to eat and talk. There were at least a hundred of us, and we didn’t want to raise suspicion. Our small cache of artillery was hidden. The air was prickling, men with urgency in their dark eyes.
This street where we sat was an alley between two factory buildings, and at each end was a tall iron fence. To protect us, perhaps, or confine us.
Three lanky teenage boys wearing coats that were too small, stood at one end of the alley. They were dark-skinned with smooth black hair. Their nationality was different. They had rifles strapped on their backs, as if they were keeping watch on our behalf. They were friends of my son. A friendship, I suspected, that was ill-advised. I knew they would betray us, or we would betray them. I wouldn’t let my son go to them, and this upset him. But there was no time to sort it out. My son was lost in the crowd as it scattered. Someone was coming. Something had gone wrong.
The fight was breaking out too soon. This was not as planned. Our men had been spooked. For a moment everything paused, like the silence before a falling glass shatters on the concrete, and then a single shout splintered the street into chaos. Gunfire pulverized the brick over my head. We were discovered. Now the enemy would close in from both sides and kill us all. All was lost, and so quickly. I ducked for cover in one of the buildings, doom and grief in my heart. I knew, I knew there was no way out of this. Nowhere to go. In here, the booming gunfire was muffled, but soon they would hunt me down. Death was coming for me, breathing down my shoulder, how would I meet it?
Down one of the corridors stood a beautiful woman, sheltering some children. I knew her. In a world of sepia-toned shadows, her face glowed brilliantly with calm and sweetness. She had long curly hair down to her shoulders.
Stay and fight, she implored me. Face the enemy and remember our cause.
But I was panicked to my core, I didn’t care about our cause, I wanted only to stay alive, to find a place to hide, to escape.
They’re coming! I hissed at her, climbing up to a bank of windows that lead to the roof. I rammed my shoulder into the glass, breaking a few panes, stumbling out into the air above the crossfire. The city around me was engulfed in flames. I turned to my right, but the beautiful woman had followed. She was beside me.
Stop, she warned me, holding up her hand. She had seen something. A thick gunshot rang out from across the street, and a shell rocketed toward her in slow motion, leaving behind a trail of fire as it landed in her body, embedding in her coat, knocking her off the roof. I covered my eyes but I had already heard it, the soft thud that snuffed out her life. The sucking sound of her dying breath roared in my ears, louder than the deafening artillery fire, filling me with dread and sickness.
Just like that, she was gone.
A soldier was coming through the window behind me. I fell down to play dead, but it was too late. Before I could surrender to him, I remembered I could escape. I placed my hidden gun to my head and pulled the trigger.
I’ve done this in dreams a dozen times before.
First comes the loss of breath, then the darkness, the wrenching away, then the blissful fall through the escape hatch, back into my room. And then there is light.
In the distance, no gunfire, just the steady hum of a leaf blower. I lay there blinking in the sunlight, breathless.
When I die, will this life become as distant to me as that one, just some passing, transient dream? Will I doubt I was even here, the same way I doubt if I was there?
I guess it doesn’t matter. Life on earth is fucking barbaric. Centuries of war, suffering, murder, loss– it’s in our blood, the DNA of every cell. Maybe I have a frayed strand in my heart that wicks up these memories, and when I wake it casts a little flicker, and in that brief moment before the darkness recedes, I can hold vigil between two worlds, remembering enough for everyone. Or maybe for no one.
|
Q:
Substring multifasta file using python
I am trying to extract sequences from a multifasta file from position 2 to 8 (seeds of microRNAs). To do this I have written a small python script. The script works but I couldn't write an output file. Could anyone help me or point me in the right direction?
Thanks
Script:
from Bio import SeqIO
for index, record in enumerate(SeqIO.parse("file.fasta","fasta")):
seed= record.seq[1:8]
a = (print(">" + record.id + '\n\ + seed)
Output:
>aga-miR-12417-5p
AGUCGUU
>aga-miR-12418-3p
GUUCGAU
>aga-miR-12419-5p
GCUGUUC
A:
You just need to use SeqIO.write(), this would be the most similar way to your current structure:
from Bio import SeqIO
with open("out_file.fasta", "w") as out_f:
for index, record in enumerate(SeqIO.parse("file.fasta","fasta")):
record.seq = record.seq[1:8]
SeqIO.write(record, out_f, "fasta")
|
When a mobile device stays in a location serviced by multiple access points, the mobile device may continually handoff between different access points. Frequent handoffs are caused when the signal strengths from multiple access points vary above and below a handoff signal strength threshold even when a mobile device is stationary within a location. Handoffs are designed to seamlessly switch communications from one access point to another. However, when a mobile device hands off too frequently between multiple access points, undesirable behavior may arise. Some examples of undesirable behavior are missed calls, dropped calls, and slower data rates. Additionally, some access points may not be capable of accepting incoming handoffs.
|
Alyssa Bennett, who developed a following as the founder of Pie Craft, has signed on as the kitchen manager. Her menu shows a long roster of the baked goods she's known for, as well as an assortment of savory snacks — arepas, quiches, samosas and hummus, served with either pita or roasted veggie chips.
Samosas include a vegan Punjabi, a Mexican street corn with Chihuahua cheese and basil chicken. There will also be a few daily varieties of cicchettis, which are a variation on bruschetta, including beet, hummus and cucumber or buffalo mozzarella with red pepper skewers.
"We knew we didn't just want soup and sandwiches," says co-founder Dana Huth. "We wanted something more unique than that. And knowing people would be eating while petting cats, we wanted to have it be as clean as possible." That means soup is out; an Asian-inflected menu of finger foods are in.
And that only seems fitting, since the cat cafe concept premiered in Asia. But unlike many cat cafes both overseas and in the U.S., MAUHAUS won't be charging an hourly rate for people who want to hang out, Huth promises: "We want people to be able to come and go as they please, without having to pay for a full hour."
The menu is careful to include both gluten-free and vegan options. And even if you're allergic to cats, you shouldn't be entirely out of luck: Thanks to the Kickstarter's runaway success, MAUHAUS will be adding extra touches, including windows on the cat-free cafe side that look into the lounge side, where the cats reside, Huth says.
The two software developers who co-founded MAUHAUS, Huth and Ben Triola, own the building the cafe will be based in. They'll be renovating the 1,500-square-foot former artist's studio on the ground floor to create the space that will house the restaurant and lounge. Construction is set to begin in July, with a goal of opening in September.
|
[First report of coccidioidomycosis associated with Sweet syndrome].
We describe the first reported case associating coccidioidomycosis and Sweet syndrome, two uncommon diseases in Europe. One month after traveling to Mexico, a 47-year-old woman developed a maculo-papulous rash on her trunk, neck and limbs. She also had cough, associated with signs of an upper respiratory tract infection and weight loss. Sweetís syndrome was first diagnosis and confirmed histologically on a skin lesion biopsy. An aspectific pulmonary infiltrate, associated with a left-sided paracardiac opacity was found on chest X-rays and the CT scan. Bronchoalveolar lavage products contained more than 60% lymphocytes. Serology using coccidioidin showed an F-precipitin on agar (IgM) and an IgG-titre of 1:8, leading to the diagnosis of primary Coccidioides immitis infection with a probable lung localization. Search for an associated disease should be made in patients with Sweet syndrome. The Sweet syndrome coccidioidomycosis association could be related to TH-1 lymphocyte proliferation.
|
Q:
Moving an Alcatel I-211M-L using Fiberoptic connection
I have an Alcatal I-211M-L that I'd like to move. Is it possible to buy fiberoptic couplers and cables to extend the range of the fiberoptic cable, or do I need to call Verizon to have them move it? What should I buy, if so? Thanks!
Specifically, would the coupling and cables I need be multi-mode, and if so, what size? I'm sure the connector is an SC connector on the ONT.
A:
It looks like it uses a normal SC/APC connector, so something like this should be working; WAN uses single mode almost exlusively, a green connector indicates Angled Physical Contact which is used with SMF only.
|
A quaint powder room made better use of the small space and was a convenient addition to the home's makeover. Because the Shatners try to reuse materials whenever possible, the home's old entry doors now serve as the powder room doors.
|
Inspiring Little Leaguer With Down Syndrome Strikes Out Batter to End Game
Brayden Gero is a 12-year-old boy from suburban Boston who is rightfuly going viral after he recorded a save by striking out the final batter in his final Little League game of the season.
After he punches out the batter, players from both sides storm the mound and mob Brayden in a true show of sportsmanship.
It was a tremendous way for Brayden to end the season. He spent the whole year patrolling the outfield and, amidst a sea of walks and strikeouts, notched his one and only hit last week. He scored his lone run of the season in the finale, as well.
Brayden is certainly no stranger to fame. After the Patriots beat the Seahawks in Super Bowl XLIX, he managed to ride in the parade with Tom Brady.
|
ltiple of 41?
False
Is 43 a factor of 836600518?
True
Is 2366025117 a multiple of 91?
False
Is 880 a factor of 15567049?
False
Is 17104540 a multiple of 86?
True
Is 3992 a factor of 442221784?
True
Is 351 a factor of 143307684?
True
Is 677476316 a multiple of 68?
True
Is 2187 a factor of 2981601628?
False
Does 1775 divide 351647025?
True
Is 118555290 a multiple of 630?
True
Is 5176 a factor of 827833912?
True
Is 124802140 a multiple of 10?
True
Does 40 divide 303369876?
False
Does 7331 divide 1373724623?
False
Is 9 a factor of 9247807?
False
Is 10 a factor of 166224780?
True
Does 935 divide 80640010?
True
Is 3105766 a multiple of 9?
False
Is 15038082 a multiple of 230?
False
Is 48168120 a multiple of 130?
True
Is 2093410 a multiple of 11?
True
Is 3 a factor of 147582024?
True
Does 57 divide 32796003?
False
Is 148094793 a multiple of 201?
False
Does 27 divide 47393323?
False
Is 1112 a factor of 32543513?
False
Is 8863138 a multiple of 26?
False
Is 1951 a factor of 1549291712?
False
Is 7417714 a multiple of 22?
False
Is 41209344 a multiple of 16?
True
Is 1455 a factor of 599916870?
True
Does 11 divide 864404?
False
Does 166 divide 10136539?
False
Is 513017897 a multiple of 1718?
False
Is 991 a factor of 178641130?
False
Is 3 a factor of 289846888?
False
Is 12 a factor of 3194035872?
True
Is 2060 a factor of 21630883?
False
Is 26976672 a multiple of 144?
True
Is 998034866 a multiple of 123?
False
Is 34 a factor of 2270724547?
False
Is 172 a factor of 5787346?
False
Is 169 a factor of 638499238?
True
Is 53835228 a multiple of 478?
True
Is 24628344 a multiple of 78?
True
Is 2454 a factor of 268713000?
True
Is 436262 a multiple of 32?
False
Does 40 divide 46102936?
False
Is 687678728 a multiple of 367?
True
Is 25683091 a multiple of 109?
False
Does 22 divide 19260696?
False
Does 25 divide 13368750?
True
Is 89 a factor of 198464560?
False
Is 2408 a factor of 238514808?
True
Is 595058927 a multiple of 76?
False
Is 21598148 a multiple of 143?
True
Does 12 divide 2060994925?
False
Does 117 divide 1053724720?
False
Is 533882432 a multiple of 64?
True
Does 9 divide 32386995?
True
Is 1253853552 a multiple of 8108?
True
Is 76 a factor of 193663352?
True
Is 84662390 a multiple of 99?
False
Is 179 a factor of 2947468058?
True
Is 23 a factor of 31084355?
False
Is 663004895 a multiple of 71?
False
Is 28084930 a multiple of 5?
True
Does 1538 divide 596691359?
False
Does 37 divide 52080053?
True
Is 36 a factor of 2453471712?
True
Is 11 a factor of 456544979?
True
Is 338199246 a multiple of 7?
True
Is 1868050296 a multiple of 14?
True
Does 86 divide 413012764?
True
Is 538111638 a multiple of 909?
True
Is 1557551157 a multiple of 61?
False
Is 34 a factor of 88652246?
True
Is 4916452050 a multiple of 336?
False
Is 133270443 a multiple of 10?
False
Is 696 a factor of 11615548?
False
Does 910 divide 74834046?
False
Is 534410062 a multiple of 17?
True
Is 26147260 a multiple of 11?
False
Is 7419420 a multiple of 94?
True
Is 5 a factor of 12382635?
True
Is 705 a factor of 18653467?
False
Does 408 divide 31031215?
False
Is 14719041 a multiple of 123?
True
Does 114 divide 1056535667?
False
Does 8 divide 50079640?
True
Is 2998 a factor of 355382920?
True
Is 3469727 a multiple of 62?
False
Is 10 a factor of 20520670?
True
Is 5632 a factor of 6709485772?
False
Is 984 a factor of 628314504?
True
Is 1705381 even?
False
Is 1203586111 a multiple of 10?
False
Does 27 divide 113229657?
True
Is 110 a factor of 111508210?
True
Does 530 divide 1678078050?
True
Is 44840372 a multiple of 91?
False
Does 1974 divide 331452722?
False
Does 6 divide 84735762?
True
Does 52 divide 4179964?
False
Is 19 a factor of 85196033?
False
Is 575 a factor of 139990290?
False
Is 1601 a factor of 169699596?
True
Is 1954915 a multiple of 545?
True
Is 1088 a factor of 51350336?
True
Is 233 a factor of 458990465?
False
Does 8841 divide 1173766524?
True
Is 53001494 a multiple of 573?
False
Is 10148800 a multiple of 20?
True
Is 24 a factor of 129924176?
False
Does 4 divide 11184864?
True
Is 90519125 a multiple of 183?
False
Is 25003827 a multiple of 3?
True
Does 2139 divide 2595796284?
True
Is 153704363 a multiple of 49?
False
Does 65 divide 2232376339?
False
Does 8 divide 34846824?
True
Does 78 divide 12065686?
False
Is 191203006 a multiple of 531?
False
Is 631 a factor of 769990608?
False
Is 18 a factor of 50717988?
True
Does 465 divide 858130475?
False
Does 533 divide 190081513?
False
Is 125404576 a multiple of 1852?
False
Does 7 divide 282302076?
True
Does 14 divide 26856634?
True
Is 7640765 a multiple of 775?
False
Is 19 a factor of 13228840?
False
Is 83260254 a multiple of 714?
True
Is 11 a factor of 458938128?
True
Does 223 divide 9095947?
True
Is 710225281 a multiple of 1741?
True
Does 21 divide 104670071?
False
Is 2244 a factor of 2549435328?
True
Is 59478970 a multiple of 14?
False
Does 129 divide 55162639?
False
Does 39 divide 68239509?
True
Is 6526 a factor of 1430107808?
False
Is 56 a factor of 174905047?
False
Is 30481996 a multiple of 2860?
False
Is 174839435 a multiple of 4055?
True
Is 33 a factor of 16928174?
False
Is 1517704548 a multiple of 149?
False
Is 120861045 a multiple of 3085?
True
Is 307 a factor of 15578101?
True
Is 225 a factor of 421995600?
True
Is 17 a factor of 642311?
True
Is 58 a factor of 289849896?
True
Is 42736914 a multiple of 1260?
False
Is 57 a factor of 71218464?
False
Does 7 divide 765585117?
False
Is 1544 a factor of 204587720?
True
Is 4159575 a multiple of 139?
True
Does 477 divide 1127731986?
True
Does 28 divide 67542356?
True
Is 114 a factor of 158492401?
False
Is 3304526280 a multiple of 562?
True
Is 6 a factor of 2620002?
True
Is 5 a factor of 366200060?
True
Does 47 divide 7522162?
True
Is 27 a factor of 108944217?
True
Does 394 divide 30544456?
True
Is 367 a factor of 1095828069?
False
Is 262660541 a multiple of 247?
True
Does 6400 divide 23840000?
True
Is 246 a factor of 759137580?
False
Does 258 divide 218938134?
False
Is 88 a factor of 3032378976?
True
Is 208368516 a multiple of 99?
False
Does 201 divide 150009717?
True
Does 141 divide 2081498?
False
Is 2302011 a multiple of 7?
False
Is 7 a factor of 264340425?
False
Is 69027624 a multiple of 72?
True
Is 47056415 a multiple of 1073?
True
Is 159 a factor of 63600160?
False
Does 63 divide 12748285?
False
Is 2037 a factor of 894890766?
True
Is 42055584 a multiple of 48?
True
Is 321 a factor of 306965501?
False
Is 40053956 a multiple of 10?
False
Is 382 a factor of 54142268?
False
Is 20501089 a multiple of 7?
True
Is 2253 a factor of 278133687?
False
Does 19 divide 688079547?
True
Is 374 a factor of 2236258574?
True
Is 60 a factor of 87365180?
False
Does 27 divide 25621052?
False
Is 6 a factor of 8187606?
True
Is 258867091 a multiple of 1842?
False
Is 10 a factor of 21618470?
True
Is 6784401 a multiple of 949?
True
Is 309 a factor of 71071236?
True
Is 48289010 a multiple of 539?
True
Is 1434 a factor of 13081597?
False
Is 6907193 a multiple of 151?
True
Is 6691403516 a multiple of 14?
True
Is 403305590 a multiple of 95?
True
Is 479 a factor of 1693185113?
False
Does 1468 divide 134680029?
False
Is 1560194734 a multiple of 7911?
False
Does 21 divide 342499479?
True
Is 88 a factor of 6589704?
True
Is 75036478 a multiple of 41?
True
Does 17 divide 876282221?
True
Is 1108 a factor of 186647995?
False
Is 2229 a factor of 1555820033?
False
Does 3036 divide 53479618?
False
Is 131297634 a multiple of 39?
True
Does 2045 divide 984049910?
True
Is 3 a factor of 14550354?
True
Does 4497 divide 349718199?
True
Does 20 divide 159047852?
False
Is 488106600 a multiple of 40?
True
Is 158097366 a multiple of 3625?
False
Does 11 divide 1054354598?
True
Does 807 divide 82831027?
False
Is 270917342 a multiple of 99?
False
Does 73 divide 991486?
True
Does 28 divide 6123796?
True
Is 9265756 a multiple of 358?
True
Does 1457 divide 2742847667?
True
Is 68044769 a multiple of 6?
False
Does 378 divide 28698874?
False
Is 2724860 a multiple of 82?
True
Does 1581 divide 19533904?
False
Is 46621641 a multiple of 1225?
False
Is 2919 a factor of 213129676?
False
Is 9 a factor of 168050417?
False
Is 41 a factor of 32886223?
True
Does 262 divide 436594187?
False
Is 3020649914 a multiple of 46?
False
Does 1329 divide 79568259?
False
Is 1178530
|
If These Textiles Had Been Paintings...
(Above) Early American 20th Century Modern Geometric Quilt 1930-1940A cotton quilt made in geometric shapes which lends a very contemporary feel. All of the fabrics are cotton, including the back which is in a navy tiny floral print with a rod pocket. The quilt has rounded corners, and is banded in a deep red cotton.
IF THESE RUGS HAD BEEN PAINTINGS, considering the period in which they were made, they would have been hailed as breakthroughs in modern art. But, hooked rugs, quilts and textiles were considered craft and, for the most part, kept apart from the big museums.
African American quilts, on the other hand, shared the same story, until Mr. Bill Arnett and his family in Atlanta brought to the public eye the incredible quilts of Gee’s Bend. That singular effort changed art history, the way we view African American textiles and more importantly, clearly showed that the quilts of this rural Alabama community (and others) were far more than craft. More on that in another post.
|
Pharmacologic treatment of attention-deficit hyperactivity disorder.
Attention-deficit hyperactivity disorder (ADHD) is highly prevalent in children and adolescents. Highly effective pharmacological treatments are available that allow the child and the adolescent to function at his/her full potential. Various preparations of methylphenidate and amphetamines have been used for a long time in the treatment of ADHD. This article reviews these and some of the newer drugs used in the treatment of ADHD, including atomoxetine and bupropion.
|
Motor vehicle crashes are the leading cause of death for children from 1 to 14 years of age. The odds of motor vehicle crash injury to children aged 4 to 7 are 59% lower when riding in belt-positioning booster seats than when riding in safety belts alone, and rear seating can reduce the risk of death to child motor vehicle passengers by as much as 46%. Despite these facts, 90% of booster-age children are prematurely graduated to adult safety belts and 30% of children are permitted to ride in the front seats of vehicles. The proposed project will develop and evaluate an efficient process for disseminating preventive messages regarding booster-seats and rear seating to large numbers of parents via partnership with community preschool and daycare programs. Considerable research on other health topics indicates that persuasive and risk communication tactics have a greater likelihood of motivating the adoption of protective behaviors than do traditional messages. The current research will expand upon this premise by developing a novel five-minute video that is framed according to such efficacious risk communication guidelines. Specifically, the video will include crash test footage, portraying the power of crash forces and evoking high emotion by means of vivid imaging. Such communication tactics are known to motivate maximum behavioral change; however, the literature indicates that this method has not yet been employed in child passenger safety programming. The effectiveness of the video-based program will be piloted at two large and representative preschool/daycare programs, using two similar control sites for comparison. The program will engage the assistance of community-based coalitions and will include incentives for participating preschool/daycare staff. As part of the evaluativeprocess, caregivers will complete (a) pre-post knowledge and practice surveys regarding back-seat and booster-seat use and (b) pre-post risk estimations related to childhood motor vehicle hazards. In addition, researchers will observe booster seat and rear seat use in preschool parking lots before, during, and after program implementation. It is hypothesized that families exposed to the video-based program, compared to those in the control schools, will have (a) increased knowledge about causes of injury and reasons for booster seat and rear seat use; (b) a more realistic assessment of personal risk; and (c) greater use of booster seats and rear vehicle seats when age-appropriate. Long-term goals for the program, if effective, are to package it for district-wide adoption and broad-scale dissemination.
|
1. Introduction {#s1}
===============
Behavioural change is an important factor in the maintenance of health and well-being in a number of conditions; a change in a person\'s behaviour can often be an indication of a change in their health state. Monitoring behaviour and detecting change as part of self-management can therefore be an effective tool for the maintenance of stable health in chronic diseases \[[@C1]\], including bipolar disorder \[[@C2]\] and chronic fatigue syndrome \[[@C3]\]. By monitoring behaviour, changes that correlate to prodromes or early warning signs can be identified and corrective or preventative action taken early. There are many paper-based solutions available for these conditions, but the prevalence of technology and potential cost savings are creating a driver towards more automated behaviour-monitoring systems.
Behaviour-monitoring systems, which are increasingly used in dementia care \[[@C4]\], typically take the form of distributed sensing environments that capture a large volume of information about the subject from a variety of sensors, such as in \[[@C5]\]. This produces a very large, multivariate dataset, often with significant elements of noise. The establishment of what constitutes a 'normal' pattern of behaviour and the detection of deviations from such a dataset pose significant challenges.
In this Letter, a novel approach to the detection of both normal behavioural patterns and deviations from these patterns is presented, which operates on a distributed sensing environment. The approach centres on the application of an existing algorithm, the continuous profile model (CPM), to an application domain it has not been previously applied to and the novel processing of the output of the CPM algorithm to detect behavioural patterns and changes in a multi-sensor system. This approach is termed multivariate behavioural modelling (MBM). An experimental validation of the MBM approach is presented to demonstrate that behavioural patterns and change can be detected by showing that the method is capable of determining the difference in behaviour between weekday and weekend days in two normal controls under different circumstances.
The method developed to detect change is described in Section 2, the experimental approach to validating the method is described in Section 3 and the results obtained are given in Section 4. Section 5 provides a discussion of the results and Section 6 presents some conclusions.
2. Method {#s2}
=========
The MBM method uses the CPM algorithm to detect the underlying behaviour from the data provided by the sensors in the system and to assess the similarity between new data and the established pattern for each sensor. The output from this step is then fused in an automatically weighted manner to detect the changes in behaviour.
The CPM has been chosen for this task as it is specifically designed to extract the underlying pattern from a cohort of input patterns and assumes that these patterns are all noisy and derived from some underlying pattern. This maps very closely to the problem addressed in this work of detecting an underlying behaviour pattern from several days of observation of free living behaviour.
The CPM is particularly suited to this task as it is cohort based, in that it works on the entire input set at once, and is capable of performing two key aspects of the analysis -- identification of normal behavioural patterns and calculation of differences using the same model. Alternative methods exist that can handle one of these tasks, but not both. Dynamic time warping (DTW) \[[@C6]\], for example, is suited to analysing the difference between a known pattern and a new pattern, but does not provide a robust way to determine the underlying pattern. Statistical methods, such as a temporal average, could be used to perform this task but are less resistant to noise than the CPM. Other approaches such as identifying clusters of sensor firings as significant events and looking for the presence or absence of these \[[@C7]\] have been presented in the literature but do not offer the same granularity of output as the CPM.
This Section gives first an overview of the MBM method and then further details on the pattern detection and change detection algorithms.
2.1. Overview {#s2a}
-------------
The MBM method operates on a multivariate input set where several sensors exist that each produce one or more data streams. The MBM method proceeds in four steps: (1) *Pre-processing*. The pre-processing step performs feature extraction on the raw data to compress the data stream into a set of characterising features. Pre-processing is not performed on data that are very simple, such as those from PIR sensors, which simply comprise the timestamps of sensor firings. Further details on potential pre-processing techniques can be found in \[[@C8]\]; however, a range of pre-processing options are possible dependent on the data being used.(2) *Time-series generation*. A time-series generation step converts the pre-processed sensor output into a time series. At this point, the data stream has some level of basic meaning with respect to time and provides the lowest level of information in the system. An example of this is the processing of raw accelerometry data through to providing a measure of activity intensity within a five-minute epoch and generating a data stream consisting of activity scores for successive five-minute epochs. The pre-processing and time-series generation steps are bespoke for each data stream included in the MBM analysis. More details on suitable processing techniques can be found in \[[@C9]\].(3) *Data fusion and pattern detection*. The data fusion and pattern detection step utilises the CPM algorithm to detect the normal pattern of activity from each time-series data stream and combines these to establish a normal pattern of behaviour for the user.(4) *Change detection*. The change detection step uses the CPM algorithm to detect differences between the detected normal pattern and new data and fuses the detected difference scores across all data streams to detect deviations from the normal pattern of behaviour.
2.2. Pattern detection and change detection {#s2b}
-------------------------------------------
The data fusion and pattern detection step is where the user\'s data are processed to extract their normal behaviour pattern. This pattern is used to detect changes in their behaviour over time. The core algorithms for both of these stages are in the CPM \[[@C10]\], which is a model for the simultaneous alignment, and estimation of the underlying pattern, of a set of time-warped input time series. Briefly, the CPM takes a set of repeated observations of a phenomenon, aligns them in time and generates a model for the underlying phenomenon that is capable of generating the input set. A full explanation of the CPM can be found in \[[@C10]\] but the principal points are repeated here as the change detection step makes use of a number of outputs that the CPM provides. (1) *CPM background*. The primary assumption of the CPM is that there is an input set comprising many uniformly sampled time series that are all time-shifted and locally time-warped observations of an underlying process, termed the latent trace. This is analogous to a set of data recorded from a person repeating the same patterns of behaviour over many days; the underlying behaviour is the same, but individual parts may be shifted in time or take longer or shorter times to complete. The CPM provides a way to reverse engineer the input set to model the latent trace and align the input set in time.Given a model for a particular input set, the CPM is capable of producing a log-likelihood of a new input being generated from the model in addition to the total log-likelihood of producing all the time series in the input data set from the model. These two measures, as well as the latent trace and time-aligned input set are the outputs of the CPM that are used by the MBM method. (2) *MBM method*. The CPM is used in the MBM system to model the behaviour patterns for each data stream given a set of training data from that data stream. Assuming *N* data streams, the processing for each data stream is as follows. Over a training period of *T* days, the CPM model is trained and the total log-likelihood of producing the input set is calculated as *L~s~*, where *s* denotes the data stream. The average log-likelihood of generating any one of the input time series is thus calculated as $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{upgreek}
\usepackage{mathrsfs}
\setlength{\oddsidemargin}{-69pt}
\begin{document}
}{}$$L\alpha _s = \displaystyle{{L_s } \over T}$$\end{document}$$The latent trace obtained as a result of the training process corresponds to the detected normal pattern of behaviour observed for that data stream. During training a further measure, *ρ~s~*, is calculated as the correlation of the input set after alignment with the CPM. This is a measure of the consistency of the input from the data stream and is used in subsequent processing.
The process of pattern detection from training data is repeated for all the data streams in the system. In this way, a collection of known behavioural patterns is built up and collectively termed an activity signature. The activity signature defines the normal patterns of behaviour for the user as captured by the data streams used to monitor that user.
Once an activity signature is defined for a user, it is possible to calculate a metric that identifies how different a given day is to the activity signature. This calculation is performed in three steps. First, for each data stream, a likelihood measure for generating the new data from the optimised model is obtained using the CPM and denoted *Lβ~s~*. The weighted behavioural difference (WBD) between the new data and the established pattern can be calculated by comparing the difference between the two log-likelihoods as $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{upgreek}
\usepackage{mathrsfs}
\setlength{\oddsidemargin}{-69pt}
\begin{document}
}{}$$W_s = \rho _s \lpar L\beta _s - L\alpha _s \rpar \; $$\end{document}$$where the multiplication by the consistency factor, *ρ~s~*, emphasises the differences in data streams that produce highly consistent data since a change in an otherwise consistent data source is deemed to be more significant than a change in an inconsistent data source. Furthermore, if any *W~s~* is positive it is set to 0, which has the effect of ignoring it in subsequent processing.
Given difference scores across all the data streams, an averaged WBD (AWBD) score for a single day can be calculated as $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{upgreek}
\usepackage{mathrsfs}
\setlength{\oddsidemargin}{-69pt}
\begin{document}
}{}$$W_A = \displaystyle{1 \over N}\mathop \sum \limits_{s = 1}^N W_s $$\end{document}$$The averaging over *N* allows the calculation of *W~A~* to take account of a varying number of data streams and for a sensor to drop out without adversely distorting *W~A~*. The reasoning for ignoring positive *W~s~* values also becomes apparent in this equation. A positive *W~s~* indicates that the new data is highly typical of the training data; that it is not different. Since the objective is to identify differences, and since high positive scores could overwhelm smaller negative scores (which indicate difference), positive *W~s~* values are ignored.
By following the processing outlined above, a number of different data streams are used to calculate a single metric that quantifies how similar the behaviour of a new day is to the patterns that have been detected in the training data.
3. Technical trial {#s3}
==================
To develop and test the MBM method, data from a technical trial of a self-management system for bipolar disorder \[[@C8]\] was used. The trial was run at two sites using multi-sensor systems to monitor the behaviour of two participants, both health controls. Participant \#1\'s trial lasted for 12 weeks and participant \#2\'s trial lasted for 5 weeks. A slightly different sensor set was used in each trial and these are shown in Tables [1](#TB1){ref-type="table"} and [2](#TB2){ref-type="table"}. Data obtained from the trials were used to develop the processing architecture described above. Table 1Sensor locations for participant \#1Sensor nameLocationcamerakitchenPIR 1bedroomPIR 2loungedoor switch 1kitchendoor switch 2kitchenIR sensorloungepressure matbedroomenvironmental nodelounge Table 2Sensor locations for participant \#2Sensor nameLocationcamerakitchenPIR 1hallwayPIR 2hallwaypressure matbedroomenvironmental nodelounge
To test the MBM method, a hypothesis was made that the weekday behavioural patterns are different from weekend behavioural patterns and the system was used to detect this difference. For each trial participant, an activity signature was obtained based on their weekday behavioural data over a training period. Following the training period, the activity signature was used to assess the similarity of each new day. This was performed on both weekdays and weekends and the AWBD scores were used to identify weekend days from the data.
During the training period, only good days of data were used. A 'good' day of data is defined as a day with enough data that the processing algorithms run correctly. In practical terms, this means that when a sensor drops out during the training period, the training period for the data streams associated with that sensor are extended. This results in some of the data streams not being used at the start of the testing phase because they are still being trained. This is not a problem as the way the AWBD is calculated accounts for differing number of data streams.
4. Results {#s4}
==========
The results of the technical trial for participants \#1 and \#2 are presented in this Section. To take account of the difference in days of the two datasets, each set was analysed using a different number of days for training; participant \#1\'s data was analysed with a 30-day training period and participant \#2\'s data with a 7-day training period. A summary of the results is shown in Table [3](#TB3){ref-type="table"}. Table 3Summary of technical trial resultsParticipantTrial length, weeksTraining length, days*P*-value\#112300.0182\#2570.0106
4.1. Participant \#1 {#s4a}
--------------------
Fig. [1](#F1){ref-type="fig"} shows behavioural patterns obtained from four of the data streams from participant \#1. The Camera Cooker AOI, Fig. [1](#F1){ref-type="fig"}*a*, shows a definite peak at around 2000 with smaller peaks during the day. The PIR sitting room pattern, Fig. [1](#F1){ref-type="fig"}*b*, and environmental artificial light pattern, Fig. [1](#F1){ref-type="fig"}*d*, also show activity peaks around this time and the PIR pattern continues to identify activity later into the evening. The pressure mat pattern, Fig. [1](#F1){ref-type="fig"}*c*, identifies three peaks, around 1000, 1900 and 0000. Figure 1Behavioural traces from four data streams for participant \#1 showing camera cooker AOI, PIR sitting room, pressure mat and environmental artifical light*a* Camera cooker AOI*b* PIR sitting room*c* Pressure mat*d* Environmental artificial light
The overall activity signature for participant \#1 is shown in Fig. [2](#F2){ref-type="fig"}, in which amplitudes of the behavioural patterns have been normalised for display purposes. The behavioural patterns from Fig. [1](#F1){ref-type="fig"} can be seen from this figure along with behavioural patterns from the remaining sensors. The alignment between the behavioural patterns can be clearly seen from this figure, in particular the activity in the evening, around 2000, and during the middle of the day, around 1300. Figure 2Activity signature for participant \#1 showing how behavioural patterns from each data stream align in time
The activity peaks identified in Figs. [1](#F1){ref-type="fig"} and [2](#F2){ref-type="fig"} are consistent with the general patterns known for participant \#1, particularly leaving the office for lunch and preparing food in the evening. This is particularly evident in the data streams 'WER Accelerometer' and 'CAM Cooker'.
Fig. [3](#F3){ref-type="fig"} shows all of the WBD scores from the test data. Gaps in the data are because of sensor problems and missing data. In general, it is difficult to identify any trends from this graph; however, there are several days that show a drop across several sensors, notably days 23, 30 and 37. Figure 3WBD scores for all data streams for participant \#1
Fig. [4](#F4){ref-type="fig"} shows the AWBD score over the testing period for participant \#1. From this figure, the difference between weekdays and weekends is much clearer; weekends have a significantly lower AWBD score than weekdays. This observation is verified with a Student\'s *t*-test on the data with a null hypothesis that there is no statistical difference between the scores obtained on weekdays and weekends. A *P*-value of 0.0182 was obtained, which rejects the null hypothesis at the 5% confidence interval and indicates that there is a significant difference between weekday and weekend AWBD scores for participant \#1. Figure 4AWBD scores obtained from participant \#1
4.2. Participant \#2 {#s4b}
--------------------
Fig. [5](#F5){ref-type="fig"} shows the activity signature for participant \#2. There is no particular correlation in the data streams, other than a trend for activity in the evenings. Only one sensor, the PIR, is of particular note as it displays two distinct activity peaks, one in the morning and one in the evening. These correspond to the times that participant \#2 got up and went to bed. Figure 5Activity signature for participant \#2 showing how behavioural patterns from each data stream align in time
Fig. [6](#F6){ref-type="fig"} shows the AWBD score for the test period from participant \#2. As with participant \#1, the weekends can be clearly seen as different. This is verified with a Student\'s *t*-test *P*-value of 0.0106 which rejects the null hypothesis at the 5% significance level and indicates that there is a significant difference between the weekday and weekend AWBD scores. Figure 6AWBD scores obtained from participant \#2
Table [3](#TB3){ref-type="table"} shows the *t*-test results for both participants. Both tests reject the null hypothesis (that there is no statistical difference between the scores obtained on weekdays and weekends) at the 5% significance level.
5. Discussion {#s5}
=============
The results of the technical trial show that behavioural patterns can be extracted and that the difference between weekdays and weekend days can be identified; the AWBD scores were shown to be significantly different at the 95% confidence level for both participants. The AWBD metric allows easy identification of difference and allows an inspection of the individual WBD scores to identify those that caused a difference to be flagged, providing additional insight into the user\'s behaviour. Furthermore, the results show that the calculation of the AWBD metric is able to run successfully with poor quality data that include significant and inconsistent gaps across different data streams.
The data processing does not identify every weekend as different, but it would not be expected to. It is entirely possible that the behavioural pattern for a weekend day might be similar enough to a weekday for it to be given the same score. A record of what each participant did on each day of the trial was not maintained, which prevented a complete verification that the change detection algorithm was working correctly for each day. However, a general record of activity for each participant was maintained and this is sufficient to know that, in general, they behaved differently at the weekend and the Student\'s t-tests confirm that the AWBD scores in the weekend and weekday groups are statistically different.
It is, however, acknowledged that there are some misclassifications present in the data. A principal cause of some of these in the testing period is sensor drop-out. If the sensors that are important in distinguishing between weekdays and weekends drop-out then the system will not be able to distinguish between the two. Days 50 and 51 from participant \#1 display this type of misclassification and can be seen in Fig. [3](#F3){ref-type="fig"}. Many of the sensors dropped out over those 2 days, causing a reduction in the number of data streams available for classification. Of the data streams remaining, two were light sensors, which report the same pattern each day. Thus, the WBD scores for the light sensor data streams are very high, resulting in a very high AWBD score for those days.
The robustness of the algorithm to this form of missing data, and to noisy data comes from two factors. Noisy data are accounted for through the use of the probabilistic approaches in the CPM and through the consistency factor, which deliberately reduces the influence of noisy data. Robustness to missing data is a result of the modular treatment of the difference scores from each data stream. By treating each data stream independently and averaging scores as the final step, missing days of data do not adversely affect the AWBD unless those sensors are key to determining the behavioural difference, as can be seen for days 50--51 for participant \#1.
6. Conclusions {#s6}
==============
The work presented in this Letter demonstrates an approach to monitoring behavioural change from multi-sensor systems and shows that macro-level changes in behaviour can be identified using the MBM method. The use of a cohort-based pattern detection method (CPM) in this application to generate activity signatures, and the use of automatically weighted behavior difference scores in the data fusion step are the principal novel contributions of this work. In particular, the way in which the data are analysed provide for a method that is particularly robust to noise and data drop-out and that can adjust automatically to the addition and removal of sensor components.
The results, presented in summary form in Table [3](#TB3){ref-type="table"}, show that the AWBD scores for weekdays and weekend days are significantly different at the 95% confidence level for two different test scenarios, providing *P*-values of 0.0182 and 0.0106, respectively, which strongly reject the null hypothesis that there is no difference between weekday and weekend data. Behavioural differences are shown in both participant\'s data and this indicates that the MBM method is capable of operation on differing datasets with differing underlying behavioural characteristic expressed by the two trial participants.
The above results show that the MBM method provides a solid foundation for detecting behavioural change and a single overarching indicator metric that can be drilled down into to provide additional insight. This approach could be used as a data analysis technique in self-management systems for chronic health as a means of detecting changing behaviour patterns and further work with this approach will focus on this area.
In such a system, the input sensor devices could be tailored to be condition specific and a decision support system (DSS) used to provide insight to the user. The DSS would be able to take action when behaviour change was detected, such as providing alerts or suggestions to the user. Since the data processing can be examined to identify specific changes, these, coupled with the use of specific input sensors, could be used to make inferences about the user\'s health state, predicting affective change, for example, in bipolar disorder.
The development of such a system has the potential to provide a significant improvement in long-term health for people with chronic conditions.
Additionally, the work in this Letter could be extended to support the detection of different patterns for different days, such as weekend or weekday patterns and an automation of this process could be investigated with a cluster-based approach on the activity signatures. There would also be utility in developing a mechanism to identify the specific aspects of a day that were different from the normal, both in terms of which sensors are different, but more importantly, to localise those differences in time. These improvements would allow for greater flexibility in behaviour detection and provide a more targeted and specific indicator of change.
The authors thank the trial participants for the invaluable data generated in testing the system.
8. Funding and declaration of interests {#s7}
=======================================
This work was supported by EPSRC grant EP/F005091/1. Christoper James is the Editor-in-chief of *Healthcare Technology Letters*; the manuscript was handled by an alternative editor.
|
Highly efficient and chemoselective α-iodination of acrylate esters through Morita-Baylis-Hillman-type chemistry.
The chemoselective α-iodination of various simple and multi-functionalised acrylic esters is efficiently accomplished by a Morita-Baylis-Hillman protocol involving the use of N-iodophthalimide, 3-quinuclidinol and KF-Celite in acetonitrile. No degradation of the obtained compounds was observed under the optimized conditions thus, furnishing α-iodoacrylates suitable for organometallic reactions (i.e. Nozaki-Kishi-Hiyama type coupling).
|
Image caption Leo Jacobs' death was deemed to be "unexpected"
The number of unexpected patient deaths reported by England's mental health trusts has risen by almost 50% in three years, figures suggest.
The findings, for the BBC's Panorama programme, are based on FOI results from half of mental health trusts.
Unexpected deaths include death by suicide, neglect and misadventure.
The Department of Health said the increase was "expected" because of changes to the way deaths were recorded and investigated.
Raising the issue at Commons' health questions on Tuesday, former shadow health minister Luciana Berger said she was "ashamed to live in a country" where the number of unexpected deaths among mental health patients had risen in recent years.
She said: "That is not a reflection of a country that cares equally about mental health as it does about physical health."
Health Secretary Jeremy Hunt said there was "a huge to do to improve mental health care", but said more money had been made available, and more patients were being seen. "I think we are one of the best in the world," he said.
Unexpected deaths
Thirty-three mental health trusts - which provide most mental health care - out of a total of 57 in England responded to the Panorama Freedom of Information request.
In 2012-13, the trusts reported a total of 2,067 unexpected deaths.
By 2015-16 that had risen to 3,160.
The increase comes at a time of decreased funding for mental health trusts, which provide the bulk of mental health care in England.
Exclusive new analysis for Panorama from the think tank, the Health Foundation, indicates that mental health trusts in England have had their funding cut by £150m over the past four years, compared with a rise in national spending on health of £8bn.
Mental health and stigma: 'You're not alone'
Mood self-assessment: Could I be depressed?
The death of Leo Jacobs was one of those classed as an "unexpected death".
Leo, who had schizophrenia, was 39 when he died of a suspected accidental overdose at his flat.
Image caption Leo Jacobs' mother feels he was let down
Leo's mother, Sheila Preston, said "I begged the trust to help him but they thought he was living well - he was managing but I knew that he wasn't.
"I knew that he was going to get iller and iller and iller. And he died and when they came to tell me I was not surprised. I was expecting it.
"The idea that people would be better living in the community is a very good idea - but the support is not there to help them maintain their health."
Leo was a patient at Norfolk and Suffolk Foundation Trust where Sheila is a lay governor.
"I know, I know, that my son and I know that people in the trust, good people in the trust, know that my son could've been saved."
Norfolk and Suffolk Foundation Trust has recently been removed from special measures despite concerns over high numbers of patient deaths.
It redesigned its services in 2013 after substantial cuts to its funding.
Its chief executive Michael Scott said: "Five years ago before I joined the trust, the trust was under financial pressure, there's no doubt about that, and it had to respond to that financial pressure by changing the way it ran its services.
"And my personal view is I think mistakes were made in that period."
He said of the trust "we're on a journey of improvement".
"What the facts actually show is that one of the reasons that those numbers [unexpected deaths] are changing is that we are providing more services than we ever did before.
"We've acknowledged that people are dying, what's important is that we understand the causes."
Missing out
Anita Charlesworth, economist at the Health Foundation, said mental health trusts were receiving a falling share of funding.
"The NHS has not set out to cut mental health services but as they've got rising patient demand elsewhere, they've had to look for cuts to make up that budget shortfall and often it is mental health services that have borne the brunt of those."
Almost every mental health trust in the country is currently in the process of redesigning its services and restructuring is under way across England as part of 44 STPs or Sustainability and Transformation Plans.
But there is concern about what those redesigns will mean for care.
The President of the Royal College of Psychiatrists, Sir Simon Wessely, has concerns that services may be about to get worse.
"I've been in meetings with chief executives and chairs of trusts who are openly talking about that they'll have to decommission services next year," he said.
"What is I think tragic is that it's the time when we have been promised increased funding and there is no doubt that this is not yet getting to where it is intended."
Marjorie Wallace, from the mental health charity Sane, said she was shocked by the rise in unexpected deaths.
She said: "We are particularly concerned because these are the most vulnerable people that we have entrusted into the care of mental health services and they are so often being failed - both them and their families."
A Department of Health spokesman said: "This increase in the number of deaths is to be expected because the NHS is very deliberately improving the way such events are recorded and investigated following past failings.
"From April all NHS trusts will be required to publish both numbers of avoidable deaths and how they are improving care.
"We also dispute the funding figures used in this programme - just this year, mental health spending by Clinical Commissioning Groups has gone up by £342m, which is on top of an extra £1.4bn allocated in this Parliament."
An NHS spokesperson, said: "The statistics on suicide are clear: for the last decade the suicide rate amongst people in mental health services has been falling, by more than 30% since 2004, most clearly in inpatient services and more recently in community services.
"We do not believe that the figures obtained by the BBC reflects the national data most recently published, which suggests that their figures are incomplete and misleading."
Royal Statistical Society assisted in exploring the data and evaluation of the analysis.
|
Sunday, September 22, 2013
Did I ever know I was something else than a pushed for time mother ?
Seriously ! I'm watching a lot of cooking blog. And is there someone who can tell me how those women do ?
For example, I'm a fan of Pioneer Woman.
Thanks to her, I began to read american blog. I came on her blog by chance and I just loved her pictures and her cooking.
But please, someone, answer me ...
How can she do to cook such various things ?
How can she do to cook as often as she does ?
How can she do to have such a busy life, with a ranch, 4 children, a husband, pets, a blog and now, books, TV show, city tours... and, and, and ... while I'm totally overtaking by my daily life, sometimes !
SO, yes ! Sometimes, I'm just cooking my dear sweet friend "Yogurt cake" ! And I cry on my sofa.
Well, I don't cry as often as I use to write it.
Except when I listen sad songs.
Well, here my recipe for women as me : in brain dead !
1 yogurt (125 grammes)
3 eggs
3 yogurt pot of flour (375 grammes)
2 yogurt pot of white sugar (250
grammes)
1/2 yogurt pot of neutral oil (65
grammes)
10 grams of baking powder
1 tablespoon of vanilla extract.
And for chocolate topping :
200 grams of dark chocolate
100 grams of unsalted butter.
Your oven must be preheated at 240°C
(Th 9 / 464°F).
When you'll put the mixture in the
oven, reduce the heat at 180°C (Th 6 / 356°F).
7 comments:
Dear Axelle, Now I really want to just jump inside the computer and eat this cake...yum! And, what great presentation with the dark chocolate (drool) inside the cake and then covering the cake and sprinkles on top! This is my kind of cake. Yes, those of us who do not have help in the kitchen most appreciate your style of recipe and use of the yogurt container for amounts of ingredients (fewer dishes to wash). Thank you! love and prayers, jep
Dear Axelle-Don't criticize the yoghurt cakes! We love them in all of the various forms. And the green olive bread. I could eat that forever! They have been a hit at a few church fellowship meals. Whenever we take them. Yum yum yum. Regards-Jamie
p.s. The grape vines are not ours. We pick the grapes for someone else. The property is gorgeous and the family is nice. We have also been busy at an organic blueberry farm. It is new and they are busy laying out the new rows and plants. At least 20,000 plants. It's big. We have been doing this field work since June: starting with picking blueberries, now cutting grapes and setting up the new blueberry farm. With other people, of course. We will be finishing soon and getting back to our homeschooling. Who needs to work out in a gym? My husband is busy as headmaster at a small new classical christian school. Imagine how different our days are from his right now! : ) We have a few grape vines at home but just make juice for now. Our friend know how to make the homemade wine and we will ask him soon to show us. Have a wonderful day!
Dear Jamie, THANK YOU FOR DEFENDING YOGURT CAKE, I LOVE YOU !!! :DAnd I'm so glad to know you cook it often and that your church likes it too ! :) Oh, yes, I remember : you told me about your husband's job (sorry, Jamie, I really have a chicken brain). This is a very courageous way to end holidays, believe me !! And I love this idea to work in an organic farm and to help each others. It must create strong likns and I love this idea of Humans relationship. Congrats, Jamie to you and your family !
Last post
Search
About Me
Hello !
My name is Axelle, I'm french.
I’m 40 years old.
I live in the south of France.
I met my husband, Vincent, when I was 20 years old.
I’m the lucky mother of two monsters that I love more than myself, known with love, as Le Gnome (13 years old) and La Gnomette (10 years old).
They make me laugh. They make me scream. They make me become mad. But they make my life.
This blog is for all the not French person in the world who want to discover the daily cook of a "normal" french family.
I thank you for forgiving my english mistakes ;)
Welcome in my tiny kitchen.
|
Treatment of post-traumatic avascular necrosis of the femoral head by multiple drilling and muscle-pedicle bone grafting. Preliminary report.
Twenty-nine patients with avascular necrosis of the femoral head after injury have been treated by operation. Multiple drilling of the femoral head was performed, necrotic bone removed and a muscle-pedicle bone graft implanted into the head and neck of the femur. In 17 of the patients the necrosis was associated with an un-united femoral neck fracture, in 11 it occurred after the fracture had united, and one case followed reduction of a dislocated hip. The hips became painless soon after operation. The patients were young (average age 35 years), and full weight-bearing was not allowed for several months. The follow-up period ranged from 22 to 64 months. The results were excellent in 20 patients, good in five, fair in three and poor in one.
|
Maybe you should just delete your blockchain (folders blocks & chainstate) and use a bootstrap to quickly re-download the blockchain and have it synced from scratch.You can download a Dash bootstrap here : https://github.com/UdjinM6/dash-bootstrap (use the most recent for mainnet)Check your balance for your address(es) here : https://chainz.cryptoid.info/dash/ if that shows you the correct balance then its a matter of getting you on the right chain.The reason for your transaction(s) not getting confirmed could be related to you staying on the v0.12 chain too long (as in wayyy too long). The risks for staying ona not supported chain is transactions not getting confirmed (basicly you end up in a forked-off chain without any support).
|
Additional Information
Reviews
Mistral is an assemble of distinctive elements that are linked together by a flowing, 24K gold plated, elegant chain. It’s a jewel that overwhelms the wearer, through its complexity; yet, there are simple elements that become a masterpiece once they are linked together.
All our jewels are 100% handmade and crafted under the direct supervision of our designer and professional technicians.The crystals used are from Swarowski, inserted in settings attached to a base of cast acrylic material. Special glues are used to ensure a firm grip and to maintain the high quality of the jewel.
|
Q:
Is something creating itself nonsense?
There seems to me to be a big trend among scientist, many if not all of the atheist variety, that think that the universe could somehow create itself. Stephen Hawking goes on to say...
Bodies such as stars or black holes cannot just appear out of nothing.
But a whole universe can… Because there is a law like gravity, the
universe can and will create itself from nothing… Spontaneous creation
is the reason there is something rather than nothing, why the universe
exists, why we exist. It is not necessary to invoke God to light the
blue touch paper and set the universe going.
Is the idea that something can be its own creator logically sound? Would you not have to exist before you existed to create yourself? It seems like nonsense to me. It seems to me that for the same reasons a person cannot be his own father a universe cannot create itself.
So the question remains... Is the idea that a universe can create itself nonsense?
Endnotes
1. Stephen Hawking and Leonard Mlodinow, The Grand Design (New York: Bantam Books, 2010), p. 5
A:
The New Atheism seems to be promoted by Scientists or Philosophers pursuing a Physicalist agenda.
The actual physics is silent about why or how the universe was created. Its also not generally noticed that the Physics of the very early Big Bang is highly speculative. It's impossible to say what new Physics are possible at such incredible density of both matter & spacetime.
That their arguments are taken seriously is due to the high visibility & success of the Physicalist project in its manifold forms. This does not mean that it is correct.
The argument that the universe created itself is not correct:
a. One explanation put forward is that the universe begun as a quantum fluctuation. But this already posits a void where quantum laws are real. How can then one say it is void? The statement is paradoxical (without further elucidation).
b. That Heisenbergs Uncertainty principle applied to time & energy seems to imply creation of energy is a standard popular interpretation, however I find this problematic given just how important conservation principles are in physics. Its also rife with philosophical interpretational issues. Taking Heisenberg principle seriously as uncertainty (which is how it was originally thought up) means you cannot be certain as to what energy is available in that time-frame. To ask for conservation at all times means that quantum reality has definiteness - and it is not clear exactly how this happens, if at all - at least in traditional frameworks like the Copenhagen explanation or its modern update Consistent Histories.
Only something with creative agency can create - what the universe, at least in a physicalist narrative, is change from one moment to the next in line with Law. Now, what one notices is that the physical laws of conservation of energy & momentum involve time. If there is no time - there are no laws.
Of course, one can posit that there are epochs before the one we are now. For example in Indian Cosmology we are now in the Kala Yug. I suspect it will be (relatively) easy enough to modify the standard Big Bang Cosmology so that there previous epochs to the one we are now in - simply because we have no empirical access to that point in time.
These are actually very old arguments. For example in Christian Theology God created time & space. That is the Sun to regulate time, the earth as the theatre of action. One should understand this symbolically and not literally. As was already understood by the early Christian Fathers.
Plato, in the Timaeus which describes his cosmology has the Demiurge inject order into the formless void. Unlike the New Athiests he is at least lacks the hubris to have:
Timaeus say he will strive to give an account that is “no less likely than anyone else's”
One also notes that Hume gleefully applies the new critical spirit endemic to the then new science to empirical phenomena to deny cause & effect and stall the scientific project. It took Kant to restart it by injecting human consciousness into the world and distinguishing a phenomenal realm where science can happen and the noumenal realm on which we have no purchase.
In fact, a similar argument to Humes was also applied by the Islamic Theologian Al-Ghazali against the rationalists of his time - the Falsafas. He invoked Allah so that cause & effect happened.
In Christian philosophy, say for example as elucidated in Leibnizs Monadology, the infinite substance he identifies as God. It is uncreated & eternal. To prove this is entirely beside the point, which Kant points out. It's a position taken up, in the same way one may say there is a void set. The reasoning here is axiomatic. To then ask - well what created that substance - contradicts that first assertion. It's a stepping outside of that framework. This is rather like reasoning with Set Theory but then deciding to change the meaning of the membership relationship.
A:
Reality is a very strange place. Energy is created from nothing all the time and then disappears again. The reason is the uncertainty principle:
ΔE Δt >= ℏ / 2
and this isn't imaginary energy; you can actually use it to e.g. catalyze some reaction (overcome some energy barrier, whatever) as long as you give it back within the appropriate time window.
So if you ask: isn't it strange to create something from nothing? I answer: happens all the time; the universe just lasts way too long. Does this mean that the universe in some sense creates itself? Maybe.
The main lesson to take from relativity and quantum mechanics is that everyday intuition which can be rock-solid on our size and time scales can be utterly bafflingly wrong on the scale of universes or subatomic particles. So while you shouldn't place too much faith in "scientific" results that aren't able to be heavily tested (how many universes can your average experimental cosmologist create?), raising philosophical objections on the basis of how apples and walls behave also begins to look rather foolish.
A:
1) Yes, it is: But then, a selfcreating God is as nonsense as selfcreating universes. Therefore, you'd have to assume some kind of Infinitism. Either the universe or God could be infinite, but the universe being infinite requires one less entity.
2) No, it is not: Then why assume a selfcreating God if there can be a selfcreating universe. Both theories have the same explanatory strength, but the theory of a selfcreating universe does need an entity less (namely, no god).
Therefore: Selfcreating universe.
|
Q:
SML, Write a function that concatenates a list of lists
I need to write a concat function in StandardML such that:
concat [[5,4,3],[],[9,5],[],[],[1,1]] = [5,4,3,9,5,1,1]
I am new at SML, so I don't think I fully understand how to breakdown the lists and append them. The answer may use the built in append function
aList @ bList
Thanks!
A:
If you're expected to write such a function, I'm assuming you have learned how to build recursive functions that iterate through a list. That knowledge plus the @ function should be enough.
If you're unsure about which list method to use, listA @ listB creates a new list from the combination of listA and listB, while item1 :: listA creates a new list with item1 added to the head of listA.
|
I vote in a small, rural, conservative, Republican town in Illinois. There is nothing major for either state or local on the ballot. I waited 20 minutes to vote at 6:30 a.m. and the elderly poll workers said they had never seen an election like this before, even when there was a major local issue on the ballot.
I take some hope from this – I think all those people were there, just as my wife and I were there, to vote against Obama when it won’t make a difference at all, since he’ll easily carry Illinois based on Chicago. As my wife noted, the folks in the Remington caps were unlikely to be Obama voters.
In my little Red corner of Ohio, there were no lines at 11:15, but there was a larger GOP than Democratic volunteer presence outside. The only reason this might be significant is that some popular local Democratic officials are running for higher office (e.g. state rep), and I would have thought they’d have had more foot soldiers working the polls.
|
Charlie Rose, a TV icon, is accused of improper behavior by former interns
The TV news anchor Charlie Rose at Trump Tower on November 21, 2016, in New York. AP Photo/Carolyn Kaster
Three women who formerly interned for Charlie Rose told Business Insider that they experienced inappropriate behavior.
One spoke of Rose touching her legs in the back of a car as he had his driver take her to her college dormitory. Two others spoke of Rose opening the door to his home wearing nothing but a bathrobe and inviting them in.
The allegations are distinct from those reported by The Washington Post but similar in nature: Namely, the women say he took advantage of them as they sought professional opportunities.
Delivering research to Rose's home was "the worst job," one intern said, because of his reputation.
Three women have told Business Insider of their experiences while interning for Rose, or seeking to work for him, in 2005, 2008, and 2010. One said Rose touched her legs inappropriately as he was dropping her off at a dormitory in New York City and then on a separate occasion when she sought career advice invited her to his hotel room late in the evening.
Another says he invited her to dinner to discuss career opportunities, had her meet him at his townhouse, and greeted her at the door in a bathrobe and invited her into his home.
A third woman also says Rose greeted her at the door in a bathrobe and invited her in while she was delivering research to his apartment as an intern. She declined.
The accounts are distinct from those reported by Irin Carmon and Amy Brittain at The Washington Post. Carmon and Brittain also describe Rose groping women or walking around nude in their presence. It's not clear whether the women Business Insider spoke with are among the eight women who spoke with The Post. During our reporting, sources told us other publications were looking into Charlie Rose.
The stories share some similar characteristics. The women were young, and drawn to Rose by the promise of opportunities — knowing that working for him could provide a huge boost to their careers. Rose, 75, is a broadcast television icon, and he now hosts his own show that airs on PBS and Bloomberg Television during which he interviews world leaders, artists, and celebrities. He is also an anchor of "CBS This Morning" and the network's TV news magazine, "60 Minutes."
The women we spoke with said they were prompted to share their stories after other women in the entertainment and media industries spoke up about mistreatment by powerful men, namely the Hollywood producer Harvey Weinstein.
"I grew up watching [Charlie Rose] and thought it was a great opportunity," said one of the women, who interned at "Charlie Rose" in 2005. "It looks great on the résumé. He's revered in the industry and really respected."
They did not report the incidents because they didn't want to harm their chances of getting professional opportunities in the future. They still worry about that. All three women spoke with Business Insider only on the condition that they are provided anonymity because they fear reprisals if they publicly accuse one of television's best-known journalists of improper behavior. Business Insider has also spoken with several other women who say they have stories to tell or whose names have come up while reporting this story but who would not go on the record or elaborate.
"In my 45 years in journalism, I have prided myself on being an advocate for the careers of the women with whom I have worked," Rose said in a statement provided to The Post. "Nevertheless, in the past few days, claims have been made about my behavior toward some former female colleagues.
"It is essential that these women know I hear them and that I deeply apologize for my inappropriate behavior. I am greatly embarrassed. I have behaved insensitively at times, and I accept responsibility for that, though I do not believe that all of these allegations are accurate. I always felt that I was pursuing shared feelings, even though I now realize I was mistaken.
"I have learned a great deal as a result of these events, and I hope others will too. All of us, including me, are coming to a newer and deeper recognition of the pain caused by conduct in the past, and have come to a profound new respect for women and their lives."
A spokesman for Rose declined to add further comment when contacted by Business Insider.
None of the women Business Insider spoke with filed a workplace complaint against Rose. No complaints have been filed against him at New York City's Commission on Human Rights, which is one of the groups that takes complaints about workplace harassment.
But this is not the first time Rose has been accused of inappropriate behavior with women.
In 2007, the entertainment magazine Radar published a story titled "Toxic Bachelors" in which Rose was described as having groped a woman at a dinner party. The story, which refers to the women who produce his show as "Charlie's Angels" prompted a request for a retraction from David Boies, Rose's lawyer at the time. Boies represents other powerful media executives, including Weinstein.
Radar did not retract its story.
Job opportunities
Rose's show is filmed in a studio at the headquarters of Bloomberg LP, the data and news company owned by the former New York mayor Michael Bloomberg. There he can often be seen on his way to and from the TV studio surrounded by a group of often young, attractive women, according to people who have worked there.
Interns' tasks ranged from providing research for Rose for his interviews to greeting guests, getting coffee, and cleaning up after the broadcast, former interns said.
One of the women was interning for the show in the summer of 2010 while she attended college in New York City. She conducted research for Rose's interviews at the headquarters of Bloomberg LP and says he took a liking to her early on.
After an interview with a guest who had come on to discuss international affairs, he would ask what she thought of the interview. Though flattered at the time, seven years later she finds it strange that Rose — who speaks with policymakers and experts — cared what a 21-year-old student thought.
"Looking back, why on earth did he want to talk to a 21-year-old about this?" she said in a telephone interview. "Maybe I was naïve."
When Rose found out that her internship was ending before the summer, he suggested they get lunch to talk about job opportunities. She recalls being ecstatic; the other interns told her that getting lunch with Rose was unusual.
Then, Rose asked to reschedule the lunch to dinner.
"I told my dad that it had turned into a dinner," she said, "and he said, 'Be careful, and don't drink alcohol.'"
At dinner, Rose discussed job opportunities and got a sense of what her ambitions were, she said.
He told her: "I'd like to get a job for you," she said.
Then he offered to have his driver take her back to her dormitory. Once they were in the car, Rose "put his hand on my knee and thigh," she said. She felt uncomfortable, she said, but also thought "maybe it's grandfatherly."
The summer passed, and she reached back out to Rose to discuss a potential job, which he had previously discussed with her as her internship ended.
He emailed her that he'd like to meet with her to discuss the job at his hotel at about 7 or 8 p.m. She didn't see the message until about 10 or 11 p.m., and when she replied at that hour, he responded that she could come see him then.
The woman says she called her parents to ask for advice, and her mother said they should reschedule. She recounted pushing back against her mother's advice at first, thinking she didn't realize how important it was to accommodate a busy man like Rose who could open doors for her professionally.
In the end, she ended up not going to see Rose, and she never heard back from him again.
The woman, who currently does not work in the television industry, said she was unable to retrieve the emails to share them with Business Insider. She declined to put us in touch with her parents.
Meeting at the townhouse
The second woman, ending her internship in 2005, sought Rose out at Bloomberg's headquarters on 59th Street and Lexington Avenue in New York to ask for advice on getting a job at "60 Minutes," which he sometimes hosts.
Rose, who was in his 60s at the time, suggested they get dinner together that night, she said, later asking her to meet him first at his townhouse in Manhattan.
Getting dinner with Rose was certainly out of the ordinary since he had little face time with interns on a day-to-day basis. But Rose and this woman had met for lunch once.
She drove her mother's car from her parents' home in New Jersey, where she was living at the time, to Rose's townhouse in Manhattan. He opened the door to his home in a white bathrobe — like one, she says, that you'd find at a hotel.
"Come in," she remembers him telling her. "I still have to get dressed upstairs."
She felt uncomfortable with the situation but waited for him downstairs while he got dressed.
"He was my dad's age," she said.
Rose drove her in his car to a West Village restaurant that he said he frequented, where they ate dinner and shared a bottle of wine. The woman recounted that when the check came Rose said he couldn't pay the bill because the restaurant accepted only cash. She ended up paying, she said.
As an intern, she was unpaid, a common practice in the media industry at the time. (Rose and his production company settled a class-action lawsuit in 2012 brought by unpaid interns.)
The woman returned to her parents' home that night feeling shaken and recalled what happened, according to her mother, who spoke separately with Business Insider.
But there was no talk of reporting the incident, odd as it was, the mother said.
Asked why, the mother said: "He is a powerful man, and she was an intern. She was very fortunate to have an internship with him. To the extent that he could be helpful, he could also be hurtful."
The woman's conversations with Rose did not lead to a job, and she found a job outside the company after her internship ended shortly thereafter.
'The worst job'
The third woman's incident with Rose occurred when she brought research — also as an intern — to his apartment at the Sherry Netherland Hotel on Manhattan's Central Park. This was during an afternoon in the late winter — February or March — of 2008, she said.
"That was the worst job," she said, because Rose had a reputation among some of the interns of being inappropriate.
When the woman — who was 21 years old at the time — arrived, Rose opened the door wearing nothing but a light-colored bathrobe, which was closed, she said. It appeared that he had just emerged from the shower.
He invited her into his apartment, and she declined. "I was so shocked," she said, recalling the incident. "It was weird because he knew someone was coming over … It made me feel uncomfortable." It was common for interns to deliver Rose research personally to his apartment in the afternoons before the show began taping, multiple people who worked there said. Rose usually was not present at the show before then.
The woman's father told Business Insider that she told him about the experience around the time it occurred nearly a decade ago.
The woman said she had no one to report Rose's misconduct to.
"He was the star of the show," she said. "Who do you go talk to about the star of the show?"
She was also an intern at the time, making any complaint all the more likely that she wouldn't get hired full time. "You need them more than they need you," she said.
The three women who spoke with Business Insider said they did not report their accounts to anyone in charge. Yvette Vega, Rose's longtime executive producer, told The Washington Post that she regretted not supporting the women whose accounts she had heard of.
"I should have stood up for them," Vega told The Post. "I failed. It is crushing. I deeply regret not helping them."
|
Friday, October 31, 2014
In several posts, I have tried to track how successful the ACA exchanges were in steering lower-income buyers of private plans toward silver plans, the only metal level at which subsidies that reduce deductibles and out-of-pocket costs are available. Low-income buyers of bronze plans, which offer low premiums but sky-high deductibles, forfeit access to these Cost Sharing Reduction (CSR) subsidies, which radically reduce costs for those with household incomes under 200% of the Federal Poverty Level and phase out at 250% FPL.
On the whole, the news is good, though information that correlates metal level selection with buyers' income is sketchy. In New York, the only state that breaks out metal level selection by income bracket, 89% of buyers under 200% FPL chose silver plans and so took advantage of CSR. In the federal exchange, only 15% of buyers who qualified for any kind of subsidy bought bronze plans.
Bronze plan selection varies quite a bit by state, however, for reasons that are hard to tease out. For starters, more people on average bought bronze in the 14 states (plus D.C.) that built their own exchanges -- most of which are also among the wealthier states.
State per capita income seems to affect metal level selection. interacting with other factors such as premium prices, the quality of outreach to the uninsured, whether the state expanded Medicaid (which takes out potential buyers between 100 and 138% FPL), and the age composition of the buying pool.*
My thanks to a friendly stranger on Twitter who put together a scatterplot correlating state median income and bronze plan selection. That led me to the latest census data on median household income by state. Below, I've matched it up with HHS state-by-state data on ACA buyers' metal level selections.
For ACA buyers at all income levels, here are the bronze takeup rates for the thirteen highest- and thirteen lowest-earning states:High income states
The wealthier group averaged 25.7% bronze takeup, while the poorer states averaged 17.2%. There are anomalies in both groups -- New Jersey among the wealthier states, Montana among the poorer ones. States with high bronze takeup include a couple where the state online exchange barely functioned -- Hawaii and Maryland -- and one where it functioned quite well, Colorado.
For the 36 states that relied on the federal exchange, HHS breaks out metal level selection for those who qualified for premium subsidies. i.e. buyers with incomes as high as 400% FPL. That's as close as we can get in most states to a glimpse of the percentage CSR-eligible buyers who bought bronze and so forfeited CSR - that is, buyers with incomes under 250% FPL, and under 200% for really strong CSR.
Among the subsidy-eligible in the 36 states on the federal exchange, in descending order of median household income, here are the bronze takeup rates:
While the twelve highest-income states in this group, again, have a higher average bronze takeup rate than the rest, 18.25%, the middle and lower-income group averages are virtually identical, at 15.33% and 15.58% respectively.
There are some real mysteries in these figures. In Mississippi, as I've noted before. the premium price spread between bronze and silver plans was stark, in-person help with the shopping process was in short supply, and the client base was very poor -- yet almost no one selected bronze. Pennsylvania, a middle-income state, had an anomalously low bronze takeup rate, as did high-income New Jersey.
Income interacts with other factors in complex ways. In states with high premiums, like New York, bronze might be a good choice for healthy people with incomes over 200% FPL, as CSR weakens considerably at that level -- and in fact, in New York, silver plan selection drops precipitously to 59% between among buyers with incomes between 200 and 250% FPL. Younger people with some financial cushion -- a few thousand dollars in savings, or parents with means -- might be more inclined to gamble on bronze -- two or three thousand dollars in extra out-of-pocket costs might be at stake in a given year. New York has a lot of wealthy people and a lot of poor people and is in fact a middle income state. It had a bronze plan selection rate close to the mean and platinum plan takeup way above it (13%, as opposed to a 5% national average).
My inferences thus far are that 1) in wealthier states, more people have more options, and a higher level of bronze takeup may be appropriate, 2) in many though not most poor states, a heartening percentage of buyers chose silver plans, and 3) overall, given the balkiness of the online exchanges and the scarcity of in-person help,a large majority seem to have made the right choice at least of metal level. I'll continue to explore this.
-----
* Some factors appear to matter less than meets the eye. Metal level selection doesn't vary much by age. Some states with vigorous outreach had very high bronze selection, while some in which buyers were largely left to their own devices -- e.g., Mississippi, had very low bronze takeup.
|
Lyrics List
Plot
In Srinagar, a Kashmiri terrorist, Wasim Khan is arrested by a team led by Colonel Rayappa (Nassar). In South India, Roja (Madhoo) is a simple village girl born and brought up in Sundarapandianpuram in Tirunelveli district in southern Tamil Nadu. Roja fervently wishes that her sister's (Vaishnavi) marriage proposal with Rishi Kumar (Arvind Swamy), a top cryptologist working with the Indian government, goes smoothly. Unknown to her and her family, Roja’s sister is in love with the son of her paternal aunt.
When Rishi wishes to speak to Roja’s sister alone, she gathers enough courage to convey this and politely asks him to reject her in front of her parents, to which he obliges. To everyone’s surprise Rishi requests Roja's hand in marriage instead. Being unaware of her sister's love affair, Roja is not willing to accept Rishi's proposal as she believes that he is the best match for her sister but she marries Rishi, and the couple go to live in Madras while her sister is married to her aunt's son.
Initially Roja does not like what Rishi did, but when she learns of her sister's love affair and consequent rejection of Rishi, she apologizes and starts seeing him in a new light. Love blossoms, and life is blissful for the couple for a short while. Meanwhile, Rishi is assigned a posting at an army communications center in Kashmir. The couple find themselves in a beautiful yet alien land. Roja's world turns upside down when Rishi is abducted by terrorists whose agenda is to separate Kashmir from India and to free their leader Wasim Khan from judicial custody.
Faced with the daunting task of rescuing her husband, Roja runs from pillar to post, pleading with politicians and the military for help. Further complicating matters is the communication gap: She can't speak their language, and they can't speak hers. Meanwhile Rishi, held captive by a group of terrorists led by Liaqat (Pankaj Kapur), tries to reason with them. Liaqat’s sister shows a little compassion towards him. Initially, when Roja’s efforts fail, the Indian government denies any negotiations with the terrorists for the release of Rishi in the media.
The angered terrorists burn an Indian flag. Rishi risks his life to put out the fire and shows the terrorist how much the country means to him, a regular citizen. When Liaqat’s younger brother, who with few other youths from his village are sent across the border to Pakistan for training, is shot down by the Pakistan Army, Liaqat’s strong belief is shaken, but he still manages to convince himself of the cause. Consequently, Roja’s efforts to apprise the politicians of her suffering and pain are successful as a minister pities her and offers to help.
Much to the chagrin of Colonel Rayappa, the government decides to release Wasim Khan in exchange for Rishi. Rishi, not wanting to be used as a pawn to release a dangerous terrorist, gets help from the sympathetic Liaqat’s sister and escapes — with Liaqat and his men chasing him. Colonel Rayappa, Roja and other Army officers get to the hostage exchange spot with Wasim Khan, but Liaqat doesn’t show up. This leads Roja to think that Rishi is dead.
Rishi has managed to get close to the exchange spot on his own after evading the terrorists. Liaqat catches up with him and holds him at gun point. Rishi reasons with Liaqat further and convinces him that his war is immoral. Liaqat lets Rishi go and he goes to the exchange spot. Rishi and Roja are united once again.
DMCA: All song lyrics listed in the site are for promotional purposes only. We do not provide mp3 songs as it is illegal to do so. If you like any of the songs lyrics, you can buy the CDs directly from respective audio companies. TamilPaa.com does not sell or monetize on the songs by any means. All the rights are reserved to the audio company / recording studios. TamilPaa.com hold no responsibility for any illegal usage of the content. For any queries, you can email to info[at]tamilpaa.com. Once we get any DMCA complaint regarding the LYRICS we have in our website, we take them down in 24 hours period.
|
Indigenous chicken production in Kenya: II. Prospects for research and development
Poultry production and in particular indigenous chicken (IC) production has been recognised as an avenue to improve livelihoods of the rural households. Previous attempts to improve their productivity have had little success due to, among others, lack of a holistic approach in solving the constraints and dissemination of inappropriate technologies given the production circumstances and market dynamics.
Marketing as a constraint is often blamed for the failure of interventions to improve livelihoods, despite lack of saturation for IC products at local and national levels and the increasing demand for the same. This paper highlights the past improvement attempts and suggests strategies to improve IC productivity and thereby improve the livelihood of the rural households which are the custodians of these genetic resources.
It is concluded that there is potential for improvement of IC production in Kenya given the available genetic and physical resources. However, a holistic strategy that increases productivity without increasing production costs or leading to loss of biodiversity must be developed. Such a strategy must take into account the various uses of the IC in a rural household.
|
Our Different Realities
Reality is different for different people because we all experience life differently. Our faith, choices, desires, and longings are based on multiple parameters of individual and social existence. Human beings experience major emotions such as love, lust, anger, satisfaction, humour differently, and this has a lot to do with the major influences we have had while growing up.
For example, a child that has been continuously bullied by his classmates in his school will experience self-esteem in a completely different way in comparison to the popular kid. In such scenarios, we all need to posses the skill of empathy and sympathy to understand background of diversity of thoughts and perceptions of people.
We should often encourage people to practice authenticity for the collective growth of the humanity. When people are in perpetual state of identity and emotional crisis, they have a tough time expressing their thoughts and emotions. Such a sense of self-doubt leads to a feeling of alienation and isolation. In a new researched data, migrated people are more prone to depression because they have a tough time adjusting in a new way of life wherein they have to explain their worth as a foreigner to every native citizen.
No religion or culture is larger than life, and instead of distinguishing people on the basis of their faith, we should rather learn to see them as people with different realities and accept them with an open mind.
Our learned behaviour and constant cultural conditioning creates a psychological barrier in accepting realities that differ from ours, but with a bit of conscious effort we can shed our conditioned mind and adapt a whole new one.
Shared understanding of diversity of people and their expectations from life helps us all in living a harmonious life free of discrimination and unconscious biases.
|
Migraine Types
A cephalalgia may be a cacophonic headache that simply looks to line in apparently because of no reason in the slightest degree. the explanations for a cephalalgia square measure principally vascular . which means that bound changes within the blood vessels that provide blood to the brain trigger of the pain. Of course, the causes for the changes within the blood vessels could vary from person to person however this can be typically however it starts.
Migraines have a powerful impact on the standard of a person’s life. It affects not solely the person however additionally the lives of these World Health Organization move in shut contact with he person. cephalalgia attacks will thusme times be so severe that person could got to abandon his or her routine activities for 3 or four days at a stretch.
Types
Migraines square measure classified per the symptoms they turn out. the 2 most typical sorts square measure cephalalgia with aura and cephalalgia while not aura. Less common sorts embody the following: artery cephalalgia, Carotidynia, Headache-free cephalalgia, Ophthalmoplegic cephalalgia, standing cephalalgia.
Some girls expertise cephalalgia headaches simply before or throughout menses. These headaches, that square measure referred to as discharge migraines, is also associated with secretion changes and sometimes don’t occur throughout maternity. different girls develop migraines for the primary time throughout maternity or once change of life.
Abdominal cephalalgia is additionally called periodic syndrome that is common among youngsters. It usually happens to those have it in their heredity and this sort could cause a classic cephalalgia.
Basilar cephalalgia, additionally referred to as Bickerstaff’s syndrome, usually affects adolescent girls. this happens once cephalalgia obstructs the circulation the rear a part of the neck or brain.
Another kind is that the sophisticated cephalalgia that typically happens with extended aura that will last for variety of hours or may reach to few days.
Hemiplegic cephalalgia is that the rarest among all kinds however one in all the foremost severe. Its symptoms embody temporary dysfunction of the motor perform and obstructions within the sensory system on an exact facet of the body.
|
Predictive value of fibrinolytic factors in coronary heart disease.
An impaired fibrinolytic function, as evidenced by increased plasma concentrations of PAI-1, tPA antigen and tPA/PAI-1 complex, or a decreased capacity to release active tPA on exercise, is more common in individuals suffering from myocardial infarction. These factors, especially the tPA/PA-1 complex, also predict myocardial infarction in patients with manifest coronary heart disease, such as angina pectoris or a previous myocardial infarction. There is a highly statistically significant correlation between tPA/PAI-1 complex and both PAI-1 and tPA antigen. It is important to test these factors in prospective studies on healthy individuals.
|
ILLINOIS OFFICIAL REPORTS
Appellate Court
People v. Wright, 2012 IL App (1st) 073106
Appellate Court THE PEOPLE OF THE STATE OF ILLINOIS, Plaintiff-Appellee, v.
Caption HARVEY WRIGHT, Defendant-Appellant.
District & No. First District, Sixth Division
Docket Nos. 1-07-3106, 1-07-3464 cons.
Filed March 30, 2012
Held Defendant’s conviction for aggravated criminal sexual assault based
(Note: This syllabus primarily on a cold-case DNA match was reversed and the cause was
constitutes no part of remanded for a new trial on the ground that the trial court abused its
the opinion of the court discretion in denying defendant’s motion to require the Illinois State
but has been prepared Police to conduct a nine-loci database search to determine the number of
by the Reporter of nine-loci DNA matches in its offender database, especially in view of the
Decisions for the conflicting evidence concerning the DNA analysis employed in
convenience of the defendant’s case.
reader.)
Decision Under Appeal from the Circuit Court of Cook County, No. 04-CR-16608; the
Review Hon. John J. Fleming, Judge, presiding.
Judgment Reversed and remanded with directions.
Counsel on Michael J. Pelletier, Patricia Unsinn, and Scott F. Main, all of State
Appeal Appellate Defender’s Office, of Chicago, for appellant.
Anita M. Alvarez, State’s Attorney, of Chicago (James E. Fitzgerald,
Mary Needham, and William L. Toffenetti, Assistant State’s Attorneys,
of counsel), for the People.
Panel PRESIDING JUSTICE R. GORDON delivered the judgment of the court,
with opinion.
Justice J. Gordon concurred in the judgment and opinion.
Justice McBride dissented, with opinion.
OPINION
¶1 This is a case of first impression. This case involves a criminal defendant’s pretrial
motion for a DNA database search. As far as we know, this is the first case to review a trial
court’s denial of a motion governed by section 116-5 of the Illinois Code of Criminal
Procedure of 1963, the Illinois statute that permits criminal defendants to seek pretrial DNA
database searches. 725 ILCS 5/116-5 (West 2006). In addition, “Illinois is one of the few
states in the nation to provide a statutory framework” for a criminal defendant who seeks
pretrial access to the state’s DNA database. Erin Murphy, The New Forensics: Criminal
Justice, False Certainty and the Second Generation of Scientific Evidence, 95 Calif. L. Rev.
721, 790-91 (2007). Compare with State v. Dwyer, 2009 ME 127, ¶ 16, 985 A.2d 469 (since
there is no specific statute in Maine authorizing pretrial DNA database searches, a pretrial
search motion was decided solely on general evidentiary principles).
¶2 Defendant Harvey Wright was prosecuted almost entirely on the basis of a cold-case
DNA match. He was convicted of aggravated criminal sexual assault after a jury trial and
sentenced to life in prison, although the victim could not identify him as the perpetrator, and
there was no other physical evidence linking him to the crime.
¶3 Two DNA samples were recovered: from the victim’s underwear and from the victim’s
rectal swab. The State’s forensic expert testified that only the rectal sample yielded a “match”
to defendant’s DNA. However, the analysis of the rectal swabs was done on the basis of only
9 loci, instead of the more standard 13 loci. For the underwear, the analysis was done on the
basis of 13 loci; but from the analysis of the underwear, the expert could not find a “match”;
he could conclude only that defendant could not be excluded as a contributor.
¶4 On appeal, defendant claims that the trial court erred by denying his pretrial motion to
have the Illinois Department of State Police determine the number of nine-loci DNA matches
in its offender database. Defendant also makes several other claims, including that the State
failed to prove beyond a reasonable doubt that defendant “acted in such a manner as to
threaten or endanger the life” of the alleged victim. 720 ILCS 5/12-14(a)(3) (West 1998). In
-2-
its appellate brief, the State concedes: “The People agree that they failed to prove beyond a
reasonable doubt the aggravating factor alleged.”
¶5 For the reasons stated below, we find that the trial court erred, and we reverse and
remand for a new trial.
¶6 BACKGROUND
¶7 1. Defendant’s Pretrial DNA Motion
¶8 On June 12, 2006, defendant moved to exclude any DNA evidence obtained from the
State’s analysis of the victim’s rectal swabs. Defendant’s motion stated that the analysis of
the rectal swabs was done on the basis of only 9 loci and DNA analysis is typically done on
the basis of 13 loci. His motion stated that, normally, “two kits” are used “to develop the
DNA profile,” and the two kits are called “Profiler” and “Cofiler.” Profiler develops “nine
locations on the human genome, and Cofiler can develop the four additional locations
necessary in developing a full profile.” Defendant’s motion stated that, “[a]ccording to the
paperwork in the case file,” the DNA extracted from the rectal swabs was quantified and
amplified using both Profiler and Cofiler, but “there [are] no electronic data or paper
printouts from any Cofiler” runs.
¶9 Defendant’s motion stated that Michael DeFranco, the forensic scientist who extracted
the DNA from the rectal swabs, left the employ of the Illinois State Police, and Edgar Jove,
the new scientist assigned to the case, “noticed this discrepancy in the Cofiler materials, and
decided to get the DNA extract in the case to reamplify the DNA in Cofiler for the rectal
swabs.” However, Jove “located the tube where the extract should have been, and there was
nothing in the tube.” Later at trial, Jove testified that there were no rectal swabs left to test,
because “[a]ll four swabs were consumed in the original extraction.”
¶ 10 Defendant moved to exclude the DNA evidence from the rectal swabs, pursuant to
Illinois Supreme Court Rule 417(b)(i) (eff. Mar. 1, 2001), which requires the proponent of
DNA evidence to provide to the adverse party copies of “the case file,” including all reports
and data relating to the testing performed. Since the State failed to produce the data from
DeFranco’s Cofiler testing of the rectal swabs, defendant sought to exclude any DNA
evidence obtained from the rectal swabs.
¶ 11 In the alternative, defendant’s motion asked that, if the trial court ruled to admit the nine-
loci evidence, then it should order the State to determine how many nine-loci “matches there
are in [the State’s] convicted database.” In support of his alternative argument, defendant
cited an Arizona study, stating:
“[A] recent examination of Arizona’s convicted offender database revealed 120 nine
location matches between two inmates in a database of 65,493 offenders. In other words,
in Arizona there is a 1 in 700 chance that two individuals will match up at nine
locations.”
Defendant argued that in order to have “a match,” the samples had to match at 13 loci and
that anything less was not a match. Defense counsel stated that, “to [their] knowledge, no
study has been performed to determine how many nine loci matches are present in the Illinois
-3-
database.” Defendant asserted that “[p]erforming such a study would give perspective to the
strength of the partial profile match developed in this case” and would support defendant’s
argument that a 13-loci analysis was required.
¶ 12 In his motion, defendant did not ask for the names, addresses, or any identifying
information for any DNA profiles that matched his profile at nine loci in the State’s offender
database. Defendant asked only for the number of profile pairs that were the same at nine
loci.
¶ 13 In its response to defendant’s motion, the State claimed: “The State has much more
evidence against the Defendant than this one swab, including [1] a swab from the Victim’s
underwear that matches the Defendant at all 13 loci, and [2] additional testing is currently
underway on swabs that were taken from the Victim’s vaginal area.”
¶ 14 Contrary to what the State asserted in its response, one of the State’s forensic experts at
trial testified that the DNA from the victim’s underwear was not a match to defendant’s
DNA. As will be discussed more fully below, the expert could conclude only that defendant
could not be excluded as a contributor. At trial, the State explained that, even though 13 loci
were considered with respect to the underwear, the sample did not yield “a full profile.” He
testified that the sample yielded only “some of the loci.” In addition, for some of the loci, the
expert found that there were “different possibilities.” The expert testified that, by using “all
possible combinations for that particular area of the DNA,” he found that “[a]pproximately
one in 5 point 4 quadrillion black, one in 4 point 3 quadrillion white, or one in 66 quadrillion
Hispanic unrelated individuals cannot be excluded as the male contributors.” At trial, the
State’s expert observed that these numbers were much higher than the population of the
earth. In addition, contrary to the State’s prediction about the vaginal swab, one of the State’s
experts at trial testified that analysis of the victim’s vaginal swabs did not yield a male DNA
profile.
¶ 15 The State’s response also claimed that defendant had failed to provide it with a copy of
the Arizona study and that Illinois Supreme Court Rule 417 (eff. Mar. 1, 2001) did not apply
to the case at bar, because it went into effect on March 1, 2001, which was after the date that
tests on the rectal swabs and underwear were performed. As noted above, Rule 417(b)(i)
requires the proponent of DNA evidence to provide to the adverse party copies of “the case
file,” including all reports and data relating to the testing performed. Ill. S. Ct. R. 417(b)(i)
(eff. Mar. 1, 2001). Since the State failed to produce the data from DeFranco’s Cofiler testing
of the rectal swabs, defendant sought to exclude any DNA evidence obtained from the rectal
swabs.
¶ 16 On August 18, 2006, defendant filed a “supplemental” motion. In this response,
defendant argued that Rule 417 applied because the case was still in the pretrial stage.
Defendant also stated that he had previously provided a copy of the Arizona study to Edgar
Jove, the State’s DNA expert. In addition, defendant attached a copy of the five-page Arizona
report. The report is entitled “9+ Locus Match Summary Report,” and it states that it was
prepared as a special report by the Arizona Department of Public Safety, pursuant to court
order. The study lists matches, match by match, that occurred at 9, 10, 11 and 12 loci. The
report states that the matches that occurred at 11 and 12 loci are siblings. The report states
-4-
that any relationship between the 9-loci matches and the 10-loci matches “has not been
determined.” The report lists each individual pair that matched, with identifying numbers for
each one in the pair.
¶ 17 The report lists: 122 pairs that matched at 9 loci; 20 pairs that matched at 10 loci; only
1 pair that matched at 11 loci; and only 1 pair that matched at 12 loci. The grand total was
144 matches. Subtracting the siblings that matched at 11 and 12 loci leaves a total of 142
matches.
¶ 18 On February 8, 2007, the trial court heard argument on defendant’s motion. Defense
counsel informed the court, “[b]asically, your Honor, we will just go on the pleadings.”
Concerning the nine-loci match, defense counsel stated: “[W]e have to seem to learn [sic]
that 9 loci matches are not completely uncommon, this would deprive [defendant] of a fair
trial, particularly because this is the only evidence against him, this 9 loci match.” The
prosecutor immediately responded with “[t]hat’s not true,” and the trial court interjected:
“All right. I read the motion.” The trial court then stated that defendant’s “motion to exclude
evidence based on the destruction of evidence” was denied. Defense counsel then pointed
out that there were two filings, so that “the Appellate Court will know” defendant intended
to discuss both on appeal. The filing on June 12, 2006, set forth both the motion to exclude
and the argument in the alternative for a database search; and the supplemental filing on
August 18, 2006, which responded to the State’s arguments and provided the full Arizona
report. The trial court indicated that it had read both documents and that its ruling included
both.
¶ 19 After his motion was denied, the defense strategy switched to a consent defense.
Defendant had previously filed an answer to the State’s discovery request, and his original
answer, filed on June 12, 2006, did not allege a consent defense. However, after the trial
court’s ruling, defendant amended his answer, on June 25, 2007, in order to include a consent
defense. His counsel later argued a consent defense in both his opening and closing
statements at trial.
¶ 20 2. State’s Evidence at Trial
¶ 21 The four-day trial began on June 25, 2007, with jury selection and ended with a verdict
of guilty on June 28, 2007. At trial, the State called 11 witnesses. The first witness was the
victim, age 24 years old, who had been only 15 years old at the time of the offense and who
was unable at trial to identify defendant as the perpetrator. Although the victim was 15 years
old at the time of the offense, the State’s indictment of defendant made no charges relating
to the victim’s age.
¶ 22 Five of the State’s witnesses were DNA forensic scientists: (1) Therese Biogard, who
received from the Chicago police a buccal swab kit1 for defendant and who took actions to
preserve the DNA material; (2) Jamie Gibson, who generated a DNA profile from the
1
Officer Thaddeus Hajduk, who obtained the buccal sample from defendant, testified at trial
concerning what a buccal sample is: “A buccal sample is obtained on two Q-tips by rubbing the
inside of your mouth and obtaining saliva and then is submitted for analysis.”
-5-
material recovered from defendant’s buccal swab; (3) Brian Schoon, who testified that his
analysis of the victim’s vaginal swabs did not yield a male DNA profile although semen was
present; (4) Michael DeFranco, who generated DNA profiles from the material recovered
from the victim’s underwear, rectal swabs, and blood standard; and (5) Edgar Jove, who
compared the DNA profile generated for defendant with the DNA profiles generated from
the samples recovered from the victim’s underwear and rectal swabs.
¶ 23 The State’s remaining witnesses were: (1) Angela Halpin, the emergency room nurse who
examined the victim immediately after the offense and completed a rape kit; (2) Officer
Richard Samanas, the evidence technician who retrieved the completed rape kit from the
hospital; (3) Officer Thaddeus Hajduk, the evidence technician who obtained the buccal
sample from defendant; (4) Detective Kupczyk, who interviewed the victim; and (5)
Argentry Dean, the security guard at the bus station whom the victim approached after the
offense.
¶ 24 The parties entered into two stipulations, which were read to the jury as part of the State’s
case-in-chief. First, the parties stipulated that Jennifer Schultz, a forensic DNA scientist,
received the victim’s rape kit, which contained the victim’s underwear and blood standard,
and her vaginal, oral and rectal swabs. If called as a witness, Schultz would testify that semen
was found on the underwear and on the vaginal and rectal swabs but not on the oral swabs.
Schultz would further testify that “she preserved these swabs for future DNA analysis.”
Second, the parties stipulated to defendant’s address on October 12, 1998.
¶ 25 3. Victim’s Testimony
¶ 26 The victim, who could not identify defendant as the perpetrator, testified about the
following events during her direct examination at trial. At the time of trial, she was 24. When
she was 15 years old, she traveled with her mother and sisters by automobile to visit her aunt
in Iowa. However, when they returned to New York, they left without her. She stayed in Iowa
and later returned by Greyhound bus on September 26, 1998. She was en route by bus from
Iowa to New York, when she had a two-hour layover in Chicago, starting at approximately
9 p.m. At the Chicago bus station, she approached strangers asking where she could buy a
snack, when a man told her to follow him.
¶ 27 The victim testified that she walked with the man, out of the station for a number of
blocks to his apartment, which was on the first floor of a two-family house. The walk lasted
about a half-hour. At the house, a woman in the living room was watching television, and
the victim walked past the woman and followed the man into a bedroom. The victim said
nothing to the woman as she walked past, and the man closed and locked the bedroom door
behind them. In the bedroom, she had vaginal sex twice and oral sex twice with the man.
¶ 28 The victim testified that the man then walked her back to the bus station, where he asked
a security guard when the next bus to New York was leaving. At that point, she said nothing
to the security guard. After the guard informed the man that the next bus to New York was
leaving in an hour, she followed the man outside to an alley, where they had vaginal
intercourse again. As he was putting his clothes back on, she ran from him, leaving her travel
bag behind in the alley. She had carried her travel bag to his apartment and back to the bus
-6-
station, but she left it in the alley. When she entered the bus station, she approached the same
security guard who had previously spoken with the man, and she told him that “the guy I was
with” had raped her. She testified that none of the sexual acts had been consensual.
¶ 29 The victim testified that when the police arrived, she told them what had happened and
they took her to a hospital emergency room, where she was examined by a doctor and a
nurse. The examination included swabs of her vagina, mouth and rectum. The victim also
informed the nurse what had happened. The victim also testified that she had washed her
underwear “a couple of days before that” night. After the hospital examination, police
officers drove her around, but they could not locate the man’s residence. They did locate the
alley. Eventually, she boarded a bus and returned home.
¶ 30 The victim testified that, years later, in May 2004, she met in Brooklyn with a Chicago
police detective and an assistant State’s Attorney. Concerning the perpetrator, she testified:
“I just remember a scar he had on his face. I don’t even remember what he really looked like.
I just try to black it out. It was so many years ago.”
¶ 31 On cross-examination, the victim testified that she did not return to New York with her
mother and sisters because she “went to hang out with an ex-boyfriend and a couple of
friends.” She left her aunt’s house and did not tell anyone where she was going. She stayed
in Iowa, because she was having problems with her mother. She admitted that she had run
away a lot. After she returned to her aunt’s house, her aunt told her that she had to leave
because she refused to follow her aunt’s rules.
¶ 32 On cross-examination, the victim admitted that, before she first spoke to the perpetrator,
a woman at the train station informed her that there was a grocery store nearby, at a college.
The victim had previously relayed this information to the detective. The victim testified that
she left the bus station, because “there was like no junk food, stuff that I wanted.” However,
she admitted that she thought there was a restaurant and vending machines at the bus station.
She testified that she was looking for “[j]ust a grocery store.” She thought that she had left
the bus station and started walking toward the university, when the perpetrator approached
her. She told him what kind of junk food she wanted and he told her he would take her to a
store.
¶ 33 4. Testimony by DNA Comparison Expert
¶ 34 Edgar Jove testified that he was a “DNA group supervisor” at the Illinois State Police
Forensic Science Center in Chicago, where he had been employed over 11 years. After the
prosecutor stated that he was “tender[ing] the witness as an expert in the field of forensic
DNA analysis,” the trial court offered defense counsel an opportunity to question the expert
which counsel declined. The trial court then stated “okay” and the State’s questioning
resumed.
¶ 35 On direct examination, Jove testified that he made two comparisons in the case at bar.
Specifically, he compared DNA data recovered from defendant’s buccal swab with DNA
data recovered from (1) the victim’s underwear and (2) the victim’s rectal swabs.
¶ 36 Jove testified that, in making his comparisons, he utilized data generated by other
forensic scientists employed by the Illinois State Police. He received the notes and the DNA
-7-
profiles generated by Michael DeFranco, a previous DNA analyst, before DeFranco left the
employ of the Illinois State Police. This DNA data included data from the victim’s blood
standard, her rectal swabs and her underwear, which had been processed by DeFranco in
approximately 1998. Jove testified that he also received DNA data from defendant’s buccal
swab, which had been processed by Jamie Gibson, another forensic scientist.
¶ 37 Jove testified generally about DNA analysis, explaining that if there is “enough DNA,
we look at 13 different areas of DNA” or loci. To identify all 13 loci, a scientist “run[s] two
systems.” He explained that “[t]he first system has nine different areas of the DNA, plus
another area that will determine the sex of the donor, and then the second system will have
four areas of the DNA.”
¶ 38 In the case at bar, Jove testified first about DNA recovered from the victim’s rectal
swabs, and then about DNA recovered from the victim’s underwear. For the victim’s rectal
swabs, the notes that Jove received from DeFranco provided results only from the first
system, and thus provided only 9 loci, rather than the full 13 loci. Jove testified that, in his
opinion, the second test had simply never been run on the rectal swabs. (However, on cross,
Jove admitted that he was not certain whether the second test had never been run or whether
the data from the test had been destroyed.)
¶ 39 Jove testified that the victim’s rectal swabs contained DNA from two individuals, one
male and one female. Jove stated that it was common to find the victim’s own DNA on her
own rectal swab. Jove testified that “[a]ssuming the mixture of human DNA profile
identified in the rectal swab is a mixture of [the victim’s] and one other individual, a male
[nine-loci] DNA profile was identified which matches the DNA profile of [defendant]
Harvey Wright.” Jove testified that the frequency with which he would expect to see this
nine-loci male DNA profile occurring in the general population was “approximately one in
420 trillion black[s], one in 670 trillion white[s], or one in 2 point 9 quadrillion Hispanic
unrelated individuals.”
¶ 40 Jove did not testify whether, to generate these numbers, he used the FBI’s database, the
Illinois database, some combination of the two, or some other population database altogether.
Compare In re Jessica M., 399 Ill. App. 3d 730, 748 (2010) (“but one database is used” in
Illinois “to identify or exclude potential suspects or offenders as well as for random statistical
probability calculations”), with Dwyer, 2009 ME 127, ¶ 15, 985 A.2d 469 (in Maine, DNA
probability calculations are produced by “ ‘using FBI population studies,’ ” as well as
“ ‘limited information from the Maine database’ ”).
¶ 41 Jove testified next about the DNA recovered from the victim’s underwear, stating that
this DNA was a mixture from three people. There was a greater amount of DNA from two
of the three people than from the third. Of the two major contributors, one was a female and
one was a male. However, Jove could not identify the gender of the third and minor
contributor, and this third profile was too “limited” to make any comparisons. Concerning
the DNA recovered from the underwear, Jove testified “[a]ssuming [the victim] is one of the
major human DNA profiles, an additional male human DNA profile was identified from
which [defendant] Harvey Wright cannot be excluded.”
¶ 42 On direct examination, Jove clarified that, while he had used the term “match” with
-8-
respect to the 9-loci analysis on the rectal swab, he could not reach that same conclusion with
respect to the 13-loci analysis on the underwear. With the underwear, Jove could conclude
only that [defendant] Wright could “not be excluded”; however, there was no match.
¶ 43 During cross-examination, in response to a question asked by the trial court, Jove
indicated that, in his experience, he had never seen a nine-profile match that was not
accurate. The trial court then barred defense counsel from asking any follow-up questions
about the Arizona study, which had been provided to Jove prior to trial and which had
revealed over a hundred pairs of nine-loci matches:
“THE TRIAL COURT: –is there a possibility that by running those other, the second
part of the test, that the result would have been different? Could he have been excluded?
JOVE: In my experience, I haven’t seen–in my casework, I haven’t seen a nine loci
match at the profiler system, the first system, and then have an exclusion. I haven’t seen
that in my casework.
DEFENSE COUNSEL: Okay. You were interviewed by attorneys from our office
regarding this case?
JOVE: Yeah.
DEFENSE COUNSEL: Okay. You were interviewed by an attorney named Andrew
Northrup.
JOVE: Yes, I was.
DEFENSE COUNSEL: Mr. Northrup gave you a study from the Arizona database–
PROSECUTOR: Objection.
DEFENSE COUNSEL: –regarding the nine loci matches.
THE COURT: I believe we’ve had motions in limine on this issue.”
¶ 44 During cross-examination, Jove testified that, when he discovered that the second test
had not been run on the rectal swabs, he examined the tube which had contained the swabs
to see if there was any liquid left to test. Jove testified that, according to the last analyst who
stored the tube, there was DNA left in the tube. But when Jove found the tube, it was empty.
However, Jove admitted that it was possible that he could have added some sort of liquid or
other medium to the tube to determine if there was additional DNA left and that he did not
do that.
¶ 45 During cross-examination, Jove testified that the third contributor to the underwear stain
could have been male. On redirect examination, the prosecutor elicited that the DNA from
the third contributor could have been there for weeks, if the underwear had not been washed.
¶ 46 5. Conviction, Posttrial Motions and Sentencing
¶ 47 On June 27, 2007, the State rested, and the defense rested without offering evidence.
After listening to jury instructions, the jury went home for the day. On June 28, after hearing
closing arguments from both sides, the jury found defendant guilty of “aggravated criminal
sexual assault, oral” and “aggravated criminal sexual assault, vaginal.”
¶ 48 On July 26, 2007, defendant filed a posttrial motion for a new trial, followed by a
-9-
supplemental motion on October 15, 2007. In the supplemental motion, defendant claimed
that the trial court had erred in denying his motion relating to the “destruction of [DNA]
evidence in violation of Supreme Court Rule 417.” On October 15, 2007, the trial court
denied defendant’s posttrial motions for a new trial and sentenced defendant to natural life
in prison, without parole. Defendant’s motion to reconsider sentence was denied on October
29, 2007, and a notice of appeal was filed on October 30, 2007.
¶ 49 On November 2, 2007, defendant filed a pro se motion entitled: “A Add On Motion for
a New Trial.” With respect to the DNA motion, the pro se motion stated:
“8. Defendant states there were two DNA samples found on the victim. But the police
nor the state’s attorney tried to find out where this other sample came from. The state
also failed to preserve these samples for testing. For the defense, be it intentional or not,
the state has the obligation to prove innocence or guilt, citing State v. Mitchell, 140 Ariz.
551.
***
13. Defendant states that trial counsel [name] was ineffective when he refused to
have the DNA Andrew Northup, who wrote the motion to suppress the DNA evidence,
to appear in court to explain his own reasons for filing the motion. Had Andrew Northrup
would have argue [sic] his own motion, things would have been different.
14. Defendant states that trial counsel [name] was ineffective when he refuse [sic] to
have a [sic] independent DNA test done, after defendant advised attorney that there was
some misconduct on the part of Detective Kupczyk and the state attorney when handle
[sic] the initial arrest on 4-6-2003 which lead up [sic] to this cause. I also informed trial
attorney that this issue has never been addressed. Had attorney would have did [sic] so,
defendant[’s] trial would have been different.”
On November 14, 2007, the trial court denied defendant’s pro se motion for a new trial.
Although the trial judge stated that he did not believe that defendant’s motion had
sufficiently alleged claims of ineffective assistance of counsel, the judge stated that he was
“going to deny it as being late.” A second notice of appeal was subsequently filed on
December 4, 2007. The appellate court then consolidated the two appeals on November 7,
2008, and this consolidated appeal followed.
¶ 50 6. Supplemental Record
¶ 51 On page 23 of the appellate brief filed by the State Appellate Defender on defendant’s
behalf, defendant stated that a “test was run by the Illinois State Police in People v. Juan
Luna, No. 02 CR 15430” to determine the number of entries in its offender database that will
appear identical at only 9-loci, and that this test found 903 pairs occurring at 9 or more loci,
out of the 220,456 offender profiles. On December 31, 2009, this court ordered defendant
to supplement the record “with the portions of the Luna record which will substantiate” the
statement in his appellate brief about the prior search of the Illinois database. See People v.
McKown, 226 Ill. 2d 245, 258-59 (2007) (permitting an appellate court, when evaluating a
trial court’s ruling concerning scientific evidence, to consider scientific information outside
of the existing record). The State made no objection to this order.
-10-
¶ 52 On January 8, 2010, defendant supplemented the appellate record with (1) the evidentiary
deposition of Donald Parker, the administrator of the Illinois DNA offender database, who
was responsible for the search of the Illinois offender database in August 2006 for nine-loci
pairs; and (2) the trial testimony of defense expert Karl Reich and State expert Ranajit
Chakraborty, who analyzed the findings of the nine-loci test run by the Illinois State Police.
The evidentiary deposition occurred on October 17, 2006, and the trial testimony occurred
in May 2007.
¶ 53 Parker, the administrator in charge of our state’s offender database, testified at his
deposition that, in his opinion, “[i]f it doesn’t match across the thirteen loci, then it’s not a
true match.” Parker stated repeatedly that nine-loci comparisons are “not true matches” and
that “[i]t’s misleading to call them matches.” Parker testified that he started with the Illinois
State Police as a forensic scientist trainee in April 1995, and then he rose through the ranks,
until he became the administrator of the state’s DNA offender database in 2005. His
educational background was in microbiology, and he received training and classes in DNA
analysis and statistics from the State Police. In 1997, he was selected by the directors of the
Chicago crime forensic science center to be part of the State’s validation team to analyze a
new type of DNA analysis, namely, STR testing. Parker was part of the group that published
an article on the team’s results in the Journal of Forensic Sciences. Parker testified that he
had been qualified many times in court as an expert in DNA analysis. When he “testified in
court, it [was] to give a probability or an odds to a profile.”
¶ 54 Parker testified that, in response to an order by the trial court in the Luna case, he ran a
search of the Illinois database to determine how many pairs of matches it contained at only
nine loci. Parker was aware that the defense request in the Luna case was based, in part, on
a similar search that had been done of the Arizona database. At the time of the Luna search,
the Illinois database contained 220,456 DNA profiles, and all the profiles contained 13 or
more loci. The database search revealed 903 pairs of individuals who matched at only 9 loci.
In other words, 1,806 individuals had the same alleles at 9 loci as at least one other
individual in the database. Parker testified that “[i]f you look[ed] at the further loci, they
would be considered nonmatches.” In other words, after the “match” at nine-loci, a further
review of the other four loci on each individual would show that there was really no match.
¶ 55 ANALYSIS
¶ 56 On this direct appeal, defendant makes several claims. He claims that the trial court erred
(1) by failing to order the Illinois State Police to determine the number of nine-loci matches
in its offender database; (2) by barring defense counsel from asking the State’s DNA expert
any questions about a similar search of the Arizona offender database; (3) by admitting the
victim’s out-of-court statements recounting the alleged offense to a nurse; and (4) by
admitting a photograph of another alleged victim of a sexual assault by defendant. Defendant
also claims that the prosecutor committed misconduct by telling the jury that “the State
knows the defendant is guilty.” Defendant also asks us to remand, on the ground that the trial
court failed to inquire adequately into defendant’s pro se claims of ineffective assistance of
counsel.
-11-
¶ 57 Last but not least, defendant asks this court to reduce his conviction from aggravated
criminal sexual assault to sexual assault, because the State allegedly failed to prove guilt on
the aggravating element, namely, that defendant “acted in such a manner as to threaten or
endanger the life” of the alleged victim. 720 ILCS 5/12-14(a)(3) (West 1998). In its appellate
brief, the State concedes: “The People agree that they failed to prove beyond a reasonable
doubt the aggravating factor alleged.”
¶ 58 For the reasons discussed below, we find, first, that the trial court erred by failing to order
a DNA database search; second, that defendant received ineffective assistance of counsel;
and third, that the trial court erred by barring defense counsel from asking the State’s DNA
expert questions about a similar search of the Arizona offender database. Since we reverse
and remand on these grounds, we do not reach defendant’s remaining claims.
¶ 59 1. Standard of Review
¶ 60 We find that our standard of review is abuse of discretion, based on our consideration of
the statute at issue and of evidence law, in general.
¶ 61 The statute at issue is section 116-5 of the Illinois Code of Criminal Procedure. 725 ILCS
5/116-5 (West 2006). This statute governed defendant’s motion for a pretrial DNA database
search. Section 116-5 states, in relevant part, that “[u]pon motion by a defendant charged
with any offense where DNA evidence may be material to the defense investigation or
relevant at trial, a court may order a DNA database search by the Department of State
Police.” 725 ILCS 5/116-5 (West 2006).
¶ 62 The statute took effect on November 19, 2003, and there are no published opinions that
discuss the appropriate standard of review for a trial court’s denial of a defense motion.
However, the statute itself states that the trial court “may” order a DNA database search. As
our supreme court has stated many times, the job of a reviewing court in construing a statute
is to give effect to the legislature’s intent, and the best indication of the legislature’s intent
is the language it chose to use in the statute. E.g., People v. Cardamone, 232 Ill. 2d 504, 512
(2009). The word “may” indicates that the legislature intended to leave, to the sound
discretion of the trial judge, the grant or denial of the requested search. People v. Garstecki,
234 Ill. 2d 430, 443 (2009) (use of the word “may” indicates that a rule is “permissive”). In
addition, evidentiary rulings are generally reviewed only for an abuse of discretion. People
v. Dunmore, 389 Ill. App. 3d 1095, 1105 (2009).
¶ 63 However, defendant claims that our review should be de novo, “because the trial court
is in no better position than a reviewing court to decide the merits of the motion” for a DNA
database search. In support of his argument, defendant cites the Illinois Supreme Court’s
opinion in People v. Shum, 207 Ill. 2d 47, 65 (2003).
¶ 64 The statute at issue in Shum was the statute that allows a defendant, after he has already
been convicted, to move the trial court for postconviction DNA testing. Shum, 207 Ill. 2d at
64 (quoting 725 ILCS 5/116-3 (West 2000)). The statute sets forth detailed criteria for a trial
court to consider and states that the trial court “ ‘shall’ ” allow the requested testing after a
“ ‘determination’ ” that the listed criteria are satisfied. Shum, 207 Ill. 2d at 64 (quoting 725
ILCS 5/116-3 (West 2000)). It is well established, under Illinois case law, that an appellate
-12-
court will review de novo a trial court’s denial of a defendant’s postconviction motion made
pursuant to section 116-3. Shum, 207 Ill. 2d at 65; People v. Franks, 323 Ill. App. 3d 660,
662 (2001); People v. Urioste, 316 Ill. App. 3d 307, 310 (2000).
¶ 65 However, we are not persuaded by the line of cases decided under the postconviction
statute, since the postconviction and the pretrial statutes are different. First, the
postconviction statute uses the word “shall,” and the pretrial statute uses the word “may.”
The difference in language indicates that the pretrial statute is discretionary while the
postconviction statute is not. Garstecki, 234 Ill. 2d at 443 (the effect of “change from ‘may’
to ‘shall’ ” was “to change the rule from a permissive one to a mandatory one”); People v.
Walker, 392 Ill. App. 3d 277, 295 (2009) (“use of the word ‘shall’ indicates a ‘mandatory’
requirement”). Second, the postconviction statute sets forth a detailed list of criteria that a
trial court must consider. By contrast, the pretrial statute sets forth no criteria. The lack of
criteria in the pretrial statute is additional evidence that the legislature intended to leave the
decision of the pretrial motion up to the trial court’s discretion.
¶ 66 For the foregoing reasons, we find that, for a trial court’s denial of a defendant’s section
116-5 motion, abuse of discretion is the appropriate standard of review. 725 ILCS 5/116-5
(West 2006). However, no matter which standard of review we used, our decision in this case
would be the same.
¶ 67 2. Forfeiture Issues
¶ 68 In the case at bar, the State claims that defendant forfeited this issue for appellate review
by failing to obtain a ruling on his motion.
¶ 69 In the case at bar, defendant’s pretrial DNA motion asked the trial court to exclude the
DNA evidence and then argued in the alternative for a DNA database search. During the
argument on the motion, defense counsel stated that he would rest primarily on his
“pleadings.” When the trial court denied his motion, the trial court indicated that it had read
all the defendant’s filings pertaining to defendant’s DNA motion. This case is completely
different from a case where an entire filing slips through the cracks after the case is
transferred to another judge and where the new judge issues no ruling on the filing at all.
People v. Redd, 173 Ill. 2d 1, 35 (1996). Since a party is allowed to rest on his written
motion, particularly when the trial judge stressed that he had read it, we find that defendant
preserved this issue for our review. However, as we explain in section 5 of this opinion, the
forfeiture issue does not affect our decision, since we also find that the error rises to the level
of plain error.
¶ 70 In support of its forfeiture argument, the State cites People v. Schmitt, 131 Ill. 2d 128
(1989). In Schmitt, our supreme court held that defendant had failed to preserve his severance
motion for appeal, where no ruling was made prior to trial, where defendant brought the
omission to the trial court’s attention during trial, and where defendant then agreed to the
conduct of simultaneous but separate bench trials. Our case is nothing like Schmitt, where
the defendant’s explicit agreement removed the need for a ruling.
¶ 71 In the case at bar, the State also claims that defendant forfeited the issue of a database
search by failing to raise it in a posttrial motion. Defendant’s posttrial motion referred
-13-
specifically to his pretrial DNA motion. However, his posttrial motion did not reiterate his
alternative argument, stated in his pretrial motion, that if the trial court denied his motion to
exclude the DNA evidence, due to destruction of evidence, then the trial court should order
a database search. Defendant’s specific identification of the pretrial motion at issue was
sufficient to preserve the issue for appellate review. People v. Lewis, 223 Ill. 2d 393, 401
(2006) (the claimed violation of a hearsay statute was preserved for review, even though
defendant’s posttrial motion claimed only that “[defendant] was not proven guilty beyond
a reasonable doubt because the State presented hearsay testimony,” and even though it did
not identify the witness, the testimony or the statute, because there were only two hearsay
objections at trial).
¶ 72 The Illinois Supreme Court has held that a “defendant must both specifically object at
trial and raise the specific issue again in a posttrial motion to preserve any alleged error for
review.” People v. Woods, 214 Ill. 2d 455, 470 (2005); People v. Piatkowski, 225 Ill. 2d 551,
564 (2007). When a defendant has failed to preserve an error for review, we may still review
for plain error. Piatkowski, 225 Ill. 2d at 562-63; Ill. S. Ct. R. 615(a) (“Plain errors or defects
affecting substantial rights may be noticed although they were not brought to the attention
of the trial court.”).
¶ 73 “[T]he plain-error doctrine allows a reviewing court to consider unpreserved error when
(1) a clear or obvious error occurred and the evidence is so closely balanced that the error
alone threatened to tip the scales of justice against the defendant, regardless of the
seriousness of the error, or (2) a clear or obvious error occurred and that error is so serious
that it affected the fairness of the defendant’s trial and challenged the integrity of the judicial
process, regardless of the closeness of the evidence.” Piatkowski, 225 Ill. 2d at 565; Woods,
214 Ill. 2d at 471.
¶ 74 We find, for the reasons stated above, that the error was preserved for appellate review
and that the plain error doctrine does not apply. For the reasons discussed below in section
5 of this opinion, we also find that, even if defendant forfeited the error by failing to raise it
specifically in his posttrial motion, the error qualified as “plain error” under the second prong
of the plain error doctrine.
¶ 75 3. Statutory Interpretation
¶ 76 As noted, this is a case of first impression. Neither we nor the parties were able to locate
an appellate case reviewing a trial court’s denial of a defendant’s pretrial motion for a DNA
database search, pursuant to section 116-5. 725 ILCS 5/116-5 (West 2006).
¶ 77 As far as we know, the statute has been cited three times in published Illinois opinions:
(1) In re Lakisha M., 227 Ill. 2d 259 (2008); (2) In re Jesscia M., 399 Ill. App. 3d 730
(2010); and (3) People v. Watson, 2012 IL App (2d) 091328. First, in In re Lakisha M., 227
Ill. 2d 259, 272 (2008), the Illinois Supreme Court cited the statute in passing, observing that
it authorizes the release of database information to defense counsel. Second, in In re Jesscia
M., 399 Ill. App. 3d 730 (2010), the appellate court also discussed the statute in dicta. The
Jessica M. court observed that the statute authorized the defense to make a motion for
“genetic marker analysis,” which the court defined as “computerized patterns of the genetic
-14-
marker groupings within the database, rather than the initial biological testing of the samples
themselves.” In re Jessica M., 399 Ill. App. 3d at 747. In the case at bar, the question of
whether the statute authorizes biological testing is not an issue, since defendant is requesting
only a computerized search and not biological testing. Thus, this dicta does not apply to our
case. Third, in Watson, the majority held that a defense attorney was ineffective for failing
to probe the statistical meaning of a seven-loci “match.” Watson, 2012 IL App (2d) 091328,
¶ 25. The majority pointed out the options that a defense counsel has, observing that “there
is a statutory procedure by which an attorney may request a database search.” Watson, 2012
IL App (2d) 091328, ¶ 31. The desirability of the search option appears to be one of the few
points that both the majority and the dissent in Watson agreed on. The dissent stated “I am
surprised” that the appellate defense counsel had “not considered whether trial counsel
should have sought a court order directing the State Police to search the Illinois database.”
Watson, 2012 IL App (2d) 091328, ¶ 89 ( Birkett, J., dissenting). None of these cases
involved, as our case does, a trial court’s denial of a defense request for a pretrial database
search.
¶ 78 Even though we are without case law, we are not without guidance. As we do in every
case of statutory interpretation, we look first and foremost to the language of the statute
itself. Cardamone, 232 Ill. 2d at 512. Our primary objective in construing a statute is to give
effect to the legislature’s intent. Cardamone, 232 Ill. 2d at 512. We consider the statute in
its entirety, “keeping in mind the subject it addresses and the legislature’s apparent objective
in enacting it.” Cardamone, 232 Ill. 2d at 512.
¶ 79 The legislature’s objective in enacting section 116-5 was to level the playing field. 725
ILCS 5/116-5 (West 2006); see also Erin Murphy, The New Forensics: Criminal Justice,
False Certainty, and the Second Generation of Scientific Evidence, 95 Calif. L. Rev. 721,
790-91 (2007) (the purpose of the Illinois statute is to provide the defendant, “upon a
particular showing,” with “a parallel capacity to investigate an offense through a search of
the database”). That purpose is clear from the language of the statute itself, which provides
access to the DNA database to the defendant. The State already has unlimited and unfettered
access.
¶ 80 The statute requires a defendant to show only that “DNA evidence may be material to the
defense investigation or relevant at trial.” 725 ILCS 5/116-5 (West 2006). On appeal, the
State does not argue that DNA evidence was not “material to the defense investigation.” The
materiality of the search request to the defense investigation is shown by the late addition of
a consent defense, after the request was denied.
¶ 81 The primary evidence identifying defendant as the offender was a nine-loci analysis
between his DNA profile and a male DNA profile obtained from the victim’s rectal swabs.
As the State’s expert conceded at trial, his 13-loci analysis on the victim’s underwear failed
to yield a “match.” People v. Schulz, 154 Ill. App. 3d 358 (1987) (where the expert’s
testimony “demonstrated nothing more than that defendant could not be excluded as the
semen donor,” “this testimony served no relevant purpose, was totally lacking in probative
value, and thereby prejudiced defendant’s cause”). A trial court cannot bar a defendant’s
access to evidence that has a good chance of creating a reasonable doubt in the jury’s mind,
in light of the facts and circumstances of the case and the other evidence that is likely to be
-15-
admitted at trial. To do so would be to pervert the purpose of the statute and call into
question the integrity of the criminal process.
¶ 82 That the requested search would have a good chance of leading to “reasonable doubt”
evidence was shown by the Arizona study. Now, we also know that an actual study of the
Illinois database did yield over 900 pairs at only 9 loci. However, as Donald Parker, the
administrator of the Illinois database tesified, if you looked at further loci, these 903 pairs
would not be matches. We also know that a similar study of the Maryland offender database
yielded similar results. In Maryland, a court in a death penalty case ordered a study of
Maryland’s offender database, at the defendant’s request. Ken Strutin, Databases, E-
Discovery and Criminal Law, 15 Rich. J.L. & Tech. 6, 54 (2009). Although the Maryland
database contained fewer than 30,000 profiles–a small fraction of the size of the Illinois
database–the Maryland search also yielded 32 pairs at 9 loci, which does not mean a match
because the other loci were not included. Strutin, supra, at 54.
¶ 83 The dangers of partial matches have been known for over a decade. For example, in a
highly publicized English case, Raymond Easton was charged in 1999 with burglary after
police had a “ ‘cold hit’ ” with his DNA in a database. Jennifer L. Mnookin, Fingerprint
Evidence in an Age of DNA Profiling, 67 Brook. L. Rev. 13, 49-50 (2001); Allison Pari,
Note, An International DNA Database: Balancing Hope, Privacy, and Scientific Error, 24
B.C. Int’l & Comp. L. Rev. 341, 368-69 (2001). His DNA “matched” the DNA from the
crime scene at six loci. Since British police estimated that there was only a 1 in 37 million
chance that such a match would occur at random, he was charged with burglary. Mnookin,
supra, at 50; Pari, supra, at 368-69. When Easton, who had advanced Parkinson’s disease,
had an alibi, the police ran a test at more loci and discovered that his DNA did not match at
all. Mnookin, supra, at 50; Pari, supra, at 368-69. The charges were, of course, dropped.
Mnookin, supra, at 50; Pari, supra, at 368-69.
¶ 84 As a result of the Arizona, Maryland and Illinois searches, some legal scholars and
scientists have questioned whether the extraordinarily large figures used in court to estimate
the probability of a nine-loci “match” are “no better than alchemy.” David H. Kaye, Trawling
DNA Databases for Partial Matches: What Is the FBI Afraid Of?, 19 Cornell J.L. & Pub.
Pol’y 145, 146 (2009); Strutin, supra, at 54 (after the Arizona, Maryland and Illinois
searches, “academics and experts have added their voices in calling for access to the DNA
databanks to test the assumptions of profile rarity”). For example, a Stanford mathematician
has called these numbers “ ‘total nonsense’ ” and “ ‘a damned lie.’ ” Kaye, supra, at 148
(quoting Keith Devlin, Damned Lies, Mathematical Association of America (2006),
available at http://www.maa.org/devlin/devlin_10_06.html.). He has stated that admitting
this testimony into court is “ ‘disgraceful,’ ” and that courts “ ‘may as well admit alchemy
and astrology.’ ” Kaye, supra, at 147 (quoting Keith Devlin, Damned Lies, Mathematical
Association of America (2006), available at
http://www.maa.org/devlin/devlin_10_06.html.).
¶ 85 Although the trial court in the case at bar was not presented with the results of the
Maryland or Illinois searches, the trial court did have in front of it a report from the search
of the Arizona database, which revealed 120 pairs of 9-loci “matches” in a database of
65,493 offenders. Kaye, supra, at 154-55 (describing how the Arizona study was conducted
-16-
and its results). As one legal scholar has asked, if the frequency “for a nine-locus match is
anything like ‘one in 754 million for whites, and one in 561 million for blacks’ [as some
DNA experts testify], how can it be that a database as small as [Arizona’s with] ‘a mere
65,493 entries’ produces even one such match?” Kaye, supra, at 155; Erin Murphy, The New
Forensics: Criminal Justice, False Certainty, and the Second Generation of Scientific
Evidence, 95 Calif. L. Rev. 721, 781 (2007) (“recent evidence calls into question the
accuracy of using the product rule to convey match probabilities”).
¶ 86 We have not been asked to determine whether the expert’s conclusion of a “match” based
on only nine-loci was correct. We have been asked to determine whether the trial court
abused its discretion in denying the defense the ability to investigate and impeach this
conclusion. Considering that a nine-loci analysis was the primary identification evidence
against defendant, the trial court abused its discretion by denying defendant’s motion. C.f.
People v. Watson, 2012 IL App (2d) 91328, ¶ 25 (defense counsel was ineffective for failing
to probe the statistical meaning of a seven-loci “match” when plenty of arguments and
evidence were available).
¶ 87 The dissent relies heavily on the case of State v. Dwyer, 2009 ME 127, 985 A.2d 469, in
which the Maine Supreme Court held that it was not an abuse of discretion for a Maine trial
court to deny a defense request for a database search for nine-loci matches. However, what
the dissent overlooks is that, in Illinois, we have a statute that specifically authorizes DNA
database searches and that our statute is very different from Maine that has none. 725 ILCS
5/116-5 (West 2006). The Illinois statute requires the defense to show either that the search
may be relevant at trial “or” that it may be material to the defense investigation. 725 ILCS
5/116-5 (West 2006). The “or” in this sentence means that the defense must show one or the
other, but not both. Thus, in Illinois, to obtain a database search, a defendant is not required
to show that the search will produce results that are relevant to or admissible at trial. By
contrast, in Maine, the standard is different. In Maine, a defendant must show that the
anticipated evidence will be admissible at trial. Dwyer, 2009 ME 127, ¶ 16, 985 A.2d 469.
That is simply not the standard in Illinois. The difference between the law of the two states
becomes more clear, when one remembers that an Illinois court already ordered a nine-loci
search, pursuant to our statute. See id. ¶ 50 (describing the search run in the case of People
v. Juan Luna, No. 02 CR 15430 (Cir. Ct. Cook Co.) (hereafter Luna), to determine the
number of entries in the Illinois offender database that will appear identical at only nine-
loci).
¶ 88 4. Consent Defense
¶ 89 Although neither party raised this issue in its appellate briefs, the State claimed at oral
argument that defendant’s use of a consent defense at trial barred this claim on appeal. The
State is confusing two statutes: the statute that permits postconviction DNA testing (725
ILCS 5/116-3 (West 2006)); and the statute that permits pretrial DNA testing (725 ILCS
5/116-5 (West 2006)).
¶ 90 A defendant’s use of a consent defense at trial does bar him from seeking postconviction
DNA analysis. 725 ILCS 5/116-3(c) (West 2006). However, our legislature specifically did
-17-
not include this bar in its pretrial statute. By contrast, to seek a pretrial search, a defendant
must show only that it “may be material to the defense investigation.” 725 ILCS 5/116-5(a)
(West 2006). Thus, the key issue under the pretrial statute is not whether the defendant
intends to use a consent defense, but whether his request showed that the DNA search may
have been material to the defense investigation. To rule otherwise would be to rewrite the
statute.
¶ 91 First, we find that the State forfeited the consent issue by failing to raise it in its appellate
briefs. Second, we find that, even if it was not forfeited, defendant’s use of a consent defense
at trial did not act as a judicial admission of identity on appeal under the particular facts and
circumstances of this case.
¶ 92 “[J]udicial admissions ‘are formal concessions in the pleadings in the case or stipulations
by a party or its counsel that have the effect of withdrawing a fact from issue and dispensing
wholly with the need for proof of the fact.’ ” Knauerhaze v. Nelson, 361 Ill. App. 3d 538,
557-58 (2005) (quoting 2 John William Strong, McCormick on Evidence § 254, at 142 (4th
ed. 1992)). In other words, if a fact is judicially admitted, the adverse party has no need to
submit any evidence on that point. The admission serves as a substitute for proof at trial.
Lowe v. Kang, 167 Ill. App. 3d 772, 776 (1988) (judicial admissions “dispens[e] with proof
of a fact claimed to be true, and are used as a substitute for legal evidence at trial”), cited
with approval in People v. Howery, 178 Ill. 2d 1, 40-41 (1997). We do not find a judicial
admission occurred here, for the following reasons.
¶ 93 First, the Illinois Appellate Court has previously held that a defense counsel’s opening
and closing statements in a criminal case do not always qualify as judicial admissions and
thus they do not always preclude a defendant from arguing on appeal that the State failed to
prove an element of the offense beyond a reasonable doubt. People v. Neylon, 327 Ill. App.
3d 300, 307 (2002). For example, in Neylon, the defendant stood accused of personally
discharging a firearm, and his counsel argued in his opening statement that the defendant had
fired a gun inside a residence, because the defendant had not realized that such a firing was
against the law. Neylon, 327 Ill. App. 3d at 306. The defense counsel then followed that
concession with a second concession, this time during closing statement, that defendant
owned the gun in question. Neylon, 327 Ill. App. 3d at 307. After the appellate court
observed that, for a conviction of this particular offense, the defendant “must possess and
discharge his firearm,” the appellate court reversed his conviction, holding that there was “no
proof defendant personally fired the gun.” Neylon, 327 Ill. App. 3d at 307. Thus, the
appellate court concluded that this defense counsel’s concessions in his opening and closing
statements constituted “no proof.” Neylon, 327 Ill. App. 3d at 307.
¶ 94 The facts of Neylon are remarkably similar to the facts in the case at bar. In both cases,
defense counsel conceded that his client had committed the act at issue. In our case, the act
was sexual penetration; in the Neylon case, it was discharging a gun inside a residence.
Neylon, 327 Ill. App. 3d at 306. In both cases, defense counsel argued that their clients
lacked the requisite mens rea or state of mind for the crime. In our case, defense counsel
argued that the acts were consensual; and in the Neylon case, defense counsel argued that the
acts were done under the mistaken impression that they were legal. Neylon, 327 Ill. App. 3d
at 306. In Neylon, the appellate court found that counsel’s concessions did not qualify as
-18-
judicial admissions. Neylon, 327 Ill. App. 3d at 307. Applying the holding of Neylon to the
facts of our case requires us to reach the same holding here.
¶ 95 Second, on the facts and circumstances of this case, a finding by us that defendant made
a judicial admission would be to turn a blind eye to the reality facing this particular
defendant. In Howery, a criminal defendant asked our supreme court to find that remarks by
a prosecutor in the State’s rebuttal closing constituted a “judicial admission.” However, our
supreme court held that the closing remarks did “not constitute a judicial admission.”
Howery, 178 Ill. 2d at 42. In a parenthetical, our supreme court cited the civil case of Lowe
for the proposition that “whether or not a statement by an attorney is a judicial admission
depends upon the circumstances of the individual case.” Howery, 178 Ill. 2d at 41 (discussing
in a parenthetical Lowe, 167 Ill. App. 3d at 777). Thus, we will review the “circumstances”
of the case at bar.
¶ 96 In the case at bar, defendant was facing a type of evidence that juries and courts alike find
highly persuasive: a DNA match. Today, whenever a DNA expert uses the words, “it’s a
DNA match,” the jury believes that the defendant is guilty. In re T.W., 402 Ill. App. 3d 981,
992-93 (2010) (finding that DNA evidence alone constituted “overwhelming” evidence, even
where defendant looked nothing like the victim’s description of the assailant); People v.
Johnson, 389 Ill. App. 3d 618, 619 (2009) (finding that an expert’s testimony about a DNA
match was “overwhelming” evidence). See also People v. Safford, 392 Ill. App. 3d 212
(2009) (“witnesses have little chance of being found credible when [forensic] evidence points
to the defendant being present at the scene of the crime”). The American Psychological
Association published an article in 2008 that summarized conclusions from three different
studies concerning the impact of DNA evidence on a jury. Joel D. Lieberman et al., Gold
Versus Platinum: Do Jurors Recognize the Superiority and Limitations of DNA Evidence
Compared to Other Types of Forensic Evidence?, 14 Psychol. Pub. Pol’y & L. 27 (2008).
The article concluded that DNA evidence has a “ ‘mystical aura.’ ” Lieberman et al., supra,
at 33. “Public jurors, on average, rated DNA evidence as 95% accurate, and it was rated as
94% persuasive of a suspect’s guilt.” Lieberman et al., supra, at 52-53. The article warned
that “[t]he strong and largely invariant impact of DNA evidence across experimental
conditions suggests that this type of scientific evidence may be so persuasive that its mere
introduction in a criminal case is sufficient to seriously impede defense challenges.”
Lieberman et al., supra, at 58.
¶ 97 Although the claimed “match” in this case was based on only a 9-loci analysis instead
of the standard 13-loci analysis, the State’s expert still claimed that it was a “match.”
Showing the frequency with which such nine-loci “matches” appeared in the offender
database would have provided a strong basis for cross-examination; yet, defendant was
denied the ability to develop this evidence. After he was denied the ability to develop this
evidence, it would be absurd to criticize him for resorting to a consent defense. Johnson, 389
Ill. App. 3d at 619 (“[f]aced with overwhelming DNA evidence, the defense in this sexual
assault *** case attempted to persuade the jury” that he did not force the victim). It would
be like knocking out one leg and criticizing him for hopping on one foot.
¶ 98 Even if we found that consent acted as a bar, we would then have to find ineffective
assistance of counsel, as we discuss in the last section of this opinion.
-19-
¶ 99 5. Plain Error Analysis
¶ 100 Even though we found in section 2 of this opinion that defendant did not forfeit this issue
for appellate review, the forfeiture issue is not material to our decision, since the plain error
doctrine is satisfied.
¶ 101 The trial court’s denial of defendant’s motion for a database search violated the second
prong of the plain error doctrine. Under the second prong of the plain error doctrine, an error
rises to the level of “plain error” when the “error is so serious that it affected the fairness of
the defendant’s trial and challenged the integrity of the judicial process, regardless of the
closeness of the evidence.” Piatkowski, 225 Ill. 2d at 565; Woods, 214 Ill. 2d at 471. In the
case at bar, the error challenged the integrity of the judicial process by barring defendant’s
access to evidence that could have assisted him in establishing his innocence, by casting a
serious doubt on the State’s identification evidence. The State’s own administrator in charge
of its DNA offender database testified in another case that a nine-loci analysis is simply not
a “match.” By contrast, in the case at bar, the State’s expert testified that there was a “match”
based on a nine-loci analysis, and this “match” was the primary evidence identifying
defendant as the perpetrator. From the 13-loci analysis, defendant could be neither excluded
nor identified as the perpetrator. By barring the defense from even the chance to develop
evidence that could have undermined the claimed “match,” the trial court’s error seriously
affected the fairness of defendant’s trial. Cf. Watson, 2012 IL App (2d) 091328, ¶ 25 (defense
counsel’s performance fell below an objective standard of reasonableness when she failed
to probe the statistical meaning of a seven-loci “match”). See also 725 ILCS 5/116-5(a)
(West 2006) (all a defendant has to show is that the “DNA evidence may be material to the
defense investigation”).
¶ 102 6. Ineffective Assistance of Counsel
¶ 103 As noted above, even if we found that consent acted as a bar, we would then have to find
ineffective assistance of counsel. Defendant specifically alleged in his pro se posttrial motion
that his trial counsel was ineffective in his handling of the pretrial DNA motion and for
failing to hire an independent DNA expert. On appeal, defendant claims in his brief to this
court that the trial court “failed to adequately inquire into [defendant’s] pro se claims of
ineffective assistance of counsel.” The trial court concluded that the “allegations of
ineffective assistance of counsel” in defendant’s pro se motion “go to trial strategy *** on
it’s face [sic],” and thus the trial court conducted no inquiry into those claims.
¶ 104 A criminal defendant has a constitutional right to the effective assistance of counsel at
trial. People v. Smith, 195 Ill. 2d 179, 187 (2000) (citing Strickland v. Washington, 466 U.S.
668, 686-87 (1984)). This right also applies to pretrial proceedings to exclude evidence.
Smith, 195 Ill. 2d at 188-89. To establish a claim of ineffective assistance of counsel, a
defendant must prove both (1) deficient performance and (2) prejudice. Smith, 195 Ill. 2d at
187-88 (citing Strickland, 466 U.S. at 687).
¶ 105 To satisfy the first prong of the Strickland test, a defendant must show that his counsel’s
performance fell below an objective standard of reasonableness, as measured by prevailing
norms. Smith, 195 Ill. 2d at 188. In considering whether counsel’s performance was deficient,
-20-
a court must indulge a strong presumption that the challenged action, or inaction, was the
result of sound trial strategy. Smith, 195 Ill. 2d at 188.
¶ 106 To satisfy the second prong, a defendant must establish a reasonable probability that, but
for counsel’s deficient performance, the outcome of the proceeding would have been
different. Smith, 195 Ill. 2d at 188 (citing Strickland, 466 U.S. at 694). A probability rises to
the level of a “reasonable probability” when it is sufficient to undermine confidence in the
outcome or the proceeding. Smith, 195 Ill. 2d at 188. Counsel’s deficient performance must
have rendered either the outcome unreliable or the proceeding fundamentally unfair. Smith,
195 Ill. 2d at 188.
¶ 107 When a defendant raises a claim of ineffective assistance of counsel on direct appeal, the
trial court may consider the claim or it may decline to adjudicate it if it involves “matters
beyond the record on direct appeal.” People v. Parker, 344 Ill. App. 3d 728, 737 (2003)
(quoting People v. Burns, 304 Ill. App. 3d 1, 11 (1999)); People v. Ligon, 365 Ill. App. 3d
109, 121-23 (2006) (appellate court chose to consider one of defendant’s three
ineffectiveness claims but declined to adjudicate the other two). Declined matters may be
addressed later in a proceeding for postconviction relief. Ligon, 365 Ill. App. 3d at 122. In
the case at bar, the appellate record is sufficient for us to review defendant’s claim.
¶ 108 The record before us establishes that defense counsel was asking the trial court to order
a database search, that had already been done, and that had been done at the request of the
same counsel.
¶ 109 On October 17, 2006, Donald Parker, the administrator in charge of our state’s offender
database, testified at his deposition in the Luna case that, in his opinion, “[i]f it doesn’t
match across the thirteen loci, then it’s not a true match.” Parker stated repeatedly that nine-
loci comparisons are “not true matches” and that “[i]t’s misleading to call them matches.”
¶ 110 At this same deposition, Parker testified that, in response to an order by the trial court in
the Luna case, he had already run a search of the Illinois database to determine how many
pairs of matches it contained at only nine loci. The database search revealed 903 pairs at 9
loci. In other words, 1,806 individuals had the same alleles at 9 loci, as at least one other
individual in the database. Parker testified that “[i]f you look[ed] at the further loci, they
would be considered nonmatches.”
¶ 111 Present at this deposition on October 17, 2006, was Andrew Northrup, an assistant public
defender who appeared on behalf of one of the defendants in the Luna case. Several months
later, on February 8, 2007, the trial court in the case at bar heard argument from counsel on
defendant Wright’s DNA motion. The assistant public defender representing defendant
Wright on February 8, 2007, was the same assistant public defender who had appeared at
Parker’s deposition on October 17, 2006: Andrew Northrup. Northrup failed to inform the
trial court on February 8, 2007, that the database search had already been performed and
what the results were, or that the state’s own director of that database had stated that it was
“misleading” to call a nine-loci comparison “a match.” Northrup’s co-counsel, Ketih Ahmad,
did inform the trial court at the conclusion of the February 8 proceeding that Northrup was
leaving the defender’s office.
¶ 112 On February 8, 2007, instead of informing the trial court of the results of the recent nine-
-21-
loci search of the Illinois database, Northrup stated only that “we have seem [sic] to learn
that 9 loci matches are not completely uncommon.” Northrup argued that use of the nine-loci
analysis “would deprive Mr. Wright of a fair trial, particularly because this is the only
evidence against him, this 9 loci match.”
¶ 113 We cannot think of a single reason, strategic or otherwise, why defense counsel would
withhold from the trial court the information that a 9-loci search of the Illinois database had
already been done, that it had revealed that close to 2,000 individuals had matched at 9 loci,
and that the State’s own director of that database had concluded that 9-loci “matches” were
not, in fact, matches. This information was highly favorable to the defense’s motion to
exclude the nine-loci analysis, and as defense counsel observed, this was “the only evidence
against him.” Without it, the State had almost no case. Cf. In re T.W., 402 Ill. App. 3d at 992-
93 (holding that, where no “potential discrepancies or errors in the DNA test results” were
exposed, DNA evidence alone constituted “overwhelming” evidence). Thus, we find that the
first prong of Strickland is satisfied.
¶ 114 As for the second prong, we find that, but for counsel’s deficient performance, there is
a reasonable probability that the outcome of the proceeding would have been different. If the
trial court had in front of it the information that a 9-loci search of the Illinois database had
already been done, that it had revealed that close to 2,000 individuals had matched at 9 loci,
and that the state’s own director of that database had concluded that 9-loci “matches” were
not, in fact, matches, there is a reasonable probability that it would have granted the
defense’s motion to exclude the 9-loci analysis, which was the primary evidence against
defendant.
¶ 115 Thus, even if we were to find that consent was a bar, we would have to find ineffective
assistance of counsel. Watson, 2012 IL App (2d) 091328, ¶ 25 (defense counsel was
ineffective for failing to probe the statistical meaning of a seven-loci “match”).
¶ 116 7. Cross-Examination
¶ 117 Defendant also claims on appeal that the trial court abused its discretion by barring
defense counsel from asking the State’s DNA expert any questions about the Arizona study.
¶ 118 The facts underlying this claim are few and straightforward. During cross-examination
and in response to a question asked by the trial court (quoted above in the Background
section), Edgar Jove, the State’s DNA expert, indicated that, in his experience, he had never
seen a nine-profile match that was not accurate. Defense counsel then tried to immediately
follow up with questions about the Arizona study, which had been provided to Jove before
trial and which contained over a 100 pairs of 9-loci matches. The trial court barred any
questions about it, indicating that the State had already obtained a favorable ruling on a
motion in limine on this specific issue.
¶ 119 On appeal, the State claims that defendant forfeited review of this issue. As we discussed
above, to preserve an issue for an appellate review, a defendant must raise the issue, first, at
trial and, second, in a posttrial motion. Woods, 214 Ill. 2d at 470; Piatkowski, 225 Ill. 2d at
564.
¶ 120 First, defense counsel’s unsuccessful attempt to raise this issue at trial is quoted above,
-22-
in the Background section of this opinion. On appeal, the State argues that defendant
forfeited any claims with respect to the Arizona study by allegedly failing to obtain a ruling
on this portion of his pretrial motion. However, at trial, the court stated that there was, in
fact, a ruling on “this issue” of the Arizona study. Thus, we do not find this argument
persuasive. Second, defendant’s posttrial motion referred specifically to his pretrial DNA
motion in which he discussed the Arizona study in detail and asked the trial court to provide
a limiting instruction on the evidence’s defects, if the State’s DNA evidence was admitted.
Defendant’s “supplemental” version of his pretrial motion included a copy of the Arizona
study and stated that defendant had already provided a copy to the State’s DNA expert. As
we already stated above, we find that defendant’s specific reference to his pretrial DNA
motion was sufficient to preserve the DNA issue for our review.
¶ 121 The dissent finds that defendant forfeited this issue by failing to make an offer of proof
during trial and cites in support People v. Andrews, 146 Ill. 2d 413, 420-21 (1992). Andrews
stated that the purpose of an offer of proof is to disclose to the trial court, the opposing
counsel and, eventually, the reviewing court “the nature of the offered evidence.” Andrews,
146 Ill. 2d at 421. In the case at bar, the trial court’s and the prosecutor’s familiarity with “the
nature” of the issue was evident from the fact that just the words “Arizona database” were
enough to trigger the prosecutor’s swift objection followed by the trial court’s immediate
recollection of the pretrial discussion and ruling. The “nature of the offered evidence” was
disclosed to them in the defendant’s pretrial motions, in both his original and supplemental
DNA motion. Specifically, in the State’s response to defendant’s original pretrial motion, the
State had objected on the ground that it had not been provided with a copy of the Arizona
study. In reply, defendant filed a “supplemental” motion in which he observed that he had
already provided the study to the State’s DNA expert. However, defendant also attached a
copy of the five-page report from the Arizona study to his supplemental motion, which is
also in our appellate record. Thus, we find that defendant adequately disclosed to the trial
court, to opposing counsel and to us the nature of the evidence offered.
¶ 122 The dissent also finds that defendant failed to explain the relevance of the Arizona study
to his case. However, in his pretrial motion, he stated: “The statistics that they cite in this
case are 1 in 420 trillion blacks, 1 in 670 trillion whites, and 1 in 2.9 quadrillion Hispanics.”
He further stated: “However[,] a recent examination of Arizona’s convicted offender
database revealed 120 nine location matches between two inmates in a database of 65,493
offenders. In other words, in Arizona there is a 1 in 700 chance that two individuals will
match up at nine locations.” His supplemental motion further explained that “[t]his
information is relevant in determining how much weight to attach to the statistics set forth
in this case by the government.” We find that this was a more than adequate explanation of
the relevance of the study to his case. For these reasons, we do not find the issue forfeited.
¶ 123 The decision of whether to allow expert testimony on a particular topic is a decision
usually left to the sound discretion of the trial court, and a reviewing court will not usually
reverse the trial court absent an abuse of discretion. People v. Becker, 239 Ill. 2d 215, 234
(2010). An abuse of discretion occurs when the trial court’s decision is arbitrary or
unreasonable. Becker, 239 Ill. 2d at 234.
¶ 124 Rule 705 of the Illinois Rules of Evidence (Ill. R. Evid. 705 (eff. Jan. 1, 2011)) permits
-23-
an expert to give an opinion without divulging the basis for it. Although Rule 705 was not
enacted at the time of defendant’s trial, it merely codifies preexisting case law. Ill. R. Evid.,
Committee Commentary (eff. Jan. 1, 2011) (the newly enacted Illinois Rules of Evidence
merely codified existing case law whenever the Illinois Supreme Court “had clearly
spoken”); People v. Williams, 238 Ill. 2d 125, 137 (2010) (observing that, in 1981, the
Illinois Supreme Court had adopted the identical Rule 705 of the Federal Rules of Evidence).
Rule 705 shifts the burden to the opposing party to elicit and to explore the underlying facts
or data on cross-examination. Williams, 238 Ill. 2d at 140. An unnecessary curtailment of
cross-examination undercuts the burden-shifting scheme embodied in Rule 705.
¶ 125 The appellate court has held that even a “routine” defense against a less-than-13-loci
comparison should include argument that such a “match” is not uncommon. Watson, 2012
IL App (2d) 091328, ¶ 31. In Watson, we recently held that a defense counsel’s performance
fell below an objective standard of reasonableness when she failed to probe the statistical
meaning of a a seven-loci “match” admitted against her client. Watson, 2012 IL App (2d)
091328, ¶ 25. It would be strange to require defense counsel–at danger of being held
ineffective–to make this argument and then deny her the means to support it. “[Q]uestioning
the statistical implications of a recovered DNA profile is a basic line of inquiry.” Watson,
2012 IL App (2d) 091328, ¶ 31.
¶ 126 Even if the Arizona study itself was not admissible at trial, the expert could have been
cross-examined about it. Rule 703 provides that, even if facts or data are not admissible in
evidence, the expert may be asked to offer an opinion based on them, if they are disclosed
at or before trial and if they are “of a type reasonably relied upon by experts in the particular
field in forming opinions or inferences upon the subject.” In the case at bar, the study was
disclosed to the expert at trial, and the defense was denied the opportunity of asking whether
this was the type of data usually relied upon by experts in his field.
¶ 127 In the case at bar, the trial court qualified the State’s expert as an expert “in the field of
forensic DNA analysis” but then blocked the defense from asking any questions about
possibly conflicting results from a forensic DNA study that the defense had provided to this
same expert prior to trial. “An expert’s opinion is only as valid as the basis and reason for
the opinion.” Wilson v. Bell Fuels, Inc., 214 Ill. App. 3d 868, 875 (1991). We find that the
trial court abused its discretion when it barred the defense from posing a single question to
the expert about the Arizona study.
¶ 128 Since defendant preserved this issue for our review, the State bears the burden of
showing that any error was harmless beyond a reasonable doubt. People v. Johnson, 238 Ill.
2d 478, 488 (2010) (defendants “properly preserved their claims of error, thus requiring the
State to show that the errors were nonprejudicial under a harmless-error analysis”). For an
error to be considered harmless, the State must establish, beyond a reasonable doubt, that the
error did not contribute to the verdict. People v. Stechly, 225 Ill. 2d 246, 304 (2007). A
reviewing court may find an error harmless, if the remaining evidence is overwhelming or
if the evidence at issue merely duplicates other properly admitted evidence. Becker, 239 Ill.
2d at 240. In the case at bar, the evidence was far from overwhelming, and defendant’s
questions about the Arizona study were not duplicative of any other evidence in the record.
We cannot find, beyond a reasonable doubt, that the outcome was not affected by the trial
-24-
court’s preclusion of defendant’s attempted impeachment of the State’s DNA evidence.
¶ 129 Recently, we found that a trial court’s denial of a defense request for independent DNA
testing was harmless, because defense counsel was permitted extensive cross-examination
of the State’s expert and nothing at trial suggested “potential discrepancies or errors in the
DNA test results.” In re T.W., 402 Ill. App. 3d at 993. Conversely, in the case at bar,
defendant’s opportunity to cross-examine was limited, and it was specifically limited with
respect to exposing potential discrepancies or errors in the DNA test results.
¶ 130 For these reasons, we find that the trial court abused its discretion by curtailing cross-
examination.
¶ 131 CONCLUSION
¶ 132 For the foregoing reasons, we reverse and remand for a new trial. We find that the trial
court abused its discretion by denying defendant’s motion to order the Illinois State Police
to conduct a nine-loci database search. We find that defendant did not forfeit this issue for
review and that, even if he had forfeited it, this error rose to the level of plain error. We also
find that defendant received ineffective assistance of counsel and that the trial court abused
its discretion by barring the defense from asking the State’s DNA expert any questions about
the Arizona study. We take no position whether, on remand, the trial court must order a new
search, upon defendant’s motion, or whether the trial court may direct the parties to rely on
a similar search already conducted by the Illinois State Police in another case.
¶ 133 Reversed and remanded with directions.
¶ 134 JUSTICE McBRIDE, dissenting:
¶ 135 I respectfully dissent from the majority’s decision to reverse and remand for a new trial
because I believe the claimed errors have been forfeited. Under the plain error rule, defendant
must show that a clear or obvious error occurred and the evidence is so closely balanced that
the error alone severely threatened to tip the scales of justice against him or that a clear and
obvious error occurred and the error was so serious that it affected the fairness of his trial and
challenged the integrity of the judicial process. People v. Herron, 215 Ill. 2d 167, 186-87
(2005). Since the defendant has not met his burden of persuasion under either prong of the
rule, his claims are forfeited.
¶ 136 The first claimed error was the trial court’s denial of defendant’s motion to order the
State to perform a comparative search of its convicted felon DNA database known as CODIS
(Combined DNA Index System) to see if any of the database’s records matched each other
at nine or more loci. This comparative search has been referred to as an “Arizona search”
because when it was first run by a DNA analyst in that state, it produced a nine-loci match
between two unrelated individuals in the Arizona CODIS. A subsequent search in Arizona
yielded more matches. State v. Dwyer, 2009 ME 127, ¶ 12, 985 A.2d 469.
¶ 137 I do not agree that the trial court erred in the denial of this request because defendant has
not shown how a database search would have produced relevant evidence to compare with
-25-
the DNA testimony presented at defendant’s trial. Although the motion claimed that a study
would give perspective to the strength of the partial profile match developed in this case,
there was no scientific support for such a claim. Citing to the Arizona study does not make
defendant’s argument persuasive. The Arizona study contains twins, relatives and duplicate
samples. Moreover, the study itself indicates that it was not generated or used by the Arizona
Department of Public Safety Crime Laboratory for any statistical analyses. It also indicates
that the 11 and 12 locus matches are confirmed siblings. Finally, it indicates that
“relatedness” between 9 and 10 locus matches has not been determined. Defendant does not
address this fact, nor explain how any scientific comparison could be made here. In this case,
there was no proffered testimony, no evidentiary basis, no scientific argument to demonstrate
how a database search would produce relevant evidence to compare that search with the
DNA testimony presented at defendant’s trial. Defendant simply rested on the pleadings.
Evidentiary rulings are generally reviewed for an abuse of discretion. The denial of this
motion does not show that the trial court committed an error so serious that it affected the
fairness of defendant’s trial and challenged the integrity of the judicial process.
¶ 138 Even on appeal, defendant has not supplied this court with any support for his claim or
how the database search would have produced relevant evidence that could have been used
at defendant’s trial. Defendant has not referred to any reported decision suggesting that data
based studies have been used to call into question the validity of random match probability
calculations. The majority has cited an article not presented to the trial court and taken
isolated testimony of a deposition transcript from another criminal matter and used those
materials to conclude the trial court erred. I respectfully disagree with that type of analysis
and find no authority for doing so.
¶ 139 The majority suggests the primary evidence identifying defendant as the offender was a
9-loci analysis between his DNA profile and a male DNA profile obtained from the victim’s
rectal swabs. This statement, however, ignores the other DNA evidence presented at trial.
¶ 140 The majority also suggests there was no match in this case. I disagree with this
characterization. When a law enforcement agency attempts to connect a DNA sample to a
particular person, it does not compare entire DNA sequences, but rather the DNA at thirteen
specific places or loci. A person’s DNA characteristics at those thirteen loci make up his or
her DNA profile. A match between an unknown sample and the profile of a particular person
can occur at all thirteen or fewer loci. As more loci match, the probability increases that the
DNA in the unknown sample comes from that person.
¶ 141 The testimony from the prosecution’s DNA expert, Mr. Jove, was compelling. This
testimony established that the 9-loci profile obtained from the victim’s rectal swabs matched
that of the defendant and Jove was able to calculate a frequency of the male DNA profile
even though it was not a complete profile. This male profile identified in the rectal swabs
would be expected to occur in approximately one in 420 trillion black, one in 670 trillion
white, or one in 2.9 quadrillion Hispanic unrelated individuals. Jove also testified the
defendant could not be excluded as a contributor to the male human DNA profile taken from
the victim’s underwear. From this evidence, he estimated that one in 5.4 quadrillion black,
one in 4.3 quadrillion white or one in 66 quadrillion Hispanic unrelated individuals could not
be excluded as male contributors. In fact, Jove had never heard of a case where the first nine
-26-
loci matched and that same person was later excluded as a possible offender.
¶ 142 The majority also concludes that the trial court’s erroneous ruling prompted the consent
defense. I completely disagree. I think it is clear that the DNA evidence disclosed to the
defense prior to trial prompted the consent defense rather than the trial court's ruling. Even
though the defendant did not testify, the jury was advised of the consent defense in opening
statements, during trial through cross-examination, during closing arguments, and then in the
final instructions on the law tendered by the judge. As a result, defendant has waived any
challenge to the database search when he argued to the jury that the victim consented to the
sexual acts.
¶ 143 It appears the denial of a motion for an “Arizona” database search has not been the
subject of a reviewing court’s decision in Illinois; however, the Maine Supreme Court
considered the denial of such a motion in the Dwyer decision. Dwyer, 2009 ME 127, ¶ 12,
985 A.2d 469. In that case, in response to defendant’s motion, the State called one witness,
Catherine MacMillan a DNA analyst for the Maine State Police crime lab. She testified that
she had never been asked to perform a search prior to that time, but it would be problematic
for a number of reasons. MacMillan said the Maine database had twins, relatives, and
duplicate samples within the database, so one would expect profiles to match based on those
facts. Dwyer, 2009 ME 127, ¶ 14, 985 A.2d 469. The Maine trial court found that a
comparison would not be reliable for those very reasons, pointing out that the results of the
DNA comparison in Dwyer’s case were produced, as in other cases using FBI population
studies, not only the limited information from a state database. Dwyer, 2009 ME 127, ¶ 17,
985 A.2d 469.
¶ 144 On appeal, the Maine Supreme Court affirmed that ruling and noted that the expert gave
logical reasons for her opinion that a comparative analysis would not produce scientifically
reliable results. It concluded that the trial court did not abuse its discretion considering the
limited evidence available to the court on the question of reliability.
¶ 145 Because defendant has not demonstrated that 9-loci pair-wise comparisons call into
question the product rule or the validity of the random match probability calculations
testified to by Jove, the trial court did not commit any error when it denied the motion for a
database search. Because there was no error, there can be no plain error.
¶ 146 Defendant’s next claim that the trial court improperly limited his right to cross-examine
Jove regarding the Arizona database search is, in my opinion, also forfeited. It is forfeited
primarily because there was no offer of proof made to preserve the issue at trial and on
appeal.
¶ 147 The purpose of an offer of proof is to disclose to the trial judge the nature of offered
evidence and to enable a reviewing court to determine whether the exclusion of the evidence
was proper. People v. Andrews, 146 Ill. 2d 413, 420-21 (1992). The failure to make an offer
of proof results in waiver of that issue on appeal. Andrews, 146 Ill. 2d at 420-21.
¶ 148 When defense counsel began to question the witness about the Arizona study, the State
immediately objected. Before defense counsel responded, the trial judge remarked that he
thought there were motions in limine regarding the study. Rather than respond further or set
forth any basis for this area of inquiry, counsel moved onto another question. The trial court
-27-
did not formally rule on the objection, nor did it actually sustain the objection. There was no
discussion of any kind after the trial judge’s initial remarks. The colloquy in this regard
simply ended. Based upon this limited exchange, the majority concludes defendant’s right
to effective cross-examination was erroneously denied. As with his request for the Illinois
database search, defendant did not present or explain to the trial judge the relevance or
significance of the results of the Arizona database study at his trial. He did not suggest how
that study called into question the DNA evidence that was presented against defendant. Nor
did he argue that the study called the product rule into question. There simply was no offer
of proof. Under these circumstances, I do not agree that the trial court committed an error,
let alone a serious or obvious error, that affected the fairness of defendant’s trial and
challenged the integrity of the judicial process.
¶ 149 By the time the defendant’s jury trial commenced both the Arizona and an Illinois
database search had been done. If these searches could have provided significant areas of
cross-examination, defense counsel would have pursued them with an offer of proof.
¶ 150 In regard to the Illinois search, the record does show that defense counsel agreed not to
question the State’s witnesses about this fact. In any event, there was no ruling that would
have precluded the use of either search by way of a defense expert. This path, however,
appears not to have been taken for the very reason that comparing a database study with the
DNA evidence would not have shed any relevant light on the other.
¶ 151 The majority has not addressed defendant's other claims on appeal because of the reversal
and remand. In my opinion, those claims would not warrant a reversal of defendant’s
conviction and I would affirm.
¶ 152 Based upon the foregoing, I respectfully dissent from the decision to reverse and remand
for a new trial.
-28-
|
1. Field of the Invention
The present invention relates to a PFC (power factor correction) LED (light emitting diode) driver, especially to a PFC LED driver capable of reducing flicker.
2. Description of the Related Art
In present LED lighting applications, LED drivers are generally required to provide a PFC (power factor correction) function, that is, to make an input current in phase with a full-wave-rectified line input voltage. However, an output current flowing through an LED module will thereby tend to have a large current ripple, which causes an annoying flicker phenomenon and degrades luminous efficiency.
To reduce the current ripple of an LED current, one solution is to utilize a two-stage PFC architecture. Please refer to FIG. 1, which illustrates a block diagram of a prior art LED driver having a two-stage PFC architecture. As illustrated in FIG. 1, the prior art LED driver includes a bridge rectifier 110, a PFC converter 120, a bulk capacitor 130, and a PWM converter 140, and an LED module 150 is driven by the prior art LED driver.
The bridge rectifier 110 is used to generate a full-wave-rectified line input voltage VIN according to an AC power VAC.
The PFC converter 120 is used to force an input current IIN to track the full-wave-rectified line input voltage VIN to achieve power factor correction, and at the same time provide a loosely regulated DC voltage VB on the bulk capacitor 130.
The PWM converter 140, of which the operation is independent of that of the PFC converter 120, is used to convert the loosely regulated DC voltage VB to a DC current IOUT to drive the LED module 150.
Although the two-stage PFC architecture is capable of providing a required power factor and reducing the current ripple of an output current, and thereby the flicker, for an LED module, it has the disadvantages of being expensive and bulky.
Another solution is to utilize a single stage PFC constant average current converter to drive an LED module with a very large capacitor in parallel with the LED module. The single stage PFC constant average current converter is responsible for forcing an input current to track a full-wave-rectified line input voltage and regulating the average value of an output current at a preset value for the LED module, and the very large capacitor is responsible for reducing the current ripple of the output current. However, the very large capacitor is bulky and its performance on ripple reduction is still not good enough.
To solve the foregoing problems, a novel PFC LED driver is needed.
|
Transmitter release from vertebrate hair cells occurs at ribbon synapses where glutamate-containing vesicles fuse with the plasma membrane upon a rise in cytoplasmic calcium. Voltage-sensitive calcium channels are gated by receptor potentials to cause transmitter release that then triggers action potentials. Remarkably, in the mammalian cochlea each afferent neuron makes a single postsynaptic contact with an inner hair cell, where usually a single ribbon provides the requisite glutamate release. Thus, throughout the lifetime of the organism, a single ribbon synapse is responsible for signaling all that neuron can report to the brain concerning the frequency, timing and intensity of sound, including spontaneous activity as high as 100 Hz in the absence of sound! How does an individual ribbon carry out this task? Recent synaptic recordings from single afferent dendrites have suggested that the gating of single VGCCs is critical for information transfer at the ribbon synapse. Hair cell VGCCs are dihydropyridine-sensitive, rapidly gating at relatively negative membrane potentials, and show little inactivation in most studies. There is good evidence that the majority of VGCCs in mammalian inner hair cells contain the Cav1.3 (a1D) pore-forming subunit. However, heterologous expression of that gene product results in channels whose properties differ variously from those of the native hair cell VGCCs. Most notably, the cloned channel shows robust calmodulin-dependent calcium inactivation. Several possibilities exist to explain this difference, including alternative splicing of Cav1.3 mRNA in hair cells, and combination with various modulatory proteins. In this proposal we will combine the expertise of three laboratories to examine these possibilities. Dr. Tuck Wah Soong will use his technique of exon-scanning to characterize alternative splicing in cochlear hair cells. Dr. David Yue will apply his knowledge to develop further hypotheses of calmodulin and calmodulin-like protein modulation of hair cell VGCCs. The Fuchs laboratory will complete basic descriptions of GDI in cochlear hair cells, provide materials for gene-amplification by Soong, and together with Yue and Soong, employ new molecular tools in to alter native VGCCs in hair cells. The steady-state and dynamic gating of VGCCs will be determined by the balance of calcium-dependent inactivation and opposing mechanisms. Our ultimate aim will be to derive the contribution of VGCC gating to hair cell information transfer.
|
Documentation
This is the main export here. We take a list of aliases for the
environment and a String to parse. The return type is Right
[Command] if parsing succeeded and Left (String,Bool) upon
failure. The Bool is True when the error was fatal/unrecoverable.
|
London's Little Gardens: Geffrye Museum's Herb Garden
We plonk ourselves down on a seat and within seconds, a squirrel has tightrope-walked his way along the back of the bench, perched tentatively on our shoulder and given us a good sniff, bold as you like. Deciding we're of no interest, he totters off to a nearby bin, dives in head first, and comes back with a sandwich (ham and cheese, we later discover) which he proceeds to unwrap and munch his way through.
We've been to the Geffrye Museum before, but this is the first time we've acquainted ourselves with the wildlife. We're in the front garden, on Kingsland Road, an expanse of green lawn, flanked by the almshouses which form the core of the museum itself.
Aged trees filter the flickering sunlight. Benches are full of office workers lunching, pensioners reading newspapers, toddlers letting off steam. A circus group is practising on the lawn, all multi-coloured hula hoops and flying streamers.
But the front garden isn't what we're here to see, and we proceed round the left side of the building to the museum's lesser-known herb gardens.
The first thing of note are three tombstones. They're set in a rather dark and dingy corner, a damp spot which rarely gets any sunlight. Officially, it's known as the Ironmongers' Graveyard (the museum is situated in the former Geffrye's Almshouse of the Ironmongers' Company). The remains of Sir Robert and Lady Geffrye are buried here, along with Thomas Bethon, a member of the Ironmonger's Company, and Maria Chapman, a matron of the almshouses. It's a foreboding welcome to the gardens, but do persevere.
Pass the plaque marking the time capsule on your right — the time capsule itself is of course buried deep — and head deeper in. Entering the walled garden feels like a secret in itself — it's the stuff childhood dreams are made of, a black wooden door pinned back against the brickwork acting as an invite inside.
The walled garden is split into quadrants, a pergola-covered bench nestled into each of the four walls. A brick pathway skirts the edge of the garden, and criss crosses the middle. The sun beats down on the trickling central fountain. The fragrant smell — jasmine? honeysuckle? — is enough to put us in mind of the countryside — excluding, of course, the Overground trains gliding past on the tracks just a few metres above. A closer look at the green floor tiles surrounding the fountain reveals dedications to the people and organisations who helped create it.
Outside of the walled garden, the herbs continue. Considerable thought has gone into the garden — it's organised into time periods, as is the museum. Each plant is carefully labelled, some more alarmingly than others, and historical research has gone into getting an accurate layout for each time period. By the time we reach the late-Georgian period, the smell of freshly-baked cookies from the museum's cafe is almost too much to bear.
We'll be honest; this isn't our first trip to the Geffrye Museum's gardens. The wisteria of a few weeks ago has died off, but the gardens as a whole are greener, more luscious now in May.
Focus is very much on herbs and historical accuracy rather than aesthetics, so it's not London's most colourful garden — but it does get increasingly vibrant towards the far end of the brick footpaths.
At the end of the path, a 'No Entry' signs appear on the gate, despite the garden seeming to continue beyond — and then we see why:
The other side of the short hedge is a cluster of beehives, visible to the public but at a safe distance. It's clearly working. The whole area is a hive of activity. Bees and wasps swarm the plants, butterflies flutter by — and schoolchildren arrive en-masse at Hoxton station opposite, ready for a day at the museum.
The garden's been open since the early 1990s. Prior to this, the land was derelict. A team of gardeners is hard at work today, stopping long enough to be complimented by a visitor on their efforts so far.
Despite the constant arrival of trains at the station opposite, and the rumble of traffic on Kingsland Road, you could do a lot worse than spending a summer's afternoon among the herbs, bees and squirrels of the Geffrye Museum's garden.
|
Attomole sensitivity for unlabeled proteins and polypeptides with on-chip capillary electrophoresis and universal detection by interferometric backscatter.
A universal detector based on backscatter interferometry has been developed to perform nanoliter volume refractive index measurements for on-chip sodium dodecyl sulfate (SDS) gel based (polyethylene oxide gel) separations and quantification label-free proteins. The on-chip interferometric backscatter detector (OCIBD) system consists of a simple, folded optical train based on the interaction of a laser beam with an etched channel in the shape of half cylinder in a fused-silica plate. The backscattered light from the channel takes on the form of a high-contrast interference pattern that contains information related to the bulk properties of the fluid located within the probe or detection volume of 2.32 x 10(-9) L. Depending on capillary electrophoresis (CE) injection method, the positional changes of the interference pattern extrema (fringes) allow for the quantification of unlabeled proteins at levels ranging from 11 to 310 amol (2.7 x 10(-8)mol/L) with a linear dynamic range of 2.5 decades (egg albumin). Using OCIBD microchannel-based SDS capillary gel electrophoresis (SDS/CGE), separation and detection of five label-free proteins was achieved in less than 100 seconds with detection limits ranging from 0.95 pg (1.1 x 10(-16)mol or 2.5 x 10(-7)mol/L) of calmodulin to 7.0 pg (1.0 x 10(-16)mol or 2.4 x 10(-7)mol/L) for bovine serum albumin (BSA) without signal filtering or active thermal control. This development shows that a universal detector based on backscatter interferometry can be used effectively for on-chip label-free solute analysis.
|
Most pet bird species originate in the tropics,where sunlight averages 12 hours per day. Their bodies rely on the
abundant sunlight to drive feeding, sleeping, breeding, and molting
schedules, as well as growth and overall behavior.
However,
because of artificial lighting, most pet birds receive far more than
12 hours of light. Plus, artificial light provides lower quality light
than sunlight.
|
Roy Hodgson Announces England Squad For European Championship
Arsenal youngster Alex Oxlade-Chamberlain has been included in Roy Hodgson's England squad for the European Championship.
Liverpool flop Stewart Downing is another surprise inclusion, with club team-mate Steven Gerrard captaining his country for a second successive international tournament.
Hodgson, 64, confirmed the omission of Rio Ferdinand and Micah Richards, originally reported on Tuesday night.
Look out for the Ad just below here
Article continues after the advertisement
Oxlade-Chamberlain is the youngest member of the squad and one of two uncapped members. Norwich goalkeeper John Ruddy is the other uncapped newbie.
Hodgson explained how Oxlade-Chamberlain's performance against AC Milan's Andrea Pirlo and Massimo Ambrosini in the Champions League played a significant part in his selection. Pirlo, of course, plays for Juventus.
Hodgson said Terry's trial at Westminster Magistrates' Court was irrelevant in his decision.
"He is an innocent man until proven guilty," Hodgson said. "So my decision with John Terry was based purely on footballing matters. I realise there will be raised eyebrows."
Richards' exclusion is baffling after he enjoyed a resurgence in form for Manchester City during their Premier League-winning season.
He played 37 games for the Citizens throughout the campaign and was expected to make the squad as the second right-back to Kyle Walker. The Tottenham defender however is out injured with a broken toe.
Richards' omission now ensures Glen Johnson will start in defence, despite defensively unconvincing during his career. Manchester United's Phil Jones, who prefers to play at centre-back, appears to be the cover for the 27-year-old.
Downing meanwhile has endured a miserable season at Anfield. The former Aston Villa did not score a goal or provide a single assist in the Premier League - less on both counts than Everton goalkeeper Tim Howard.
The Football Association have often cited their desire to follow Spain's lead on producing technically sound players, yet Hodgson overlooking Michael Carrick and Adam Johnson contradicts their idealism.
|
Cubs Edge Phils 3-1 Schmidt Draws Cheers
July 02, 1985|by TED MEIXELL, The Morning Call
trotted to his position at first base wearing a long brown wig and dark sunglasses.
But, had he somehow contrived to smash a three-run home run with two outs and two on in the bottom of a high theater ninth inning to beat Lee Smith and the Cubs, he'd have made a whole stadium full of buddies - 23,091, to be exact.
Alas, what came to pass wasmore like a rerun of "Casey at the Bat." Yes, Mighty Schmitty struck out. And the Mudville Nine . . . er, Phillies . . . lost, 3-1.
Frankly, the whole thing came down to a conclusion that made one seem it had to be written in advance. The only hitch was, the uncooperative Mr. Smith, apparently figuring his 17th save was more important than going along with the program, ad libbed an unwanted ending.
By now, of course, Schmidt's two-month old negative remarks about Phillie fans to a Montreal reporter have been more than adequately chronicled. Frankly, they've been overkilled. The classic example of making mountains out of molehills.
Nevertheless, Schmidt knew darn well the crowd would herald his return from the Northland with something other than cordiality. So he used his "disguise" to try and defuse the situation.
The crowd's ugly mood was quickly confirmed, before Schmidt even left the dugout: when public address announcer Dan Baker called Schmidt's name while reading off the Phils' lineup, a loud chorus of Philadelphia's favorite noise greeted it.
One of Baker's 1985 innovations is to call out the Phils' names as they emerge from the dugout, position-by-position, and trot onto the field. What followed was comical: as Schmidt's name was called, the boos began once again. But as the crowd, almost as one, saw Schmidt's impromptu costume, the boos instantly turned to cheers. Incredibly, it swelled to almost a standing ovation.
"No, I didn't mind that at all," manager John Felske said. "That was before the game started; once the game started it was all business. Hey, I think Schmitty had to do something to take the pressure off. He knew the fans would be mad, he figured he had to do something, and I think it worked."
Indeed. While he wasn't cheeredwhen he struck out in the bottom of the first with Rick Schu at second base, he wasn't booed with much gusto, either. He was cheered lovingly when he singled in the third, when he lined sharply to center in the fifth and again when he singled to deep third to load the bases in the seventh.
And then came the high camp ninth inning. Thanks to a couple of unearned runs (Schu hit Billy Hatcher in the shoe with his throw to the plate in the first, and Schmidt's throwing error set up a sacrifice fly by Ryne Sandberg in the ninth) and Steve Lake's inartistic but successful suicide squeeze bunt in the sixth, the Cubs enjoyed a 3-1 lead. The fireballing Smith was on the mound.
But Von Hayes pinch hit a bloop single to center and, after pinch hitter Derrell Thomas and Juan Samuel both struck out, Big Lee walked Tim Corcoran (the third pinch hitter of the inning) on four pitches. With Schmidt crouched on deck, the whole scene seemed unreal, almost contrived.
As he strode to the plate, the crowd went nuts, cheering madly. When Smith jumped ahead in the count 0-2 with a couple of 95 mph fastballs, they picked up the chant, "Let's go Mike, let's go Mike, let's go Mike."
Smith threw a hard slider into the dirt, and Schmidt fouled off a high hard one. But the high drama ended on a low note when Schmidt swung mightily at an 84 mph slider - and missed.
Incredibly, the crowd booed. Very loud.
One of the quotes the Montreal writer attributed to Schmidt was that, although he in the past felt badly about the booing, "This year I couldn't care less."
He may have said it, but you can book this: he didn't mean it. One look at Schmidt slumped forlornly in front of his locker as the media trooped into Felske's office told that most eloquently.
Later, when the media vultures swooped over the carcass, the first question was, "How bad did you want to get a base hit?"
"Well," he said, "awfully bad. I knew I was gonna get to hit when I was the fifth batter (of the ninth inning). Something just told me things were gonna work out so that I'd get a chance to do something neat, you know, on a night like this.
"I got the chance, and all I can tell you is I got a couple good pitches to hit. But I just swung too hard at them, tried too hard. What else can I say?"
What else, indeed?
To be accurate, the game was not lost on Schmidt's final strikeout. There were, for instance, the two unearned runs that ruined an excellent seven- inning performance by loser John Denny (5-6). There was the squeeze bunt, of which Felske said, "Yeah, we thought of a pitchout. But we couldn't get Ozzie's (catcher Virgil's) attention in time."
And there were two other innings - the third and seventh - when the Phils had the opportunity to lay waste to Cub starter and winner Ray Fontenot (3-3).
In the third, Schu reached on Larry Bowa's error and Schmidt singled, with no out. But Glenn Wilson bounced to short, with both runners advancing, Virgil fanned and Garry Maddox grounded to third.
In the seventh, singles by pinch hitter Luis Aguayo, Schu and Schmidt loaded the bases with one out. But Wilson lashed a broken-bat, semi-line drive to Bowa, and Schu, who had unwisely broken with the crack of the bat, was doubled off.
"It's the same problem we've had all year," Felske said. "We didn't hit when we had the chances. We didn't play well defensively. And Ricky (Schu) made a mistake on that ball Glenn hit. He had nowhere to go. In that situation, he's got to make sure the ball goes into the outfield."
Forget all the Mighty Casey drama stuff. Felske's comments were the bottom line.
|
Q:
What are the criteria for partial fractions?
Consider the example of
$$1\over (u^2 - 1)(u+1)$$.
$${Au + B\over u^2 - 1} + {C \over u + 1} = {Au^2 + Au + Bu + B + Cu^2 - C\over (u^2 - 1)(u+1)} = {1\over (u^2 - 1)(u+1)}$$
$$\begin {cases}A + C =0 \\ A + B = 0\\ B - C = 1\end{cases}$$
Adding $3$ and $1$,
$$\begin {cases}A + B =1 \\ A + B = 0\end{cases}$$
The degree of denominator is $3$ and that of numerator is $0$, so I should not have got inconsistent group of equations.
What are the criteria for partial fractions ? what am I missing in this example ?
Also Wolfram Alpha gives proper partial fraction of the following.
A:
Let's change variables to make things clearer (won't affect the theory, of course). If we put $1+u=x$, the original fraction becomes
$$ \frac{1}{((x-1)^2-1)x} = \frac{1}{(x^2-2x)x} = \frac{1}{x^2(x-2)}. $$
Now, your question boils down to what happens when we add two fractions
$$ \frac{A}{x}+\frac{Bx+C}{x(x-2)}. $$
But we can put them over the common denominator $x(x-2)$, so
$$ \frac{A}{x}+\frac{Bx+C}{x(x-2)} = \frac{Ax-2A+Bx+C}{x(x-2)} = \frac{(A+B)x-2A+C}{x(x-2)}! $$
So this is the problem: no matter what polynomial we put on top of these fractions, they will never produce a denominator that is $x^2(x-2)$!
Okay, what about
$$ \frac{A}{x^2} + \frac{Bx+C}{x(x-2)}? $$
This looks better, since we have to put it over a common denominator $x^2(x-2)$. Then we get
$$ \frac{Ax-2A+Bx^2+Cx}{x^2(x-2)}. $$
Therefore we're forced to take $B=0$. We also have to get rid of the $x$ term, so $A=-C$. Then you can choose $A$ in order to get $-2A=1$, so
$$ \frac{-1/2}{x^2} + \frac{1/2}{x(x-2)} $$
is a valid partial fraction decomposition for $1/x^2(x-2)$ (and equally,
$$ \frac{-1/2}{(1+u)^2} + \frac{1/2}{u^2-1} = \frac{1}{(u+1)(u^2-1)}). $$
|
Announcing .NET Core 3.0 Preview 7
Richard
July 23rd, 2019
Today, we are announcing .NET Core 3.0 Preview 7. We’ve transitioned from creating new features to polishing the release. Expect a singular focus on quality for the remaining preview releases.
Download .NET Core 3.0 Preview 7 right now on Windows, macOS and Linux.
ASP.NET Core and EF Core are also releasing updates today.
Visual Studio users need Visual Studio 2019 16.3 Preview 1 to use .NET Core 3.0 Preview 7.
The Microsoft .NET Site has been updated to .NET Core 3.0 Preview 7 (see the version displayed in the website footer). It’s been running successfully on Preview 7 for over two weeks, on Azure WebApps (as a self-contained app). We will likely move the site to Preview 8 builds in a couple of weeks.
ICYMI, check out the improvements we released in .NET Core 3.0 Preview 6 and the June Update on WPF, both from last month.
Go Live
NET Core 3.0 Preview 7 is supported by Microsoft and can be used in production. We strongly recommend that you test your app running on Preview 7 before deploying Preview 7 into production. If you find an issue with .NET Core 3.0, please file a GitHub issue and/or contact Microsoft support.
We intend to make very few changes after Preview 7 for most APIs. Notable exceptions are: WPF, Windows Forms, Blazor and Entity Framework. Any breaking changes after Preview 7 will be documented.
We are working to ensure a high degree of compatibility with .NET Core 1.x and 2.x apps, making it straightforward to upgrade existing apps to .NET Core 3.0.
.NET Core SDK Size Improvements
The .NET Core SDK is significantly smaller with .NET Core 3.0. The primary reason is that we changed the way we construct the SDK, by moving to purpose-built “packs” of various kinds (reference assemblies, frameworks, templates). In previous versions (including .NET Core 2.2), we constructed the SDK from NuGet packages, which included many artifacts that were not required and wasted a lot of space.
You can see how we calculated these file sizes in the .NET Core 3.0 SDK Size Improvements gist. Detailed instructions are provided so that you can run the same tests in your own environment.
.NET Core 3.0 SDK Size (size change in brackets)
Operating System Installer Size (change) On-disk Size (change) Windows 164MB (-440KB; 0%) 441MB (-968MB; -68.7%) Linux 115MB (-55MB; -32%) 332MB (-1068MB; -76.2%) macOS 118MB (-51MB; -30%) 337MB (-1063MB; -75.9%)
The size improvements for Linux and macOS are dramatic. The improvement for Windows is smaller because we have added WPF and Windows Forms as part of .NET Core 3.0. It’s amazing that we added WPF and Windows Forms in 3.0 and the installer is still (a little bit) smaller.
You can see the same benefit with .NET Core SDK Docker images (here, limited to x64 Debian and Alpine).
Distro 2.2 Compressed Size 3.0 Compressed Size Debian 598MB 264MB Alpine 493MB 148MB
Closing
The .NET Core 3.0 release is coming close to completion, and the team is solely focused on stability and reliability now that we’re no longer building new features. Please tell us about any issues you find, ideally as quickly as possible. We want to get as many fixes in as possible before we ship the final 3.0 release.
We recommend that you start planning to adopt .NET Core 3.0. This recommendation is stronger if you are using containers. The 3.0 improvements for containers are critical for anyone using docker resource limits directly or via an orchestrator.
If you install daily builds, please read an important PSA on .NET Core master branches.
|
Q:
Getting automation error while executing a procedure via VBA ADODB Recordset
Private Sub Check_FLag_Click()
Dim cnf As ADODB.Connection
Dim rsf As ADODB.Recordset
Dim rsf_t As ADODB.Recordset
Dim mtxDataf As Variant
Dim mtxDatasf As Variant
Dim mtxDatatf As Variant
Dim i_f As Integer
Dim answer As Integer
Dim sqlstr As String
Set cnf = New ADODB.Connection
Set rsf = New ADODB.Recordset
Set rsf_t = New ADODB.Recordset
cnf.Open ( _
"User ID=x1xxxx" & _
";Password=x2xxxxx" & _
";Data Source=x3xxxx" & _
";Provider=OraOLEDB.Oracle")
mtxDatasf = ThisWorkbook.Sheets("Sheet3").Range("A1").Value
rsf.Open (mtxDatasf), cnf, adOpenStatic
mtxDataf = rsf.RecordCount
Worksheets(1).Activate
If CDec(mtxDataf) = 0 Then
ActiveSheet.Range("D5") = "Done - FLag is N for all model"
Else
ActiveSheet.Range("D5") = "No. of models having flag as Y " & mtxDataf
answer = MsgBox(Join$(Split(Range("F5").Value, vbCrLf), " ") & " are having flag as Y. Do you want to update it now?", vbYesNo + vbQuestion)
If answer = vbYes Then
Do While Not rsf.EOF
i_f = 0
mtxDatatf = mtxDatatf & rsf.Fields(i_f).Value & vbCrLf
sqlstr = "exec JI_" & rsf.Fields(i_f).Value & "_DBA.ke_var_pkg.k_var_rec('UPD','KE_RECLOG','a.flag = ''N'''); COMMIT;"
Set rsf_t = cnf.Execute(sqlstr)
rsf.MoveNext
Loop
ActiveSheet.Range("F5") = mtxDatatf
End If
End If
'Cleanup in the end
Set rsf = Nothing
Set cnf = Nothing
Set rsf_t = Nothing
End Sub
I am calling a procedure which will update a flag to 'N' but getting Automation error at Set rsf_t = cnf.Execute(sqlstr) statement. Is the way of executing procedure is incorrect in my code? Not getting what is the issue here. I'd appreciate any help towards a solution for my problem.
A:
To receive a recordset from a PL/SQL stored procedure with OraOLEDB Provider, you have to set PLSQLRSet property to TRUE.
See example from docs (OraOLEDB Custom Properties for Commands):
Example: Setting the Custom Property PLSQLRSet
Dim objRes As NEW ADODB.Recordset
Dim objCon As NEW ADODB.Connection
Dim objCmd As NEW ADODB.Command
....
objCmd.ActiveConnection = objCon
objCmd.CommandType = adCmdText
' Enabling the PLSQLRSet property indicates to the provider
' that the command returns one or more rowsets
objCmd.Properties("PLSQLRSet") = TRUE
' Assume Employees.GetEmpRecords() has a REF CURSOR as
' one of the arguments
objCmd.CommandText = "{ CALL Employees.GetEmpRecords(?,?) }"
' Execute the SQL
set objRes = objCmd.Execute
' It is a good idea to disable the property after execute as the
' same command object may be used for a different SQL statement
objCmd.Properties("PLSQLRSet") = FALSE
Adapted to your code:
Private Sub Check_FLag_Click()
Dim cnf As ADODB.Connection
Dim rsf As ADODB.Recordset
Dim rsf_t As ADODB.Recordset
Dim mtxDataf As Variant
Dim mtxDatasf As Variant
Dim mtxDatatf As Variant
Dim i_f As Integer
Dim answer As Integer
Dim sqlstr As String
Set cnf = New ADODB.Connection
Set rsf = New ADODB.Recordset
Set rsf_t = New ADODB.Recordset
cnf.Open ( _
"User ID=x1xxxx" & _
";Password=x2xxxxx" & _
";Data Source=x3xxxx" & _
";Provider=OraOLEDB.Oracle")
mtxDatasf = ThisWorkbook.Sheets("Sheet3").Range("A1").Value
rsf.Open (mtxDatasf), cnf, adOpenStatic
mtxDataf = rsf.RecordCount
Worksheets(1).Activate
If CDec(mtxDataf) = 0 Then
ActiveSheet.Range("D5") = "Done - FLag is N for all model"
Else
ActiveSheet.Range("D5") = "No. of models having flag as Y " & mtxDataf
answer = MsgBox(Join$(Split(Range("F5").Value, vbCrLf), " ") & " are having flag as Y. Do you want to update it now?", vbYesNo + vbQuestion)
If answer = vbYes Then
Do While Not rsf.EOF
i_f = 0
mtxDatatf = mtxDatatf & rsf.Fields(i_f).Value & vbCrLf
sqlstr = "exec JI_" & rsf.Fields(i_f).Value & "_DBA.ke_var_pkg.k_var_rec('UPD','KE_RECLOG','a.flag = ''N'''); COMMIT;"
Dim cmd as ADODB.Command
Set cmd as New ADODB.Command
Set cmd.ActiveConnection = cnf
cmd.CommandType = adCmdText
cmd.Properties("PLSQLRSet") = TRUE
cmd.CommandText = sqlstr
Set rsf_t = cmd.Execute
cmd.Properties("PLSQLRSet") = FALSE
rsf.MoveNext
Loop
ActiveSheet.Range("F5") = mtxDatatf
End If
End If
'Cleanup in the end
Set rsf = Nothing
Set cnf = Nothing
Set rsf_t = Nothing
End Sub
|
U.S. Sen. Barbara Boxer, D-Calif., who co-chairs the Senate Military Family Caucus, wrote today to the Air Transport Association of America asking for the airline industry group to help establish and communicate a clear and consistent checked baggage policy across all airlines for active duty military personnel.
Boxer’s letter was prompted by the recent disclosure that Delta Air Lines charged a group of active duty military personnel a total of $2,800 in baggage charges as they flew home from serving in Afghanistan. Delta already has amended its policies, but Boxer wants the entire industry on the same page.
“I urge you to work with the airlines to communicate a clear, consistent approach to both active duty military and airline personnel, which will help our service members get the treatment they deserve,” the senator wrote.
I was disturbed to read news accounts about a group of active duty military personnel who were charged $2,800 in extra bag fees while on a Delta flight returning from a deployment in Afghanistan. Because Delta limited them to three checked bags, they were forced to pay $200 each to check a fourth bag.
It is troubling that the welcome home for these soldiers after an overseas deployment consisted of confusion at the Delta ticket counter followed by a $200 charge – a fee that is truly a hardship for our military men and women and their families.
Delta has sought to address this unfortunate situation by announcing a new baggage policy for active duty military personnel that will permit four complimentary checked bags. Still, this incident serves as a reminder of the need for a clearly defined and consistent approach across all air carriers for baggage checked by active duty military personnel on travel orders.
As the nation’s oldest and largest airline trade association, the Air Transport Association of America is uniquely positioned to ensure that all carriers take the necessary steps to meet the needs of our troops. I urge you to work with the airlines to communicate a clear, consistent approach to both active duty military and airline personnel, which will help our service members get the treatment they deserve.
I know we all agree that after lengthy overseas deployments which require our service members to carry hundreds of pounds of equipment, the last thing they should face is excessive baggage fees and a lack of clarity in an airline’s checked bag policy.
|
It's not an outright ban, which is what Russia threatened Telegram with, and the size of the fine implies that Russia's doing this for show. Telegram founder Pavel Durov posted about the decision on the social networking site VK (which he also founded). He claims that the demands of the FSB, Russia's state security organization, are unconstitutional. What's more, they are not feasible from a technological standpoint. After all, providing backdoor access to an app isn't exactly a simple endeavor.
Durov is currently working on appealing the decision. His VK post asks any lawyers interested in this case to contact him; they will choose from the candidates in the next few days. It's not a large fine, to be sure, so Telegram could just pay it, but it's clear that Durov wants to take a stand on the issue of user privacy.
|
/*=============================================================================
Copyright (c) 2012 Paul Fultz II
aggregate.h
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
==============================================================================*/
#ifndef LINQ_GUARD_EXTENSIONS_AGGREGATE_H
#define LINQ_GUARD_EXTENSIONS_AGGREGATE_H
#include <linq/extensions/extension.h>
#include <linq/extensions/detail/function_object.h>
#include <boost/range.hpp>
#include <algorithm>
#include <numeric>
namespace linq {
//
// aggregate
//
namespace detail {
struct aggregate_t
{
//TODO: make it work for empty and single ranges
template<class Range, class Reducer>
auto operator()(Range && r, Reducer reducer) const LINQ_RETURNS
(std::accumulate(++boost::begin(r), boost::end(r), *boost::begin(r), make_function_object(reducer)));
template<class Range, class Seed, class Reducer>
auto operator()(Range && r, Seed && s, Reducer reducer) const LINQ_RETURNS
(std::accumulate(boost::begin(r), boost::end(r), s, make_function_object(reducer)));
template<class Range, class Seed, class Reducer, class Selector>
auto operator()(Range && r, Seed && s, Reducer reducer, Selector sel) const LINQ_RETURNS
(sel(std::accumulate(boost::begin(r), boost::end(r), s, make_function_object(reducer))));
};
}
namespace {
range_extension<detail::aggregate_t> aggregate = {};
}
}
#endif
|
Description: Jamal Jeffries and his trash-talking, ball-hogging, team-hating ways get him booted out of the league. When his fancy accessories--crib, cars, ultra-fine girlfriend--dribble away as quickly as his career, a desperate, financially-strapped Jamal takes his last shot at crashing the boards. Transforming himself into female power forward "Juwanna Mann," Jamal scores a tryout with the only pro organization that will take him--the women's league. It's tough enough for Jamal/Juwanna to contend with fierce competition on the court and proper protocol in the ladies' locker room, but his identity crisis hits another snag when he falls for team captain Michelle Langford. Too bad Michelle is already tight with smooth-talking lady killer Romeo, a dawg with moves sprung straight from Jamal's old bad boy playbook. And when rapper Puff Smokey Smoke tries to score with Juwanna, there are more balls in play than Jamal knows how to handle. It's gonna take more than a heavily-padded sports bra for Jamal to bounce back, but by the buzzer, he'll learn that to be a better man--and ballplayer--he's gotta get in touch with his feminine side.
|
Thiol-capped ZnO nanowire/nanotube arrays with tunable magnetic properties at room temperature.
The present study reports room-temperature ferromagnetic behaviors in three-dimensional (3D)-aligned thiol-capped single-crystalline ZnO nanowire (NW) and nanotube (NT) arrays as well as polycrystalline ZnO NT arrays. Besides the observation of height-dependent saturation magnetization, a much higher M(s) of 166 microemu cm(-2) has been found in NTs compared to NWs (36 microemu cm(-2)) due to larger surface area in ZnO NTs, indicating morphology-dependent magnetic properties in ZnO NW/NT systems. Density functional calculations have revealed that the origin of ferromagnetism is mainly attributed to spin-polarized 3p electrons in S sites and, therefore, has a strong correlation with Zn-S bond anisotropy. The preferential magnetization direction of both single-crystalline NTs and NWs lies perpendicular to the tube/wire axis due to the aligned high anisotropy orientation of the Zn-S bonds on the lateral (100) face of ZnO NWs and NTs. Polycrystalline ZnO NTs, however, exhibit a preferential magnetization direction parallel to the tube axis which is ascribed to shape anisotropy dominating the magnetic response. Our results demonstrate the interplay of morphology, dimensions, and crystallinity on spin alignment and magnetic anisotropy in a 3D semiconductor nanosystem with interfacial magnetism.
|
Welcome to Stencil Revolution! We offer a HUGE variety of reusable stencils for artists and crafters for all types. At Stencil Revolution we make ALL of our stencils right here in the USA with a laser cutter. You'll find over 1200+ different stencils for sale with up to 8 different size options to choose from. From highly detailed wall stencils to a variety of different mandala stencil designs, we've got it all. We also process all of our orders in only 1 business day. This is one area we’re extremely proud of. When you place an order, within 24 hours we’re firing up our lasers, cutting your stencil(s) and getting those babies in the mail! That means most domestic orders will be in your hands within 2-5 business days using standard shipping.
Our material
We use a 12 mil Mylar, it's the toughest, safest consumer-grade stencil material available. It's incredibly durable (tear proof) yet flexible enough to bend around surfaces if needed. Since Mylar is resistant to most solvents, it can even be washed with paint thinner! Our Mylar is also food safe, so it can be used for cookie stencils and baking.
Made with love in USA
We're a small family owned company based out of sunny Florida where we manufacture and ship ALL of our craft stencils. Every stencil we make is cut and packaged right here in the USA by one of our team. For us stencils are more than just a business. They are something we truly love and find passion in. We have to pinch ourselves sometimes because it really seems like a dream that working with stencils is actually our day job. And we get to play with lasers! This is all thanks to our amazing customers that enable our family to live a simple, purposeful life.
|
/*
* Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package com.android.settingslib.fuelgauge;
import android.app.admin.DevicePolicyManager;
import android.content.ComponentName;
import android.content.Context;
import android.content.pm.PackageManager;
import android.os.IDeviceIdleController;
import android.os.RemoteException;
import android.os.ServiceManager;
import android.telecom.DefaultDialerManager;
import android.text.TextUtils;
import android.util.ArraySet;
import android.util.Log;
import androidx.annotation.VisibleForTesting;
import com.android.internal.telephony.SmsApplication;
import com.android.internal.util.ArrayUtils;
/**
* Handles getting/changing the whitelist for the exceptions to battery saving features.
*/
public class PowerWhitelistBackend {
private static final String TAG = "PowerWhitelistBackend";
private static final String DEVICE_IDLE_SERVICE = "deviceidle";
private static PowerWhitelistBackend sInstance;
private final Context mAppContext;
private final IDeviceIdleController mDeviceIdleService;
private final ArraySet<String> mWhitelistedApps = new ArraySet<>();
private final ArraySet<String> mSysWhitelistedApps = new ArraySet<>();
private final ArraySet<String> mSysWhitelistedAppsExceptIdle = new ArraySet<>();
private final ArraySet<String> mDefaultActiveApps = new ArraySet<>();
public PowerWhitelistBackend(Context context) {
this(context, IDeviceIdleController.Stub.asInterface(
ServiceManager.getService(DEVICE_IDLE_SERVICE)));
}
@VisibleForTesting
PowerWhitelistBackend(Context context, IDeviceIdleController deviceIdleService) {
mAppContext = context.getApplicationContext();
mDeviceIdleService = deviceIdleService;
refreshList();
}
public int getWhitelistSize() {
return mWhitelistedApps.size();
}
public boolean isSysWhitelisted(String pkg) {
return mSysWhitelistedApps.contains(pkg);
}
public boolean isWhitelisted(String pkg) {
if (mWhitelistedApps.contains(pkg)) {
return true;
}
if (isDefaultActiveApp(pkg)) {
return true;
}
return false;
}
/**
* Check if it is default active app in multiple area(i.e. SMS, Dialer, Device admin..)
*/
public boolean isDefaultActiveApp(String pkg) {
// Additionally, check if pkg is default dialer/sms. They are considered essential apps and
// should be automatically whitelisted (otherwise user may be able to set restriction on
// them, leading to bad device behavior.)
if (mDefaultActiveApps.contains(pkg)) {
return true;
}
final DevicePolicyManager devicePolicyManager = mAppContext.getSystemService(
DevicePolicyManager.class);
if (devicePolicyManager.packageHasActiveAdmins(pkg)) {
return true;
}
return false;
}
public boolean isWhitelisted(String[] pkgs) {
if (ArrayUtils.isEmpty(pkgs)) {
return false;
}
for (String pkg : pkgs) {
if (isWhitelisted(pkg)) {
return true;
}
}
return false;
}
public boolean isSysWhitelistedExceptIdle(String pkg) {
return mSysWhitelistedAppsExceptIdle.contains(pkg);
}
public boolean isSysWhitelistedExceptIdle(String[] pkgs) {
if (ArrayUtils.isEmpty(pkgs)) {
return false;
}
for (String pkg : pkgs) {
if (isSysWhitelistedExceptIdle(pkg)) {
return true;
}
}
return false;
}
public void addApp(String pkg) {
try {
mDeviceIdleService.addPowerSaveWhitelistApp(pkg);
mWhitelistedApps.add(pkg);
} catch (RemoteException e) {
Log.w(TAG, "Unable to reach IDeviceIdleController", e);
}
}
public void removeApp(String pkg) {
try {
mDeviceIdleService.removePowerSaveWhitelistApp(pkg);
mWhitelistedApps.remove(pkg);
} catch (RemoteException e) {
Log.w(TAG, "Unable to reach IDeviceIdleController", e);
}
}
@VisibleForTesting
public void refreshList() {
mSysWhitelistedApps.clear();
mSysWhitelistedAppsExceptIdle.clear();
mWhitelistedApps.clear();
mDefaultActiveApps.clear();
if (mDeviceIdleService == null) {
return;
}
try {
final String[] whitelistedApps = mDeviceIdleService.getFullPowerWhitelist();
for (String app : whitelistedApps) {
mWhitelistedApps.add(app);
}
final String[] sysWhitelistedApps = mDeviceIdleService.getSystemPowerWhitelist();
for (String app : sysWhitelistedApps) {
mSysWhitelistedApps.add(app);
}
final String[] sysWhitelistedAppsExceptIdle =
mDeviceIdleService.getSystemPowerWhitelistExceptIdle();
for (String app : sysWhitelistedAppsExceptIdle) {
mSysWhitelistedAppsExceptIdle.add(app);
}
final boolean hasTelephony = mAppContext.getPackageManager().hasSystemFeature(
PackageManager.FEATURE_TELEPHONY);
final ComponentName defaultSms = SmsApplication.getDefaultSmsApplication(mAppContext,
true /* updateIfNeeded */);
final String defaultDialer = DefaultDialerManager.getDefaultDialerApplication(
mAppContext);
if (hasTelephony) {
if (defaultSms != null) {
mDefaultActiveApps.add(defaultSms.getPackageName());
}
if (!TextUtils.isEmpty(defaultDialer)) {
mDefaultActiveApps.add(defaultDialer);
}
}
} catch (RemoteException e) {
Log.w(TAG, "Unable to reach IDeviceIdleController", e);
}
}
public static PowerWhitelistBackend getInstance(Context context) {
if (sInstance == null) {
sInstance = new PowerWhitelistBackend(context);
}
return sInstance;
}
}
|
171My spirit is broken,my days are cut short,the grave awaits me.2Surely mockers surround me;my eyes must dwell on their hostility.3“Give me, O God, the pledge you demand.Who else will put up security for me?4You have closed their minds to understanding;therefore you will not let them triumph.5If anyone denounces their friends for reward,the eyes of their children will fail.6“God has made me a byword to everyone,a man in whose face people spit.7My eyes have grown dim with grief;my whole frame is but a shadow.8The upright are appalled at this;the innocent are aroused against the ungodly.9Nevertheless, the righteous will hold to their ways,and those with clean hands will grow stronger.10“But come on, all of you, try again!I will not find a wise man among you.11My days have passed, my plans are shattered.Yet the desires of my heart12turn night into day;in the face of the darkness light is near.13If the only home I hope for is the grave,if I spread out my bed in the realm of darkness,14if I say to corruption, ‘You are my father,’and to the worm, ‘My mother’ or ‘My sister,’15where then is my hope—who can see any hope for me?16Will it go down to the gates of death?Will we descend together into the dust?”
|
Q:
how to understand Bootstrap t - method
Here is the definition of bootstrap t-method in book Statistics and Data Analysis for Financial Engineering with R examples page 144. But I cannot understand:
Here $\bar{Y}$ is really the population mean (resampling), but random variable itself is not normal. How can equation (6.8) be a t-distribution approximately (I remember the condition of Gaussian is necessary for t-distribution)?
Suppose equation (6.8) is t-distribution, then why do we use $\alpha/2$ quantiles of resamples but not use the $\alpha/2$ t-value?
Confidence Interval for a General Parameter:
Basic Bootstrap Interval:
A:
Regarding question 1: In general (without additional assumptions), this statistic does not follow a t-distribution because, as you said, neither is the mean normally distributed at arbitrary sample sizes nor does the variance follow a chi-squared distribution when normality of the sample values may not be assumed (well, put aside some asymptotic considerations that do not matter for the answer of your question). The statistic is called t mainly because it is computed using a very similar formula but it does not follow a t-distribution and the text does not imply that it should. However, if normality holds, this distribution will closely resemble a t-distribution on the long run.
Regarding your question 2: Bootstrapping essentially means resampling from your sample to get an estimate of the true unknown sampling distribution of your t-statistic. Here, you estimate the sampling distribution of your t-statistic. It will be an approximate t-distribution under conditions under which the "classic" t-test would be valid and under any other conditions, it will resemble whatever the sampling distribution is. For instance, if your variable follows a skewed distribution, the bootstrap samples of t will also be skewed. Then, the t distribution is no longer your best approximate for the sampling distribution but rather your estimated distribution is. Hence, you should compute the quantiles on this distribution instead.
Does this help?
|
KAIST’s most famous and sophisticated robot began life as the KHR-0 (Korean Humanoid Robot), beginning back in 2000. The very first prototype had no head or arms, as the researchers were focused on the first and all-important task of getting it to balance on two legs. It stood 110cm tall and weighed 29kg with only 12 DOFs.
By 2002 the KHR-0 was replaced by the KHR-1, which had simple arms on an upper body. This was KAIST’s first full-size humanoid, standing 120cm tall and weighing 48kg. However, it lacked sophistication in its arms and head with only 21 DOFs (legs x6, arms x4, and 1 for waist yaw motion).
The KHR-1 was able to walk forward, shuffle sideways, turn, and balance on one leg. It was also given some PI control using FSRs in its feet, which allowed it to stabilize itself when knocked off balance by external forces by shifting its weight. Its batteries had a running time of about 1 hour.
|
Specifications TableSubjectAgricultural, chemical scienceSpecific subject areaAllelopathic effect of *Casuarina equisetifolia* leaf on seed germinationType of dataTable, figure, chartHow data were acquiredDifferent leaf aquatic extract concentrations and leaf powder were used to study the effect of *Casuarina equisetifolia* leaf on seed germination, and data were analyzed using SPSS Package 25 and MS Excel 2016.Data formatRaw, analyzedParameters for data collectionSeed germination percentage (GP), root and shoot length of selected plant crops were investigated in the lab greenhouse under different concentrations of *Casuarina* dried leaf. The pH and Electrical Conductivity (EC) of soil were tested using jenway pH and conductivity meter.Description of data collectionA four plant crops (Maize, lentil, Mustard, and Wheat) were tested for germination with different concentrations (0, 1.25%, 2.5%, and 5%) of leaf extract and (0, 15, 30 and 45 g kg^−1^) of well-dried leaf powder in the greenhouse were mixed with soil to study the seedlings inhibition effect during the study period.Data source locationInstitution: Environmental Science Center (ESC) and Department of Biological and Environmental Sciences (DBES), Qatar University\
City: Doha\
Country: Qatar\
Latitude and longitude: (25°48′27.70″N, 51°20′47.10″E)Data accessibilityThe raw data was archived in Mendeley Data <https://data.mendeley.com/datasets>\
Reserved [https://doi.org/10.17632/g8jvhmxy9h.4](10.17632/g8jvhmxy9h.4){#intref0015}\
Link to the preview <https://data.mendeley.com/datasets/g8jvhmxy9h/4>**Value of the Data**•Understanding the allelopathic effects of *Casuarina equisetifolia*-L on some plant crops (Maize, lentil, Mustard, and Wheat) germination percentage and seedling inhibition, root and shoot length.•The present dataset could be useful for concerned researchers and those who interested in cultivation, from the potential effects of crops surrounded by *Casuarina* trees in order to select the candidate most suitable plant.•Furthermore, the dataset introduced in this article can be used to investigate the possible effect of the chemicals released from *Casuarina equisetifolia* leaves on the potential of hydrogen (pH) and Electrical Conductivity (EC) of the soil.
1. Data {#sec1}
=======
Allelopathy refers to the valuable or damaging effects of a specific plant on another, both crop and weed species, by the release of chemicals from plant parts \[[@bib1]\]. Phenolics, terpenoids, and organic cyanides were reported as active allelochemicals can be leaching from leaves and stem of *Casuarina* trees and many plants to the environment \[[@bib2], [@bib3], [@bib4]\]. The current data focused on the potential effects of *Casuarina equisetifolia*-L on Maize, lentil, Mustard, and Wheat crops during the study.
An experiment was conducted to measure the germination percentage, seedling inhibition, root and shoot length under the effect of the allelochemical compounds released from *Casuarina equisetifolia* leaves on Maize, Lentil, Mustard, and Wheat crops using Petri dishes under controlled lab conditions.
The second experiment was performed using pots in the greenhouse, to study the actual effect of the fallen *Casuarina equisetifolia* leaves on the wheat crop germination and seedling in the presence of Mustard as a weed. Furthermore, the effect of soil mixed with *Casuarina equisetifolia-L* powder on (pH), and Electrical Conductivity (EC) were studied.
1.1. Petri-dish experiment {#sec1.1}
--------------------------
An aqueous leaf extract solution of *Casuarina equisetifolia*-L was added to each Petri dish to study the potential inhibition effects of germination in all crops selected. Significant effects on seeds germination were observed in the laboratory. Seedling growth results from the current study showed that the germination percentage, shoot, and root length of lentil, wheat, mustard, and maize were markedly suppressed by increasing the leaf aqueous extract concentration. ([Table 1](#tbl1){ref-type="table"}, [Table 2](#tbl2){ref-type="table"}).Table 1Means of seed germination percentage, shoot length, root length (cm), and standard deviation as influenced by different concentrations of *Casuarina* leaf extracts of Mustard and Maize.Table 1TreatmentMustardMaizeGP±SDRL±SDSL±SDGP±SDRL±SDSL±SDControl9514.83.511.112.030.3472.554.511.841.650.461.25%8514.83.210.572.320.852.512.55.030.942.260.322.50%908.62.660.822.540.47608.163.520.51.820.365%66.6712.21.560.711.970.773752.060.251.430.13[^1]Table 2Means of seed germination percentage, shoot/root length (cm), and standard deviation as influenced by different concentrations of *Casuarina* leaf extracts of lentil and Wheat.Table 2TreatmentlentilWheatGP±SDRL±SDSL±SDGP±SDRL±SDSL±SDControl10002.210.521.910.1595.004.082.680.82.290.131.25%92.59.571.570.371.050.2487.506.452.110.572.150.242.50%955.771.150.220.760.1478.752.500.250.161.620.125%808.160.660.030.590.1367.502.890.210.131.260.33[^2]
### 1.1.1. Descriptive data {#sec1.1.1}
One-way ANOVA test was done to check the growth variation between four different treatments (0, 1.25, 2.5, and 5%) in the laboratory. A significant variation in (GP) was observed between the treatments in Lentil, Mustard, and Maize while in Wheat no significant difference found ([Table 3](#tbl3){ref-type="table"}).Table 3Analysis of variance of seed germination percentage as influenced by different concentrations of *Casuarina* leaf extracts of Mustard, Maize, Lentil, and Wheat.Table 3Source of VariationDFMSMustardMaizeLentilWheatGPSLRLGPSLRLGPSLRLGPSLRLBetween3611.2[a](#tbl3fna){ref-type="table-fn"}0.282.95[a](#tbl3fna){ref-type="table-fn"}856.25[a](#tbl3fna){ref-type="table-fn"}0.49[a](#tbl3fna){ref-type="table-fn"}6.84[a](#tbl3fna){ref-type="table-fn"}289.58[a](#tbl3fna){ref-type="table-fn"}1.36[a](#tbl3fna){ref-type="table-fn"}1.72[a](#tbl3fna){ref-type="table-fn"}559.90[a](#tbl3fna){ref-type="table-fn"}0.90[a](#tbl3fna){ref-type="table-fn"}0.35[a](#tbl3fna){ref-type="table-fn"}Within12164.80.340.5768.750.111.1447.920.020.1118.230.040.24Total15[^3]
Shoot and root length variations were tested under the same treatments and conditions.
Significant variation was recorded between treatments in all seeds except Mustard shoot length (*p* \> *0.05*) at a confidence interval of 95% ([Table 3](#tbl3){ref-type="table"}).
The mean values of germination% (GP), shoot length (SL), and root length (RL) (with a standard deviation) for the studied crops were illustrated in [Fig. 1](#fig1){ref-type="fig"}Fig. 1The mean measurement data of germination percentage (GP), Root, and Shoot lengths (cm) for four crops under controlled lab conditions. (A)Mean germination %, (B)Mean root length, (C)Mean shoot length.Fig. 1
1.2. Greenhouse experiment {#sec1.2}
--------------------------
Greenhouse experiments were conducted to investigate the potential effect of *Casuarina equisetifolia* leaves on seedling growth of Wheat as a crop and Mustard as a weed with four treatments (control, 15, 30, 45 g/kg soil).
The seedling measurements of (GP, SL, and RL) were recorded weekly in three weeks. The results concluded that the growth of Wheat and Mustard plants, as indicated by germination percentage ([Table 4](#tbl4){ref-type="table"}, [Table 5](#tbl5){ref-type="table"}), showed opposite outcomes with Wheat (Stimulatory effect); the most significant germination occurred at high concentration (45 g kg^−1^) ([Fig. 2](#fig2){ref-type="fig"}).Table 4Means of germination percentage, plant characteristics, and their standard deviations of wheat as influenced by different concentrations of *Casuarina* dried leaf powder.Table 4TreatmentGP±SDSL±SDRL±SDControl97.500.505.280.335.360.5215 g/kg87.501.505.160.123.750.4230 g/kg60.001.154.420.193.500.4445 g/kg40.002.504.220.213.370.53Table 5Means of germination percentage, plant characteristics, and their standard deviations of Mustard as influenced by different concentrations of *Casuarina* dried leaf powder.Table 5TreatmentGP±SDSL±SDRL±SDControl60.004.089.604.224.080.7415 g/kg68.302.063.750.653.370.6230 g/kg58.336.133.790.573.330.9845 g/kg95.001.505.751.302.371.41Fig. 2Mean of Wheat, and Mustard germination percentage (GP) in a greenhouse under different Treatments.Fig. 2
A significant variation of seed germination percentage, shoot, and root length of wheat and Mustard between treatments were found except the Mustard root length had no differences among means (*p* \> *0,05*) at 95% confidence interval ([Table 6](#tbl6){ref-type="table"}).Table 6Analysis of variance of seed germination percentage, shoot, and root length of wheat and Mustard as influenced by different concentrations of *Casuarina* leaf extracts of Wheat plant in the greenhouse.Table 6ANOVAdfMean SquareFSig.ANOVAdfMean SquareFSig.Wheat (GP)Between Groups32741.6**1074.5**[a](#tbl6fna){ref-type="table-fn"}.000Mustard (GP)Between Groups31151.22**75.952**[a](#tbl6fna){ref-type="table-fn"}.000Within Groups122.55Within Groups1215.16Total15Total15Wheat (SL)Between Groups31.12**24.39**[a](#tbl6fna){ref-type="table-fn"}.000Mustard (SL)Between Groups330.22**6.067**[a](#tbl6fna){ref-type="table-fn"}0.009Within Groups120.046Within Groups124.98Total15Total15Wheat (RL)Between Groups33.41**14.68**[a](#tbl6fna){ref-type="table-fn"}.000Mustard (RL)Between Groups31.9712.0150.166Within Groups120.23Within Groups120.979Total15Total15[^4]
Two physical parameters (pH and EC) of soil were tested under the effect of *Casuarina* dry leaves that were mixed with soil in different concentrations ([Table 7](#tbl7){ref-type="table"}).Table 7Means of pH, the electrical conductivity of soil, and their standard deviations as influenced by different concentrations of *Casuarina* leaf extracts of wheat and Mustard experiment in a greenhouse.Table 7TreatmentpH±SDEC±SDControl8.500.20659.5108.2015 g/kg8.400.42709.526.6030 g/kg7.710.201054156.2545 g/kg7.810.301154233.39
The mean of measured pH values of soil was decreased gradually with increasing the treatment concentration, while the mean of EC was on the contrary ([Fig. 3](#fig3){ref-type="fig"}).Fig. 3A-line chart of pH and EC under the effect of four different treatments.Fig. 3
ANOVA test represents a noted variation (*p* \> *0.05*) between treatments in both pH and EC parameters. ([Table 8](#tbl8){ref-type="table"}).Table 8Analysis of variance of pH and electrical conductivity of soil as influenced by different concentrations of *Casuarina* leaf extracts of Wheat and Mustard experiment in a greenhouse.Table 8ANOVAdfMean SquareFSig.pHBetween Groups3.648**7.10**[a](#tbl8fna){ref-type="table-fn"}.005Within Groups12.091Total15ECBetween Groups3242973.67**10.66**[a](#tbl8fna){ref-type="table-fn"}.001Within Groups1222784.62Total15[^5]
2. Experimental design, materials, and methods {#sec2}
==============================================
The treatments were organized in a completely randomized design (CRD) with four replicates in each set. In the Petri dish experiment, each single petri dish was considered as a replicate. Moreover, in the greenhouse experiment, each pot is considered one replicate
2.1. Preparation of aqueous extract of *Casuarina equisetifolia*-L {#sec2.1}
------------------------------------------------------------------
Fresh leaves of *Casuarina equisetifolia* were collected from the area surrounding the College of Arts and Sciences, Qatar University. Leaves from mature trees were brought to the laboratory and were air-dried in the oven at 50 °C for 48 hours ([Fig. 4](#fig4){ref-type="fig"}). Then, the dried leaves were chopped into small pieces and ground into a fine powder. Distilled water was used to make plant extraction. Approximately 5 g of dried leaves powder was soaked into 50 ml distilled water followed by vigorous shaking for 48 hours at room temperature. The resulting solution was centrifuged, and the supernatant was filtered using a vacuum filter unit 1000 ml (Buchner Apparatus) to obtain a stock solution. The resulting brownish and dark extract was stored in the fridge in conical flasks until required.Fig. 4Collection of *Casuarina equisetifolia*-L. leaves.Fig. 4
Sequential dilutions were applied to the prepared stock solution to obtain three different concentrations (1.25%, 2.50%, and 5.00%) using Equation [(1)](#fd1){ref-type="disp-formula"} ([Table 9](#tbl9){ref-type="table"}), with distilled water used as a control treatment ([Fig. 5](#fig5){ref-type="fig"}).$$DF\% = \frac{Initial\ volume}{Final\ volume} \times 100$$where.Table 9Preparation of the different concentrations.Table 9Volume taken (ml)Volume up to (ml)Final concentration (DF%)12.510001.252510002.55010005Fig. 5Three different extract concentrations 1.25%, 2.50%, and 5% obtained from the stock solution of *C. equisetifolia* Leaves.Fig. 5
$DF\text{\%}$ is a final concentration percentage after dilution.
2.2. Germination test {#sec2.2}
---------------------
Seeds of four crop plants (Maize, lentil, Mustard, and Wheat) were used in the seed germination test. Healthy uniform size seeds were selected and washed thoroughly four times by distilled water to remove any chemical residues and well dried using tissue paper. 10--20 seeds of each species were placed evenly (based on seed size) in sterilized 9 cm Petri dishes lined with a double layer of Whatman filter papers. The experimental set includes four different concentration of aqueous extract 0% 1.25%, 2.50% and 5.00%. The treated Petri dishes with distilled water were taken as a control, and it was considered as a zero concentration, while others were treated with approximately 8 ml of different aqueous extracts. Petri dishes were kept undisturbed under controlled lab conditions (room temperature (24 ± 2 °C), light) on the laboratory bench until germination occurs. ([Fig. 6](#fig6){ref-type="fig"}).Fig. 6Germination test on Maize seeds by different extract concentrations.Fig. 6
2.3. Seed germination and seedling growth {#sec2.3}
-----------------------------------------
Seeds are considered germinated upon radical emergence, germination is determined by counting the number of germinated seeds each two days interval over a 6--8 days period to observe the germination rate. After eight days, the germination percentage (GP) was determined by counting the number of seeds germinated during the period of the experiment over the total number of seeds based on Equation [(2)](#fd2){ref-type="disp-formula"}, \[[@bib5]\].$$GP = \frac{Number\ of\ germinated\ seeds}{Total\ number\ of\ seeds} \times 100$$Where $GP$. Germination percentage.
Shoot length and root length were measured using a centimeter ruler by taking five seedlings at random from each petri dish.
2.4. Greenhouse experiment {#sec2.4}
--------------------------
The experiment was performed in the greenhouse to investigate the effect of *C. equisetifolia* leaves on plant growth. Two different crop plants were selected to grow together in this experiment under *C. equisetifolia* leaf residuals with different dosages. Mustard is considered as a weed plant and competition factor against wheat growth. Dried leaf powder of *C. equisetifolia* was mixed with peat moss and clay (1:4) at a rate of 15, 30, and 45 g kg^−1^ of soil, in addition to the control treatment with no leaf powder. Plastic pots of 15 cm in diameter were filled with 2 kg of soil. Ten viable seeds of wheat with fifteen seeds of Mustard were sown together in each pot. Water supplied as required to avoid water stress. Pots were arranged in a completely randomized block design with four replications ([Fig. 7](#fig7){ref-type="fig"}).Fig. 7Effect of incorporation of *C. equisetifolia* leaf powder on Wheat and Mustard (weed) germination and growth.Fig. 7
2.5. Data collection of the greenhouse experiment {#sec2.5}
-------------------------------------------------
Number of germinated seeds was observed weekly in three weeks, then germination percentage was calculated by counting the number of seeds germinated over the total number of seeds based on Equation [(2)](#fd2){ref-type="disp-formula"}, \[[@bib5]\]. After plant maturity, data were recorded for growth parameters including the number of shoots, root lengths (cm), number of spikes, plant height, fresh and dry weights (g/plant), stem diameter (mm), as well as a number of leaves. In addition, soil physical analysis was conducted Electric conductivity EC and pH. In the end, statistical analysis was conducted to all the collected results using analysis of variance and means comparisons.
Conflict of Interest {#appsec1}
====================
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
The authors want to thank Prof Hamad Al-Kuwari, Director of the ESC, for his continued help and support. All appreciations also go to Ms. Hajer Alnaimi (Technical Manager) for her assistance. This project was supported by Qatar University Internal Grant No. QUS-CAS-FALL-15/16-3. The findings achieved herein are solely the responsibility of the authors.
[^1]: Germination percentage (GP), Standard Deviation (SD), root length (RL), shoot length (SL).
[^2]: Germination percentage (GP), Standard Deviation (SD), root length (RL), shoot length (SL).
[^3]: Indicates significant differences among means at 0.05. MS; Means of squares. Germination percentage % (GP%), shoot length (SL), root length (RL).
[^4]: Indicates significant differences among means at 0.05. Germination percentage (GP), shoot length (SL), root length (RL).
[^5]: Indicates significant differences among means at 0.05. The potential of Hydrogen (pH) and Electrical conductivity (EC).
|
Instituto Federal de Educação, Ciencia e Tecnologia de Goiás
|
100 cases of Ebola-like symptoms since July
3 Oct, 2014
Hospitals around the U.S. have reported 100 cases of Ebola-like symptoms since July. A CDC official says many hospitals remain unsure about how they are supposed to react when a suspected patient shows up. Atlanta’s Emory University Hospital, which has treated several Ebola patients from West Africa, has provided information and advice to hospitals, many of which are struggling with a lack of awareness about safety protocols and fear among some workers who feel ill-prepared. Washington-area health officials say they are trying to identify gaps in preparedness plans.
Welcome to Newslines!
Newslines is a social news network that aims to give readers the complete unbiased news history of any topic. Newslines is built from NewsBlocks, a blockchain that stores news as data, allowing the creation of trusted news applications.
|
[Cite as State v. Cooper, 2016-Ohio-4730.]
IN THE COURT OF APPEALS
ELEVENTH APPELLATE DISTRICT
ASHTABULA COUNTY, OHIO
STATE OF OHIO, : OPINION
Plaintiff-Appellee, :
CASE NOS. 2015-A-0042
- vs - : 2015-A-0043
2015-A-0044
JAMES L. COOPER, : 2015-A-0045
Defendant-Appellant. :
Criminal Appeals from the Ashtabula County Municipal Court.
Case Nos. 15 TRC 00002, 15 CRB 00009, 15 TRC 00536, and 14 CRB 01357.
Judgment: Modified and affirmed as modified.
Lori B. Lamer, Assistant Ashtabula City Solicitor, Ashtabula Municipal Court, 110 West
44th Street, Ashtabula, OH 44004 (For Plaintiff-Appellee).
Edward M. Heindel, 400 Terminal Tower, 50 Public Square, Cleveland, OH 44113 (For
Defendant-Appellant).
TIMOTHY P. CANNON, J.
{¶1} Appellant, James L. Cooper, appeals from multiple judgments of the
Ashtabula Municipal Court convicting and sentencing him for five petty misdemeanor
offenses, to wit: two counts of using weapons while intoxicated, one count of
discharging firearms within city limits, and two counts of operating a motor vehicle while
under the influence (“OVI”). For the following reasons, we modify the trial court’s
judgments and affirm as modified.
{¶2} On February 10, 2015, appellant pled guilty to one count of OVI, a first-
degree misdemeanor, in violation of R.C. 4511.19(A)(1)(a); two counts of using
weapons while intoxicated, misdemeanors of the first degree, in violation of R.C.
2923.15(A); and one count of discharging a firearm within the city limits, a fourth-degree
misdemeanor, in violation of Ashtabula Municipal Ordinance §549.08(A). One
misdemeanor count of reckless operation and one felony count of improperly handling
firearms in a motor vehicle were dismissed.
{¶3} Prior to sentencing, appellant was charged with another count of OVI in
violation of R.C. 4511.19(A)(1)(h), a first-degree misdemeanor, to which he pled guilty
on July 9, 2015. Two misdemeanor counts of driving under suspension and failure to
control, in addition to a seatbelt violation, were dismissed.
{¶4} Appellant was sentenced on all five of the remaining charges, in four
separate cases, on July 9, 2015, as follows: 30 days (all suspended) for discharging a
firearm within city limits; 180 days (60 suspended) for the first offense OVI; 180 days
(90 suspended) for the second offense OVI; and 180 days (90 suspended) for each
count of using a weapon while intoxicated. The trial court ordered the sentences to be
served consecutively, such that the resulting aggregate term was 750 days (360 days
suspended). He was credited with 30 days for the first offense OVI and 30 days for
each offense of using a weapon while intoxicated. Appellant’s total time in jail, not
including his suspended sentences, was therefore 300 days, including the 30 days he
had already served awaiting sentencing.
{¶5} Appellant initially raised two assignments of error for our review:
2
[1.] The trial court erred when it sentenced Cooper to a total of 300
days in jail. The sentence constituted an abuse of discretion and
was not consistent with R.C. 2929.21 and R.C. 2929.22.
[2.] The trial court erred when it did not comply with Criminal Rule
11(E) before accepting Cooper’s guilty plea, at the plea hearing on
February 10, 2015.
This court subsequently ordered the parties to file supplemental briefs regarding the
imposition of consecutive sentences for multiple misdemeanors in excess of the
statutory maximum found in R.C. 2929.41(B)(1). Appellant filed a supplemental brief
and assigned a third error:
[3.] The trial court erred when it imposed a suspended jail sentence
in excess of eighteen months in violation of R.C. 2929.41(B)(1).
{¶6} Under his first assignment of error, appellant argues the trial court’s
imposition of the maximum sentence for each offense was an abuse of discretion.
Appellant specifically asserts the trial court failed to consider the misdemeanor
sentencing criteria found in R.C. 2929.21 and R.C. 2929.22.
{¶7} “Misdemeanor sentencing is within the discretion of the trial court and will
not be disturbed absent an abuse of discretion.” Conneaut v. Peaspanen, 11th Dist.
Ashtabula No. 2004-A-0053, 2005-Ohio-4658, ¶18, citing State v. Wagner, 80 Ohio
App.3d 88, 95-96 (12th Dist.1992). The term “abuse of discretion” is one of art,
“connoting judgment exercised by a court which neither comports with reason, nor the
record.” State v. Underwood, 11th Dist. Lake No. 2008-L-113, 2009-Ohio-2089, ¶30,
citing State v. Ferranto, 112 Ohio St. 667, 676-678 (1925).
{¶8} When a trial court imposes a sentence upon a defendant for a petty
misdemeanor, and a mandatory jail term is not required, the court “has discretion to
determine the most effective way to achieve the purposes and principles of sentencing
3
set forth in section 2929.21 of the Revised Code.” R.C. 2929.22(A). “The overriding
purposes of misdemeanor sentencing are to protect the public from future crime by the
offender and others and to punish the offender.” R.C. 2929.21(A). The sentence must
also be “commensurate with and not demeaning to the seriousness of the offender’s
conduct and its impact upon the victim, and consistent with sentences imposed for
similar offenses committed by similar offenders.” R.C. 2929.21(B).
{¶9} The trial court is also required to consider criteria listed in R.C. 2929.22(B)
before sentencing a defendant on a misdemeanor. These factors include, inter alia, the
“nature and circumstances of the offense”; whether the offender has a “history of
persistent criminal activity”; whether there is a “substantial risk that the offender will
commit another offense”; whether the offender’s conduct shows a “pattern of repetitive,
compulsive, or aggressive behavior with heedless indifference to the consequences”;
whether the offender is likely to commit “future crimes in general”; and also “any other
factors that are relevant to achieving” the purposes of misdemeanor sentencing. R.C.
2929.22(B), citing R.C. 2929.21.
{¶10} Failure to consider the purposes and principles of misdemeanor
sentencing constitutes an abuse of discretion. See State v. Rogers, 11th Dist. Trumbull
Nos. 2009-T-0051 & 2009-T-0052, 2010-Ohio-197, ¶11. However, “[w]hen a
misdemeanor sentence is within the statutory limits, the trial court is presumed to have
considered the required factors, absent a showing to the contrary by the defendant.”
Peaspanen, supra, at ¶18. “Further, there is no requirement that the court state on the
record it considered the statutory sentencing criteria.” State v. Kish, 11th Dist. Lake No.
2010-L-138, 2011-Ohio-4172, ¶8, citing Peaspanen, supra, at ¶29. “A silent record
4
raises the presumption that the trial court considered all of the factors.” State v.
Peppeard, 11th Dist. Portage No. 2008-P-0058, 2009-Ohio-1648, ¶75 (citations
omitted).
{¶11} Finally, “[a] court may impose the longest jail term authorized under
section 2929.24 of the Revised Code only upon offenders who commit the worst forms
of the offense or upon offenders whose conduct and response to prior sanctions for
prior offenses demonstrate that the imposition of the longest jail term is necessary to
deter the offender from committing a future crime.” R.C. 2929.22(C) (emphasis added).
{¶12} Appellant pled guilty to four first-degree misdemeanors (two counts of OVI
and two counts of using weapons while intoxicated) and one fourth-degree
misdemeanor (discharging a firearm within city limits). Pursuant to R.C. 2929.24(A), the
maximum sentence for a first-degree misdemeanor is 180 days, and the maximum
sentence for a fourth-degree misdemeanor is 30 days. Thus, the 180-day sentences for
each first-degree misdemeanor and the 30-day sentence for the fourth-degree
misdemeanor are authorized by statute.
{¶13} At the sentencing hearing, the trial court recognized that two different
offenses were committed involving two different weapons. The trial court also had the
benefit of reviewing a pre-sentence investigation report prior to sentencing and stated
on the record that appellant is “a danger to our community,” did not “take any
responsibility for [his] actions,” and has a “lengthy juvenile court history from age 12.”
{¶14} Appellant has not rebutted the presumption that the trial court properly
considered the required sentencing criteria. In light of the seriousness of appellant’s
multiple offenses involving driving while intoxicated and the discharge of two different
5
weapons within city limits, we do not find the trial court abused its discretion by
imposing the maximum sentences authorized by statute.
{¶15} Appellant’s first assignment of error is without merit.
{¶16} Under his third assignment of error, appellant argues the trial court’s
sentence of 750 days in jail, including suspended time, violated R.C. 2929.41(B)(1).
{¶17} When consecutive sentences are imposed for multiple misdemeanors,
“the aggregate term to be served shall not exceed eighteen months.” R.C.
2929.41(B)(1). See also State v. Trainer, 2d Dist. Champaign No. 08-CA-04, 2009-
Ohio-906, ¶15; State v. Pierce, 4th Dist. Meigs No. 10CA10, 2011-Ohio-5353, ¶11.
{¶18} Some appellate districts have held that the imposition of an aggregate
term in excess of the statutory maximum is harmless error because the statute is self-
executing. These courts have refused to modify the errant sentences or remand the
cases for resentencing, instead stating it is the duty of the incarcerating authority to limit
aggregate terms by automatically releasing defendants from prison once the statutory
limit of incarceration has been served. See, e.g., State v. Barnes, 12th Dist. Clermont
No. CA2008-10-090, 2009-Ohio-3684, ¶11; and State v. Torres, 7th Dist. Mahoning No.
12 MA 203, 2013-Ohio-4167, ¶24. The Sixth District has further stated that it “need
take no action on this error beyond declaring appellant’s rights.” State v. Kesterson, 91
Ohio App.3d 263, 264 (6th Dist.1993).
{¶19} The explicit wording of R.C. 2929.41(B)(1) provides: “When consecutive
sentences are imposed for misdemeanor[s] under this division, the term to be served is
the aggregate of the consecutive terms imposed, except that the aggregate term to be
served shall not exceed eighteen months.” An aggregate term in excess of 18 months
6
imposed by a trial court is thus contrary to law. We cannot agree with our sister districts
that imposing a sentence contrary to law is harmless error.
{¶20} In addition, contrary to the Sixth District’s holding in Kesterson, we do not
have authority to enter a “declaration of rights” as the remedy for a sentencing error.
Ohio appellate jurisdiction is constitutionally limited “as may be provided by law to
review and affirm, modify, or reverse judgments or final orders of the courts of record
inferior to the court of appeals.” Ohio Constitution, Article IV, Section 3(B)(2). See also
State ex rel. Neer v. Indus. Comm. of Ohio, 53 Ohio St.2d 22, 24 (1978) (“Permitting a
Court of Appeals to give what is basically a declaratory judgment is to expand its
constitutionally declared jurisdiction.”); and R.C. 2953.07 (stating appellate courts may
affirm, reverse, or modify appealed judgments and may also remand for the sole
purpose of correcting a sentence imposed contrary to law).
{¶21} Here, appellant was sentenced to a total of 750 days (i.e., approximately
25 months), with 360 days (i.e., approximately 12 months) suspended. Therefore,
appellant is currently incarcerated for 300 days (i.e., approximately 10 months).
Although the current 10-month period is within the statutory limit, the aggregate 25-
month sentence is not. Thus, appellant’s aggregate term of imprisonment was imposed
contrary to law. The judgments of the trial court must be modified to reflect that
appellant’s aggregate term of imprisonment, including suspended time, is limited to the
statutory maximum of 18 months. If for any reason appellant’s suspended sentence is
later imposed, it must be limited to a total of 8 months (i.e., approximately 240 days).
{¶22} Appellant’s third assignment of error is well taken.
7
{¶23} Under his second assignment of error, appellant argues the trial court
failed to comply with Crim.R. 11(E) before it accepted his guilty plea at the first plea
hearing held on February 10, 2015.
{¶24} “In misdemeanor cases involving petty offenses the court may refuse to
accept a plea of guilty or no contest, and shall not accept such plea without first
informing the defendant of the effect of the pleas of guilty, no contest, and not guilty.”
Crim.R. 11(E). “Although Crim.R. 11(E) does not require the trial court to engage in a
lengthy inquiry when a plea is accepted to a misdemeanor charge involving a petty
offense, the rule does require that certain information be given on the ‘effect of the
plea.’” State v. Jones, 116 Ohio St.3d 211, 2007-Ohio-6093, ¶51. “Whether orally or in
writing, a trial court must inform the defendant of the appropriate language under
Crim.R. 11(B) before accepting a plea.” Id. When a defendant is pleading guilty, a trial
court must inform the defendant that a plea of guilty is a complete admission of guilt. Id.
at ¶25, citing Crim.R. 11(B)(1).
{¶25} “‘[F]ailure to comply with nonconstitutional rights (such as the information
in Crim. R. 11(B)(1)) will not invalidate a plea unless the defendant thereby suffered
prejudice.’” Id. at ¶52, quoting State v. Griggs, 103 Ohio St.3d 85, 2004-Ohio-4415,
¶12; see also State v. Griffey, 11th Dist. Portage No. 2009-P-0077, 2010-Ohio-6573,
¶26-27. “A defendant who has entered a guilty plea without asserting actual innocence
is presumed to understand that he has completely admitted his guilt. In such
circumstances, a court’s failure to inform the defendant of the effect of his guilty plea as
required by Crim.R. 11 is presumed not to be prejudicial.” Griggs, supra, at syllabus;
see also Jones, supra, at ¶54.
8
{¶26} Appellant was represented by counsel at the plea hearing. The following
colloquy took place on the record between the trial court and appellant:
COURT: All right. Then, I’m going to have you consult with your
attorney. Please, advise me how you’re pleading on each of those
remaining charges.
MR. COOPER: Guilty.
COURT: You understand, Mr. Cooper, that when you enter a plea
of guilty, the constitutional rights that were explained to you
previously, you recall all of those rights?
MR. COOPER: Yes.
COURT: You’re going to be giving all those rights up, all except the
right to have counsel, you do have counsel with you today. All the
rest of those rights you’re going to be giving up; the opportunity for
you to remain silent, the opportunity for you to have a trial, and to
have your guilt proved beyond a reasonable doubt. Do you want to
give up all those rights, do you, sir?
MR. COOPER: Yes.
COURT: All right. In that case, I will accept your guilty plea on
each of those charges.
{¶27} There is no mention of the language from Crim.R. 11(B)(1) that pleading
guilty is a complete admission of guilt. However, appellant did not assert his innocence
during the plea colloquy and has not presented any evidence that he claimed innocence
at the time he entered his pleas. Rather, appellant argues the trial court did not inform
him of the various pleas available, the potential penalties for any of the charges, or that
it could impose consecutive sentences and “stack the fines.” This was not required,
however, for the court to accept guilty pleas to petty misdemeanor offenses. See
Jones, supra, at ¶22.
9
{¶28} We hold, under the totality of the circumstances surrounding appellant’s
guilty pleas, that the trial court’s error in failing to adequately inform appellant of the
effect of his pleas under Crim.R. 11 was not prejudicial and, thus, not reversible error.
{¶29} Appellant’s second assignment of error is without merit.
{¶30} The judgments of the trial court are hereby modified to reflect that
appellant’s aggregate term of imprisonment is limited to the statutory maximum of 18
months, including suspended time, pursuant to R.C. 2929.41(B)(1). If for any reason
appellant’s suspended sentence is later imposed, it must be limited to a total of 8
months (i.e., approximately 240 days). Thereafter, the judgments of the trial court
regarding appellant’s convictions and sentence are affirmed as modified.
CYNTHIA WESTCOTT RICE, P.J.,
THOMAS R. WRIGHT, J.,
concur.
10
|
Q:
Import pandas error
I keep getting an error in Git Bash as I run my python code:
$ python Humiditypyth.py
Traceback (most recent call last):
File "Humiditypyth.py", line 1, in <module>
import pandas as pd
ImportError: No module named pandas
I have Anaconda installed and I checked in "python list" that pandas is installed. Can you please help?
A:
Let's do a checklist
Do you have anaconda installed in the same python version that you are using? e.g. if python is calling python2.7 and python3 does python 3.6 you have to install anaconda in the right folder with either "sudo pip install anaconda" or "sudo pip3 install anaconda"
after that I think you still have to install pandas "pip install pandas" or "pip3 install pandas"
I might be wrong though I never used that library.
|
QAIT: a quality assurance issue tracking tool to facilitate the improvement of clinical data quality.
In clinical and translational research as well as clinical trial projects, clinical data collection is prone to errors such as missing data, and misinterpretation or inconsistency of the data. A good quality assurance (QA) program can resolve many such errors though this requires efficient communications between the QA staff and data collectors. Managing such communications is critical to resolving QA problems but imposes a major challenge for a project involving multiple clinical and data processing sites. We have developed a QA issue tracking (QAIT) system to support clinical data QA in the Clinical Breast Care Project (CBCP). This web-based application provides centralized management of QA issues with role-based access privileges. It has greatly facilitated the QA process and enhanced the overall quality of the CBCP clinical data. As a stand-alone system, QAIT can supplement any other clinical data management systems and can be adapted to support other projects.
|
Q:
How do I create a 1px line in Interface Builder?
Note, I'm looking to make a 1px line, not a 1pt line. Meaning it should be 1px regardless of screen scale (so 0.5pt on Retina devices).
I can do this programmatically, but can I do it in the Interface Builder? For example I cannot set a UIView to have a height of less than 1.
If I can do it in IB then I don't have to declare an outlet and manually set the frame in awakeFromNib.
A:
Just in case someone else comes here wanting to know how it can be done programmatically, heres how you do it:
Interface Builder
Make a height constraint in IB to the desired view and set the constant to 1.
Then you will need to CTRL+Drag from the constraint into your custom view or ViewController.
Whenever the Xib is loaded, be it in awakeFromNib or viewDidLoad, you are going to set the constant of the constraint to the scale of the display:
Swift
onePixelViewHeightConstraint.constant = 1/UIScreen.main.scale//enforces it to be a true 1 pixel line
Objective-C
self.onePixelViewHeightConstraint.constant = 1.f/[UIScreen mainScreen].scale;//enforces it to be a true 1 pixel line
Enjoy
A:
I created NSLayoutConstraint subclass:
class HairlineConstraint: NSLayoutConstraint {
override func awakeFromNib() {
super.awakeFromNib()
self.constant = 1.0 / UIScreen.main.scale
}
}
Then simply create your view in interface builder, add height constraint
and set its class to HairlineConstraint.
Done.
A:
By creating this tiny subclass of NSLayoutConstraint I'm now able to add 1px lines in IB:
@implementation NSLayoutConstraintHairline
-(void)awakeFromNib
{
[super awakeFromNib];
if ( self.constant == 1 ) self.constant = 1/[UIScreen mainScreen].scale;
}
@end
Any constraint with a value of 1 can be set to class NSLayoutConstraintHairline to make the constant effectively 1px instead of 1pt.
If you ever decide to change the constant to another value, it will just work as any other constraint.
|
Follow KDKA-TV: Facebook | Twitter
PITTSBURGH (KDKA) — Two people accused of killing a local pizza delivery driver during an alleged attempted robbery will stand trial.
D’Ambrosse Garland, 18, and Timothy Walls, 17, will stand trial fro the murder of AbdulGhaniyu Sanusi in October.
Sanusi was delivering pizzas for Dominoes Pizza to an address on Penn Avenue when he was called and told to drive to North St. Clair Street instead. A witness said they heard the suspects demanding money just before the victim was shot.
Attorney Blaine Jones represents Walls.
“Mr. Walls was not the trigger person. He was not the person holding the gun. He was not the person that shot anyone and all that we’ve done today is going to be most beneficial for Mr. Walls,” Jones said.
A police detective testified that Garland confessed in the shooting, claiming the gun went off accidentally.
Attorney James Sheets represents Garland.
“This is an 18-year-old young man, not without his problems but certainly not a murderer, cold-hearted, cold-blooded murderer. He’s an 18-year-old kid. This was an accident. This was tragic,” Sheets said.
At the time of the shooting, police say Garland was under house arrest for allegedly shooting his half-brother, but he removed his ankle bracelet monitor.
Both suspects were on the run when they were arrested. Police caught up with them after comparing shots of Garland on Facebook video to surveillance footage. Meanwhile, Sanusi, a Nigerian immigrant, was working to take care of his seven children.
Sheets says his client has expressed remorse for the shooting.
“This was never his intent for anyone to die on the night in question or for those children not to have a father,” Sheets said.
Garland and Walls are facing counts of homicide, robbery, conspiracy, as well as gun charges. Police say the 17-year-old Walls will be charged as an adult in the case.
|
Effects of selective ultraviolet phototherapy (SUP) and local PUVA treatment on DNA synthesis in guinea pig skin.
The treatment with UV-light with wavelengths between 292.5--335 nm (known as selective UV-phototherapy, or SUP) and 320--390 nm (plus local treatment with 8-methoxypsoralen, known as PUVAex) gave rise to a biphasic reaction of epidermal cell proliferation in guinea pig skin. A decrease of proliferative activity was followed by a synchronized stimulation of DNA synthesizing cells after 2--4 h. These quantitative displacements were accompanied by qualitative changes in the proliferative behaviour of epidermal cells in the S-compartment.
|
---
abstract: 'Given a bounded open set in $\mathbb{R}^n$, $n\ge 2$, and a sequence $(K_j)$ of compact sets converging to an $(n-1)$-dimensional manifold $M$, we study the asymptotic behaviour of the solutions to some minimum problems for integral functionals on $\Omega\setminus K_j$, with Neumann boundary conditions on $\partial(\Omega\setminus K_j)$. We prove that the limit of these solutions is a minimiser of the same functional on $\Omega\setminus M$ subjected to a transmission condition on $M$, which can be expressed through a measure $\mu$ supported on $M$. The class of all measures that can be obtained in this way is characterised, and the link between the measure $\mu$ and the sequence $(K_j)$ is expressed by means of suitable local minimum problems.'
address:
- 'Scuola Internazionale Superiore di Studi Avanzanti, Trieste, Italy'
- 'Istituto Nazionale di Alta Matematica, Unità di Ricerca di Firenze - DiMaI “U. Dini”, Università di Firenze, Italy'
- 'Dipartimento di Matematica “G. Peano”, Università di Torino, Italy'
author:
- Gianni Dal Maso
- Giovanni Franzina
- Davide Zucco
title: Transmission conditions obtained by homogenisation
---
[**Keywords.** $\Gamma$-convergence, capacitary measures, Neumann sieve.]{}
Introduction
============
This paper studies the asymptotic behaviour of the solutions $u_j$ to the equations $$-\Delta u_j +u_j=h \qquad \text{in $\Omega\setminus K_j$,}$$ with homogeneous Neumann boundary conditions on $\partial (\Omega\setminus K_j)$. Here and henceforth $\Omega$ is a bounded open set in $\mathbb{R}^n$, $n\ge 2$, and $(K_j)$ is a sequence of compact sets in $\mathbb{R}^n$. We assume that there exists a compact $(n-1)$-dimensional $C^1$ manifold $M$ with boundary, contained in $\Omega$, such that $$\label{eq:1.1}
K_j \subset \big\{ x\in\mathbb{R}^n\,\,\colon\,\, {\rm dist}(x,M)\le\rho_j\big\}\,,$$ for a suitable sequence of positive numbers $(\rho_j)$ with $\rho_j\to0^+$ as $j\to\infty$.
It is well known that $u_j$ is the minimiser of the functional $$\int_{\Omega\setminus K_j}|\nabla u|^2dx +\int_{\Omega\setminus K_j} u^2dx - 2\int_{\Omega\setminus K_j}hu\, dx\,,$$ and this property will be the starting point of our analysis.
More in general, in this paper we will consider sequences of minimisers of functionals of the form $$\label{fct0}
\int_{\Omega{\setminus}K_j} f(\nabla u)\,dx +\int_{\Omega\setminus K_j} g(x,u)\,dx\, ,$$ where $f$ and $g$ are suitable functions satisfying standard convexity and growth conditions (see Section \[subsec:2.1\] for details). A significant instance included in our analysis will be that of the functions $f(\nabla u)=|\nabla u|^p$, with $1<p\le n$, and $g(x,u)=|u-h(x)|^q$, with $1\le q<\infty$ and $h\in L^q(\Omega)$.
This kind of question is related with the so-called *Neumann sieve problem* that was proposed by Sanchez and Palencia, who gave in [@SP2] a formal asymptotic expansion of the solution. It was then studied by Attouch, Damlamian, Murat, and Picard (see [@AP; @D; @M; @P]) in the case where the perforations are composed of open balls periodically distribuited over the manifold. For related studies on the asymptotic behaviour of periodically-perforated domains see [@AB; @AB2; @C1; @C2; @C3; @DV; @SP1; @SP3].
A slight modification (see Section \[sec:3\]) of the results of [@Cor] shows that, under our general conditions, there exists a subsequence of $(K_j)$ (not relabelled) satisfying such that the minimisers $u_j$ of converge in $L^q(\Omega)$ as $j\to\infty$ to the minimiser of a functional of the form $$\label{eq:1.5}
\displaystyle
\int_{\Omega{\setminus}M} f(\nabla u)\,dx + \int_{M} [u]^p\,{d}\mu
+\int_{\Omega\setminus M} g(x,u)\,dx\,, \quad u\in L^{1,p}(\Omega{\setminus}M)\,,$$ where $\mu$ is a suitable Borel measure on $\Omega$, concentrated on $M$ and vanishing on all Borel sets $B$ with $C_{1,p}(B)=0$ (see Section \[subsec:2.2\] for the definition of the $p$-capacity $C_{1,p}$ and Section \[subsec:2.3\] for details on these $p$-capacitary measures). Here and henceforth $L^{1,p}$ denotes the Deny-Lions space, while the jump of $u$ is defined by $ [u]:=|u^+-u^-|$, where $u^+$ and $u^-$ are the measure-theoretic limits of $u$ at $x$ on both sides of $M$ (see again Section \[subsec:2.2\]). The measure $\mu$ appearing in is independent of $g$ and depends only on the sequence of compact sets $(K_j)$ and on the energy density $f$.
In some special cases, a suitable choice of the sequence of compact sets $(K_j)$ allows for an explicit computation of the measure $\mu$. For example, if $K_j=\emptyset$ for all $j$, then one obtains in the limit the measure $\mu$ defined for every Borel set $B$ as $$\mu(B) = \begin{cases}
0\,, & \ \text{if } C_{1,p}(B\cap M)=0\,,\\
\infty\,, &\ \text{otherwise.}
\end{cases}$$ In this case, the finiteness of the functional implies that $[u]=0$ on $M$ so that reduces to $$\displaystyle
\int_{\Omega} f(\nabla u)\,dx +\int_{\Omega}g(x,u)\,dx\,,
\quad u\in L^{1,p}(\Omega)\,.$$
Moreover, if $K_j=\{x\in\mathbb R^n\colon {\rm dist}(x,M)\le\rho_j\}$, then $\mu=0$ and the corresponding limit functional becomes $$\displaystyle
\int_{\Omega\setminus M} f(\nabla u)\,dx +\int_{\Omega\setminus M} g(x,u)\,dx\,,
\quad u\in L^{1,p}(\Omega\setminus M)\,.$$
From our point of view the most interesting case is when the limit measure is of the form $\mu = \theta\mathscr H^{n-1}{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}M$ for a function $\theta\in L^{p'}(M,\mathscr H^{n-1})$ where $p'=p/(p-1)$ (see Section \[sec:density\]). In this case, under suitable regularity assumptions on $f$ the first order minimality conditions lead to a partial differential equation in $\Omega{\setminus}M$ with suitable *transmission conditions* across $M$. For instance, when $f(\nabla u)=|\nabla u|^2$ and $g(x,u)=|u-h(x)|^2$ for some $h\in L^2(\Omega)$, the minimiser of satisfies $$\begin{cases}
-\Delta u +u=h\,, & \ \text{in $\Omega\setminus M$,}\\
\partial_\nu u=0\,, & \ \text{on $\partial \Omega$,}\\
(\partial_\nu u)^+= (\partial_\nu u)^-=\theta(u^+-u^-) \,,& \ \text{on $M$,}
\end{cases}$$ where $\nu$ is a unit normal. A particular case when $\theta$ is constant and $M$ is a hyperplane has been investigated in [@ansini].
In this paper we prove a density result (see Section \[sec:density\]), which shows that every measure vanishing on sets of $p$-capacity zero can appear in the limit problem . More precisely, given $f$, $M$, and $\mu$, we prove that there exists a sequence $(K_j)$ of compact sets, satisfying , such that, for every $g$, the minimisers of converge in $L^q(\Omega)$ to the minimiser of . For this result the hypothesis $p\le n$ is crucial.
We also prove an asymptotic formula which allows us to obtain the measure $\mu$ starting from some auxiliary minimum problems which involve $f$ and the $K_j$’s (see Section \[reconstruction\]). Moreover, for a given sequence $(K_j)$ of compact sets we provide necessary and sufficient conditions to establish when we have full convergence of the minimisers of to the minimiser of (i.e., without passing to a subsequence).
The authors wish to thank Dorin Bucur for useful discussions about this paper. This material is based on work supported by the Italian Ministry of Education, University, and Research under the Project “Calculus of Variations" (PRIN 2015). All authors are members of the Gruppo Nazionale per l’Analisi Matematica, la Probabilità e le loro Applicazioni (GNAMPA) of the Istituto Nazionale di Alta Matematica (INdAM), which provided funding for GF and DZ.
Technical tools
===============
Assumptions {#subsec:2.1}
-----------
Throughout the paper, we fix a bounded open set $\Omega\subset\mathbb{R}^n$, $n\ge 2$, and a function $f\colon\mathbb{R}^n\to[0,\infty)$ such that
\[A\] $$\begin{aligned}
& \text{$f(\cdot)$ is convex, even, and positively homogeneous of degree $p$;}
\label{Ab}\\
& \lambda |\xi|^p\le f(\xi)\le \Lambda |\xi|^p\,,\ \text{for all $\xi\in\mathbb{R}^n$,}\label{Ac}\end{aligned}$$
for suitable constants $1<p\le n$ and $0<\lambda<\Lambda<\infty$. We also fix a function $g:\Omega\times\mathbb R\to[0,\infty)$ such that
\[C\] $$\begin{aligned}
& \text{$g(\cdot,s)$ is measurable for all $s\in\mathbb{R}$;} \label{C1} \\
& \text{$g(x,\cdot)$ is continuous for a.e.\ $x\in\Omega$;} \label{C2}\\
& \text{ $c_1 |s|^q- a_1(x)\le g(x,s)\le c_2(1+|s|^q+a_2(x))$ for a.e.\ $x\in\Omega$ and all $s\in\mathbb R $,} \label{C3}\end{aligned}$$
for suitable constants $1\le q<\infty$, $0<c_1<c_2<\infty$, and functions $a_1,a_2\in L^1(\Omega)$.
Moreover, we fix a compact $(n-1)$-dimensional $C^1$ manifold $M$ with boundary, contained in $\Omega$, and a sequence $(K_j)$ of compact sets of $\mathbb{R}^n$ such that $$\label{eq:1.1sec3}
\lim_{j\to\infty}\max_{x\in K_j} {\rm dist}(x,M)=0\,.$$ Eventually, $\Sigma$ will denote a fixed compact $(n-1)$-dimensional $C^1$ manifold with boundary, contained in $\Omega$, with $M\subset \Sigma{\setminus}\partial\Sigma$.
Some fine properties of Sobolev functions {#subsec:2.2}
-----------------------------------------
Given an open set $A\subset\mathbb R^n$, $L^0(A)$ stands for the space of all (equivalence classes of) real valued measurable functions on $A$, endowed with the topology of the convergence in measure. Note that the topological space $L^0(A)$ is metrisable and separable. The Sobolev space $W^{1,p}(A)$ consists, as usual, of all functions $u\in L^p(A)$ whose distributional gradient $\nabla u$ belongs to $L^p(A;\mathbb R^n)$. We shall also make use of the Deny-Lions space $L^{1,p}(A)$, i.e., the set of all functions $u\in L^1_{\rm loc}(A)$ whose distributional gradient $\nabla u$ belongs to $L^p(A;\mathbb{R}^n)$. We recall that if $A$ is locally the subgraph of a Lipschitz function near $x\in\partial A$, then there exists an open neighbourhood $A'$ of $x$ such that $L^{1,p}(A\cap A')=W^{1,p}(A\cap A')$. In particular, $L^{1,p}(A)=W^{1,p}(A)$ whenever $A$ is a bounded Lipschitz open set. It is also known that $\{\nabla u:\, u\in L^{1,p}(A)\}$ is a closed subspace of $L^p(A;\mathbb R^n)$. For a more detailed account about these spaces, the reader is referred to [@DL] and [@Mazya]. Here and henceforth, for every $u,v\in L^0(A)$ we set $(u\wedge v)(x):=\min\{u(x),v(x)\}$ $(u\vee v)(x):=\max\{u(x),v(x)\}$. For every $u\in L^0(\Omega)$ and $t>0$, we denote the truncation of $u$ at level $t$ by $u^t:=u\wedge t \vee -t$. The $p$–capacity $C_{1,p}$ of a set $E\subset \Omega$ is defined as $$C_{1,p}(E):=\inf_{u\in \mathcal U(E)}\int_{\Omega} |\nabla u|^p\,dx\,,$$ where $\mathcal U(E)$ is the set of all $u\in W^{1,p}_0(\Omega)$ such that $u\ge1$ almost everywhere in an open neighbourhood of $E$. Then, one says that a property holds $p$-quasi everywhere or equivalently for $p$-q.e. $x$, both abbreviated to $p$–q.e., if the points where it fails form a set of $p$–capacity zero. The usual abbreviation a.e. for almost everywhere, if not specified, always refers to the Lebesgue measure. Given a set $E\subset \Omega$, a function $u$ defined on $E$ is said to be $p$–quasicontinuous if for every ${\varepsilon}>0$ there exists a set $E'$ with $C_{1,p}(E')<{\varepsilon}$ such that the restriction of $u$ to $E\setminus E'$ is continuous. The notions of $p$-quasi upper and $p$-quasi lower semicontinuity are defined in a similar way. A set $U\subset \Omega$ is said to be $p$-quasi open in $\Omega$ if for every $\varepsilon>0$ there exists an open set $A\subset \Omega$ such that $C_{1,p}(U\triangle A)<\varepsilon$, where $\triangle$ denotes the symmetric difference of sets. Given a $p$-quasi open set $U$ in $\Omega$, for every $\varepsilon>0$ there exists an open set $V\subset \Omega$ such that $U\cup V$ is open and $C_{1,p}(V)<\varepsilon$. The definition of $p$-quasi closed is analogous and we have that $U$ is $p$-quasi open in $\Omega$ if, and only if, $\Omega\setminus U$ is $p$-quasi closed. It is easily seen that a set $U\subset\Omega$ is $p$-quasi open ($p$-quasi closed) if and only if its characteristic function $1_U$ is $p$-quasi lower ($p$-quasi upper) semicontinuous. It can be proved that a function $f\colon \Omega\to [-\infty,\infty]$ is $p$-quasi lower ($p$-quasi upper) semicontinuous if and only if the sets $\{ x\in\Omega\colon f(x)>t\}$ ($\{x\in\Omega\colon f(x)\ge t\}$) are $p$-quasi open ($p$-quasi closed) for all $t\in\mathbb R$. Given an open set $A\subset \Omega$, for all $u\in W^{1,p}(A)$ there exists a $p$–quasicontinuous function $\tilde u$ that coincides with $u$ a.e., called the $p$–quasicontinuous representative of $u$; it is well known that $\tilde u$ is uniquely determined $p$-q.e. and that $$\label{defmed2.1}
\lim_{\rho\to0^+}\intmed_{B_{\rho}(x)}|u(y)-\tilde u(x)|\,dy=0\,,\qquad \text{for $p$-q.e.\ $x\in A$.}$$ For a complete treatment of the notion of capacity and of the fine properties of Sobolev functions, we refer to the books [@EG; @HKM; @Mazya; @Z].
Incidentally, under suitable assumptions the values of Sobolev functions can be made precise also at $p$-q.e. boundary point. More precisely, if $A\subset\subset \Omega$ is an open set with Lipschitz boundary and $u\in W^{1,p}(A)$ then there exists a $p$-quasicontinuous function on $\overline A$, which we still denote by $\tilde u$, such that $$\label{rapprqcont}
\lim_{\rho\to0^+} \frac{1}{\rho^n}\int_{A\cap B_\rho(x)}|u(y)-\tilde u(x)|\,dy=0\,,
\qquad \text{for $p$--q.e.\ $x\in\overline A$.}$$ Indeed, the extension theory for Sobolev spaces implies that there exists $v\in W^{1,p}(\Omega)$ such that $v=u$ a.e. in $A$. Applying to the $p$-quasi continuous representative $\tilde v$ of $v$ we obtain that $$\limsup_{\rho\to0^+} \frac{1}{\rho^n}\int_{A\cap B_\rho(x)} |u(y)-\tilde v(x)|\,dy \le
\lim_{\rho\to0^+} \frac{1}{\rho^n}\int_{B_\rho(x)}|v(y)-\tilde v(x)|\,dx=0\,,$$ for $p$-q.e. $x\in\overline A$. It is now enough to define $\tilde u$ as the restriction of $\tilde v$ to $\overline A$. On the other hand, it is clear that uniquely determines $\tilde u$ $p$-q.e. on $\overline A$.
By standard properties of the traces of Sobolev functions (see, e.g., [@AFP Theorem 3.87], [@EG Theorem 2, p. 181]), implies that $\tilde u_{|_{\partial A}}$ coincides $\mathscr{H}^{n-1}$–a.e. with the trace $\gamma(u)$ of $u$ on $\partial A$, where $\mathscr{H}^{n-1}$ denotes the $(n-1)$-dimensional Hausdorff measure. Moreover, $\tilde u_{|_{\partial A}}$ is $p$-quasicontinuous.
Since $\gamma(u)\in W^{1-1/p,p}(\partial A)$, it is possible to prove that $\tilde u_{|_{\partial A}}$ coincides with the quasicontinuous representative of $\gamma(u)$ with respect to the fractional capacity $C_{1-1/p,p}$, for which we refer to [@Mazya Section 10.4] or [@Z Section 2.6]. However, this last property will never be used in this paper.
From what noticed above a set $U$ is $p$-quasi open if, and only if, there exists $u\in W^{1,p}(\mathbb R^n)$ with $U=\{x\in\mathbb R^n\colon u(x)>0\}$. Moreover, we have the following result.
\[lm:qa0\] Let $U$ be a $p$-quasi open set in $\Omega$. Then there exists a sequence of compact sets $(Q_k)$ with $Q_k\subset U$ and a monotonically non-decreasing sequence of functions $(\chi_k)$ with $\chi_k\in W^{1,p}_0(\Omega)$, with $0\le \chi_k\le1$, $\chi_k=0$ in $\Omega\setminus Q_k$, and $\chi_k\to1$ $p$-q.e. in $U$.
We take $u\in W^{1,p}(\mathbb R^n)$ with $U=\{u>0\}$. For every $k>0$ we define $u_k\in W^{1,p}(\mathbb R^n)$ setting $u_k = \big((u-\tfrac{1}{k})\vee 0)\cdot k\big)\wedge1$. Clearly $0\le u_k\le1$ and out of the $p$-quasi closed set $U_k:=\{u\ge\tfrac{1}{k}\}$ we have that $u_k=0$. For every $k$, let $v_k\in W^{1,p}_0(\Omega)$, with $0\le v_k\le1$, be such that $$\int_\Omega |\nabla v_k|^p\,dx = C_{1,p}(V_k)\,,$$ where $V_k$ is an open set, with $C_{1,p}(V_k)<\frac{1}{k}$, such that $U_k\setminus V_k$ is closed. It follows that the function $w_k:=u_k\wedge(1-v_k)$ belongs to $W^{1,p}(\Omega)$ and vanishes out of the compact set $Q_k := U_k\setminus V_k$. Moreover, $w_k$ converges to $1$ $p$-q.e. in $U$, since so does $u_k$ by construction. Therefore, the sequence defined by recursion setting $\chi_1:=w_1$, and $\chi_k:=w_k\vee \chi_{k-1}$ for all $k>1$, is a monotonically non-decreasing sequence that satisfies the desired properties.
We introduce a $p$–quasicontinuous version of the traces of a piecewise $W^{1,p}$ function on both sides of a manifold. We begin with the case of a graph of a $C^1$ function. Given $x_0\in \mathbb{R}^n$, $\nu_0\in \mathbb{R}^n$ with $|\nu_0|=1$, and $r_0>0$, we consider the cylinder defined by
\[notazioni\] $$\label{cilynder}
\Omega_0:=\left\{ x\in\mathbb{R}^n\colon |(x-x_0)\cdot\nu_0|<r_0\,, \ |x-x_0 - ((x-x_0)\cdot\nu_0)\nu_0|<r_0\right\}\,.$$ We fix a function $\phi$ of class $C^1$ defined on the $(n-1)$-dimensional disk $\Pi_0= \{x\in \Omega_0\colon (x-x_0)\cdot \nu_0=0\}$ with values in $\left(-\tfrac{r_0}{4},\tfrac{r_0}{4}\right)$ and vanishing at $x_0$. Its graph is defined by $$\label{Ngraph}
\Sigma_0:=\left\{\bar x+ \phi(\bar x)\nu_0\colon \bar x\in \Pi_0\right\}\,.$$ We now define the open sets $\Omega_0^+$ and $\Omega_0^-$ by $$\label{2Omega}
\Omega_0^\pm = \left\{\bar x+r\nu_0\colon \bar x\in \Pi_0\,, \ r\in \left(-r_0,r_0\right) \,, \ \pm (r- \phi(\bar x))>0\right\}\,,$$
so that $\Omega_0=\Omega_0^+\cup \Sigma_0\cup \Omega_0^-$.
\[lm:2.1\] Let $\Omega_0$, $\Sigma_0$, and $\Omega_0^\pm$ be defined by , and let $\nu$ be the continuous unit normal to $\Sigma_0$ such that $\nu(x_0)=\nu_0$. Then for every $u \in W^{1,p}(\Omega_0\setminus \Sigma_0)$ there exist two $p$-quasicontinuous functions $u^+ $ and $u^-$ defined on $\Sigma_0$ such that $$\label{intmedbd}
\lim_{\rho\to0^\pm}\intmed_{B_{\rho,\nu}^\pm(x)}|u(y)-u^\pm(x)|\,dy=0\,,
\qquad \text{for $p$-q.e.\ $x\in \Sigma_0$,}$$ where $
B_{\rho,\nu}^\pm(x) := \left\{y\in B_\rho(x)\,\,\colon \pm(y-x)\cdot\nu(x)>0 \right\}
$.
Let $u\in W^{1,p}(\Omega_0{\setminus}\Sigma_0)$ be fixed. The extension theorems for Sobolev functions imply that that there exist $v,w\in W^{1,p}(\Omega_0)$ such that $v=u$ a.e. in $\Omega_0^+$ and $w=u$ a.e. in $\Omega_0^-$. Let us set $u^+(x):=\tilde v(x)$ and $u^-(x):=\tilde w(x)$ for all $x\in \Sigma_0$. Then for $p$-q.e. $x\in \Sigma_0$ we have $$\int_{\Omega_0^+\cap B_{\rho}(x)} \!|u(y)-u^+(x)|\,dy
=\int_{\Omega_0^+\cap B_{\rho}(x)} \!|v(y)- \tilde v(x)|\,dy
\le \int_{ B_{\rho}(x)} \!|v(y)- \tilde v(x)|\,dy$$ and a similar inequality holds when $u^+$ and $v$ are replaced by $u^-$ and $w$. Therefore, by $$\lim_{\rho\to0^+}\intmed_{\Omega_0^\pm\cap B_{\rho}(x)} |u(y)-u^\pm(x)|\,dy=0\,.$$ It is easily seen that $\Omega_0^\pm\cap B_{\rho}(x)$ can be replaced by $B_{\rho,\nu}^\pm(x)$ (see, e.g., [@EG Corollary 1, p. 203]) and by this we can conclude.
Note that under the assumptions of Lemma \[lm:2.1\] the functions $u^\pm$ coincide $\mathscr{H}^{n-1}$–a.e. on $\Omega_0\cap \Sigma_0$ with the traces of $u_{\vert_{\Omega_0^+}}\in W^{1,p}(\Omega_0^+)$ and $u_{\vert_{\Omega_0^-}}\in W^{1,p}(\Omega_0^-)$ in the sense of Sobolev spaces.
Moreover, since $\Omega_0^+$ and $\Omega_0^-$ have Lipschitz boundary and $\Sigma_0\subset \partial \Omega_0^+\cap \partial \Omega_0^-$, by the trace $u^\pm$ concides $p$-q.e. on $\Sigma_0$ with the restriction to $\Sigma_0$ of the $p$-quasicontinuous representative of $u_{\vert_{\Omega_0^+}}$ on $\overline{\Omega_0^+}$ and of $u_{\vert_{\Omega_0^-}}$ on $\overline{\Omega_0^-}$.
In the following lemma we introduce the absolute value of the jump of a function across a manifold.
\[lm:2.2\] Let $A$ be an open subset of $\Omega$. Then for every $u\in L^{1,p}(A{\setminus}\Sigma)$ there exists a $p$-quasicontinuous function $[u]$ on $A\cap \Sigma$ such that for $p$-q.e. $x\in A\cap \Sigma$ $$\label{jumpdef}
[u](x)=\bigg\vert \lim_{\rho\to0^+}\intmed_{B_{\rho,\nu}^+(x)}u(y)\,dy-\lim_{\rho\to0^+}\intmed_{B_{\rho,\nu}^-(x)}u(y)\,dy\bigg\vert\,,$$ where $\nu$ is a unit normal to $\Sigma$ at $x$.
For every point $x_0\in A\cap \Sigma$ there exists $r_0>0$ such that the intersection of $\Sigma$ with the cylinder $\Omega_0$ defined in is the graph of a $C^1$ function as in . Therefore, by Lindelöf Theorem $A\cap \Sigma$ can be covered by a sequence $(\Omega_i)$ of such cylinders, each well contained in $A$ so that $u\in W^{1,p}(\Omega_i\setminus \Sigma)$.
By Lemma \[lm:2.1\], for every $i$ there exist two $p$-quasicontinuous functions $u^+_i$ and $u^-_i$ on $\Omega_i\cap \Sigma$ such that holds. Note that for $p$-q.e. $x\in
\Omega_i\cap \Omega_j\cap \Sigma$ we have either $
u^\pm_i(x) = u^\pm_{j}(x)
$ or $
u^\pm_i(x) = u^\mp_{j}(x)
$, which implies that $|u^+_i(x)-u^-_i(x)|= |u^+_j(x)-u^-_j(x)|$. This allows us to define $$[u](x) := |u^+_{i}(x)-u^-_{i}(x)|\,,\qquad \text{for $p$-q.e.\ $x\in \Omega_i\cap\Sigma$.}$$ It is then immediate to see that $[u]$ is $p$-quasicontinuous and that holds.
\[convpqe\] Since the truncation $u\mapsto u^t=u\wedge t \vee -t$ is Lipschitz continuous, it commutes with the choice of a $p$-quasi continuous representative. Hence by Lemma \[lm:2.2\] we can infer that $[u^t]$ converges to $[u]$, as $t\to \infty$, $p$-q.e. on $A\cap \Sigma$.
Capacitary measures {#subsec:2.3}
-------------------
In this subsection we introduce the class of measures which are involved in the integral representation of the limit problem . In the sequel, for every open set $A\subset\mathbb{R}^n$ the symbol $\mathscr{A}(A)$ denotes the collection of all open subsets of $A$, and for every Borel set $B\subset \mathbb{R}^n$ by $\mathscr{B}(B)$ we denote the collection of all Borel subsets of $B$.
Given $A\in \mathscr{A}(\Omega)$, the symbol $\mathcal{M}_p(A)$ denotes the class of measures $\mu\colon \mathscr{B}(A)\to[0,\infty]$ such that $\mu(B)=0$ for every $B\in\mathscr{B}(A)$ with $C_{1,p}(B)=0$. In addition, $\mathcal{M}_p(A;M)$ stands for the subclass of measures $\mu\in \mathcal{M}_p(A)$ with $\mu(A\setminus M)=0$.
Let $A\in \mathscr A(\Omega)$. Since $\Omega$ is bounded, a Radon measure $\mu$ on $\Omega$, considered as a distribution on $A$, belongs to the dual space $W^{-1,p'}(A)$ of $W^{1,p}_0(A)$ if and only if there exists $\Psi\in L^{p'}(A;\mathbb R^n)$ with $\mu = \mathop{\rm div} \Psi$ in the sense of distributions, [*i.e.*]{}, $$ \int_A \varphi\,d\mu =- \int_A \nabla \varphi\cdot \Psi\,dx\,,$$ for all $\varphi\in C^{\infty}_c(A)$. We will denote by $\langle\,\cdot\,,\cdot\,\rangle$ the duality pairing between $W^{-1,p'}(A)$ and $W^{1,p}_0(A)$ (see [@HKM; @Z]).
By this integral representation and Hölder inequality, all non-negative Radon measures on $A$ of class $W^{-1,p'}(A)$ belong to $\mathcal{M}_p(A)$. In particular, a Radon measure $\mu$ on $A$ of class $W^{-1,p'}(A)$ that is supported on $M$ belongs to $\mathcal{M}_p(A;M)$. Another significant istance within this class is the Hausdorff measure $\mathscr H^{n-1}{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}(A\cap M)$; more in general, the Radon measure $\mathscr H^s{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}E$ belongs to $\mathcal{M}_p(A)$ whenever $E$ is a subset of $A$ such that $\mathscr H^{s}(E)<\infty$ with $s>n-p$. Nevertheless, measures in $\mathcal{M}_p(A;M)$ are required neither to be inner regular not to be locally finite. For example $$\label{misura:infinita}
\infty_E(B) := \begin{cases}
0\,, & \qquad \text{if $C_{1,p}(B\cap E)=0$\,,}\\ \infty\,, & \qquad \text{otherwise,}
\end{cases}
\qquad \text{for all $B\in\mathscr B(A)$,}$$ defines a measure of class $\mathcal{M}_p(A)$ for all $E\subset \Omega$, and clearly $\infty_E\in\mathcal{M}_p(
A;M)$ if $E\subset M$.
\[dfn:equiv\] We say that two measures $\mu_1,\mu_2\in\mathcal{M}_p(\Omega; M)$ are equivalent if $$\label{equivmis}
\int_{ M} [u]^p\,d\mu_1=\int_{ M}[u]^p\,d\mu_2$$ for all $u\in L^{1,p}(\Omega\setminus M)$.
It is easy to see that Definition \[dfn:equiv\] implies that $$\label{equivmisA}
\int_{A\cap M}[u]^p\,d\mu_1=\int_{A\cap M}[u]^p\,d\mu_2\,,$$ for every $A\in\mathscr A(\Omega)$ and for every $u\in L^{1,p}(A\setminus M)$. In fact, for every $\varphi\in C^\infty_0(A)$, $\varphi u$ can be considered as an element of $L^{1,p}(\Omega\setminus M)$ for which holds. To obtain it is enough to approximate $1_A$ with an increasing sequence of functions in $C^\infty_0(A)$.
In particular, two equivalent measures must agree on all open sets. We point out that this necessary condition does not imply, in general, that they agree on all Borel sets (see Example \[exa2.1\]), unless at least one of them is a Radon measure; on the other hand, the coincidence on open sets does not imply the equivalence according to Definition \[equivmis\] (see Example \[exa2.2\]).
\[exa2.1\] Let $\mu_1=\infty_E$ be the measure defined in where $E=A\cap M$, with $A\in\mathscr A(\Omega)$ fixed, and we define $$\mu_2(B) = \begin{cases}
0\,, & \qquad \text{if $\mathscr H^{n-1}(B\cap E)=0$,} \\ \infty \,, & \qquad \text{otherwise.}
\end{cases}
\qquad \text{for all $B\in\mathscr B(A)$,}$$ Then $\mu_1$ and $\mu_2$ are different but equivalent, because for a $p$-quasi continuous function $v$ we have that $v=0$ holds $\mathscr H^{n-1}$-a.e. on $A\cap M$ if and only if it holds $p$-q.e. on $A\cap M$.
\[exa2.2\] In this example, $\mu_1=\infty_{E_1}$ and $\mu_2=\infty_{E_2}$ for suitable sets $E_2\subset E_1\subset M$. We first construct the set $E_1$. Let $x_0\in M\setminus\partial M$ and $r_0>0$ be so small that $\Sigma_0=M\cap \Omega_0$ admits a representation of the form where $\Omega_0$ is the cylinder defined by . Let also $\Omega_0^\pm$ be as in . For every $E\subset\Sigma_0$, we set $$\label{kappa1}
\kappa(E) := \inf_{u\in \mathcal{U}(E)} \int_{\Omega_0^+}|\nabla u|^p\,dx$$ where $\mathcal{U}(E)$ is the set of all functions $u\in W^{1,p}(\Omega_0^+)$ such that $u=0$ $p$-q.e. on $E$ and $u=1$ $p$-q.e. on $\partial\Omega_0^+\setminus M$. We fix $r_1\in(0,r_0)$, we consider the cylinder $\Omega_1$ defined as in with $r_0$ replaced by $r_1$, and we set $E_1:=M \cap \Omega_1$.
To construct $E_2$, we fix a sequence $(x_i)$ of points dense in $E_1$ and $$E_2 := \bigcup_{i\in\mathbb N} \big(B_{\rho_i}(x_i)\cap M\,\big)$$ for a suitable choice of the radii $\rho_i>0$. The first condition on $\rho_i$ is that $B_{\rho_i}(x_i)\cap M\subset E_1 $. The second one is the inequality $\kappa(E_1)>\kappa(E_2)$, which can be obtained using the countable subadditivity of $\kappa(\cdot)$ and the fact that $$\lim_{\rho\to0^+} \kappa(B_{\rho}(x))=0\qquad \text{for every $x$.}$$ These two properties of $\kappa(\cdot)$ can be proved with the same arguments used for $C_{1,p}$.
Since $E_1$ and $E_2$ are relatively open in $ M$ and $E_2$ is dense in $E_1$, for all $A\in\mathscr A(\Omega)$ we have $$C_{1,p}(E_1\cap A)>0 \quad \Longleftrightarrow \quad C_{1,p}(E_2\cap A)>0\,.$$ This implies that $\mu_1(A)=\mu_2(A)$ for every $A\in\mathscr A(\Omega)$.
To prove that $\mu_1$ and $\mu_2$ are not equivalent, we observe that the inequality $\kappa(E_1)>\kappa(E_2)$ implies the existence of a function $u\in W^{1,p}(\Omega_0^+)$, with $u=0$ $p$-q.e. on $E_2$ and $u=1$ $p$-q.e. on $\partial\Omega_0^+\setminus M$, such that $$\label{exa:contr}
\int_{\Omega_0^+} |\nabla u|^p\,dx< \kappa(E_1)\,.$$ Let $v\in W^{1,p}(\Omega\setminus M)$ be such that $v=u$ in $\Omega_0^+$ and $v=0$ in $\Omega_0^-$. We claim that $$\label{exa:eq}
\int_{\Omega}[v]^p\,d\mu_1=\infty\quad \text{and}\quad \int_{\Omega}[v]^p\,d\mu_2=0\,.$$ To prove the first equality, by contradiction we assume that the first integral is finite. By the definition of $\mu_1$ this implies that $[v]=0$, hence $u=0$, $p$-q.e. in $E_1$. Thus $u$ is a competitor for the minimum problem which defines $\kappa(E_1)$, contradicting . The second equality in follows from the fact that $[v]=u=0$ $p$-q.e. on $E_2$.
\[lm:criterionequiv\] Two measures $\mu_1$, $\mu_2\in \mathcal{M}_p(\Omega; M)$ are equivalent if and only if they agree on $p$-quasi open sets.
The criterion follows by repeating with obvious changes the arguments used in [@DM2 Theorem 2.6].
The following lemma introduces a distinguished element in each equivalence class of $\mathcal{M}_p(\Omega; M)$.
For every $\mu\in \mathcal{M}_p(\Omega; M)$, there exists a measure $\mu^\ast\in\mathcal{M}_p(\Omega; M)$, equivalent to $\mu$, with the property that $$\label{maxcoset}
\mu^\ast(B) = \inf\big\{ \mu^\ast(U)\colon \text{\em $U$ $p$-quasi open and $B\subset U\subset \Omega$}\big\}\,,$$ for all $B\in\mathscr B(\Omega)$. Moreover, $\mu^\ast\ge\nu$ whenever $\nu\in\mathcal{M}_p(\Omega; M)$ is equivalent to $\mu$.
Arguing as in [@DM2 Theorem 3.9], it can be seen that $$\mu^\ast(B) := \inf\big\{ \mu(U)\colon\text{$U$ $p$-quasi open and $B\subset U\subset \Omega$}\big\}\,,\qquad \text{for all $B\in\mathscr B(\Omega)$,}$$ defines a Borel measure of class $ \mathcal{M}_p(\Omega; M)$ satisfying . By Lemma \[lm:criterionequiv\] $\mu^\ast$ is equivalent to $\mu$ and for any other measure $\nu$ within the equivalence class we have that $$\nu(B) \le \inf\big\{\nu(U)\colon\text{$U$ $p$-quasi open and $B\subset U\subset \Omega$}\big\}
=\mu^\ast(B)\,,$$ for all $B\in\mathscr B(\Omega)$.
The previous lemma states that any capacitary measure admits a maximal representative in its equivalence class that is outer regular with respect to $p$-quasi open sets.
In the sequel we will sometimes need to represent $\mu$ by means of a measure which is absolutely continuous with respect to an element of a dual Sobolev space.
\[lm:equivmis\] Every measure $\mu\in \mathcal{M}_p(\Omega;M)$ is equivalent to a measure $\psi\sigma$ of the form $$\psi \sigma(B) = \int_{B\cap M}\psi\,d\sigma\,,\qquad B\in\mathscr B(\Omega)\,,$$ for a Borel function $\psi:M\to[0,\infty]$ and a non-negative measure $\sigma$ of class $W^{-1,p'}(\Omega)$.
Let $\mu\in \mathcal{M}_p(\Omega;M)$. Let $\Omega_0$, $\Sigma_0$, and $\Omega_0^\pm$ be as in , let $E_0$ be a Borel set of $\Sigma_0$ and let $\mu_0=\mu{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}E_0\in \mathcal M_p(\Omega_0,\Sigma_0)$. By [@DM Theorem 5.7], there exist a Borel function $h\colon \Omega_0\times\mathbb R\to[0,\infty]$, increasing and lower semicontinuous in the second variable for all $x\in\Omega_0$, and a non-negative Radon measure $\sigma_0$ of class $W^{-1,p'}(\mathbb R^n)$ such that $$\label{eq:lemma}
\int_{A\cap \Sigma_0}
(\tilde z\vee0)^p
d\mu_0=
\int_{A\cap \Sigma_0} h(x,\tilde z)\,d\sigma_0\,,$$ for all $A\in\mathscr A(\Omega_0)$ and $z\in W^{1,p}(\Omega_0)$. The additional non-negative Borel measure $\nu$ appearing in [@DM Theorem 5.7] is not present here due to the obvious $p$-homogeneity property of the integral in the left-hand side of . Clearly, by , for every $t>0$ we have $$\int_{A\cap \Sigma_0} h(x,t\tilde z)\,d\sigma_0= t^p\int_{A\cap \Sigma_0} h(x,\tilde z)\,d\sigma_0\,.$$ Then by [@DMD Lemma 2.3], setting $\psi_0(x):=h(x,1)$ for $x\in \Omega_0$, we deduce $$\int_{A\cap \Sigma_0} h(x,\tilde z)\,d\sigma_0=\int_{A\cap \Sigma_0}(\tilde z\vee0)^p \psi_0\,d\sigma_0\,.$$ Plugging this into we obtain that $$\label{equivloc}
\int_{A\cap \Sigma_0} \tilde z^p\,d\mu_0=\int_{A\cap \Sigma_0} \tilde z^p\psi_0 \,d\sigma_0\,,$$ for all $A\in\mathscr A(\Omega_0)$ and for all non-negative functions $z\in W^{1,p}(\Omega_0)$.
We now prove the equivalence of $\mu$ to some measure $\psi\sigma$ according to Definition \[dfn:equiv\]. Let $\{E_i\}$ be a finite family of pairwise disjoint Borel sets of $M$ such that $M = E_1\cup\ldots\cup E_m$ for some $m\in\mathbb N$, every $E_i$ is contained in a cylinder $\Omega_i$ of the form and $\Sigma_i=\Sigma\cap \Omega_i$ admits a graph representation as in , for suitable radii $r_i>0$, centres $x_i\in M$, and axis $\nu_i\in \mathbb{R}^n$ with $|\nu_i|=1$. Let $\psi_i:\Sigma_i\to[0,\infty]$ and $\sigma_i\in W^{-1,p'}(\Omega_i)$ satisfy with $\Omega_0$, $\Sigma_0$, $\mu_0$ replaced by $\Omega_i$, $\Sigma_i$, $\mu_i=\mu{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}E_i$. Then we fix a function $u\in L^{1,p}(A\setminus M)$. For all indices $i$, the extension theorems for Sobolev functions imply that there exist $v_i,w_i\in W^{1,p}(\mathbb R^n)$ such that $v_i=u$ a.e. in $\Omega_i^+$ and $w_i=u$ a.e. in $\Omega_i^-$, with $\Omega_i^\pm$ being defined as in . Let $z_i = \tilde v_i-\tilde w_i$ so that $[u]=|\tilde z_i|$ for $p$-q.e. $x\in \Sigma_i$ and notice that $z_i=0$ on $\Sigma_i\setminus M$. Hence by we have $$\int_{A\cap M} [u]^p\,d\mu=
\sum_{i=1}^m\int_{A\cap \Sigma_i} |z_i|^p\,d\mu_i =
\sum_{i=1}^m\int_{A\cap \Sigma_i} |z_i|^p\,\psi_i\,d\sigma_i= \int_{A\cap M}[u]^p\psi\,d\sigma\,,$$ where in the last equality we have set $$\sigma = \sum_{i=1}^m\sigma_i\,,\qquad \psi = \sum_{i=1}^m 1_{E_i}\psi_i\,.$$ By linearity, it is clear that $\sigma$ is a non-negative Radon measure of class $W^{-1,p'}(\mathbb R^n)$ and that $\psi$ is a non-negative Borel function on $M$. The lemma is then proved.
$\Gamma$-convergence {#sec:3}
====================
We prove in this section a compactness result about the $\Gamma$-convergence of a sequence of functionals involving the compact sets $K_j$ and the function $f$. Then we discuss the convergence of the minimisers of this sequence when it is perturbed by a functional involving the function $g$.
A compactness result
--------------------
For every $j\in\mathbb N$ let $\mathscr F_{K_j}\colon L^0(\Omega)\times\mathscr{A}(\Omega)\to[0,\infty]$ be the functional defined by $$\label{eq:1.2}
\mathscr F_{K_j}(u,A) := \begin{cases}
\displaystyle\int_{A{\setminus}K_j} f(\nabla u)\,dx\,, & \qquad\text{if $u_{\vert_{{A{\setminus}K_j}}}\in L^{1,p}(A{\setminus}K_j)$,}\\
\infty\,,& \qquad \text{otherwise,}
\end{cases}$$ with $f$ satisfying and $(K_j)$ as in . Notice that for every $u\in L^0(\Omega)$ the set functions $\mathscr F_{K_j}(u,\cdot)$ are increasing on $\mathscr{A}(\Omega)$ with respect to set inclusion.
Then, let $\mathscr F',\mathscr F''\colon L^0(\Omega)\times \mathscr{A}(\Omega)\to[0,\infty]$ be the functionals defined by
\[233\] $$\begin{aligned}
\mathscr F'(u,A) & := \inf\left\{ \liminf_{j\to\infty} \mathscr F_{K_j}(u_j,A)\,\,\colon\,\, \text{$u_j\to u$ in $L^0(\Omega)$}\right\}\,,\label{233a}\\
\mathscr F''(u,A) &:= \inf\left\{ \Limsup_{j\to\infty} \mathscr F_{K_j}(u_j,A)\,\,\colon\,\, \text{$u_j\to u$ in $L^0(\Omega)$}\right\}\,.\label{233b}\end{aligned}$$
We observe that the infima in are achieved, see [@DMb Proposition 8.1]. Moreover, for every $u\in L^0(\Omega)$ the set functions $\mathscr F'(u,\cdot)$ and $\mathscr F''(u,\cdot)$ are increasing on $\mathscr{A}(\Omega)$ with respect to set inclusion and for every $A\in \mathscr{A}(\Omega)$ the functionals $\mathscr F'(\cdot,A)$ and $\mathscr F''(\cdot,A)$ are lower semicontinuous on $L^0(\Omega)$.
\[rmq:trunc\] Let $u\in L^0(\Omega)$ and let $(u_j)$ converge to $u$ in $L^0(\Omega)$. For every $t>0$ let $u_j^t=u_j\wedge t\vee -t$ and $u^t=u\wedge t\vee -t$. Since the truncation is Lipschitz continuous, $(u_j^t)$ converges to $u^t$ in $L^0(\Omega)$; moreover, it is easily seen that $\mathscr F_{K_j}(u_j^t,A)\le \mathscr F_{K_j}(u_j,A)$ for all $A\in \mathscr A(\Omega)$. Since $u^t=u$ for all $t\ge\|u\|_\infty$, we deduce that for functions $u\in L^\infty(\Omega)$ it is not restrictive to assume the recovery sequences in to be uniformly bounded by $\|u\|_\infty$ in $L^\infty(\Omega)$. Similarly, we also deduce that $$\label{truncation}
\mathscr F'(u^t,A)\le \mathscr F'(u,A)\quad \text{and}\quad \mathscr F''(u^t,A)\le \mathscr F''(u,A)\,,$$ for every $A\in\mathscr A(\Omega)$. Combining with the lower semicontinuity of $\mathscr F'$ and $\mathscr F''$ with respect to the convergence of $(u^t)$ to $u$ in $L^0(\Omega)$, we get $$\label{limits}
\lim_{t\to\infty}\mathscr F'(u^t,A)=\mathscr F'(u,A)\,,\quad \text{and}\quad \lim_{t\to\infty}\mathscr F''(u^t,A)=\mathscr F''(u,A)\,,$$ for every $A\in\mathscr A(\Omega)$.
\[richrmq\] Recall that a family of open sets $\mathscr{R}\subset\mathscr{A}(\Omega)$ is said to be [*rich*]{} if for every $\{A_t\}_{t\in\mathbb{R}}\subset \mathscr{A}(\Omega)$ such that $A_s\subset\subset A_t$ whenever $s<t$, the set $\{t\in\mathbb{R}\,\,\colon\,\, A_t\not\in \mathscr{R}\}$ is at most countable. In [@DMb Theorem 15.18] it is proved that $$\sup_{\substack{A'\in \mathscr{A}(\Omega) \\ A' \subset\subset A }}\mathscr F'(u,A') = \sup_{\substack{A'\in \mathscr{A}(\Omega) \\ A' \subset\subset A }}\mathscr F''(u,A')\,,$$ for every $u\in L^0(\Omega)$ and every $A\in \mathscr{A}(\Omega)$ if and only if there exists a rich family $\mathscr{R}\subset\mathscr{A}(\Omega)$ such that $$ \mathscr F'(u,A) =\mathscr F''(u,A)\,,$$ for every $u\in L^0(\Omega)$ and every $A\in\mathscr{R}$. Therefore, from [@DMb Theorem 16.9], the sequential characterisation of the $\Gamma$-convergence and definitions , there exists a subsequence of $(K_j)$, not relabelled, and a rich family $\mathscr R\subset \mathscr A(\Omega)$ such that the sequence of functionals $(\mathscr F_{K_j}(\cdot, A))$ $\Gamma$-converges in $L^0(\Omega)$ whenever $A\in\mathscr R$.
For every $\mu\in \mathcal M_p(\Omega;M)$ let $\mathscr F^{\mu}\colon L^0(\Omega)\times\mathscr{A}(\Omega)\to[0,\infty]$ be the functional defined by $$\label{FmuA}
\mathscr F^\mu(u,A) =
\begin{cases}
\displaystyle\int_{A\setminus M} f(\nabla u)\,dx+ \int_{A\cap M}[u]^p\,d\mu\,, & \qquad\text{if $u_{\vert_{A{\setminus}M}}\in L^{1,p}({A{\setminus}M})$,}\\
\infty\,,& \qquad \text{otherwise.}
\end{cases}$$
\[lm:p0\] Let $\mu\in \mathcal M_p(\Omega;M)$ and let $A\in\mathscr{A}(\Omega)$. Then, the restrictions to $L^q(\Omega)$ of the functionals $(\mathscr F_{K_j}(\cdot,A))$ defined by $\Gamma$-converge in $L^q(\Omega)$ to the restriction to $L^q(\Omega)$ of $\mathscr{F}^\mu(\cdot,A)$ if and only if $(\mathscr F_{K_j}(\cdot,A))$ $\Gamma$-converge in $L^0(\Omega)$ to $\mathscr{F}^\mu(\cdot,A)$.
Assume that the restrictions $\Gamma$-converge in $L^q(\Omega)$ and let us prove the $\Gamma$-convergence in $L^0(\Omega)$. We fix $u\in L^0(\Omega)$. As for the $\Gamma$-limsup inequality, we have to prove that $$\label{limsupLq2}
\mathscr F^\mu(u,A)\ge \mathscr F''(u,A)\,.$$ Let $t>0$. Since the truncated function $u^t\in L^q(\Omega)$ by assumption there exists a sequence $u_j\in L^{q}(\Omega)$ converging to $u^t $ in $L^q(\Omega)$ and such that $\mathscr F^\mu(u^t,A)\ge \Limsup_j \mathscr F_{K_j}(u_j, A)$. Moreover, since convergence in $L^q(\Omega)$ implies convergence in $L^0(\Omega)$, we have $ \Limsup_j \mathscr F_{K_j}(u_j, A)\ge \mathscr F''(u^t,A) $. By , we have $\mathscr F^\mu(u,A)\ge \mathscr F^\mu(u^t,A)$ and taking the limit as $t\to\infty$ we obtain , thanks to .
As for the $\Gamma$-liminf inequality, we have to prove that $$\label{liminfLq2}
\mathscr F'(u, A)\ge \mathscr F^\mu(u,A)\,.$$ Let $(v_j)$ be a sequence converging to $u$ in $L^0(\Omega)$, with $\mathscr F'(u,A)=\liminf_{j} \mathscr F_{K_j}(v_j,A)$. By the dominated convergence theorem, $v_j^t$ converges to $u^t$ in $L^p(\Omega)$ for every given $t>0$. Therefore, by assumption and by Remark \[rmq:trunc\] we have $$\liminf_{j\to\infty} \mathscr F_{K_j}(v_j,A)\ge \liminf_{j\to\infty} \mathscr F_{K_j}(v_j^t,A)\ge \mathscr F^\mu(u^t,A).$$ Taking the limit as $t\to\infty$ we get , thanks to Remark \[convpqe\] and Fatou’s lemma.
Conversely, assume $\Gamma$-convergence in $L^0(\Omega)$ and let us prove $\Gamma$-convergence in $L^q(\Omega)$. To this aim we introduce the functionals $\mathscr F'_q(\cdot,A)$ and $\mathscr F''_q(\cdot,A)$, defined on $L^q(\Omega)$ as in with $L^0(\Omega)$ replaced by $L^q(\Omega)$. The proof is similar to that of [@DMI Lemma 7.2]. The $\Gamma$-liminf inequality is immediate: for every $u\in L^q(\Omega)$ and for every sequence $u_j\in L^q(\Omega)$ converging to $u$ in $L^q(\Omega)$, clearly $u_j$ converges to $u$ in $L^0(\Omega)$ too, hence by assumption $
\liminf_{j}\mathscr F_{K_j}(u_j,A)\ge\mathscr F^\mu(u,A)
$ which implies that $$\mathscr F'_q(u,A)\ge \mathscr F^\mu(u,A)\,.$$
As for the $\Gamma$-limsup inequality, we have to prove that for every $u\in L^q(\Omega)$ we have $$\label{limsupLq}
\mathscr F^\mu(u,A)\ge \mathscr F''_q(u,A)\,.$$ Let $t>0$. By assumption, there exists a sequence $(v_j)$, converging to the truncation $u^t$ in $L^0(\Omega)$, such that $\mathscr F^\mu(u^t,A)\ge \Limsup_j \mathscr F_{K_j}(v_j,A)$; by Remark \[rmq:trunc\] we may also assume that $v_j$ is bounded by $t$ in $L^\infty(\Omega)$. Hence $(v_j)$ converges to $u^t$ in $L^q(\Omega)$ and consequently $\mathscr F^\mu(u^t,A)\ge \mathscr F''_q(u^t,A)$. Since $\mathscr F^\mu(u,A)\ge \mathscr F^\mu(u^t,A)$ we have $
\mathscr F^\mu(u,A)\ge \mathscr F''_q(u^t,A).
$ Since $u^t\to u$ in $L^q(\Omega)$ as $t\to\infty$, the lower semicontinuity of $\mathscr F''_q(\cdot,A)$ implies .
We now prove a compactness theorem ensuring $\Gamma$-convergence of the functionals to a $\Gamma$-limit with the integral representation given in
\[mainthm\] There exist a subsequence of $(K_j)$, not relabelled, a measure $\mu\in \mathcal{M}_p(\Omega;M)$ and a rich family $\mathscr R\subset \mathscr A(\Omega)$ such that the sequence of functionals $(\mathscr F_{K_j}(\cdot,A))$ defined by $\Gamma$-converges in $L^0(\Omega)$ to the functional $\mathscr F^\mu(\cdot,A)$ defined by for all $A\in\mathscr R$. The measure $\mu$ possibly depends on $f$ and on the subsequence $(K_j)$ but not on $\mathscr R$. Moreover, $A\in \mathscr R$ whenever $C_{1,p}(\partial A\cap M)=0$, thus $\Omega\in \mathscr R$.
By Remark \[richrmq\] and by [@Cor Theorem 7.8, Remark 7.9 and Theorem 8.2], there exist a subsequence of $(K_j)$, not relabelled, a measure $\mu\in \mathcal M_p(\Omega;M)$ and a rich family $\mathscr R\subset \mathscr A(\Omega)$ such that the restrictions to $L^p(\Omega)$ of the functionals $\mathscr F_{K_j}(\cdot,A)$ defined by $\Gamma$-converge in $L^p(\Omega)$ to the restriction to $L^p(\Omega)$ of the functional $\mathscr F^\mu(\cdot,A)$ for all $A\in \mathscr R$. Hence the conclusion follows thanks to Lemma \[lm:p0\].
Convergence of minimisers
-------------------------
This subsection is devoted to the convergence of the minimisers when the functionals $\mathscr F_{K_j}$ and $\mathscr F^\mu$ appearing in Theorem \[mainthm\] are perturbed with the functional $\mathscr G\colon L^0(\Omega)\times \mathscr{A}(\Omega)\to[0,\infty]$ defined by $$\mathscr G(u,A) := \begin{cases}
\displaystyle\int_{A} g(x,u)\,dx\,, & \qquad\text{if $u\in L^{q}(A)$,}\\
\infty\,,& \qquad \text{otherwise,}
\end{cases}$$ with $g$ satisfying . A significant instance of a function satisfying is $g(x,s)=|s-h(x)|^q$ for some $h\in L^q(\Omega)$. Notice that the compactness in $L^q(\Omega)$ of sequences of minimisers is not immediate even in this case, except when $h$ is also bounded so that minimisers satisfy apriori uniform $L^\infty$ estimates and their convergence to a minimiser is a mere consequence of a $\Gamma$-convergence result (see Proposition \[Gconvg\] below).
\[mainthm2\] Let $\mu\in\mathcal{M}_p(\Omega,M)$ and let $A\in \mathscr A(\Omega)$. Assume that $(\mathscr F_{K_j}(\cdot, A))$ $\Gamma$-converge in $L^0(\Omega)$ to $\mathscr F^\mu(\cdot, A)$. Then every sequence $(u_j)$ of minimisers of the problems $$\label{minj}
\min_{u\in L^{1,p}(A{\setminus}K_j)} \Big\{ \int_{A{\setminus}K_j} f(\nabla u)\,dx + \int_A g(x,u)\,dx\Big\}$$ has a subsequence which converges in $L^q(\Omega)$ to a minimiser of the problem $$\label{minj0}
\min_{u\in L^{1,p}(A{\setminus}M)} \Big\{ \int_{A{\setminus}M} f(\nabla u)\,dx + \int_{A\cap M} [u]^p\,d\mu + \int_A g(x,u)\,dx
\Big\}\,.$$ Moreover, the minimum values of converge to the minimum value of .
In order to prove Theorem \[mainthm2\], we need the following results about the $\Gamma$-convergence in $L^0(\Omega)$ of the functionals $\mathscr F_{K_j}+\mathscr G$ to $\mathscr F^\mu+\mathscr G$. Notice that the conclusion is not obvious because $\mathscr G$ is, in general, not continuous in $L^0(\Omega)$.
\[Gconvg\] Let $\mu\in\mathcal{M}_p(\Omega,M)$ and let $A\in \mathscr A(\Omega)$. Assume that $(\mathscr F_{K_j}(\cdot,A))$ $\Gamma$-converge in $L^0(\Omega)$ to $\mathscr F^\mu(\cdot,A)$. Then, the sequence of functionals $(\mathscr F_{K_j}(\cdot, A)+\mathscr G(\cdot, A))$ $\Gamma$-converge in $L^0(\Omega)$ to the functional $\mathscr F^{\mu}(\cdot, A)+\mathscr G(\cdot, A)$.
Let $u\in L^0(A)$. By assumption and by the lower semicontinuity of the functional $\mathscr G$ with respect to the convergence in $L^0(\Omega)$, which follows from Fatou’s Lemma, we have $$\label{Glimsupinf}
\begin{split}
\mathscr F^{\mu}(u,A)+\mathscr G(u,A)
& \le \inf\Big\{ \liminf_{j\to\infty} \big(\mathscr F_{K_j}(u_j,A)+\mathscr G(u_j,A)\big)\colon
\text{$u_j\to u$ in $L^0(\Omega)$} \Big\}\\
& \le
\inf\Big\{ \Limsup_{j\to\infty} \big(\mathscr F_{K_j}(u_j,A)+\mathscr G(u_j,A)\big)\colon \text{$u_j\to u$ in $L^0(\Omega)$} \Big\}\,.
\end{split}$$ We claim that these inequalities are in fact equalities. Indeed, if $u\not\in L^q(A)$, by the left-hand side in is infinite and the conclusion is obvious. If instead $u\in L^q(A)$ then by Lemma \[lm:p0\] and by the continuity of the functional $\mathscr G$ with respect to the strong convergence in $L^q(\Omega)$, we have that $$\inf\Big\{ \Limsup_{j\to\infty} \Big(\mathscr F_{K_j}(u_j,A)+\mathscr G(u_j,A)\Big)\colon \text{$u_j\to u$ in $L^q(\Omega)$} \Big\}
\le \mathscr F^{\mu}(u,A) + \mathscr G(u,A)\,.$$ Since clearly the convergence in $L^q(\Omega)$ implies the convergence in $L^0(\Omega)$, we deduce the equalities in . This concludes the proof.
In order to deduce the convergence of minimisers in $L^q(\Omega)$, we also need the following result.
\[prop:ptw\] Let $A\in \mathscr A(\Omega)$, let $u\in L^q(A)$, let $(u_j)$ be a sequence converging to $u$ in $L^0(\Omega)$ and assume that $$\label{convergence}
\lim_{j\to\infty} \int_{A}g(x,u_j)\,dx= \int_{A}g(x,u)\,dx\,.$$ Then $(u_j)$ converges to $u$ strongly in $L^q(\Omega)$.
By , the convergence of $(u_j)$ to $u$ in $L^0(\Omega)$ implies that $g(x,u_j)\to g(x,u)$ in $L^0(\Omega)$. Thus, by the generalised dominated convergence theorem, using and the lower bound in we deduce that $$\label{convnorm}
\lim_{j\to\infty} \int_A |u_j|^q\,dx = \int_A |u|^q\,dx\,.$$ By using again the generalised dominated convergence theorem, implies the strong convergence in $L^q(\Omega)$ of $(u_j)$ to $u$.
Let $u_j\in L^{1,p}(A {\setminus}K_j)$ be a sequence of minimisers of the minimum problems . By [@DMb Proposition 7.1], $\sup_j [\mathscr F_{K_j}(u_j,A)+\mathscr G(u_j,A)]<\infty$, hence by and there exists a function $u\in L^{1,p}(A{\setminus}M)\cap L^q(A)$ and a subsequence, not relabelled, $( u_j)$ converging to $ u$ weakly in $W^{1,p}(A{\setminus}M_\rho)$, for every $\rho>0$, where $
M_\rho = \left\{ x\in \Omega \colon {\rm dist}(x,\Sigma)\le\rho \right\}
$. Therefore, $(u_j)$ converges in $L^0(\Omega)$ to a function $u\in L^q(A)$. Moreover, as a general consequence of the $\Gamma$-convergence result of Proposition \[Gconvg\], see [@DMb Corollary 7.20], $u$ is a solution of the minimum problem and $$\label{minTOmin2}
\lim_{j\to\infty} \Big\{\int_{A\setminus K_j} f(\nabla u_j)\,dx+ \int_A g(x,u_j)\,dx\Big\}
=\int_{A\setminus M}f(\nabla u)\,dx+ \int_{A\cap M} [u]^p\,d\mu+\int_A g(x,u)\,dx\,.$$
Then, by the $\Gamma$-convergence assumption $$\label{minj3}
\int_{A{\setminus}M} f(\nabla u)\,dx + \int_{A\cap M} [u]^p\,d\mu
\le \liminf_{j\to\infty} \int_{A{\setminus}K_j} f(\nabla u_j)\,dx\,.$$ The lower semicontinuity of $\int_A g(x,\cdot)dx$ with respect to the convergence in $L^0(\Omega)$ implies $$\label{minj2}
\int_A g(x,u)\,dx\le \liminf_{j\to\infty} \int_A g(x,u_j)\,dx\,.$$ Combining with we get $$\int_{A{\setminus}M} f(\nabla u)\,dx + \int_{A\cap M} [u]^p\,d\mu+ \int_A g(x,u)\,dx
\le \liminf_{j\to\infty}\Big\{ \int_{A{\setminus}K_j} f(\nabla u_j)\,dx + \int_A g(x,u_j)\,dx\Big\}\,,$$ and by all the inequalities are in fact equalities. Hence by we have $$\int_A g(x,u) =\lim_{j\to\infty}\int_A g(x,u_j)\,dx\,.$$ Thus, by Proposition \[prop:ptw\] we can deduce that $(u_j)$ converges to $u$ strongly in $L^q(\Omega)$, and this implies the desired conclusion.
Approximation of capacitary measures {#sec:density}
====================================
This section is devoted to prove that all capacitary measures concentrated on smooth hypersurfaces can be approximated by homogeneisation as described in Section \[sec:3\]. This density result means that the class $\mathcal L_p(\Omega;M)$ of limit measures, i.e., limit measures that can appear in the conclusion of Theorem \[mainthm\] (see the following definition), coincides with the whole class $\mathcal M_p(\Omega;M)$ of capacitary measures concentrated on $M$.
\[class:mu\] Let $\mu\in \mathcal{M}_p(\Omega; M)$ and let $A\in\mathscr A(\Omega)$. We say that $\mu\in\mathcal L_p(A; M)$ if there exists a sequence of compact sets $(K_j)$ satisfying and such that the sequence of functionals $(\mathscr F_{K_j}(\cdot,A) )$ defined by $\Gamma$-converge in $L^0(\Omega)$ to the functional $\mathscr F^\mu(\cdot,A)$ defined as in . In this case, we say that the sequence $(K_j)$ is associated with $\mu$.
Stability results
-----------------
A sufficient condition for the stability of the class introduced in Definition \[class:mu\] is the $\Gamma$-convergence of the corresponding functionals $\mathscr F^\mu$.
\[Gamma-stability\] Let $A\in\mathscr A(\Omega)$. Let $\mu^k \in\mathcal{L}_p(A; M)$ for every $k\in\mathbb N$, and let $\mu\in\mathcal M_p(A; M)$. Assume that $(\mathscr F^{\mu^k}(\cdot, A))$ $\Gamma$-converge in $L^0(\Omega)$ to $\mathscr F^\mu(\cdot, A)$. Then $\mu\in\mathcal{L}_p(A;M)$.
Given a functional $\mathscr F\colon L^q(\Omega)\times \mathscr{A}(\Omega)\to[0,\infty]$, for every $A\in\mathscr A(\Omega)$ and for every $\tau>0$ we define a Moreau-Yosida-type approximation of index $\tau$ of $\mathscr F(\cdot,A)$ setting $$\mathcal Y_\tau \mathscr F(u,A) = \inf \big\{ \mathscr F(v,A) +\tau \|u-v\|^q_{L^q(A)}: v\in L^q(A)\big\}\,,$$ for all $u\in L^q(A)$.
Since $\mu^k\in\mathcal{L}_p(A;M)$, by Definition \[class:mu\], there exists a sequence of compact sets $(K_j^k)$, with $\max\{{\rm dist}(x,M)\colon x\in K_j^k\}\to0^+$ as $j\to\infty$, such that the sequence of functionals $(\mathscr F_{K_j^k}(\cdot, A))$ defined by $\Gamma$-converge in $L^0(\Omega)$ to the functional $\mathscr F^{\mu^k}(\cdot, A)$. Possibly passing to a subsequence we may assume $\max\{{\rm dist}(x,M)\colon x\in K_j^k\}\le 1/j$. By Theorem \[mainthm2\] $$\label{moryo}
\lim_{j\to\infty} \mathcal{Y}_\tau \mathscr F_{K_j^k}(u,A) = \mathcal{Y}_\tau \mathscr F^{\mu^k}(u,A)\quad
\text{for every $u\in L^q(A)$, $\tau>0$, and $k\in\mathbb N$.}$$ As in Lemma \[lm:p0\], by the $\Gamma$-convergence assumption we can prove that the restrictions to $L^q(\Omega)$ of $(\mathscr F^{\mu^k}(\cdot, A))$ $\Gamma$-converge in $L^q(\Omega)$ to the restriction to $L^q(\Omega)$ of $\mathscr F^{\mu}(\cdot, A)$. Then arguing as in Theorem \[mainthm2\] we obtain $$\label{moryo2}
\lim_{k\to\infty} \mathcal{Y}_\tau \mathscr F^{\mu^k}(u,A) = \mathcal{Y}_\tau \mathscr F^{\mu}(u,A) \quad \text{for every $u\in L^q(A)$, $\tau>0$, and $k\in\mathbb N$.}$$ Let $(u_i)$ be a countable dense sequence in $L^q(A)$. By for every $k$ there exists $j_k\ge k$ such that $$\left|\mathcal{Y}_\tau \mathscr F_{K_{j_k}^k}(u_i,A) - \mathcal{Y}_\tau \mathscr F^{\mu^k}(u_i,A)\right|\le 1/k\,,$$ every $i=1,\dots, k$ and every $\tau=1,\dots, k$. By this implies $$\lim_{k\to\infty} \mathcal{Y}_\tau \mathscr F_{K_{j_k}^k}(u_i,A) = \mathcal{Y}_\tau \mathscr F^\mu(u_i,A)\,,\qquad
\text{for every $i,\tau\in\mathbb N$.}$$ From [@DMb Theorem 9.16], using Lemma \[lm:p0\] again, we deduce that the sequence of functionals $(\mathscr F_{K_{j_k}^k}(\cdot, A))$ $\Gamma$-converge in $L^0(\Omega)$ to the functional $\mathscr F^{\mu}(\cdot, A)$. Hence to conclude that $\mu\in\mathcal L_p(A;M)$, it suffices to observe that $\max\{{\rm dist}(x,M)\colon x\in K_{j_k}^k\}\le 1/j_k\le1/k$ for $j$ large enough.
A simple condition for the $\Gamma$-convergence of the functionals $\mathscr F^{\mu}$ is provided by the following lemma.
\[lm:supernuovo\] Let $A\in\mathscr A(\Omega)$. Let $\mu^k\in \mathcal{M}_p(A;M)$ for every $k\in \mathbb N$, and let $\mu\in \mathcal M_p(A;M)$. Assume that $(\mu^k)$ is monotone and that $\mu$ is the pointwise limit of the measures $\mu^k$, defined as $\mu(B):=\lim_{k\to\infty} \mu^k(B)$ for every $B\in\mathscr B(A)$. Then $(\mathscr F^{\mu^k}(\cdot, A))$ $\Gamma$-converges in $L^0(\Omega)$ to $\mathscr F^\mu(\cdot, A)$.
In view of [@DMb Proposition 5.4] (see also [@DMb Remark 5.5]), if $(\mu^k(B))$ is a monotone increasing sequence for every $B\in\mathscr B(A)$ then the $\Gamma$-limit of the functionals $\mathscr F^{\mu^k}$ coincides with the pointwise monotone limit, which by assumption is given by $\mathscr F^\mu$.
An immediate consequence of Lemma \[Gamma-stability\] and Lemma \[lm:supernuovo\] is that a measure belongs to $\mathcal{L}_p(A;M)$ whenever it can be written as the pointwise monotone limit of measures of class $\mathcal{L}_p(A;M)$.
The stability of the class introduced in Definition \[class:mu\] holds also under convergence in dual Sobolev spaces. To see this we need the following result about the lower semicontinuity of the integral of the jump of $u$ when both the measure and the function vary.
\[lm:76\] Let $\Omega_0$ and $\Sigma_0$ be defined by and , respectively. Let $(\mu^k)$ be a sequence of non-negative Radon measures in $W^{-1,p'}(\Omega_0)$ converging to $\mu$ strongly in $W^{-1,p'}(\Omega_0)$ and let $(u_k)$ be a sequence of functions converging to $u$ weakly in $W^{1,p}(\Omega_0{\setminus}\Sigma_0)$. Then $$\label{eq:76}
\int_{\Sigma_0} [u]^p\,d\mu\le\liminf_{k\to\infty} \int_{\Sigma_0}[u_k]^p\,d\mu^k\,.$$
It suffices to prove that $$\label{lm7:claim}
\int_{\Sigma_0} |\tilde z|^p\, d\mu \le \liminf_{k\to\infty}
\int_{\Sigma_0}
|\tilde z_k|^p\,d\mu^k$$ for all sequences $(z_k)$ weakly converging to $z$ in $W^{1,p}(\Omega_0)$. Let $(\varphi_i)$ be a sequence in $C^\infty_c(\Omega_0)$ such that $0\le\varphi_i\le \varphi_{i+1}\le 1$ for all $i$ and $\varphi_i(x)\to 1$ for all $x$. Let $t>0$ and let $z_k^t$ and $z^t$ be the truncations of $z_k$ and $z$. Since $\mu^k$ converges to $\mu$ strongly in $W^{-1,p'}(\Omega_0)$, $|z_k^t|^p\,\varphi_i$ converges to $|z^t|^p\,\varphi_i$ weakly in $W^{1,p}_0(\Omega_0)$, and $$\langle \mu^k\!,|z_k^t|^p\varphi_i\rangle = \! \int_{\Sigma_0}\!\!\!\!
|\tilde z_k^t|^p\,\varphi_i\,d\mu^k,\quad \langle \mu,|z^t|^p\varphi_i\rangle = \! \int_{\Sigma_0}\!\!\!\!
|\tilde z^t|^p\,\varphi_i\,d\mu\,,$$ we obtain $$\label{lm7:claim22}
\int_{\Sigma_0} |\tilde z^t|^p\,\varphi_i\, d\mu \le \liminf_{k\to\infty}
\int_{\Sigma_0}
|\tilde z_k^t|^p\,\varphi_i\,d\mu^k\le \liminf_{k\to\infty}\int_{\Sigma_0}
|\tilde z_k|^p\,d\mu^k\,.$$ Letting $i\to\infty$ and $t\to\infty$, by the monotone convergence theorem we obtain from .
We now prove . Let $\Omega_0^\pm$ the two connected components of $\Omega_0\setminus \Sigma_0$, as in . By applying a linear extension operator we find $v_k,v,w_k,w\in W^{1,p}(\Omega_0)$ such that $$u_k^+ = \tilde v_k\,, \quad u^+= \tilde v\,, \quad u_k^-=\tilde w_k\,, \quad u^- = \tilde w\quad \text{$p$-q.e. on $\Sigma_0$.}$$ Let $z_k=\tilde v_k-\tilde w_k$ and $z=\tilde v-\tilde w$ so that $$[u_k]=|z_k|\quad \text{and}\quad [u]=|z| \quad \text{$p$-q.e. on $\Sigma_0$.}$$ By linearity $(z_k)$ converges to $z$ weakly in $W^{1,p}_0(\Omega_0)$, hence follows from .
We now prove the closure of the class $\mathcal{L}_p(\Omega_0;M)$ under strong convergence in dual Sobolev space.
\[lm:77\] Let $\Omega_0$ be defined by and let $\Sigma_0=\Omega_0\cap \Sigma$ be representable as in . Let $\mu^k\in\mathcal{L}_p(\Omega_0;M)$ for every $k\in\mathbb N$ and let $\mu\in\mathcal M_p(\Omega_0;M)$. Assume that $(\mu^k)$ is a sequence of non-negative Radon measures in $W^{-1,p'}(\Omega_0)$ converging to $\mu$ strongly in $W^{-1,p'}(\Omega_0)$. Then $\mu\in\mathcal{L}_p(\Omega_0;M)$.
By Lemma \[Gamma-stability\], it suffices to prove the $\Gamma$-convergence in $L^0(\Omega)$ of the sequence $(\mathscr F^{\mu^k}(\cdot, \Omega_0))$ to $\mathscr F^\mu(\cdot, \Omega_0)$. Let $\widehat{\mathscr F}'$ and $\widehat{\mathscr F}''$ be the $\Gamma$-liminf and $\Gamma$-limsup of $\mathscr F^\mu$ in $L^0(\Omega)$ of this sequence. Given $u\in L^0(\Omega)$ and $t>0$ we consider the truncation $u^t$. By extension theorems in Sobolev spaces we may find functions $v,w\in W^{1,p}(\Omega_0)\cap L^\infty(\Omega_0)$ satisfying $$(u^t)^+= \tilde v\quad \text{and} \quad (u^t)^- = \tilde w\quad \text{$p$-q.e. on $\Sigma_0$.}$$ This implies that $$\int_{\Sigma_0} [u^t]^p\,d\mu^k=\langle \mu^k,|v-w|^p\rangle\to\langle \mu,|v-w|^p\rangle=\int_{\Sigma_0} [u^t]^p\,d\mu$$ which gives $$\widehat{\mathscr{F}}''(u^t,\Omega_0)\le \lim_{k\to\infty}\mathscr F^{\mu^k}(u^t,\Omega_0)=\mathscr F^{\mu}(u^t,\Omega_0)\le \mathscr F^{\mu}(u,\Omega_0).$$ Taking the limit as $t\to\infty$ we obtain $\widehat{\mathscr{F}}''(u,\Omega_0)\le \mathscr F^\mu(u,\Omega_0)$. On the other hand, we also have $ \mathscr F^\mu(u,\Omega_0)\le \widehat{\mathscr F}'(u,\Omega_0)$. This is an immediate consequence of Lemma \[lm:76\] and of the lower semicontinuity of the integral $\int_{\Omega_0}f(\nabla u)\, dx$. Combining the two inequalities we get the desired $\Gamma$-convergence and we conclude.
Density results
---------------
We begin by proving that the collection of all non-negative finite Radon measures on $M$ belonging to $W^{-1,p'}(\mathbb R^n)$ is dense in the class of all capacitary measures concentrated on $M$.
\[lemmanuovo\] Let $\mu\in\mathcal M_p(\Omega, M)$ and let $A\in\mathscr A(\Omega)$. Then there exists a sequence $(\mu^k)$ of non-negative finite Radon measures of class $W^{-1,p'}(\Omega)$ such that $(\mathscr F^{\mu^k}(\cdot, A))$ $\Gamma$-converges in $L^0(\Omega)$ to $\mathscr F^\mu(\cdot, A)$.
By Lemma \[lm:equivmis\] there exist a Borel function $\psi\colon M\to [0,\infty]$ and a non-negative Radon measure $\sigma$ of class $W^{-1,p'}(\mathbb R^n)$ such that $$\label{equivms2}
\int_{A\cap M} [u]^p\,d\mu = \int_{A\cap M} [u]^p\psi\,d\sigma\,,$$ for all $u\in L^{1,p}(A\setminus M)$. Since the measure $\psi\sigma$ is the pointwise limit of the measures $\mu^k = (\psi\wedge k)\sigma$ the $\Gamma$-limit of $\mathscr F^{\mu^k}(\cdot,A)$ is $\mathscr F^\mu(\cdot,A)$, thanks to Lemma \[lm:supernuovo\] and . Clearly every $\mu^k$ is a finite non-negative Radon measure of class $W^{-1,p'}(\mathbb R^n)$.
In view of Lemmas \[Gamma-stability\] and \[lemmanuovo\], to prove that $\mathcal L_p(A;M)=\mathcal M_p(A;M)$ it is enough to show that every non-negative Radon measure belonging to $W^{-1,p'}(\mathbb R^n)$ also belong to $\mathcal L_p(A, M)$. We first prove this conclusion in the special case of hyperplanes.
\[prop:density\] Assume that $M$ and $\Sigma$ are contained in a hyperplane. Let $\Omega_0$ be as in so that $\Pi_0=\Omega_0\cap \Sigma$. Then $\mathcal M_p(\Omega_0,M)=\mathcal L_p(\Omega_0;M)$.
We only have to prove the inclusion $\mathcal M_p(\Omega_0;M)\subset\mathcal L_p(\Omega_0;M)$, the other being trivial by Definition \[class:mu\]. It is known that the measures $\beta\mathscr H^{n-1}{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}(A\cap M)$ belong to the class $\mathcal{L}_p(\Omega_0; M)$ for all $\beta>0$ and for all $A\in\mathscr A(\Omega_0)$, see, e.g., [@ansini Theorem 3.3] (see also Remark 3.3(a) therein), for which the hypothesis $p\le n$ is crucial. Since by Definition \[class:mu\] the class $\mathcal{L}_p(\Omega_0;M)$ is closed under sum and multiplication by positive scalars, we deduce that $$\sum_{i=1}^h\beta_i 1_{A_i}\mathscr H^{n-1}{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}M\in\mathcal{L}_p(\Omega_0;M)$$ for all pairwise disjoint relative open subsets $A_1,\ldots,A_h$ of $M$, for all $\beta_1,\ldots,\beta_h>0$, and for all $h\in\mathbb N$. Since by standard density result simple functions are dense in $L^{p'}(\Omega_0)$, by Lemma \[lm:77\] we can deduce that every measure of the form $\theta\mathscr H^{n-1}{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}M$, with $\theta\in L^{p'}(M;\mathscr H^{n-1})$ and $\theta\ge 0$, belongs to $\mathcal{L}_p(\Omega_0;M)$. Indeed, if $(\theta_h)$ is a sequence converging to $\theta$ in $L^{p'}(M,\mathscr H^{n-1})$, then the sequence of non-negative Radon measures $\theta_h\mathscr H^{n-1}{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}M$ converges to $\theta\mathscr H^{n-1}{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}M$ in $W^{-1,p'}(\Omega_0)$, by Hölder inequality and Sobolev trace theorem.
Next we prove that the linear space $\mathcal{X}:=\{ \theta\mathscr H^{n-1}{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}M\colon \theta\in C^\infty_0(\Omega_0) \}$ is dense, with respect to the strong topology of $W^{-1,p'}(\Omega_0)$, in the closed linear space $\mathcal{Y}:=\{F\in W^{-1,p'}(\mathbb R^n)\colon {\rm supp}(F)\subset M\}$. If not, by Hahn-Banach theorem and by the reflexivity of $W^{1,p}(\mathbb R^n)$ there exists $F_0\in \mathcal{Y}\setminus \mathcal X$ and $u_0\in W_0^{1,p}(\Omega_0)$ such that $\langle F_0,u_0\rangle\neq0$ and $\langle F, u_0 \rangle=0$ for every $F\in\mathcal X$. The last condition implies $$\int_{ M} u_0\,\theta\,d\mathscr H^{n-1}=0\,,\qquad \text{for all $\theta\in C^\infty_0(\mathbb R^n)$.}$$ In particular, $u_0=0$ $\mathscr H^{n-1}$-a.e. on $ M$. Then, $u$ would be the limit in $W^{1,p}(\Omega_0)$ of a sequence $(u_\varepsilon)\subset C^\infty_0(\Omega_0)$ such that ${\rm supp}(u_\epsilon)\cap M=\emptyset$. Since $F_0\in \mathcal{Y}$, then ${\rm supp}(F_0)\subset M$, hence $\langle F_0, u_\epsilon\rangle=0$ for every $\epsilon$. This implies that $\langle F_0, u_0\rangle=0$, and this contradiction concludes the proof of the density of $\mathcal X$ in $\mathcal Y$.
Using Lemma \[lm:77\] again, from the density of $\mathcal{X}$ in $\mathcal{Y}$ we deduce, in particular, that all non-negative Radon measures of class $W^{-1,p'}(\Omega_0)$ with support contained in $ M$ belong to $\mathcal{L}_p(\Omega_0; M)$. Then, the desired conclusion follows by Lemma \[Gamma-stability\] and Lemma \[lemmanuovo\].
The following lemma is another ingredient in the proof of the main result of this section: it entails that every capacitary measure is sufficiently close to a measure of the class introduced in Definition \[class:mu\].
\[lm:diffeo2\] Let $\eta>0$, let $\Omega_0$ be a cylinder of the form , let $\Sigma_0=\Omega_0\cap \Sigma$ be representable as in , and let $\Psi\colon \Omega_0\to \Omega_0$ be a $C^1$ diffeomorphism with $\|\Psi-{\rm Id}\|_{C^1(\Omega_0)}<\eta$ and $\Psi(\Sigma_0) = \Pi_0$, where $\rm Id$ is the identity map. Let $\mu\in \mathcal{M}_p(\Omega_0;M)$. Then there exists $\sigma\in \mathcal{L}_p(\Omega_0;M)$ with $$\label{eq:diffeo2}
\left|\int_{\Sigma_0}[u]^p\,d(\mu-\sigma)\right|\le C \eta\int_{\Omega_0\setminus \Sigma_0}f(\nabla u)\,dx, \quad \text{for all $u\in L^{1,p} (\Omega_0\setminus M)$,}$$ where $C>0$ is a constant only depending on $\lambda, \Lambda, p$. In addition, if $E,E'$ are Borel subsets of $\Sigma_0$ with $\mu(\Sigma_0\setminus E)=0$ and $$\label{metric:separation}
\inf_{E\times E'}|x-y|>\delta>0,$$ then $\sigma(E')=0$.
We first observe that there exists a constant $C>0$ only depending on $\lambda,\Lambda,p$ such that $$\label{smallness-f}
\left\vert\int_{\Omega_0\setminus K}\Big[f(\nabla u)-f\big(\nabla u(D\Psi^{-1}\circ \Psi)\big)|\det D\Psi(x)| \Big]\,dx\right\vert\le
C\,\eta\, \int_{\Omega_0\setminus K} f(\nabla u)\,dx\,,$$ for every closed set $K\subset \Sigma_0$ and for every $u\in W^{1,p}(\Omega_0\setminus K)$ (with the convention that $\nabla u$ is a row vector). Indeed, by and Euler’s identity we have $$\nabla_\xi f(\xi)\cdot v = \lim_{t\to0^+} \frac{f(\xi+t(v-\xi))-f(\xi)}{t} + \nabla_\xi f(\xi)\cdot \xi \le f(v)+(p-1)f(\xi)\,,$$ for a.e. $\xi\in\mathbb R^n$, so that a standard homogeneity argument gives $$| \nabla_\xi f(\xi)\cdot v| \le pf(\xi)^\frac{p-1}{p} f(v)^\frac{1}{p}\,,\quad \text{for a.e. $\xi\in\mathbb R^n$.}$$ Since the restriction of $f$ to a line is a convex function then it is differentiable a.e. w.r.t. the one-dimensional Lebesgue measure. Hence, plugging in $\xi=(1-t)\nabla u(D\Psi^{-1}\circ \Psi)+t\nabla u$ with $0<t<1$ and $v= \nabla u(I-D\Psi^{-1}\circ \Psi)$ in the last inequality and integrating, by the assumption that $\| \Psi - I \|_{C^1(\Omega_0)}<\eta$, we obtain $$\int_{\Omega_0\setminus K}\Big|f(\nabla u)- f(\nabla u(D\Psi^{-1}\circ \Psi)) \Big|\,dx\le
C \eta \int_{\Omega_0\setminus K} f(\nabla u)\,dx\,,$$ (where we also used the convexity of $f$ again) with the constant being independent of $ f$, $H$ and $\eta$. Using the assumption again, follows.
Now, let $u\in L^{1,p} (\Omega_0\setminus M)$ and let $\pi\colon \mathscr B(\Omega_0)\to [0,\infty]$ be the measure of $\mathcal{M}_p(\Omega_0;M)$ defined by $$\label{pisharp}
\pi(B) := \mu(\Psi^{-1}(B)\cap \Omega_0)\,,\qquad \text{for all $B\in \mathscr B(\Omega_0)$.}$$ Since $\psi(M)\cap \Omega_0$ is contained in $\Pi_0$, by Proposition \[prop:density\], $\pi\in \mathcal{L}_p(\Omega_0;\Psi(M))$. Therefore, there exist a sequence of compact sets $(H_j)$ with $\max\{{\rm dist}(x,\Psi(M))\colon x\in H_j\}\to0^+$ as $j\to\infty$ and a sequence $(v_j)$ of $L^{1,p}(\Omega_0\setminus \Psi(M))$ converging to the function $v=u\circ\Psi^{-1}\in W^{1,p}(\Omega_0\setminus \Psi(M))$ in $L^0(\Omega)$, such that
\[eq:density\] $$\label{eq1:density}
\lim_{j\to\infty} \int_{\Omega_0\setminus H_j} f(\nabla v_j)\,dx
=\int_{\Omega_0\setminus \Pi_0} f(\nabla v)\,dx + \int_{ \Pi_0} [v]^p\,d\pi\,.$$ Moreover, the sequence of compact sets $(K_j)$ and of functions $(u_j)$ of $W^{1,p}(\Omega_0\setminus M)$, defined by composition, respectively, as $K_j=\Psi^{-1}(H_j)$ and $u_j=v_j\circ \Psi$, are such that $\max\{{\rm dist}(x,M)\colon x\in K_j\}\to0^+$ as $j\to\infty$ and $u_j$ converges to $u$ in $L^0(\Omega)$. Hence, by Theorem \[mainthm\], up to subsequences (not relabelled) there exists $\sigma\in \mathcal{L}_p(\Omega_0;M)$ such that $$\label{eq2:density}
\liminf_{j\to\infty} \int_{\Omega_0\setminus K_j} f(\nabla u_j)\,dx\ge \int_{\Omega_0\setminus \Sigma_0} f(\nabla u)\,dx+\int_{\Sigma_0} [u]^p\,d\sigma\,.$$
Therefore, by combining with and by using $\Psi$ to change variables in the volume integrals, recalling , we deduce the estimate $$\int_{\Sigma_0}[u]^p\,d(\sigma-\mu)=\int_{ \Sigma_0} [u]^p\,d\sigma - \int_{ \Pi_0} [v]^p\,d\pi\le C\eta\,
\int_{\Omega_0\setminus\Sigma_0}f(\nabla u)\,dx\,,$$ The estimate then follows by estimating the integral $\int_{\Sigma_0}[u]^p\,d(\mu-\sigma)$ in a similar way, by choosing a recovering sequence for $\mathscr F^\sigma(u,\Omega)$ and by using $\Psi$ to change variables with the estimate .
As for the final part, from the assumption on $\mu$ and definition we deduce that $\pi$ is concentrated on $\Psi(E)\cap \Pi_0$. Therefore, by Definition \[class:mu\] we may assume the closed sets $H_j$ appearing in to be contained in $\Psi(E)$. Since $\Psi$ is a diffeomorphism, every set $\Psi^{-1}(H_j)$ is contained in $E$. Then the measure $\sigma$ appearing in must be concentrated in $\{x\in\Sigma_0\colon {\rm dist}(x,E)<\delta\}$, which by implies $\sigma(E')=0$.
We are now in position to prove the main result of this section.
The following equality holds: $\mathcal{L}_p(\Omega;M) = \mathcal{M}_p(\Omega;M)$.
In view of Definition \[class:mu\], we fix a measure $\mu\in \mathcal{M}_p(\Omega;M)$ and we prove that $\mu\in \mathcal{L}_p(\Omega;M)$. We can also assume $\mu$ to be a finite Radon measure of class $W^{-1,p'}(\mathbb R^n)$, thanks to Lemma \[Gamma-stability\] and Lemma \[lemmanuovo\]. Let $k>0$. We consider a finite family $\{E_i\}$ of pairwise disjoint Borel sets of $M$ such that $M=E_0\cup E_1\cup \ldots\cup E_m$ for some $m\in\mathbb N$, $\mu(E_0)<2^{-k}$, every $E_i$ (with $i\ge1$) is contained in a cylinder $\Omega_i$ of the form and $\Sigma_i=\Sigma\cap \Omega_i$ admits a graph representation as in , for suitable radii $r_i>0$, centres $x_i\in \Sigma$ and axis $\nu_i\in\mathbb R^n$ with $|\nu_i|=1$. Moreover, for $i\ge1$, the sets $E_i$ can be chosen to satisfy $$\min_{1\le i<j\le m}\inf_{(x,y)\in E_i\times E_j}|x-y|>0\,.$$ Let $\mu_i:=\mu{\mathbin{\vrule height 1.6ex depth 0pt width
0.13ex\vrule height 0.13ex depth 0pt width 1.3ex}}E_i\in W^{-1,p'}(\Omega_i)$ for every $i=1,\ldots,m$. By Lemma \[lm:diffeo2\], there exists $\sigma_i^k\in \mathcal{L}_p(\Omega_i;M)$, concentrated on $E_i$, such that $$\label{eq:diffeoeta}
\left|\int_{\Sigma_i}[u]^p\,d(\mu_i-\sigma_i^k)\right|\le C 2^{-k}\int_{\Omega_i\setminus \Sigma_i}f(\nabla u)\,dx\,,
\qquad \text{for all $u\in W^{1,p}(\Omega_i\setminus M)$.}$$ The measure $\sigma^k = \sum_{i=1}^m\sigma_i^k$ is a non-negative Borel measure that belongs to $\mathcal{L}_p(\Omega;M)$, since the summands are concentrated on pairwise disjoint Borel sets by construction. Therefore, since $\mu(E_0)<2^{-k}$, from we deduce that $$\label{4.19}
\left|\int_{ M}[u]^p\,d(\mu-\sigma^k)\right|\le C\Big[\int_{\Omega\setminus M} f(\nabla u)\,dx+2t^p\Big]2^{-k}\,,$$ for all $u\in W^{1,p}(\Omega\setminus M) $ with $\|u\|_{L^\infty(\Omega)}\le t$ with $t>0$, where we also used $[u]=0$ $p$-q.e. on $\Sigma\setminus M$.
By Lemma \[Gamma-stability\] again, it suffices to prove the $\Gamma$-convergence in $L^0(\Omega)$ of the sequence $(\mathscr F^{\sigma^k}(\cdot, \Omega))$ to $\mathscr F^\mu(\cdot, \Omega)$. Let $\widehat{\mathscr F}'$ and $\widehat{\mathscr F}''$ be the $\Gamma$-liminf and $\Gamma$-limsup of $\mathscr F^\mu$ in $L^0(\Omega)$ of this sequence. Given $u\in L^0(\Omega)$ and $t>0$ we consider the truncation $u^t$. The $\Gamma$-limsup is immediate. By we can assume $u\in L^{1,p}(\Omega\setminus M)$ otherwise the inequality is trivial. Therefore, by we have $$\widehat{\mathscr F}''(u^t,\Omega)\le \mathscr F^\mu(u^t,\Omega)\le \mathscr F^\mu(u,\Omega)\,.$$ Taking the limit as $t\to\infty$ we obtain $\widehat{\mathscr{F}}''(u,\Omega)\le\mathscr F^\mu(u,\Omega)$. On the other hand, for the $\Gamma$-liminf inequality we have to prove that $$\label{liminfsez4}
\widehat{\mathscr{F}}'(u,\Omega)\ge\mathscr F^\mu(u,\Omega)\,.$$ Let $(u_k)$ be a sequence converging to $u$ in $L^0(\Omega)$ with $\widehat{\mathscr F}'(u,\Omega)=\liminf_{k} \mathscr F^{\sigma^k}(u_k,\Omega)$. Moreover, we can assume this sequence to be equibounded in $L^{1,p}(\Omega\setminus M)$ so that $(u_k^t)$ converges, up to subsequences (not relabelled), to $u$ weakly in $W^{1,p}(\Omega\setminus M)$. Therefore, as $\mathscr F^{\sigma^k}(\cdot,\Omega)$ decreases under truncation, the estimate , the lower semicontinuity of the integral $\int_{\Omega_0}f(\nabla u)\, dx$ and Lemma \[lm:76\] applied to each $\Omega_i$ yields $$\liminf_{k\to\infty} \mathscr F^{\sigma^k}(u_k,\Omega)\ge \liminf_{k\to\infty} \mathscr F^{\sigma^k}(u_k^t,\Omega)\ge \mathscr F^\mu(u^t,\Omega).$$ Taking the limit as $t\to\infty$ we get , thanks to Remark \[convpqe\] and Fatou’s lemma.
Construction of capacitary measures {#reconstruction}
===================================
In this section we provide a general procedure to construct the capacitary measure $\mu\in \mathcal M_p(\Omega;M)$ appearing in the conclusion of Theorem \[mainthm\]. This will be done by solving some auxiliary localised minimum problems involving the function $f$ and the sequence of compact sets $K_j$.
Formulas for capacitary measures
--------------------------------
Let $\Omega_0$ be a cylinder of the form for some $x_0\in \mathbb{R}^n$, $\nu_0\in \mathbb{R}^n$ with $|\nu_0|=1$, and $r_0>0$. Let $\Sigma_0=\Sigma\cap \Omega_0$ be a graph representation as in . For every $\rho\in\left(0,\tfrac{r_0}{2}\right)$ we introduce $\Sigma_\rho^\pm := \Sigma_0\pm\rho\nu_0$ and $$S_\rho := \{\bar x +r\nu_0\colon \bar x\in \Pi_0\,,\ |r- \phi(\bar x)|<\rho\}\,.$$ Moreover, for every $A\in\mathscr A(\Omega_0)$ and every $\mu\in\mathcal{M}_p(\Omega_0;M)$ we set $$\label{mrhoa}
m_\rho(A,\mu):=\displaystyle\min_{v\in\mathcal{V}_{\rho}(A)}
\int_{A\cap S_{\rho}\setminus \Sigma_0} f(\nabla v)\,dx+ \int_{A\cap \Sigma_0} [v]^p\,d\mu\,,$$ where $\mathcal{V}_{\rho}(A)$ denotes the set of all functions $v\in L^{1,p}(A\cap S_\rho{\setminus}\Sigma_0)$ with $v= 1$ $\mathscr{H}^{n-1}$-a.e. on $A\cap \Sigma_\rho^+$ and $v=0$ $\mathscr{H}^{n-1}$-a.e. on $A\cap \Sigma_\rho^-$. The existence of a minimiser in can be proved by the direct methods of the Calculus of Variations. By truncation every minimiser of is bounded by 0 and 1 and therefore it belongs to $W^{1,p}(A\cap S_\rho{\setminus}M)$. Clearly defines a non-decreasing set function. We claim that it is inner regular, i.e., $$\label{inner}
m_\rho(A,\mu)=\sup_{\substack{A'\in \mathscr{A}(\Omega) \\ A' \subset\subset A }} m_\rho(A',\mu)\,.$$ The inequality $\ge$ is trivial by monotonicity of $m_\rho$ with respect to set inclusion. To prove the reverse inequality $\le$, we may assume that the $\sup$ is finite. We consider an increasing sequence of open sets $A_i\subset\subset A$ along which the sup in is achieved as a limit and $u_i\in \mathcal{V}_\rho(A_i)$ is chosen to attain the minimum in with $A$ replaced by $A_i$. Let $A''\in \mathscr{A}(\Omega)$ be fixed with $A''\subset \subset A$. Then, since clearly $A''\subset A_i$ for all large indices $i$, we have $$\sup_{\substack{A'\in \mathscr{A}(\Omega) \\ A' \subset\subset A }} m_\rho(A',\mu)\ge \liminf_{i\to\infty} \int_{A''\cap \Sigma_0} f(\nabla u_i)
+\int_{A''\cap \Sigma_0}[u_i]^p\,d\mu\,.$$ By construction $(u_i)$ converges (up to subsequences) to a function $u$ in $L^0(\Omega)$ (the functions $u_i$ are extended by zero to the whole $A$) and $(\nabla u_i)$ converges to $\nabla u$ weakly in $L^{p}(A\cap S_\rho\setminus \Sigma_0)$. By Fatou’s lemma and by Lemma \[lm:76\] we deduce that $$\sup_{\substack{A'\in \mathscr{A}(\Omega) \\ A' \subset\subset A }} m_\rho(A',\mu) \ge \int_{A''\cap S_\rho\setminus \Sigma_0} f(\nabla u)
+\int_{A''\cap \Sigma_0}[u]^p\,d\mu\,,$$ which, by the arbitrariness of $A''\subset\subset A$ and the monotone convergence theorem, implies $$\sup_{\substack{A'\in \mathscr{A}(\Omega) \\ A' \subset\subset A }} m_\rho(A',\mu) \ge \int_{A\cap S_\rho\setminus \Sigma_0} f(\nabla u)
+\int_{A\cap \Sigma_0}[u]^p\,d\mu\,.$$ Since $u\in \mathcal{V}_\rho(A)$, by the compactness of the trace operator, then it is admissible in the minimisation problem and holds. Now for every $p$-quasi-open set $U\subset \Omega_0$ and every $\rho\in\left(0,\tfrac{r_0}{2}\right)$, we also set $$\label{hatm}
\begin{split}
\widehat m_\rho(U;\mu):=\inf_{{\substack{A\in \mathscr{A}(\Omega_0) \\ A\supset U }} } m_\rho(A;\mu)\,.
\end{split}$$
In the following proposition we construct the measure on $p$-quasi open sets by squeezing $\rho\to0^+$ in . We point out that the set function $\widehat m_\rho(U,\mu)$ is not sensitive to the change of the measure inside its equivalence class, by its very definition . Hence, according to Lemma \[lm:criterionequiv\], the conclusion of Proposition \[prop:cella2\] cannot hold in general for a larger family than the collection of all $p$-quasi open sets.
\[prop:cella2\] Let $\mu\in\mathcal{M}_p(\Omega_0;M)$. Then for every $p$-quasi open set $U\subset \Omega_0$ we have $$\label{cella2}
\mu(U) = \sup_{\rho>0}\widehat m_\rho(U;\mu)\,.$$
Let $U$ be a $p$-quasi open set. The inequality $\ge$ holds in if for all fixed $\rho>0$ $$\label{intrho}
\widehat m_\rho(U;\mu)\le I_\rho(U;\mu):= \inf_{v,A}\int_{U\cap S_{\rho}\setminus \Sigma_0} f(\nabla v)\,dx+ \int_{U\cap \Sigma_0} [v]^p\,d\mu\,,$$ where the infimum is taken among all pairs $(v,A)$ where $A$ is an open set containing $U$ and $v\in W^{1,p}(A\cap S_\rho{\setminus}\Sigma_0)$ is a non-negative function with $v= 1$ $\mathscr{H}^{n-1}$-a.e. on $A\cap \Sigma_\rho^+$ and $v=0$ $\mathscr{H}^{n-1}$-a.e. on $A\cap \Sigma_\rho^-$. Indeed, given $\rho>0$ and an open set $A$ containing $U$, if we plug in $A$ and $v=1_{A\cap S_\rho}$ in the definition of $I_\rho(U,\mu)$ from we obtain that $\widehat m_\rho(U,\mu)\le \mu(U)$.
Then we prove . To do so, we fix $\eta>0$. Then there exists an admissible competitor $(v,A)$ for the minimisation problem with $$\label{stima}
\int_{U\cap S_{\rho}\setminus \Sigma_0} f(\nabla v)\,dx+ \int_{U\cap \Sigma_0} [v]^p\,d\mu \,<I_\rho(U;\mu )+\eta\,.$$ Let $\delta>0$. Since $U$ is $p$-quasi open, there exists an open set $V_\delta$, with $C_{1,p}(V_\delta)<\delta$, such that $A_\delta=U\cup V_\delta$ is an open set. It is not restrictive to assume that $A_\delta\subset A$. Then there exists $ z_\delta\in W^{1,p}_0(\Omega)$ with $z_\delta=1$ on $V_\delta\cap S_\frac{\rho}{2}$ and $\int_{\Omega} |\nabla z_\delta|^p\le \delta$. Let also $\varphi\in C^\infty_0(\Omega) $ be a cut-off function with $\varphi=1$ in $S_{\frac{\rho}{2}}$ and $\varphi=0$ in $\Sigma_\rho^+$ and we define $w_\delta=1-\varphi z_\delta$. Then $w_\delta =0$ on $S_{\frac{\rho}{2}}\cap V_\delta$, $w_\delta=1$ on $\Sigma_\rho^+$ and in addition $\int_{\Omega}|\nabla w_\delta|^p\le \omega(\delta)$, where $\omega(\delta)\to0^+$ as $\delta\to0^+$. We choose $\delta$ small enough so that $$\int_{\Omega}|\nabla w_\delta|^p\le \eta\quad\text{and}\quad
\int_{A_\delta\cap S_{\rho}\setminus \Sigma_0} f(\nabla v)\,dx \le \int_{U\cap S_{\rho}\setminus \Sigma_0}f(\nabla v)\,dx+\eta\,,$$ where the last inequality follows from the fact that $|V_\delta|\to0^+$ as $\delta\to0^+$.
We observe that $v_\delta=v\wedge w_\delta\in W^{1,p}(A_\delta\cap S_\rho\setminus \Sigma_0)$ is a non-negative function with $v_\delta=1$ $\mathscr H^{n-1}$ a.e. on $\Sigma_\rho^+\cap A_\delta$ and $v_\delta=0 $ $\mathscr H^{n-1}$ a.e. on $\Sigma_\rho^-\cap A_\delta$. Then, by we have $$\label{eqdeltaU}
\widehat m_\rho(U;\mu)\le
\int_{A_\delta\cap S_{\rho}\setminus \Sigma_0} f(\nabla v_\delta)\,dx+ \int_{A_\delta\cap \Sigma_0} [v_\delta]^p\,d\mu \,.$$ As for the volume integral we observe that $$\label{volinte}
\begin{split}
\int_{A_\delta\cap S_{\rho}\setminus \Sigma_0} f(\nabla v_\delta)\,dx
& \le
\int_{A_\delta\cap S_{\rho}\setminus \Sigma_0} f(\nabla v)\,dx+
\int_{A_\delta\cap S_{\rho}\setminus \Sigma_0} f(\nabla w_\delta)\,dx\,,\\
& \le\int_{U\cap S_{\rho}\setminus \Sigma_0}f(\nabla v)\,dx + (1+\Lambda)\eta\,.
\end{split}$$ As for the integral on $\Sigma_0$ we notice that $[v_\delta]\le [v]$ $p$-q.e. on $U\cap \Sigma_0$ and $[v_\delta]=0$ $p$-q.e. on $V_\delta\cap \Sigma_0$. This implies that $$\label{surfinte}
\int_{A_\delta\cap \Sigma_0} [v_\delta]^p\,d\mu \le
\int_{U\cap \Sigma_0}[v]^p\,d\mu \,.$$ By , , , and we deduce that $$\widehat m_\rho(U;\mu)\le I_\rho(U;\mu )+(2+\Lambda) \eta\,.$$ Since $\eta$ is arbitrary we get .
To prove the reverse inequality $\le$ in , we fix an arbitrary sequence $\rho_i\to0^+$. By , there exists a sequence of open sets $(A_i)$ containing $U$ such that $$\label{qa1}
m_{\rho_i}(A_i,\mu)<\widehat m_{\rho_i}(U,\mu) +\rho_i\,.$$ Let also $u_i\in \mathcal{V}_{\rho_i}(A_i)$ be such that $$\label{qa2}
m_{\rho_i}(A_i,\mu) = \int_{A_i\cap S_{\rho_i}\setminus \Sigma_0} f(\nabla u_i)\,dx
+\int_{A_i\cap \Sigma_0} [u_i]^p\,d\mu\,.$$
Let $\psi:\Sigma_0\to[0,\infty]$ be a Borel function and $\sigma$ be a Radon measure of class $W^{-1,p'}(\Omega_0)$ such that the measure $\psi\sigma$ is equivalent to $\mu$. We recall that we can find such $\psi$ and $\sigma$ thanks to Lemma \[lm:equivmis\]. For all $k>0$ the truncated measure $\psi^k\sigma$ is a Radon measure of class $W^{-1,p'}(\Omega_0)$. Thus, given a sequence $z_i$ converging to a function $z$ weakly in $W^{1,p}_0(\Omega_0)$, for all fixed $k>0$ we have that $$\label{qa3}
\lim_{i\to\infty}\int_{\Sigma_0} \tilde z_i \psi^k \,d\sigma=
\lim_{i\to\infty}\langle \psi^k\sigma, z_i\rangle =
\langle \psi^k\sigma,z\rangle= \int_{\Sigma_0} \tilde z\psi^k\,d\sigma\,.$$ For every $i$ we set $$v_{i} (x)=\begin{cases}
u_{i}(x)\,, & \qquad \text{if $x\in A_i\cap S_{\rho_i}^+$,}\\
u_{i}( \mathbf{R}x)
& \qquad \text{if $x\in A_i\cap S_{\rho_i}^-$\,,}\\
1\,,& \qquad \text{if $x\in A_i\setminus S_{\rho_i}$,}
\end{cases}\quad
w_{i} (x)=\begin{cases}
u_{i}( \mathbf{R}x) & \qquad \text{if $x\in A_i\cap S_{\rho_i}^+$\,,}\\
u_{i}(x)\,, & \qquad \text{if $x\in A_i\cap S_{\rho_i}^-$,}\\
0\,,& \qquad \text{if $x\in A_i\setminus S_{\rho_i}$,}
\end{cases}$$ where $$\mathbf{R}x:= x-\nu_0((x-x_0)\cdot\nu_0) + 2\phi(x-\nu_0((x-x_0)\cdot \nu_0))-(x-x_0)\cdot\nu_0$$ is the reflection about the disk $\Pi_0=\{x\in \Omega_0\colon (x-x_0)\cdot \nu_0=0\}$, $x_0$ and $\nu_0$ are the center and the axis of the cylinder $\Omega_0$, and $\phi$ is the function describing $\Sigma_0$ as a graph according to .
We take a sequence of functions $\chi_k$ as in Lemma \[lm:qa0\]. Then $z_{i,k}= |v_i-w_i|^p\chi_k$ defines an equibounded sequence in $W^{1,p}_0(\Omega_0)$. Indeed, by Lemma \[lm:qa0\] the function $z_{i,k}$ vanishes out of a compact set contained in $U$, hence in $\Omega_0$; moreover, both $v_i$ and $w_i$ are defined from $u_i$ by a norm-preserving endomorphism of $W^{1,p}(\Omega_0)$ and $u_i$ is equibounded in $W^{1,p}(\Omega_0)$ by , , and . Therefore, by possibly passing to a subsequence (not relabelled) we may assume that $z_{i,k}\to \chi_k $, as $i\to\infty$, weakly in $W^{1,p}_0(\Omega_0)$. Since the $p$-quasi continuous representative of $z_{i,k}$ is $[u_i]^p\tilde \chi_k$ from we deduce that $$\label{qa4}
\int_{U\cap \Sigma_0}\tilde \chi_k\psi^k\,d\sigma
=
\lim_{i\to\infty} \int_{A_i\cap \Sigma_0} [u_i]^p\tilde \chi_k\psi^k\,d\sigma
\le \lim_{i\to\infty} \int_{A_i\cap \Sigma_0} [u_i]^p\,d\mu\,,$$ where we also used the fact that according to Lemma \[lm:qa0\] $\chi_k=0$ $p$-q.e. in $\Omega_0\setminus U$ and the equivalence of $\mu$ to $\psi\sigma$.
Combining with and , for every $k>0$, we obtain $$\int_{U\cap \Sigma_0}\tilde \chi_k
\psi^k\,d\sigma
\le \lim_{i\to\infty} \widehat m_{\rho_i}(U,\mu)\,.$$ Since by Lemma \[lm:qa0\] the sequence $\chi_k$ converges to $1$ $p$-q.e. in $U$, letting $k\to\infty$ in the above inequality, by the monotone convergence theorem we deduce that $$ \mu(U)\le \lim_{i\to\infty} \widehat m_{\rho_i}(U,\mu)\,,$$ up to subsequences. The desired inequality follows from the arbitrariness of the infinitesimal sequence $(\rho_i)$ and the proposition is proved.
Equivalence with localised minimum problems
-------------------------------------------
Let $(K_j)$ be a sequence of compact sets satisfying . We take $\rho_j=\max\{{\rm dist}(x,M)\colon x\in K_j\}$, so that $\rho_j\to0^+$ as $j\to\infty$. For $A\in\mathscr{A}(\Omega_0)$, $\rho\in\left(0,\tfrac{r_0}{2}\right)$, and for all $j$ with $\rho_j<\rho$ we set $$\label{4}
m_{\rho,j}(A) :=
\displaystyle\min_{v\in\mathcal{V}_{\rho,j}(A)}
\int_{A\cap S_\rho{\setminus}K_j} f(\nabla v) \,dx \,,$$ where $\mathcal{V}_{\rho,j}(A)$ is the set of all functions $v\in L^{1,p}(A\cap S_\rho{\setminus}K_j)$ such that $v= 1$ $\mathscr{H}^{n-1}$-a.e. on $\Sigma_\rho^+\cap A$ and $v=0$ $\mathscr{H}^{n-1}$-a.e. on $\Sigma_\rho^-\cap A$. The existence of the minimum in follows by the direct methods of the Calculus of Variations. By truncation every minimiser of is bounded by 0 and 1 and then it belongs to $W^{1,p}(A\cap S_\rho{\setminus}K_j)$. Moreover, we set $$\label{m''}
m'_\rho(A) :=\liminf_{j\to\infty} m_{\rho,j}(A)\quad
\text{and}\quad
m''_\rho(A) :=\Limsup_{j\to\infty} m_{\rho,j}(A)\,.$$
We have the following result.
\[ultimolemma\] Let $A', A''\in \mathscr A(\Omega)$ with $A'\subset \subset A''$. Assume that $(\mathscr F_{K_j}(\cdot,A'))$ $\Gamma$-converge in $L^0(\Omega)$ to $\mathscr F^\mu(\cdot,A')$ and $(\mathscr F_{K_j}(\cdot,A''))$ $\Gamma$-converge in $L^0(\Omega)$ to $\mathscr F^\mu(\cdot,A'')$. Then, for every $\rho>0$ $$m_\rho'(A')\ge m_\rho(A',\mu) \quad \text{and} \quad m''_\rho(A')\le m_\rho(A'',\mu)\,.$$
To prove the first inequality, let $(u_j)\subset L^{1,p}(A' {\setminus}K_j)$ be a sequence of minimisers of the minimum problems . By it is not restrictive to assume this sequence to be equibounded in $W^{1,p}(A' {\setminus}K_j)\cap L^\infty(A')$. Then there exists a function $u\in W^{1,p}(A'{\setminus}M)\cap L^\infty(A')$ and a subsequence of $(u_j)$, not relabelled, converging to $u$ weakly in $W^{1,p}(A'{\setminus}M_r)$ for every $r>0$, where $
M_r = \left\{ x\in \Omega \colon {\rm dist}(x,\Sigma)\le\rho \right\}
$. Therefore, $(u_j)$ converges in $L^0(\Omega)$ to a function $u\in L^\infty(A')$. Moreover, by the $\Gamma$-convergence assumption $$m'_\rho(A')=\liminf_{j\to\infty} \int_{A'\cap S_\rho \setminus K_j} f(\nabla u_j)\,dx\ge \int_{A'\cap S_\rho\setminus M}f(\nabla u)\,dx+ \int_{A' \cap M} [u]^p\,d\mu\,.$$ Since the trace operator is compact, the function $u$ belongs to $\mathcal V_\rho(A')$ and thus it is admissible in the minimisation problem . This proves the first inequality.
To prove the the second inequality we assume $m_\rho(A'',\mu)$ to be finite and let $u$ one of its minimisers. By the $\Gamma$-convergence assumption there exists a sequence $(u_j)\subset W^{1,p}(A''\setminus K_j)\cap L^\infty(A'')$ converging to $u$ in $L^0(\Omega)$ such that $$\label{recseqqui}
m_\rho(A'',\mu)=\mathscr F^\mu(u,A'') = \lim_{j\to\infty} \int_{A''\cap S_\rho {\setminus}K_{j}} f(\nabla u_j)\,dx \\\,.$$ We consider now a cut-off function $\varphi\in C^{\infty}_c(S_\rho)$ such that $0\le\varphi\le1$, $\varphi=1$ in $S_{\rho/2}$, $\varphi=0$ out of $S_\rho$, and $|\nabla\varphi |\le \frac{C}{\rho}$ for a suitable constant $C>0$. We consider the function $v_j = \varphi u_j+ (1-\varphi)u$ so that $v_j\in \mathcal{V}_{\rho,j}(A')$ and $\nabla v_j = (\varphi \nabla u_j+(1-\varphi)\nabla u)+(u_j-u)\nabla \varphi$. By and for every $\varepsilon>0$ we obtain $$\label{13.1}
\begin{split}
& m_{\rho,j}(A')\le \int_{A'\cap S_\rho {\setminus}K_{j}} f(\nabla v_j)\,dx \\
&\le \frac{1}{{(1-\varepsilon)}^{p-1}}\int_{A'\cap S_\rho \setminus K_j}f(\varphi \nabla u_j +(1-\varphi)\nabla u)\, dx+\frac{C^p\Lambda}{\rho^p \varepsilon^{p-1}}\int_{A'\cap S_\rho \setminus K_j}|u_j-u|^p\, dx\,.\\
\end{split}$$ Next, we osberve that by we have $$\int_{A'\cap S_\rho \setminus K_j}f(\varphi \nabla u_j +(1-\varphi)\nabla u)\, dx\le
\int_{A''\cap S_\rho \setminus K_j}\varphi f(\nabla u_j )\, dx+
\int_{A''\cap S_\rho \setminus K_j}(1-\varphi)f(\nabla u)\, dx\,,$$ where we also used that $A'\subset A''$. Let now $\widehat A\in \mathcal A(\Omega)$ be a Lipschitz set with $A'\subset \widehat A \subset A''$. Then, $u_j$ converges to $u$ in $L^p(\widehat A)$, hence $$\lim_{j\to\infty}\int_{\widehat{A}\cap S_\rho \setminus K_j}|u_j-u|^p\, dx=0\,.$$ Using the last two inequalities and the fact that $\varphi\le1$, from we obtain $$\limsup_{j\to\infty}m_{\rho,j}(A') \le\frac{1}{{(1-\varepsilon)}^{p-1}} \Big[\limsup_{j\to\infty} \int_{A''\cap S_\rho \setminus K_j} f(\nabla u_j )\, dx
+ \int_{A''\cap S_\rho \setminus M}(1-\varphi)f(\nabla u)\, dx\Big]\,.$$ Since $\varphi$ was arbitrary, by the monotone convergence theorem we deduce that $$\limsup_{j\to\infty} m_{\rho,j}(A')\le \frac{1}{{(1-\varepsilon)}^{p-1}} \limsup_{j\to\infty} \int_{A''\cap S_\rho {\setminus}K_{j}} f(\nabla u_j)\,dx\,.$$ This combined with and the arbitrariness of $\varepsilon$ provides the conclusion.
\[equiteo\] The following three conditions are equivalent.
a) *($\Gamma$-convergence in $\Omega$).* The sequence of functionals $(\mathscr F_{K_j}(\cdot, \Omega))$ defined by $\Gamma$-converge in $L^0(\Omega)$ to a functional $\mathscr F:L^0(\Omega)\to[0,\infty]$.
b) *($\Gamma$-convergence on a rich family).* There exist a measure $\mu\in \mathcal{M}_p(\Omega;M)$ and a rich family $\mathscr R\subset \mathscr A(\Omega)$ such that the sequence of functionals $(\mathscr F_{K_j}(\cdot,A))$ defined by $\Gamma$-converges in $L^0(\Omega)$ to the functional $\mathscr F^\mu(\cdot,A)$ defined by for all $A\in\mathscr R$.
c) *(Equality condition of localized minimum problems).* Let $\{\Omega_i\}$ be an open covering of $M$ consisting of cylinders of the form for some $x_i\in M$, $\nu_i\in \mathbb{R}^n$ with $|\nu_i|=1$ and, $r_i>0$. Then $$\label{thirdcondition}
\sup_{\substack{A'\in \mathscr{A}(\Omega) \\ A' \subset\subset A }} m_\rho'(A')= \sup_{\substack{A'\in \mathscr{A}(\Omega) \\ A' \subset\subset A }} m_\rho''(A')\,,$$ for every open set $A\subset \Omega_i$ and every $\rho\in (0,\frac{r_i}{2})$. Here $m'$ and $m''$ are defined by with $\Omega_i$ in place of $\Omega_0$ and the graph $\Sigma_i=\Omega_0\cap \Sigma$ defined as in .
We assume (a) and prove (b). To this aim, we fix a subsequence (not relabelled) of compact sets $(K_j)$ and we consider the sequence of functionals $(\mathscr F_{K_j})$ defined by accordingly. By Theorem \[mainthm\] there exist a measure $\mu\in\mathcal{M}_p(\Omega;M)$ and a rich family $ \mathscr R\subset \mathscr A(\Omega)$ such that for every $A\in\mathscr R$ a subsequence of $(\mathscr F_{K_j}(\cdot,A))$ $\Gamma$-converge in $L^0(\Omega)$ to the functional $\mathscr F^{\mu}(\cdot,A)$ defined by . Thanks to the Urysohn property (see [@DMb Proposition 8.3]), to get the conclusion it is enough to make sure that $\mu$ is independent on the subsequence chosen at the beginning. This follows since by assumption the $\Gamma$-limit of $(\mathscr F_{K_j}(\cdot, \Omega))$ do not depend on the choice of the subsequence; hence the measure $\mu$ is uniquely determined (up to equivalence).
We now assume (b) and prove (c). By Lemma \[ultimolemma\] and for every $A\in \mathscr A(\Omega)$ and every $A',A''\in\mathscr R$ such that $ A'\subset\subset A''\subset\subset A\subset\subset \Omega_i$ we have $$m_\rho(A',\mu)\le m_\rho'(A')\le m_\rho''(A')\le m_\rho(A'',\mu)\le m_\rho(A,\mu).$$ These inequalities combined with and [@DMb Remark 14.9 and 14.13] yield $$m_\rho(A,\mu)= \sup_{\substack{A'\in \mathscr{R} \\ A' \subset\subset A }} m_\rho(A',\mu)\le \sup_{\substack{A'\in \mathscr{R} \\ A' \subset\subset A }} m_\rho'(A')\le \sup_{\substack{A'\in \mathscr{R} \\ A' \subset\subset A }} m_\rho''(A')\le m_\rho(A,\mu)\,,$$ so that these inequalities are in fact equalities and holds.
We conclude the chain of implications by assuming c) and proving a). To this aim, we fix a subsequence (not relabelled) of compact sets $(K_j)$ and we consider the sequence of functionals $(\mathscr F_{K_j}(\cdot, \Omega))$ defined by accordingly. By Theorem \[mainthm\] there exist a measure $\mu\in\mathcal{M}_p(\Omega;M)$ and a rich family $ \mathscr R\subset \mathscr A(\Omega)$ with $\Omega\in\mathscr R$ such that a subsequence of $(\mathscr F_{K_j}(\cdot,A))$ $\Gamma$-converge in $L^0(\Omega)$ to the functional $\mathscr F^{\mu}(\cdot,A)$ for every $A\in\mathscr R$. To get the thesis stated in a), by the Urysohn property (see [@DMb Proposition 8.3]) it is again sufficient to prove that the measure $\mu$ is independent on the subsequence chosen at the beginning. To see this first notice that, by arguing as in the previous implication one deduces that $m_\rho(A,\mu)$ as defined in coincides with for all open sets $A\subset \Omega_i$ and all $\rho\in (0,\frac{r_i}{2})$. Moreover, passing to subsequences, the value $m'_\rho(A)$ can only increase while $m''_\rho(A)$ only decrease (see ). This with the fact that $m'_\rho(A)\le m''_\rho(A)$ implies that the assumption is not affected by the passage to subsequences and so also the measure $\mu$. The theorem is then proved.
As a consequence of the results proved in this section we deduce a cell formula to construct every limit measure appearing in the conclusion of Theorem \[mainthm\].
Let $\mu\in \mathcal M_p(\Omega;M)$. Assume that $(\mathscr F_{K_j}(\cdot,\Omega))$ $\Gamma$-converge in $L^0(\Omega)$ to $\mathscr F^\mu(\cdot,\Omega)$. Then there exists a rich family of open sets $\mathscr R\subset \mathscr A(\Omega)$ such that, for every $p$-quasi open set $U\subset \Omega_0$ with $\Omega_0$ a cylinder as in with $x\in M$ it holds $$\mu(U)=\sup_{\rho>0} \inf_{\substack{A\in \mathscr A(\Omega_0)\\ A\supset U}} \sup_{\substack{A'\in \mathscr R\\ A'\subset \subset A}} \lim_{j\to\infty} \min_{u\in \mathcal V_{\rho, j}(A')} \int_{A'\cap S_\rho\setminus K_j} f(\nabla u)\, dx\,,$$ where $\mathcal{V}_{\rho,j}(A)$ denotes the set of all non-negative functions $v\in L^{1,p}(A\cap S_\rho{\setminus}K_j)$ with $v= 1$ $\mathscr{H}^{n-1}$-a.e. on $A\cap \Sigma_\rho^+$ and $v=0$ $\mathscr{H}^{n-1}$-a.e. on $A\cap \Sigma_\rho^-$.
The result follows by Proposition \[prop:cella2\] and by Theorem \[equiteo\].
[99]{} L. Ambrosio, N. Fusco, D. Pallara. [Functions of bounded variation and free discontinuity problems]{}. The Clarendon Press, Oxford University Press, New York, 2000. N. Ansini. The Nonlinear Sieve Problem and Applications to Thin Films. Asymptotic Analysis 39 (2) (2004), 113-145. N. Ansini and A. Braides. Separation of scales and almost-periodic effects in the asymptotic behaviour of perforated periodic media. Acta Appl. Math. 65 (2001), 59-81. N. Ansini and A. Braides. Asymptotic analysis of periodically-perforated nonlinear media, J. Math. Pures Appl. 81 (2002), 439-451. H. Attouch and C. Picard. Comportement limite de problèmes de trasmission unilateraux à travers des grilles de forme quelconque. Rend. Sem. Mat. Univ. Politec. Torino 45 (1987), 71-85. C. Conca. On the application of the homogenization theory to a class of problems arising in fluid mechanics. J. Math. Pures Appl. 64 (1985), 31-75. C. Conca. Étude d’un fluide traversant une paroi perforée I. Comportement limite près de la paroi. J. Math. Pures Appl. 66 (1987), 1-43. C. Conca. Étude d’un fluide traversant une paroi perforée II. Comportement limite loin de la paroi. J. Math. Pures Appl. 66 (1987), 45-69. G. Cortesani. Asymptotic behaviour of a sequence of Neumann problems. [Comm. in Part. Diff. Eq.]{} [22]{} (9-10) (1997), 1691-1729. G. Dal Maso. [An introduction to $\Gamma$-convergence.]{} Progress in Nonlinear Differential Equations and their Applications, 8. Birkhäuser Boston, Inc., Boston, MA, 1993. G. Dal Maso. On the integral representation of certain local functionals. [ Ricerche Mat.]{} [ 32]{} (1) (1983), 85-113. G. Dal Maso. $\Gamma$-convergence and $\mu$–capacities. [ Ann. Scuola Norm. Sup. Pisa Cl. Sci.]{} (4) [ 14]{} (3) (1987), 423–464. G. Dal Maso, A. Defranceschi. Limits of nonlinear problems in varying domains. [ Manuscripta Math.]{} [ 61]{} (1988), 251-278. G. Dal Maso, F. Iurlano. Fracture models as $\Gamma$-limits of damage models. [ Commun. Pure Appl. Anal.]{} [ 12]{} (2013), 1657-1686. A. Damlamian, Le problème de la passoire de Neumann. Rend. Sem. Mat. Univ. Politec. Torino 43 (1985), 427-450. T. Del Vecchio. The thick Neumann’s sieve. Ann. Mat. Pura Appl. 147 (1987), 363-402. . [Les espaces du type Beppo Levi.]{} [Ann. Inst. Fourier (Grenoble)]{} [5]{} (1953), 305-370. L.C. Evans, R. Gariepy. [ Measure theory and fine properties of functions.]{} Studies in Advanced Mathematics. CRC Press, Boca Raton, FL, 1992. J. Heinonen, T. Kilpeläinen, O. Martio. [ Nonlinear Potential Theory of Degenerate Elliptic Equations.]{} Clarendon Press, Oxford 1993. V.G. Maz’ya. [ Sobolev Spaces. With Applications to Elliptic Partial Differential Equations.]{} Grundlehren der Mathematischen Wissenschaften 342 (2nd ed.), Berlin-Heidelberg-New York 2011. . [The Neumann sieve.]{} [Nonlinear Variational Problems (Isola d’Elba, 1983)]{}, Res. Notes in Math. 127, Pitman, London, (1985), 24-32. C. Picard. Analyse limite d’équations variationnelles dans un domaine contenant une grille. RAIRO Modél. Math. Anal. Numér. 21 (1987), 293-326. E. Sanchez-Palencia. Non-Homogeneous Media and Vibration Theory. Lecture Notes in Physics 127, Springer- Verlag, Berlin, 1980. E. Sanchez-Palencia. Boundary value problems in domains containing perforated walls. In: Nonlinear Partial Differential Equations and Their Applications. Collége de France Seminar III, Res. Notes in Math. 70, Pitman, London, (1981), 309-325. E. Sanchez-Palencia. Un problème d’écoulement lent d’un fluide visqueux incompressible au travers d’une paroi finement perforée. In: Les Méthodes de l’Homogénéisation: Théorie et Applications en Physique, Collection de la Direction des Études et Recherches d’Électricité de France 57 (1985), 371-400. W.P. Ziemer. [ Weakly Differentiable Functions]{}. Springer-Verlag, Berlin 1989.
|
BaBylissPro Nano Titanium Portofino Dryer. Equipped with a high performance 2000-watt Italian motor, the Portofino 6600 is enhanced with Nano Titanium technology to distribute heat evenly for optimal results. The negative ions generated by the dryer will remove any static electricity in the hair and close the cuticle for smooth, shiny results.
|
Americans were voting in numbers unprecedented since women were given the franchise in 1920. Secretaries of state predicted turnouts approaching 90 percent in Virginia and Colorado and 80 percent or more in big states like Ohio, California, Texas, Missouri and Maryland.Though the exact numbers won't be determined until all the votes are counted in the next few days and weeks, a history-making high percentage of Americans voted, according to CNN and the Wall Street Journal:
More than 30 million voters had already cast ballots before Tuesday in early voting. Nearly 100 million more were expected on election day. Hundreds of thousands of voters waited from long before daybreak or for hours on end to make their choices known.
Michael McDonald, a politics professor at Virginia's George Mason University, predicted nearly 65% of the electorate would have voted by the time all polls closed -- matching or eclipsing the turnout in the presidential election of 1960 featuring candidates John F. Kennedy and Richard Nixon. Not since 1908, when the U.S. was convulsing through a shift from the machine party politics of the 19th century to the free-for-all of modern campaigns, has so large a proportion of Americans participated in a presidential election.
It was a good job! I'm glad you noticed. Maybe once you veer out of fantasyland you'll be able to see just how good a guy is that we just elected - smart, honest and articulate, all the things that the last President was not.
|
The present invention relates generally to the field of protector devices that protect a phlebotomist and the like from accidental puncture by an exposed needle. Specifically, the invention relates to a needle protector having two engageable halves that enclose the needle of a catheter assembly following use of the needle in a patient.
Phlebotomists represent one sector of the health care industry exposed to risks arising from accidental skin puncture by used needles. Accidental skin puncture can introduce viruses, bacteria, and other elements present in the circulatory system. An increased awareness of the hazards of skin punctures has arisen with the advent of AIDS in the health care sector, since AIDS is reportedly transmitted via the circulatory system.
In normal practice, using a terminal needle a phlebotomist draws blood from an individual to deliver blood into an attached syringe, directly into sampling tubes, or via a catheter assembly to collection bags for storage and subsequent use. Once the blood is drawn and the phlebotomist removes the needle from the patient's arm, there is risk of puncture from the exposed contaminated needle. During subsequent blood sampling, a phlebotomist risks needle puncture while inserting a vacutainer on the receiving end of the same or an in-line needle assembly. A phlebotomist also risks accidental puncture while replacing the old needle cover.
Exemplary art protection devices, consist of a hollow cylinder having a large top flange designed to protect the phlebotomist from impalement. The needle point is guided and inserted into a small hole in the flange and the needle hub is snapped into place. Thus positioned, that pointed end of the needle extends into the hollow cylinder. A vacutainer, or other similar sample tube, can then be inserted into the opposite end of the device so that the needle point punctures the vacutainer stopper and a blood sample drawn from the patient is directed into the vacutainer. The sampling procedure may then be repeated, replacing the vacutainer for multiple sampling, or the entire device is discarded. This disposable device is then used to retain/contain the needle assembly for disposal.
However, with such a design, it is difficult to insert the needle tip into the entry hole of the flange. The phlebotomist who does not have keen eyesight may take a long time in positioning the needle into the flange, or may miss the flange and receive a skin puncture. There is also risk of damaging the tip of the needle if the phlebotomist does miss the flange opening. The damaged needle tip may result in impaired flow through the tip, and other undesirable results.
Thus, there is a need for a protection device that protects a phlebotomist from puncture by a used needle. Such a device may be utilized prior to sampling, for safe transport of the exposed needle, for sampling prior to disposal of the used needle, and for containing the used needle for disposal.
|
Q:
Firebase: Failed to initialize crash reporting
My build.gradle file
dependencies {
compile fileTree(dir: 'libs', include: ['*.jar'])
testCompile 'junit:junit:4.12'
compile 'com.android.support:design:22.2.1'
compile 'com.google.firebase:firebase-core:9.4.0'
compile "com.google.firebase:firebase-auth:9.4.0"
compile 'com.google.firebase:firebase-crash:9.4.0'
}
apply plugin: 'com.google.gms.google-services'
This is how i am initializing FireBase Crash:
FirebaseCrash.report(new Exception("My first Android non-fatal error"));
but I am getting this from Logcat:
Failed to initialize crash reporting
com.google.firebase.crash.internal.zzg$zza: com.google.android.gms.internal.zzsb$zza:
No acceptable module found. Local version is 0 and remote version is 0.
A:
Crash reporting won't initialize if you don't have updated Google Play Services on your device or you haven't it installed at all.
|
Friday, May 14, 2010
Did this piece a few weeks ago, in an attempt to try and understand what it is about public displays of affection that makes the onlooker so upset.
Gardens of the heart
When I first moved out of a tiny town where everybody knew everybody and playing a game of chess with a boy was tantamount to ‘having an affair’, I discovered that my spoken English was lacking. College, awards and even poetry hadn’t prepared me for a phraseology that included: ‘Get a room’.
This business of getting a room would come up in clubs, cafes, the seaside – wherever youngsters held each other too close, too long. It would be thrown at their backs – their faces usually being occupied otherwise – like a sort of insult. Poor and middle-class newlyweds with no bedroom to call their own, or youngsters who couldn’t gain sexual independence at home even if they had a room.
Things have changed over the last decade. The explosion of cafes and pubs in urban India ensured that there are more indoor spaces to cuddle in. But these are private-public spaces for upper and middle-middle classes. The rest of our country must save up its loving for parks and promenades. The general principle seems to be – have green space, will canoodle.
Over the years, I have come to believe that it is a good principle. From the point of view of the environment, for instance. If people can be persuaded to have a good time minus air-conditioning, bonding in the lap of mother nature, what could be better? Why fork over significant sums of money to restaurants, malls and cinemaplexes that offer horrid fare and suck up energy resources like there’s no tomorrow.
Then, there’s mental and social health too. Human beings need human touch and a generation that has been made to feel ashamed of this can only end up hurt, and hurting others. Besides, there’s something to be said for quitting snobbery and becoming equal to other humans in your desire for a quiet nook and a beloved.
But inevitably, there is a price to pay. Youngsters are harassed by the police. Friends of mine were nearly arrested once, although they were engaged to be married and were doing nothing more intimate than having a cup of chai at a dhaba. Another young couple, accused of ‘kissing due to which passersby were feeling bad’ had to argue all the way to court, according to news reports. Apparently, the Delhi High Court did not find them guilty of obscenity because they were married.
Others were not so lucky. There was the headline-hogging Meerut bash-fest, branded ‘Operation Majnu’ where cops assaulted youngsters in a garden. There was also the tragic episode of 2005 in Mumbai, where a young girl was first humiliated for being out with male friends at Marine Drive, then taken to a police chowky and raped by a cop.
Blame it on the vagaries of the Indian Penal Code. Section 294 allows for three months’ imprisonment for 'obscene acts and songs' but fails to properly define 'obscene'. It simply wants to punish ‘Whoever, to the annoyance of others, does any obscene act in any public place’.
Annoyance?! How can you imprison someone for annoying someone else? Society is wildly divergent and it is ridiculous to assume that everyone finds the same things obscene. But I sometimes wonder if there is a base morality, a tacit agreement amongst us about how much intimacy is okay in public. I asked graphic artist Hemant Suthar and he says we need more parks to make room for love, particularly when there’s so much public display of hatred, but there’s a caveat of ‘decency’. “In multiplexes, we see people holding hands, hugging in gardens, cuddling behind bushes. I’ve heard of people making out in buses and cinemas and taxis,” he says, adding, “But I have not seen anything objectionable as yet.”
But then, what’s ‘objectionable’? I ask Navjyoti Jandu, a social development professional and a newlywed, and she admits that she and her husband let themselves go when they are in a romantic mood because “hugging or kissing on the forehead or cheeks is common” but she describes a park visit with her whole family as an embarrassment. “We had gone to the Garden of Five Senses and in every corner we saw couples in different postures. Some,” she puts it delicately, “were deeply involved.”
It reminds me of my first memorable tryst with cuddly couples several years ago. A Delhi park. Summer afternoon. Two girls seeking privacy, to just talk without being overheard by family. The walk turned out to be anything but private. Each scruffy bush, each patch of poky grass was occupied.
Oddly enough, none of the couples were bothered by each other’s presence or scrutiny (and scrutiny, there was. Most couples stole glances across the flowerbeds to look at what else who was doing), but our presence was clearly undesirable. Some youngsters stiffened at the sound of approaching footsteps and as we walked past, they held hands and looked resentful. Others stared at us with open hostility. I burned with an odd sort of reflected humiliation.
Until then, I had not been exposed to such swathes of intimacy. With that much display, it was a veritable museum of affection. While it did feel strange to be looking at the couples, I also clearly remember thinking that I was out of place. That I was the intruder in a space that had been marked out for privacy by those who needed it.
More recently, a young man told me about how much he loves Bandra Bandstand, but he added with a giggle, “I will not go there again, not until I have a girlfriend.”
These days, when I hear of police ‘action’ or politically ambitious locals rounding up lovers in parks or promenades, I remember my old feeling of trespass, the sense that I was unwanted. I remember the boy who needs a girlfriend to properly enjoy Bandstand. Then I wonder about the real reason for public outrage when people make out in public. And I wonder too if that is not the true obscenity of our times – that people cannot love without shame and, perhaps, don’t even know how.
Monday, May 03, 2010
It's been a very rushed time. Thanks for those who sent congratulations and apologies for not always responding on time or not having the good, long conversations that might have been had at the launch.
Do pick up the book. I will be horribly pleased if you read the book and send in feedback, or tell me just how much you love it.
Known Turf has events coming up in Bhopal and Mumbai this month. Launches have happened in Delhi, Chandigarh and Lucknow. There is a Facebook group for updates, photos etc, for those who might be interested.
|
Zay talks to Andrew Hoepfner and Melinda Lauw of Whisper Lodge,
a recent experiment in live ASMR experiences in New York. Zay
caught up to the creators right after his experience in the lodge,
so it's all super fresh.
Meanwhile: we've got a raft of News & Notes from
headquarters-- new shows, new reviews, and a tiny...
Before you go any further, we just want to remind you that puns
were once considered the highest form of wit...
What happens when you put old friends in a room and get them
talking about theatrical games? This episode of No Pro, that's
what. Noah sits down with Myles Nye and Greg Snyder of The Wise
Guys--whose careers...
About the Podcast
Exploring the renaissance in immersive theatre and interactive events. Hosted by Noah Nelson, creator of No Proscenium, a free events listing newsletter in Los Angeles, New York City, and San Francisco. Visit NoProscenium.com to sign up.
|
1. Introduction {#sec1-ijms-16-20468}
===============
Gene expression characterization at the steady-state mRNA level is an important step in many plant biological processes. Northern blotting \[[@B1-ijms-16-20468],[@B2-ijms-16-20468],[@B3-ijms-16-20468],[@B4-ijms-16-20468]\], is not an optimal method for gene expression quantification anymore, because it requires a large amount of RNA and is limited to detecting high-abundance transcripts. Therefore, reverse transcription-quantitative polymerase chain reaction (RT-qPCR), which can detect low-abundance mRNAs and exhibits high specificity, sensitivity, and stability \[[@B5-ijms-16-20468],[@B6-ijms-16-20468],[@B7-ijms-16-20468]\], has become one of the most commonly used techniques \[[@B8-ijms-16-20468]\]. However, RT-qPCR has certain disadvantages; for example, reference genes are important to correct the experimental error that occurs during RNA extraction, and cDNA preparation, but the normalized results are highly dependent on the expression stability of the reference genes selected \[[@B9-ijms-16-20468]\]. The use of inappropriate reference genes can result in biased target gene expression profiles; thus, using suitable reference genes for data normalization is a prerequisite for any RT-qPCR study \[[@B10-ijms-16-20468]\]. The expression of an ideal reference gene should not vary between different tissues or cells under investigation, nor in response to any experimental treatment \[[@B11-ijms-16-20468]\]. However, extensive transcriptomic data mining and gene expression analysis studies have reported that the reliability of these endogenous controls can be influenced by various conditions \[[@B12-ijms-16-20468],[@B13-ijms-16-20468],[@B14-ijms-16-20468],[@B15-ijms-16-20468],[@B16-ijms-16-20468],[@B17-ijms-16-20468]\]. Therefore, to obtain accurate and reliable target gene expression profiles, it is important to identify the best reference genes for use in each experimental set-up and verify these in each individual experiment before performing gene expression normalization. In common plant species, including *Arabidopsis*, rice, soybean, and petunia, genes associated with basic cellular processes such as those related to ubiquitin degradation, polyubiquitin, ubiquitin-conjugating enzymes, and ubiquitin ligases (collectively known as *UBQ*), as well elongation factors (EFs) \[[@B18-ijms-16-20468],[@B19-ijms-16-20468],[@B20-ijms-16-20468],[@B21-ijms-16-20468]\], have been identified and used for RT-qPCR \[[@B6-ijms-16-20468],[@B12-ijms-16-20468],[@B13-ijms-16-20468],[@B19-ijms-16-20468]\]. Nevertheless, few reference genes have been identified in forest trees, which dominate much of the terrestrial landscape on earth. Members of the genus *Populus* are used as a model forest species for diverse studies because of their amenability to experimental and genetic manipulation \[[@B22-ijms-16-20468],[@B23-ijms-16-20468],[@B24-ijms-16-20468],[@B25-ijms-16-20468]\]. Studies in *Populus* focus mainly on improving their ability to respond to environmental stress while maintaining their high-speed growth capacity because there is strong demand for their cultivation in highly saline and arid soils in many parts of the world \[[@B26-ijms-16-20468],[@B27-ijms-16-20468]\]. *Populus euphratica* Oliv., which is native to desert regions ranging from western China to North Africa, is the only arboreal species established in the world's largest shifting-sand desert, the Taklimakan Desert in China \[[@B28-ijms-16-20468]\]. The most significant characteristic of *P. euphratica* is its extraordinary adaptation to salt stress \[[@B28-ijms-16-20468],[@B29-ijms-16-20468],[@B30-ijms-16-20468]\]. This species can survive concentrations of NaCl in nutrient solution up to 450 mM while maintaining higher growth and photosynthetic rates than other poplar species \[[@B31-ijms-16-20468],[@B32-ijms-16-20468],[@B33-ijms-16-20468]\]. Previous studies of *P. euphratica* have mainly focused on analyses of salt-responsive genes \[[@B26-ijms-16-20468],[@B30-ijms-16-20468],[@B34-ijms-16-20468],[@B35-ijms-16-20468]\], miRNAs \[[@B36-ijms-16-20468],[@B37-ijms-16-20468]\], or salt-related transcriptome sequencing \[[@B26-ijms-16-20468],[@B38-ijms-16-20468],[@B39-ijms-16-20468]\]. In these studies, the genes up-regulated or down-regulated by salt stress are important and should be identified using validated reference genes by RT-qPCR.
Here, we evaluated the expression stability in *P. euphratica* leaves, stems, and roots under salt stress of ten previously used reference genes \[[@B40-ijms-16-20468],[@B41-ijms-16-20468]\], which are 60S ribosomal protein L35 (*60S*), *Actin*, elongation factor-1 α (*EF1*α), eukaryotic initiation factor 5A (*eIF-5A*), glyceraldehyde-3-phosphate dehydrogenase (*GAPDH*), glucosidase II α-subunit (*GII*α), histone superfamily protein H3 (*HIS*), ribosomal L27e protein family (*RP*), tubulin β chain (*TUB*) and ubiquitin family 6 (*UBQ*). Five different methods were used for identification of suitable reference genes and the expression normalized by the reference genes selected by these methods was investigated for nine *P. euphratica* genes; namely, *PeCOBL4* (COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family 4), *PeFLA12-1*, *PeFLA12-2*, *PeFLA12-3* and *PeFLA12-4* (FASCICLIN-like arabinogalactan-protein 12), *PeHKT1* (high-affinity K^+^ transporter 1), *PeKUP3* (K^+^ uptake transporter 3), *PeNhaD1* (NhaD-type Na^+^/H^+^ antiporter 1), and *PeNHX2* (Na^+^/H^+^ exchanger 2). The analyses show that the different reference genes identified by different methods had a variable impact on gene of interest data, and that a reliable set of reference genes should be selected based on the highest possible accuracy of RT-qPCR results. This approach can be applied to future studies of gene expression profiles in *P. euphratica*.
2. Results {#sec2-ijms-16-20468}
==========
2.1. RNA Quality and PCR Specificity {#sec2dot1-ijms-16-20468}
------------------------------------
This study was performed in accordance with the minimum information for publication of reverse transcription-quantitative PCR experiments (MIQE)-guidelines ([Table S1](#app1-ijms-16-20468){ref-type="app"}). *P. euphratica* saplings ([Figure S1](#app1-ijms-16-20468){ref-type="app"}) were exposed to salt stress for 0, 1, 3, 6, 9 and 12 h and then leaves, stems and roots were sampled for RNA extraction ([Figure 1](#ijms-16-20468-f001){ref-type="fig"}). The time-point "0" was used as a reference point, and sampling at further time-points represents a combination of salt-induced changes in gene expression as well as diurnal changes. Based on agarose gel electrophoresis, the intensity of the *25S* rRNA band was nearly twice that of *18S* rRNA band, and no genomic DNA was observed ([Figure S2](#app1-ijms-16-20468){ref-type="app"}). Using a spectrophotometer, the OD~260~/OD~280~ ratios of total RNA were between 1.8 and 2.0, and the OD~260~/OD~230~ ratios were greater than 1.5. Using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) for total RNA integrity detection, no evidence of degradation was observed. After cDNA synthesis, qPCR using the primers listed in [Table 1](#ijms-16-20468-t001){ref-type="table"} was performed, and to verify the specificity of these primers, the amplified products were analyzed using 2% agarose gel electrophoresis and only one band of the expected size was observed in each experiment. Meanwhile, also the presence of a single peak in the melting curve was observed ([Figure S3](#app1-ijms-16-20468){ref-type="app"}).
{#ijms-16-20468-f001}
ijms-16-20468-t001_Table 1
######
Gene names, Gene IDs, Primer sequences, and PCR efficiencies of the ten *P. euphratica* candidate reference genes and nine functional genes for RT-qPCR analysis. ^e^
Gene Name Phytozome v9.1 GI (*P. trichocarpa*) Primer Sequences (5′--3′, Forward/Reverse) PCR Efficiency
----------------- -------------------------------------- ---------------------------------------------------------- ----------------
*60S* ^a^ Potri.007G093700 AGGTGAACTCTTGATGCTTCGTCTT/CTTCTCTTCCATTGCCTGTCCAACT 1.972
*Actin* ^a^ Potri.006G192700 AAGATTCCGTTGTCCAGAGGTCCT/GAACATAGTAGAGCCACCACTGAGAAC 2.027
*EF1*α ^a^ Potri.006G130900 TCCGTCTTCCACTTCAGGATGTCT/GTCACGACCATACCAGGCTTCAG 1.896
*eIF-5A* ^a^ Potri.018G107300 TCGGACGAGGAGCACCACTT/TGCAAGGACGGTTCTTGATGACTAT 1.965
*GAPDH* ^a^ Potri.010G055400 ATGAAGGACTGGAGAGGTGGAAGG/CACAGTAGGAACACGGAAGGACATT 1.904
*GII*α ^a^ DQ388455.1 ^d^ CTCTCATTGAGCCGGCAAAT/CCCCCCTTCAAGCATAAGG 2.009
*HIS* ^a^ Potri.005G072300 ACTGCTCGTAAGTCTACTGGAGG/GCGGTAACGGTGAGGCTTCTTC 1.968
*RP* ^a^ Potri.001G342500 GTTACACGCTGGATGTGGACTTG/AACCACCTGTTCTTGCCTGTCTT 1.935
*TUB* ^a^ Potri.003G126800 GGAGGTGGAACTGGATCAGGAATG/GGCATTGTAAGGCTCAACCACTGT 1.914
*UBQ* ^a^ Potri.014G115100 AGACCTACACCAAGCCCAAGAAGAT/CCAGCACCGCACTCAGCATTAG 2.097
*PeCOBL4* ^b^ Potri.004G117200 GCACTTACTCACAATTCATGGCAAG/TTGGCAACCGCACGCACAA 1.887
*PeFLA12-1* ^b^ Potri.009G012100 TTATCTTGTTATTCTGGCTCCTCTTCCTC/TGTCTGAGTCGCTGCTGGTG 1.944
*PeFLA12-2* ^b^ Potri.009G012200 TGGAATAACAATCCTGGCACCAACTG/GCTCAGTCTTGTCTTCATCGCTTAG 2.031
*PeFLA12-3* ^b^ Potri.012G015000 ACTTACCAATACAAGCGTATCGGCAAT/TGGAGCAGGAGCAAGAGGTTTAGG 2.074
*PeFLA12-4* ^b^ Potri.004G210600 ACTTCACTGTCTTCGTCCGCCTAAT/CCAACTCAGTCTTGTCTTCATCGCTT 2.049
*PeHKT1* ^c^ Potri.018G132200 TCTTGGTGCTCTTCGTGGTTATGATG/CAAAGATGGCTAAGGTAGATAAAGGTGAG 2.054
*PeKUP3* ^c^ Potri.014G144900 CAATCAACAAGCAGCCGATGAGG/GGAGTAAGCACGCCATCACCTATG 1.978
*PeNhaD1* ^c^ JX981308 ^d^ GGACTCTTCTTTGGGTGGTTGGTTT/GCTTGCGGTATTCTGATGGAGGTAC 1.954
*PeNHX2* ^c^ Potri.014G134900 GACACGGTGGATTATCTAGGCTTGG/CTCGAGGTGATGTGTGAGAGGTC 2.062
^a^ Reference gene candidates \[[@B40-ijms-16-20468],[@B41-ijms-16-20468]\]; ^b^ \[[@B32-ijms-16-20468]\]; ^c^ \[[@B26-ijms-16-20468]\] Genes used to support the suitability of the identified reference genes; ^d^ GenBank accession number; ^e^ The RT-qPCR efficiency was determined by standard curve method and then confirmed by LinReg PCR program.
2.2. C~q~ Value Distribution and Expression Profile of the Ten Reference Genes {#sec2dot2-ijms-16-20468}
------------------------------------------------------------------------------
The detailed information of all the genes, primers and amplicons can be seen in [Table 1](#ijms-16-20468-t001){ref-type="table"} and [Table S2](#app1-ijms-16-20468){ref-type="app"}. All RT-qPCR assays were performed on biological triplicate samples to determine the expression rates of the selected genes. Firstly, for each candidate reference gene the average *C*~q~ values of these triplicates (for each condition and tissue) were visually presented using a histogram. This allows the expression levels of the genes to be easily compared ([Figure 2](#ijms-16-20468-f002){ref-type="fig"} and [Figure S4](#app1-ijms-16-20468){ref-type="app"}). One-way analysis of variance results were used to show differences in measured non-normalized expression. The *C*~q~ values ranged from 19.61 to 32.36 in root, stem, and leaf samples. *UBQ* showed the highest expression level irrespective of whether all tissues or just one tissue were considered. The *C*~q~ values of most of the genes ranged from 22 to 26 except *TUB* and *UBQ*. *TUB* showed the lowest expression level with a mean *C*~q~ value of 29.58 while *UBQ* overall showed the highest expression. When looking at these non-normalized data, the observed differences in measured expression within one gene under salt stress are due to both technical and biological variation. Normalization of target gene expression with reference genes will eliminate technical variation, but also erroneously impose any biological variation in reference gene expression. Therefore the expression reference genes should be minimally influenced by the salt treatment. However, these results demonstrate that the reference genes were not perfectly stable under salt stress. Indeed, considering the gene expression variation under salt stress in each tissue type, *HIS* in leaf (0.54 cycles), *RP* in stem (0.60 cycles), and *UBQ* in root (0.51 cycles) showed the lowest variance, while *TUB* in leaf (2.23 cycles), *GII*α in stem (3.33 cycles), and *TUB* in root (2.46 cycles) showed the highest variance. This different variance in measured expression for these ten reference genes under salt stress cannot only be due to technical variation but shows that there is a biological component in reference gene variation. It is necessary to identify reference genes that have a minimal biological variation component prior to performing target gene expression studies.
2.3. Statistical and Bioinformatical Analyses of Gene Expression Stability Using ΔC~t~, NormFinder, geNorm, RankAggreg and GrayNorm {#sec2dot3-ijms-16-20468}
-----------------------------------------------------------------------------------------------------------------------------------
Given the indications for variations in expression, it was important to evaluate the stability of the ten candidate reference genes. Data from leaves, stems, or roots was analyzed separately. Many approaches exist, and to compare these, statistical and bioinformatical analyses of the data were performed according to the flowchart shown in [Figure S5](#app1-ijms-16-20468){ref-type="app"}.
### 2.3.1. Δ*C*~t~ Algorithm {#sec2dot3dot1-ijms-16-20468}
In the Δ*C*~t~ algorithm \[[@B42-ijms-16-20468]\], if the Δ*C*~t~ value between two genes (the *C*~q~ value of one gene minus the *C*~q~ value of a second) remains constant when analyzed in different cDNA samples, then either both genes are stably expressed among the samples or they are co-regulated. Meanwhile, if the Δ*C*~t~ value fluctuates, then one or both genes are variably expressed. By introducing a third, fourth or fifth gene into the comparisons, more information is available on pairs showing less variability, and they can then be ranked or discarded \[[@B42-ijms-16-20468]\]. Whether the distribution of Δ*C*~t~ values between one gene and the other nine genes was discrete or concentrated was visually presented using a box-plot. [Figure 3](#ijms-16-20468-f003){ref-type="fig"} and [Table 2](#ijms-16-20468-t002){ref-type="table"} use this Δ*C*~t~ approach to reference gene selection among different tissues under salt stress.
The expression stabilities were evaluated via mean standard deviation (mSD), and the mSD values were calculated through Δ*C*~t~ values between one gene and the other nine genes. The smaller mSD value of one candidate reference gene indicates more stable expression. By calculating each gene's mSD of the Δ*C*~t~ values, we obtained the final rankings; the most stable gene showed the top ranking ([Table 2](#ijms-16-20468-t002){ref-type="table"}).
{#ijms-16-20468-f002}
{#ijms-16-20468-f003}
ijms-16-20468-t002_Table 2
######
Candidate reference genes ranked according to their expression stab. (stability, Mean StdDev values) based on Δ*C*~t~ method.
Rank (Position) Leaf Stem Root
----------------- ---------- ------- ---------- ------- ---------- -------
1 *RP* 0.384 *UBQ* 0.517 *UBQ* 0.366
2 *HIS* 0.407 *HIS* 0.547 *eIF-5A* 0.369
3 *eIF-5A* 0.464 *eIF-5A* 0.577 *GAPDH* 0.385
4 *UBQ* 0.465 *RP* 0.612 *GII*α 0.399
5 *60S* 0.472 *60S* 0.621 *HIS* 0.403
6 *GII*α 0.494 *TUB* 0.627 *RP* 0.431
7 *GAPDH* 0.519 *GII*α 0.660 *EF1*α 0.441
8 *Actin* 0.610 *EF1*α 0.689 *60S* 0.503
9 *EF1*α 0.615 *Actin* 0.816 *Actin* 0.636
10 *TUB* 0.655 *GAPDH* 1.012 *TUB* 0.772
{#ijms-16-20468-f004}
### 2.3.2. Normfinder {#sec2dot3dot2-ijms-16-20468}
Secondly, the NormFinder tool was used to identify the most suitable reference gene \[[@B43-ijms-16-20468]\]. At least three genes and two samples per group were required for analysis using this algorithm. In our study, ten genes and six samples per group were performed. Based on amplicon efficiency, the *C*~q~ values were log-transformed and used as input \[[@B43-ijms-16-20468]\]. [Table 3](#ijms-16-20468-t003){ref-type="table"} indicates that in leaves under stress, *RP* was the most stable gene (stability value = 0.024), while *Actin* was the most unstable gene (stability value = 0.164). *UBQ* and *eIF-5A* were the most stable genes in stem and root, respectively.
ijms-16-20468-t003_Table 3
######
Expression stability values of the ten candidate reference genes calculated using the NormFinder tool.
Rank (Position) Leaf Stem Root
----------------- ---------- ------- ---------- ------- ---------- -------
1 *RP* 0.024 *UBQ* 0.048 *eIF-5A* 0.031
2 *HIS* 0.031 *HIS* 0.071 *GAPDH* 0.040
3 *eIF-5A* 0.087 *eIF-5A* 0.082 *UBQ* 0.042
4 *60S* 0.098 *TUB* 0.108 *GII*α 0.053
5 *GII*α 0.110 *GII*α 0.118 *HIS* 0.055
6 *UBQ* 0.112 *RP* 0.120 *RP* 0.073
7 *GAPDH* 0.114 *60S* 0.132 *EF1*α 0.078
8 *EF1*α 0.140 *EF1*α 0.132 *60S* 0.116
9 *Actin* 0.155 *Actin* 0.218 *Actin* 0.171
10 *TUB* 0.164 *GAPDH* 0.241 *TUB* 0.206
### 2.3.3. geNorm {#sec2dot3dot3-ijms-16-20468}
For the geNorm tool, *C*~q~ values were transformed to quantities based on *E*^−Δ*C*q^ (*E* = efficiency), and in each gene among different samples the highest quantities were set to 1 to obtain the input \[[@B11-ijms-16-20468]\]. The average expression stability value, *M*, was calculated to rank the stability of the candidate genes. The genes with the lowest *M* value show the most stable expression. However, it should be noted that the strongly co-regulated genes also show low *M* values. The geNorm algorithm recommended an *M* value below a threshold of 1.5 for a gene to be considered stably expressed. However, a stricter standard using 0.5 as the threshold has also been accepted \[[@B20-ijms-16-20468],[@B44-ijms-16-20468]\]. Based on the ranking results shown in [Figure 4](#ijms-16-20468-f004){ref-type="fig"}, almost all genes showed highly stable expression in leaf and root. According to geNorm analysis, the most optimal reference genes for RT-qPCR normalization were *60S* and *UBQ* in leaf, and *eIF-5A* and *UBQ* in stem, *GAPDH* and *GII*α in root.
Quantification of target gene expression relative to multiple reference genes requires calculation of the normalization factor (*NF*), the geometric mean of the expression of combined reference genes. geNorm software computes *NF* values. To determine the minimum number of reference genes to be used for normalizing the experiment, the pairwise variation (*PV*) of two sequential NFs (*V~n/n\ +~*~1~) was used to estimate the effect of introducing additional reference genes to the NF \[[@B11-ijms-16-20468]\]. If the PV value for n genes (*V~n~*~/*n*\ +\ 1~) is below a threshold of 0.15, *n* can be considered the minimum number of reference genes. Alternatively, *n* + 1 genes can be used when the (*V~n~*~/*n*\ +\ 1~)-graph reaches a minimum \[[@B45-ijms-16-20468]\]. In our study, the expression of the ten genes varied greatly in stems, such that V~5/6~ was used in stems. V~2/3~ was used in leaf and root, but it is advisable to use at least three genes to reduce the chance of selecting co-regulated genes. Thus, three reference genes should be used for normalization in leaf and root, and six in stems (*n* + 1 at minimum *V~n~*~/*n*\ +\ 1~).
### 2.3.4. RankAggreg {#sec2dot3dot4-ijms-16-20468}
Since the different methods showed different rankings results for each gene, we used the RankAggreg statistical method to create an aggregate order to obtain a final list of genes for each tissue. The rank positions generated using the three statistical approaches were merged, including mSD values of Δ*C*~t~, stability values of NormFinder, and *M* values of geNorm. The results in [Figure 5](#ijms-16-20468-f005){ref-type="fig"} indicate that the most adequate genes tested for normalization in leaf were *RP*, *HIS*, and *eIF-5A*. In stem, the best three candidate genes were *UBQ*, *eIF-5A*, and *HIS*. In addition, *eIF-5A*, *GAPDH* and *UBQ* were top-ranked in root.
{#ijms-16-20468-f005}
### 2.3.5. GrayNorm {#sec2dot3dot5-ijms-16-20468}
GrayNorm is a recently published algorithm that finds a combination of reference genes that have the smallest possible deviation from the non-normalized data, thus are carrying the least biological variation while they are used for correcting technical variation \[[@B46-ijms-16-20468]\]. It is based on calculating normalization factors (NFs) for each treatment group and for each possible reference gene combination. The closer the averages of the 1/NF per treatment groups are to 1.0, the less biological variation is carried and the more accurate the expression levels of GOI (genes of interest) can be calculated. There are two indices that can be employed to rank the combinations of genes, *cv~inter~* (coefficient of variation of the 1/NFs averaged per condition), and cumulative deviation over all conditions from 1.0 of the 1/NF. As suggested, *cv~inter~* may be overruled and the cumulative deviation can be used \[[@B46-ijms-16-20468]\]. In our study "cumulative deviation from 1.0 of the 1/NF averaged per condition" was applied and the results in [Table 4](#ijms-16-20468-t004){ref-type="table"} and [Table S3](#app1-ijms-16-20468){ref-type="app"} indicate that a combination of EF1α, HIS and RP should be used in leaf, a combination of 60S, RP, eIF-5A and GAPDH (first combination of at least three reference genes) can be used in stem, and a combination of Actin, EF1α, GAPDH, RP, and UBQ should be used in root. It is worth mentioning that GrayNorm can evaluate all possible combinations of the ten reference genes by one operation while the other three algorithms can not. It is also noteworthy that the Δ*C*~t~ method, Normfinder and RankAggreg yield in all tissues the same outcome.
ijms-16-20468-t004_Table 4
######
Best combination of reference genes based on Δ*C*~t~, Normfinder, geNorm, RankAggreg (the top-ranked reference genes), or GrayNorm, in different tissues, and given that at least three reference genes should be used for normalisation.
Algorithms Different Tissues
------------ ---------------------- --------------------------------------- -------------------------------------
Δ *C*~t~ *RP + HIS + eIF-5A* *UBQ + HIS + eIF-5A* *UBQ + eIF-5A + GAPDH*
NormFinder *RP + HIS + eIF-5A* *UBQ + HIS + eIF-5A* *UBQ + eIF-5A + GAPDH*
geNorm *60S + UBQ + eIF-5A* *eIF-5A + UBQ + 60S + RP + HIS + TUB* *GAPDH + GII*α *+ UBQ*
RankAggreg *RP + HIS + eIF-5A* *UBQ + HIS + eIF-5A* *UBQ + eIF-5A + GAPDH*
GrayNorm *EF1*α *+ HIS + RP* *60S + RP + eIF-5A + GAPDH* *Actin + EF1*α *+ GAPDH + RP + UBQ*
2.4. Validation of the Stability of Selected P. euphratica Reference Genes via Differential Gene Expression Analysis of Nine Putatively Salt Responsive Genes {#sec2dot4-ijms-16-20468}
-------------------------------------------------------------------------------------------------------------------------------------------------------------
The relative expression levels of nine *P. euphratica* functional genes, *PeCOBL4*, *PeFLA12-1*, *PeFLA12-2*, *PeFLA12-3*, *PeFLA12-4*, *PeHKT1*, *PeKUP3*, *PeNhaD1* and *PeNHX2*, in different tissues were analyzed by RT-qPCR. Non-normalized expression levels were compared with normalized expression levels using the reference genes selected by the various algorithms as displayed in [Table 4](#ijms-16-20468-t004){ref-type="table"}. The non-normalized data change by using the normalization factor based on expression of the selected reference genes comprised in a normalization factor (NF). Various NFs have various effects on gene of interest expression. The smaller the difference between the normalized and non-normalized data, the more accurate the results are \[[@B46-ijms-16-20468]\]. [Figure 6](#ijms-16-20468-f006){ref-type="fig"} shows the induction or repression of genes by salt stress, some genes were initially induced then repressed. However, the maximum values and expression fold changes differed significantly when normalization was performed using different combinations of reference genes as proposed by the different algorithms. For example, it is known that the expression patterns of the FLA genes vary quite consistently according to the plant tissues being assessed. The mRNAs encoded by these four genes were previously found to be highly expressed in *P. euphratica* under salt stress \[[@B32-ijms-16-20468]\]. As expected, steady-state mRNA levels for the FLA genes were induced by salt stress significantly ([Figure 6](#ijms-16-20468-f006){ref-type="fig"}). When the relative expression levels of nine functional genes were normalized with the combination recommended by GrayNorm, the fold changes were smaller comparing with Δ*C*~t~, geNorm, NormFinder or RankAggreg, and the values were closer to the non-normalized data. This indicates that GrayNorm, at least in this experiment, suggests the most optimal combination of reference genes giving the highest possible accuracy.
######
Relative expression levels of nine *P. euphratica* functional genes. Expression analysis of nine genes in response to different stages of salt stress in different tissues, based on the reference genes displayed in [Table 4](#ijms-16-20468-t004){ref-type="table"} recommended by different algorithms. The expression levels were log2 transformed for easily comparing the up- or down- regulation, and the "1" in *Y*-axis and "0" in *X*-axis which show "1" fold change means unchanged. **A** to **I** represent nine different genes. Error bars indicate standard errors (*n* = 3, Bars ± SE). Columns labeled with letters "a,b,c..." indicate significant differences at *p* \< 0.05 between different expression levels.
3. Discussion {#sec3-ijms-16-20468}
=============
Although powerful techniques, including microarrays and high-throughput measurements, have been developed to detect gene expression levels, RT-qPCR is commonly used in many laboratories. Reliable RT-qPCR data depends on suitable reference genes, which must have highly stable expression under different experimental conditions. The validation of suitable reference genes is crucial, and has been performed previously in plants \[[@B6-ijms-16-20468],[@B12-ijms-16-20468],[@B13-ijms-16-20468],[@B18-ijms-16-20468],[@B19-ijms-16-20468],[@B20-ijms-16-20468]\]. However, in woody plants the identification of reference genes is limited to maritime pine \[[@B47-ijms-16-20468]\], conifers \[[@B48-ijms-16-20468]\], *Eucalyptus* \[[@B49-ijms-16-20468]\], *Jatropha curcas* \[[@B50-ijms-16-20468]\] and two species of *Populus*, namely, *P. trichocarpa* × *Populus deltoids* \[[@B51-ijms-16-20468]\] and *Populus* × *euramericana* \[[@B40-ijms-16-20468]\]. To facilitate the genetic improvement of woody plants for growth in saline soils, we performed reference gene evaluation in the salt tolerant tree *P. euphratica* and found that none of the reference genes showed perfectly stable expression ([Figure 2](#ijms-16-20468-f002){ref-type="fig"} and [Figure S4](#app1-ijms-16-20468){ref-type="app"}). For example, *Actin* had 3.22 cycles of variation in stem; if a target gene is normalized with *Actin* or a 0.3 cycle variation reference gene, the final relative quantification will have a 2^3.22−0.3^ = 7.57-fold discrepancy. This may fundamentally change the target gene expression profile. Thus, candidate genes showing high-level variation should be avoided as endogenous controls. More importantly, in our pre-experiments *18S* did not have significant variation, and it is often used as a candidate reference gene, such as in two *Populus* species for reference gene validation \[[@B40-ijms-16-20468],[@B51-ijms-16-20468]\]. However, since the expression level of *18S* was too high compared with other genes, the difference value was close to ten cycles, resulting in a 1024-fold discrepancy. To the best of our knowledge, most functional genes' expression levels are less than that of *18S*, and one of the principles in selecting suitable reference genes is that the expression level of the target and reference genes should be similar. For this reason, *18S* is rarely used as a reference gene, so we omitted it in our study and did not take it as an appropriate candidate reference gene. To further analyze the expression stability of candidate genes, several algorithms, including geNorm \[[@B11-ijms-16-20468]\], NormFinder \[[@B43-ijms-16-20468]\], BestKeeper \[[@B10-ijms-16-20468]\], Δ*C*~t~ \[[@B42-ijms-16-20468]\], qBasePlus \[[@B52-ijms-16-20468]\], RefFinder \[[@B53-ijms-16-20468]\], GenEx \[[@B54-ijms-16-20468]\], GrayNorm \[[@B46-ijms-16-20468]\], single-factor analysis of variance, and linear regression analysis \[[@B51-ijms-16-20468]\] have been applied. Among these algorithms, geNorm, and NormFinder have the greatest impact, and the latter one is superior. NormFinder and geNorm are free of charge. Meanwhile, geNorm has been integrated into the qBasePlus and GenEx tools, both of which are powerful RT-qPCR data analysis tools.
For our data analysis, we chose the Δ*C*~t~ algorithm, the two most popular tools and a new algorithm, GrayNorm, to evaluate reference gene stability in *P. euphratica*. The Δ*C*~t~ algorithm is a primary and relatively simple approach to rank gene stability based on the SD of pair-wise differences in *C*~t~ values. This uses only *C*~q~ values for calculation, while the other three tools introduce both *C*~q~ and efficiency values. In practice, PCR efficiency is an important factor that fluctuates along with coexisting substances originating from the RNA extract and cDNA synthesis, lengths and base sequences of the primers or amplification targets, quality of the Taq enzyme, and performance of the instrument. Although these factors are not considered in the Δ*C*~t~ method, the simplicity of the algorithm makes it advantageous to use. The Δ*C*~t~ method can be used for the initial screening of reference genes from a small number of candidates since it requires manual calculation, while the other three methods can perform automated calculations.
When determining the stability of the ten reference genes, the five methods mentioned above yielded different ranking patterns. Each method has its own algorithm, some of which are *C*~q~-based (Δ*C*~t~) while others are quantity-based (NormFinder, geNorm and GrayNorm). In addition, even methods with the same base algorithm showed discrepancies; for example, when transforming *C*~q~ values to quantities to obtain input, NormFinder distributes the three *C*~q~ value repeats to three groups, while geNorm uses the average *C*~q~ values of the repeats, and GrayNorm provides all the gene combinations at one time. Meanwhile, because in all RT-qPCR analysis, GOI data are divided by *NF* values during normalization, the algorithm of GrayNorm based on 1/*NF* is more visualized. The closer the average 1/*NF* per sample group to 1.0, the more stable of the reference gene \[[@B46-ijms-16-20468]\]. More importantly, GrayNorm displays all the gene combinations at one time from which the optimal combination can be easily found, so if only one algorithm is required, GrayNorm is a fine choice for RT-qPCR data analysis.
In previous studies on *Populus* reference gene evaluation, *P. trichocarpa* × *Populus* deltoids \[[@B51-ijms-16-20468]\] and *Populus × euramericana* \[[@B40-ijms-16-20468]\], both experimental conditions are in different development stages, such as overwintered terminal vegetative buds, shoot tips including unexpanded leaves and terminal vegetative buds \[[@B51-ijms-16-20468]\], or adventitious rooting of *Populus* hardwood cuttings \[[@B40-ijms-16-20468]\], neither of them is involved in abiotic stress. In our study, we focused on the extraordinary characteristic of *P. euphratica* on salt stress resistance. The appropriate reference genes identified in our study were different with those in above mentioned *Populus*. *UBQ*, *ACT2* and *18S* were the best three candidate reference genes in *P. trichocarpa × Populus deltoids*, *EF1*α and *18S* were the optimal two ones in *Populus × euramericana*. Meanwhile, *18S* was the optimal reference gene in potato \[[@B55-ijms-16-20468]\], however, in our study, *18S* was omitted because of its too-high expression level. *ACT2* (Actin) and *EF1*α were middle-ranked, and only *UBQ* was top-ranked in both *P. trichocarpa × Populus deltoids* and *P. euphratica*.
Moreover, *UBQ* and *eIF-5A* were two of the best choices for use in all tissues in our study, basically corresponding to the other species, such as rice \[[@B56-ijms-16-20468]\], soybean \[[@B18-ijms-16-20468]\], *Oryza sativa* \[[@B57-ijms-16-20468]\], lettuce \[[@B58-ijms-16-20468]\] and *Arabidopsis* \[[@B59-ijms-16-20468]\]. This may suggest that reference genes validated in *P. euphratica* have commonality with other species, and these genes are conservative. Of even greater interest, *HIS* can be considered as a novel reference gene appropriate for RT-qPCR in *P. euphratica*. However, *Actin*, widely used as endogenous control during plant development, should be avoided in *P. euphratica* under salt stress.
In *P. euphratica* DNA microarray, *GII*α have a constant expression in all experiments \[[@B60-ijms-16-20468]\], and this indicates that it can be regarded as an ideal reference gene. However, in our study, *GII*α ranks middle-level in all tissues. Its best ranks are fourth in both root and total, behind the widely used reference gene, *UBQ* and *eIF-5A*. Because the DNA microarray was focused on water deficit stress while our research conditions are salt stress, this indicates that in different experiment treatments, there are different optimal reference genes. As water deficit leads to osmotic stress while salt condition leads to both osmotic and ion stress \[[@B61-ijms-16-20468]\], maybe *GII*α is involved in *P. euphratica* response to ion stress, and this may have an influence on its expression stability. For *GAPDH*, it ranks seventhly in twenty-one candidate reference genes in *Arabidopsis* (*GAPDH*, AT1G13440) during development \[[@B13-ijms-16-20468]\], and shows middle-ranks in *Eucalyptus* \[[@B49-ijms-16-20468]\], berry \[[@B62-ijms-16-20468]\], and tomato \[[@B63-ijms-16-20468]\] during different environment conditions, even in human and mouse cells \[[@B64-ijms-16-20468]\], and the validation results were similar with ours.
Most of the nine genes' expression levels were salt-induced as seen in [Figure 6](#ijms-16-20468-f006){ref-type="fig"}, indicating that they may participate in a salt-related mechanism in *P. euphratica*. The salt-resistance contribution may be somewhat reflected by the transcript levels in plants. *PeNHX2*, an NHX-type Na^+^/H^+^ exchanger gene, reported to play a role in mediating sodium tolerance in *P. euphratica* \[[@B65-ijms-16-20468],[@B66-ijms-16-20468]\], showed a much higher level (fold change) than the other eight genes in leaf, and this indicated that *PeNHX2* might have a principle role in maintaining ion balance under salt conditions. The results in [Figure 6](#ijms-16-20468-f006){ref-type="fig"} indicate that using different combinations of reference genes identified from various algorithms can influence target gene relative expression levels, and may lead to statistical significance. More importantly our results indicate that a combination of multiple reference genes recommended by GrayNorm algorithm, as shown in [Table 4](#ijms-16-20468-t004){ref-type="table"}, should be used instead of a single reference gene. Furthermore these identified functional genes can be applied in future research in understanding of *Populus* salt-response signaling.
4. Experimental Section {#sec4-ijms-16-20468}
=======================
4.1. Plant Materials and Salt Stress Treatment {#sec4dot1-ijms-16-20468}
----------------------------------------------
In this study the RT-qPCR experimental steps were performed according to the protocols \[[@B67-ijms-16-20468]\] and MIQE guidelines \[[@B68-ijms-16-20468]\]. Seedlings of *P. euphratica* were grown in the Xinjiang Uyghur Autonomous Region of China, where they are native, after which they were transferred to an open greenhouse at Beijing Forestry University in late March the following year. They were then transplanted in individual pots containing loam soil. Each pot contained three to five individuals. The potted plants were well-irrigated according to the evaporative demand, and were grown at a natural temperature, humidity level, and photoperiod in the field for three months prior to the beginning of hydroponic culture ([Figure S1](#app1-ijms-16-20468){ref-type="app"}). In mid-July, uniformly developed plants were washed free of soil and transferred to individual pots containing 5 L of one-quarter strength Hoagland's nutrient solution in a closed greenhouse. The temperature in the greenhouse was 20--25 °C with a 16 h photoperiod (6 AM--10 PM) and 150 μmol·m^−2^·s^−1^ of photosynthetically active radiation. The nutrient solutions were renewed every 24 h and the plants were raised for 20--25 days under hydroponic conditions until they showed long white primary roots. The plants were then exposed to 350 mM NaCl for 12 h. The required amounts of NaCl were added to Hoagland's nutrient solution, and plants grown hydroponically without NaCl were used as controls. Stress physiology parameters were measured at 0, 1, 3, 6, 9 and 12 h after stress treatment. The net photosynthetic rate, stomatal conductance, intercellular CO~2~ concentration, and transpiration rate were measured using the Li-6400 Photosynthesis System (Li-Cor Biosciences, Lincoln, NE, USA). Mature leaves from the same position, epidermis on stems, and primary roots were collected at 0, 1, 3, 6, 9 and 12 h after stress treatment. All samples were examined with three biological replicates and were immediately frozen in liquid nitrogen and stored at −80 °C.
As the factors which affect the gene expressions are salt stress and diurnal changes, we are looking at a combination of both of them. Based on the principle of single factor under material treatments, we strongly recommend the other researchers to actually include time-point controls in their own experiments, and analyze reference genes and genes of interest in treated and control samples at each time-point \[[@B46-ijms-16-20468]\].
4.2. RNA Extraction, Quality Control, and cDNA Preparation {#sec4dot2-ijms-16-20468}
----------------------------------------------------------
Stored samples were ground in liquid nitrogen to powder with a mortar and pestle. Total RNA was extracted using the cetyl trimethyl ammonium bromide (CTAB) method for plants \[[@B69-ijms-16-20468]\]. Genomic DNA was eliminated by treating the RNA samples with DNase in the last step of the extraction process and with gDNase in the first step of the reverse transcription process. The quantity and quality of RNA were assessed with a NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) by detecting the OD~260~/OD~280~ and OD~260~/OD~230~ ratios, respectively. The RNA samples were also examined using 1% agarose gel electrophoresis for 15 min, and the integrities were examined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer's instructions. Equal amounts of total RNA (1.8 μg) were reverse-transcribed using a TIANGEN FastQuant RT Kit (with gDNase) (Qiagen, Hilden, Germany) according to the manufacturer's protocol; 20 μL of purified cDNA samples were diluted approximately 1:10 to the same concentration in RNase-free water.
4.3. Selection of P. euphratica Candidate Reference Genes and Functional Genes, and Primer Design {#sec4dot3-ijms-16-20468}
-------------------------------------------------------------------------------------------------
*GII*α has already been used as a reference gene in the gene expression analysis of *P. euphratica* under water deficit for four weeks \[[@B60-ijms-16-20468]\], and was added in this study. From the transcriptomics of salt-responses \[[@B30-ijms-16-20468],[@B31-ijms-16-20468],[@B32-ijms-16-20468],[@B38-ijms-16-20468],[@B70-ijms-16-20468],[@B71-ijms-16-20468]\] and the whole sequenced genome data of *P. euphratica* \[[@B26-ijms-16-20468]\], half of the candidate reference genes can be found, and all the nine functional genes were chosen. Moreover, our results were compared with other forest species such as Eucalyptus \[[@B72-ijms-16-20468]\] on the reference gene validation conclusions \[[@B49-ijms-16-20468]\]. In general, half of the candidate reference genes were widely used in model plants like *Arabidopsis* and rice, and the others were come from above mentioned transcriptomics of *P. euphratica*. Ten potential housekeeping genes were selected as candidate reference genes based on the previous research \[[@B40-ijms-16-20468],[@B41-ijms-16-20468]\]. Nine functional genes, *PeCOBL4*, *PeFLA12-1*, *PeFLA12-2*, *PeFLA12-3* and *PeFLA12-4* were selected from transcriptional data of *P. euphratica* \[[@B32-ijms-16-20468]\]. *PeHKT1*, *PeKUP3*, *PeNhaD1* and *PeNHX2* were selected from the genome data of *P. euphratica* \[[@B26-ijms-16-20468]\]. To compare the stability of the reference genes between different tissues or just in leaves, primer sequences from previous studies were used \[[@B41-ijms-16-20468]\]. The annealing temperature of the primers was 60 ± 3 °C and the length was 18--30 bp. The amplicon was between 80 and 200 bp while the GC content ranged from 40% to 60%.
4.4. RT-qPCR Reaction Conditions {#sec4dot4-ijms-16-20468}
--------------------------------
RT-qPCR was conducted in triplicate in 96-well plates with an ABI StepOne^Plus^ instrument (ABI, Carlsbad, CA, USA). A TIAGEN SuperReal PreMix Kit (Qiagen, Hilden, Germany) with SYBR Green detection chemistry was used. The reaction volume was 20 μL containing 1 μL of diluted cDNA (corresponding to 9 ng of total RNA), 0.3 μM each primer, 10 μL of 2× PreMix Plus, and 2 μL of ROX Reference Dye. The cycling parameters were 95 °C for 15 min, followed by 45 cycles of 20 s at 95 °C and 60 s at 60 °C. Melting curves for each amplicon were then performed by heating the amplicon from 40 to 100 °C and reading at each temperature to verify the specificity of each amplification reaction. Negative controls without template were performed at the same time. The PCR products were also examined on a 2% agarose gel for 30 min to determine the amplicon size and specificity of the amplification reaction.
4.5. Determination of Reference Gene Expression Stability Using ΔC~t~, NormFinder, geNorm and GrayNorm {#sec4dot5-ijms-16-20468}
------------------------------------------------------------------------------------------------------
A flowchart was constructed to explain the data analysis strategy. Four calculation methods, including Δ*C*~t~ \[[@B42-ijms-16-20468]\] and three publicly available tools, NormFinder \[[@B43-ijms-16-20468]\], geNorm \[[@B11-ijms-16-20468]\] and GrayNorm \[[@B46-ijms-16-20468]\] were used for expression stability validation of the ten genes in *P. euphratica* tissues, referred to previous study on *Coffea* species. \[[@B73-ijms-16-20468]\]. The Δ*C*~t~ approach was employed by comparing the relative expression of "pairs of genes" within each sample. Δ*C*~t~ uses the raw *C*~q~ values as input. The mean standard deviation (SD) values of the Δ*C*~t~ values (mSD) were used to rank the expression stability of the ten genes. NormFinder software (<http://moma.dk/normfinder-software>) is a Visual Basic Application (VBA) based on Excel for ranking the expression stability of reference genes. The lowest calculated value indicates the most stable expression. geNorm (<http://medgen.ugent.be/~jvdesomp/genorm/>), another VBA applet, was also used to rank the candidate reference genes based on the average expression stability values index, M. *C*~q~ values were transformed to obtain input, and the most stable gene with the lowest *M* value was ranked on the right. geNorm software can also be used to calculate another important index, the pairwise variation (PV), to determine the optimal number of control genes for use in normalization \[[@B11-ijms-16-20468]\]. Download links, summaries, or detailed directions for all these methods can also be found at the website (<http://www.gene-quantification.de/download.html>) or for GrayNorm (<https://github.com/gjbex/GrayNorm#graynorm>).
4.6. Gene Stability Rankings Merged Using RankAggreg {#sec4dot6-ijms-16-20468}
----------------------------------------------------
The RankAggreg v0.4-3 (<http://cran.r-project.org/web/packages/RankAggreg/>) package of R program v3.0.1 (<http://www.r-project.org/>), which provides an easy and convenient interface to handle complex rank aggregation problems \[[@B74-ijms-16-20468]\], was used to merge the stability measurements obtained from the three methods and establish a consensus rank of reference genes. There are two different algorithms found in RankAggreg, and according to the size of the ranking list (ten), we used the Cross-Entropy Monte Carlo algorithm (CE) to visually present the rank aggregation using a line chart. The rankings from four terms, mSD, stability, coefficient of variance (*CV*), and *M*, were used as input. The most stable two gene orders evaluated using geNorm were distinguished based on the initial *M* value when calculating the normalization factor (*NF*) value. The other bioinformatics and statistical analysis softwares used in this study including SPSS v19.0 (<http://www-01.ibm.com/software/analytics/spss/>), SigmaPlot v12.5 (<http://www.sigmaplot.com/>) and qBasePlus v2.5 (<http://www.biogazelle.com/>).
4.7. Expression Analysis of Nine P. euphratica Functional Genes {#sec4dot7-ijms-16-20468}
---------------------------------------------------------------
To explore the salt responses in the 18 *P. euphratica* samples and illustrate the suitability of those identified reference genes, we analyzed the relative expression levels of nine *P. euphratica* functional genes; namely, *PeCOBL4*, *PeFLA12-1*, *PeFLA12-2*, *PeFLA12-3*, *PeFLA12-4*, *PeHKT1*, *PeKUP3*, *PeNhaD1* and *PeNHX2*, in different tissues using the optimal or worst reference genes.
*PeCOBL4* gene which encodes an extracellular glycosyl-phosphatidylinositol-anchored protein, showing a distinctly different expression level in *Populus* *×* *canescens* (*P* *×* *c*) and *P. euphratica* (*P. eu*) under salt stress, and in *P. euphratica* the expression level is high \[[@B32-ijms-16-20468]\]. *PeFLA12-1*, *PeFLA12-2*, *PeFLA12-3* and *PeFLA12-4* displayed similar expression patterns with *PeCOBL4* in two *Populus* species \[[@B32-ijms-16-20468]\]. In *P. euphratica* the Na^+^/K^+^ transporter *PeHKT1* is similarly expanded as tandem duplicated copies in *T. salsuginea* \[[@B75-ijms-16-20468]\] and *T. parvula* \[[@B76-ijms-16-20468]\], and it responds to salt stress rapidly \[[@B26-ijms-16-20468]\]. *PeKUP3* and *PeNhaD1* were significantly up-regulated under salt stress when compared with salt-sensitive poplar, *P. tomentosa*, and both of them are involved in ion transport and homeostasis \[[@B26-ijms-16-20468],[@B65-ijms-16-20468]\]. The transcript levels of *PeNHX2* were up-regulated in roots after NaCl treatment for 6 h, and heterologous expression of *PeNHX2* in yeast mutant strain R100 can improve salt tolerance \[[@B66-ijms-16-20468]\].
The single best or worst reference gene was based on RankAggreg results, while the combination was recommended by both geNorm and RankAggreg. *C*~q~ values and amplification efficiency values were processed using the qBasePlus software \[[@B52-ijms-16-20468]\]. For calculating the relative expression levels of the nine functional genes based on a combination of multiple reference gene, such as the six top-ranked reference genes, *HIS* + *eIF-5A* + *UBQ* + *GII*α + *GAPDH* + *EF1*α. Firstly, we calculated out the relative quantification (RQ) of a functional gene, such as *PeCOBL4*, using *E*^Δ*C*t^ method. *E* was the PCR efficiency of *PeCOBL4* gene, 1.887, as shown in [Table 1](#ijms-16-20468-t001){ref-type="table"}. Δ*C*~t~ means the *C*~q~ values of stressed plants (1, 3, 6, 9 and 12 h in the stress stage) take away the *C*~q~ values of non-stressed plants (0 in the stress stage). Secondly, a "Normalization factor" (NF) needed to be calculated, the "NF" was calculated by geNorm or qBasePlus (geNorm is incorporated into qBasePlus now) software after log-transformed reference genes' *C*~q~ values were input, and the first column are reference genes' names and the first row are samples' names. Then dividing the "RQ" value of *PeCOBL4* by the "*NF*" value, we get final relative expression levels. This is also the working principle of qBasePlus and geNorm according to the manuals.
5. Conclusions {#sec5-ijms-16-20468}
==============
Overall, to identify suitable reference genes, we propose using the Δ*C*~t~ method to examine gene expression stability before subsequent evaluation by NormFinder, geNorm, GrayNorm, or other software programs. Our results provide an important reference gene selection guide when performing gene expression analysis in different tissues of *P. euphratica*.
This work was supported by the Hi-Tech Research and Development Program of China (2013AA102701), the Fundamental Research Funds for the Central Universities (No. BLYJ201505), the National Natural Science Foundation of China (31270656), Joint Programs of the Scientific Research and Graduate Training from BMEC (Stress Resistance Mechanism of Poplar), 111 Project of Beijing Forestry University (B13007), and Program for Changjiang Scholars and Innovative Research Team in University (IRT13047).
######
Click here for additional data file.
Supplementary materials can be found at <http://www.mdpi.com/1422-0067/16/09/20468/s1>.
Rui Zhao, Xinli Xia and Weilun Yin conceived this study and supervised the project; Hou-Ling Wang and Lan Li designed and conducted the experiments; Hou-Ling Wang, Lan Li, Sha Tang, Chao Yuan, Qianqian Tian, Yanyan Su, Hui-Guang Li and Lin Zhao participated in plant materials stress treatments, sample collection, and RNA preparation; Hou-Ling Wang, Lan Li, and Sha Tang analyzed the data, and Hou-Ling Wang wrote the manuscript; Hou-Ling Wang, and Rui Zhao revised the article. All authors read and approved the final manuscript.
The authors declare no conflict of interest.
[^1]: These authors contributed equally to this work.
|
arest to 1/19? (a) -0.1 (b) -6 (c) r (d) 1/5
d
Let d(i) = -i**3 + 15*i**2 - 15*i + 16. Let m be d(14). Which is the nearest to 12? (a) 3 (b) -2 (c) m
a
Let z = 38 - 19. Let y = 5.1 + -5. Which is the closest to y? (a) z (b) 2 (c) -0.1
c
Let k = -2.2 + 0.2. Let u = k + 2.1. Let y = -0.5 + u. Which is the nearest to 1? (a) y (b) -3 (c) 1/2
c
Let w = -81 - -80.9. Let c = 0.23 - -12.77. Let i = c + -12.4. What is the closest to w in -4, i, 5?
i
Suppose -2*r + 3*l = 2*l - 7, -4*l = -5*r + 25. Suppose 5 = -63*y + 58*y. Let g be (-3*y/(-12))/(14/(-16)). Which is the closest to 1/3? (a) g (b) r (c) -3
a
Let u = -1.2 - -0.6. Let v = u + -4.4. Which is the closest to -1/2? (a) 2/13 (b) -0.5 (c) v
b
Let y = 0.31 - 0.43. Which is the nearest to -1? (a) y (b) 5 (c) -2/13
c
Let q be 15 - ((-2 - (-3 + 3)) + 5). Suppose -q*r = -15*r + 9. What is the nearest to 1 in 1, r, -0.5?
1
Let r(z) = -6*z - 4. Let k be r(-3). Let y be k/(-6) + 4/6. Let c = -0.0111 + -0.1889. What is the nearest to c in -0.1, 1/3, y?
-0.1
Let k = 25/12 + -11/6. Which is the closest to k? (a) -1 (b) -2 (c) -0.1
c
Suppose 2*x - x - 5 = 0. Let z be 6/21 + (-90)/21. Let q be (z + -1)*8/48. What is the nearest to 1/2 in q, x, -3?
q
Let u be 42/(-24) - -2 - 2/(-8). What is the closest to 1/9 in u, -2/3, 2?
u
Let q = -1.208 + 1.06. Let y = 5.148 + q. Which is the nearest to 1/2? (a) -0.22 (b) y (c) -0.4
a
Suppose -3*g = 5*f - 29, -2*f + 19 = 5*g - f. Suppose 5*u + 4*k = -23, -u + g = -4*k - 2. Which is the nearest to -2? (a) 2 (b) u (c) -2/11
b
Let q = -0.28 - 0.02. Let u = 66 + -41. Let y = u - 26. Which is the closest to -2/7? (a) y (b) q (c) 4
b
Let i = -32.8 + 31.8. Which is the closest to i? (a) 106 (b) 5 (c) -2/15
c
Let h = -2315/2 - -1158. What is the nearest to -4 in 0, -2, 1/7, h?
-2
Let l be (1/26)/(2/8). Which is the nearest to -0.1? (a) -2 (b) -2/7 (c) -3 (d) l
b
Let w = -194/7 + 1760/63. Let t = -0.1 - -2.1. What is the nearest to -3/5 in w, 4, t?
w
Let r = -5.7 - -4. Let u = 1.9 + r. Let c be (-32)/(-28)*1/2. What is the nearest to 0 in u, -1, c?
u
Let f = 82 + -79. What is the nearest to 1 in f, 4, -7, 0.1?
0.1
Suppose -5*q - 23 + 8 = -5*v, -18 = -4*v + 2*q. What is the nearest to 1/4 in 0.2, -3, v?
0.2
Let d = -31 + 28. Let n = -371 + 5563/15. What is the nearest to -1 in n, d, -1/5?
-1/5
Let q = -0.0131 + 2.0131. What is the closest to 3 in 0, -0.66, q?
q
Let k = 15.49 + 0.51. Let x be (1/(-2))/((-3)/(-60)). Let p be x/(-90)*(0 - -2). Which is the closest to 1? (a) p (b) 2 (c) k
a
Let x = -0.5 + 0.2. Let r be (-2)/8 - (-29)/68. Let u = r + -23/34. Which is the closest to 0.2? (a) u (b) 4 (c) x
c
Let v = 11/18 - 10/9. Let w = 1 - 6. Let d = w + 8. Which is the closest to v? (a) d (b) 5 (c) -0.2
c
Let a = -928 - -928.413. Let k = 0.013 - a. What is the nearest to -2 in 0, k, 0.3?
k
Let h = 1 + -3. Let w = 2.1 - 2.18. Let f = -0.22 + w. What is the nearest to -1 in h, -1/2, f?
-1/2
Suppose 2*x + 5*r - 10 = -3*x, -2*x + r - 5 = 0. Let q = -0.3157 - -0.4157. Which is the closest to x? (a) q (b) -0.3 (c) 3
b
Let b = 1200.2 + -1200. What is the closest to -1 in 8, 4, b, -0.5?
-0.5
Let g be -14 + 20 + (-2 + -1 - -2). Let i(v) = 3*v**2 + 1. Let r be i(-1). Let o = r - g. Which is the closest to o? (a) -4/3 (b) 1 (c) 4
a
Let z = -68.65 + -3.35. What is the nearest to -4 in z, -1, 0.4?
-1
Let p be (14/4)/7*-1. Which is the closest to p? (a) -5 (b) 5 (c) -2/7
c
Let f = -0.29 - -0.19. Let x = 4.97 - 5. Let j = x - -0.03. What is the nearest to f in -3, j, -2/13?
-2/13
Let d = -0.2193 - -0.7193. What is the nearest to -13 in -1, d, -0.4?
-1
Suppose -19*d + 9*d = -10. What is the nearest to -0.1 in d, 3, 2/3?
2/3
Suppose 0 = 2*f - 119 - 385. Let l be 10/45 + (-128)/f. What is the nearest to 11 in 4, l, -1?
4
Let v = -35.4 - -18.3. Let x = v + 17. Which is the closest to x? (a) 2/11 (b) 0 (c) -3/7
b
Suppose -5*u - a = -63, 6*u - u = 5*a + 45. Let j = -16 + u. Let i = -4 - j. What is the nearest to -1 in 2, 0.3, i?
i
Let m(o) = -3*o**3 + o**2 + o. Let h be m(-1). Suppose -p - h = 1. Let q = 127 - 127.1. Which is the closest to q? (a) -0.4 (b) p (c) -1
a
Let y(p) = 3*p**2 + 2*p - 1. Let i be y(1). Let w be ((-6)/i)/(0 - -2). Which is the closest to 0.1? (a) -0.5 (b) -5 (c) w
a
Let i = 3.23 + -2.73. What is the closest to 1 in 3/11, i, -6?
i
Let f = -196.5 - -196. Which is the closest to 1/4? (a) f (b) 1.7 (c) 0.1
c
Suppose p = 4*p - 3. Let j = 9.4 - 7.4. Which is the closest to p? (a) -4 (b) j (c) 2/7
c
Let h = 3.01 - 0.01. Let l = -4 + h. Let g = -15.49 + 12.49. What is the nearest to l in 2, g, 1/5?
1/5
Let k = 17.2 - 17.4. What is the closest to 9/2 in -4, k, -5?
k
Let r = 13 + -25/2. Let g = -12 - -11.6. What is the nearest to -0.2 in r, g, 0.3?
g
Let z = -1.94 - 0.06. Let d = z + 2.1. Let x = -32.85 - -33.05. Which is the closest to d? (a) -2 (b) 5 (c) x
c
Let h = -435 - -9137/21. Which is the closest to -9.7? (a) -1/6 (b) 4/7 (c) h (d) 2
a
Let x = -559 + 565. What is the closest to -3 in 0.3, -1, x?
-1
Let i = 162.23 + -163. Let s = 0.67 + i. Which is the nearest to s? (a) -0.2 (b) -5 (c) 6
a
Let s be -1 - (-2 - (-3)/2). Let k be (1 - 11)*(-6)/10. Let x be (10/(-25))/(k/(-10)). Which is the nearest to x? (a) 2 (b) -0.1 (c) s
b
Let j = 39 - 38.99. Suppose 21 = 6*a + a. What is the closest to 2/3 in a, j, -0.2?
j
Let i = 0.8 + -1. Let c be (2/(-5))/(112/70). What is the nearest to -0.1 in i, c, 1/4?
i
Let k = 11.8 - 11. Let y = -0.4 + k. Which is the nearest to 1? (a) 0.2 (b) y (c) 2
b
Let d = 6.66 + -7.06. Let g = 2 - 6. Let k = -4.5 - g. What is the nearest to -2/7 in 4, k, d?
d
Let b = -6 - -4. Let z = 469.5 + -470. What is the closest to -2/7 in b, 1, z?
z
Let r = -14 - -40. Let n = r - 22. What is the closest to 2/7 in n, 0.5, 3?
0.5
Let x = -881/15 + 59. Which is the closest to x? (a) 0.4 (b) 1/4 (c) 0.5
b
Let t = -144.2 + 143.7. Which is the closest to 0.3? (a) -4 (b) t (c) -0.3 (d) 0
d
Let w be ((-111)/36 + 3)/(110/(-16)). What is the closest to w in 0.1, 2, 4, 0.2?
0.1
Let g be 6/(-24) - (-111634)/(-216). Let v = -517 - g. Let r = -80/351 + v. Which is the closest to -0.6? (a) r (b) 0.2 (c) -0.4
c
Let s = -0.29 + 1.19. What is the nearest to 2/7 in 2/7, s, 0.2, -1/4?
2/7
Let n = 412 - 3709/9. Which is the closest to 0? (a) n (b) 1/5 (c) 2/7
a
Let h = 221 + -1550/7. Let i = h + 33/28. What is the nearest to 0.1 in 1/2, i, 0.1?
0.1
Suppose -3*z = 60 + 90. Let m = z + 154/3. Which is the closest to 0? (a) m (b) 0.9 (c) -3/5
c
Let z be ((-12)/(-30))/(16/10). Which is the closest to z? (a) 0.1 (b) -8 (c) 4
a
Let h = 171.6 - 172. What is the nearest to -0.1 in -2/9, 1/7, 12/19, h?
-2/9
Let u be 4/8*-6 + 84/35. Which is the closest to -1? (a) 0.1 (b) u (c) 1/5
b
Let p be (-57)/(-135) - 4/18. Let a = -13 + 53. Let v = a + -41. What is the nearest to 2 in v, -0.3, p?
p
Let y = 17.9 - 0.9. Let r = -13 + y. Let w = 0 + 1. Which is the closest to w? (a) r (b) -7 (c) 0.1
c
Let n = -6.3 - -6. Let z = n - 0.2. Let v be (-200)/(-95) + (-2)/1. Which is the nearest to -0.1? (a) z (b) v (c) 3
b
Let b = -135.99 - -136. Let s = 0.11 - b. What is the nearest to s in -1/3, 0.1, -2?
0.1
Suppose 5*k - 4*k + 3*k = 0. Let h = -31 - -65. Let t be h/(-10) - (-6)/2. What is the nearest to -0.1 in 2/3, k, t?
k
Let l be 16/330 + 6/45. Suppose 0 = 4*s - s - 9. Which is the nearest to -1? (a) 1/6 (b) l (c) s
a
Suppose -236*s + 4*q = -231*s + 2, 3*q - 1 = 4*s. Which is the closest to -0.1? (a) -5/11 (b) s (c) -0.3
c
Let q = 802 - 802.6. Which is the closest to 11? (a) -5 (b) q (c) 3
c
Let r = 37.799 - 2.859. Let z = r + -35. Which is the closest to -1? (a) z (b) 1/7 (c) 5
a
Let n = -24.8 - -26.8. Suppose -4*x + 3*x + 5 = 0. Suppose -20 = -x*m - 0*m. Which is the nearest to -1? (a) m (b) n (c) -2
c
Let v(c) be the first derivative of c**4/4 - 5*c**3/3 - c**2/2 - 6. Let p be v(5). Let l be 3*16/420*p. What is the nearest to 0 in l, 3, -4?
l
Let y = 2 - 5. Suppose -69*u + 66*u - 51 = 0. What is the closest to u in -4, y, 2/7?
-4
Let f = -4.088 - -0.088. Let z = 9 - 9. What is the closest to -0.1 in f, 1, z?
z
Let x be (-66)/14 + 8/(-28). Let t be -4 + -1 + 156/32. Let m = 5 + -7. What
|
<?xml version="1.0" encoding="utf-8"?>
<!-- Copyright 2018 Google Inc.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License. -->
<resources>
<color name="colorPrimary">#008577</color>
<color name="colorPrimaryDark">#00574B</color>
<color name="colorAccent">#76bf5e</color>
</resources>
|
module.exports = require('./lib/babel.js')
|
Living Overseas: Delinquent FBAR Submission Procedures
U.S. taxpayers are not always aware that they must report their foreign accounts on an Foreign Bank Account Report (FBAR) in accordance with Foreign Account Tax Compliance Act (FATCA) requirements. If the taxpayer has reported all income (or did not have enough income to have a tax return filing requirement), but has foreign accounts that must be reported, he or she can file under the Delinquent FBAR Submission Procedures. To help understand this process, we will look at the example of Ruby, a U.S. citizen attending college in Canada.
Ruby is not working and only has a small amount of interest income from her U.S. and Canadian bank accounts. The amount she is earning is well below the threshold for having to file a U.S. income tax return.
However, she has bank accounts in Canada. Her parents periodically transfer funds to one of these accounts, which she then uses to pay her college tuition. She also shares a checking account with roommates that is used to pay their rent. Although she is not the primary account holder on the shared checking account, she does have signature authority, so its full value is considered a reportable asset for the FBAR informational return. The aggregate total of these Canadian accounts exceeded the $10,000 USD filing threshold for the FBAR for each of the two years she has been attending college in Canada.
Ruby did not miss any U.S. tax filings because she didn’t have enough taxable income, but she was required to file FBARs for two years. Fortunately, she is eligible to get caught up under the Delinquent FBAR Submission Procedures.
The Delinquent FBAR Submission Procedures use a six-year lookback period for determining which years need to be checked to see if there is an FBAR filing requirement. In our example, Ruby would need to look at the maximum balances for all of her foreign accounts for each of the last six years and file an FBAR for each year the aggregate maximum balance of these accounts exceeded $10,000 USD. In Ruby’s case, she has only two years of FBARs to file. Although penalties for failure to file an FBAR can be high, no penalties are due when a taxpayer qualifies and submits late FBAR returns under the Delinquent FBAR Submission Procedures.
No matter your past situation, it is important to stay in compliance with U.S. tax laws once you become aware of your filing requirements.
Sometimes individuals are unaware they had U.S. tax filing requirements. Once they take the appropriate steps to get back into compliance with U.S. tax laws, it is important that they continue to file any required FBARs and U.S. tax returns on an annual basis.
If you would like help getting into compliance or staying in compliance, please contact us for more information.
This site uses cookies to provide you with a more responsive and personalized service. By using this site you agree to our use of cookies. Please read our Cookie Policy for more information on the cookies we use and how to delete or block them. ACCEPT AND CLOSEReject
|
# /ui/src/assets
This folder contains assets that are copied by webpack to the build /dist folder.
|
Emergence of drug tolerance in cancer cell populations: an evolutionary outcome of selection, nongenetic instability, and stress-induced adaptation.
In recent experiments on isogenetic cancer cell lines, it was observed that exposure to high doses of anticancer drugs can induce the emergence of a subpopulation of weakly proliferative and drug-tolerant cells, which display markers associated with stem cell-like cancer cells. After a period of time, some of the surviving cells were observed to change their phenotype to resume normal proliferation and eventually repopulate the sample. Furthermore, the drug-tolerant cells could be drug resensitized following drug washout. Here, we propose a theoretical mechanism for the transient emergence of such drug tolerance. In this framework, we formulate an individual-based model and an integro-differential equation model of reversible phenotypic evolution in a cell population exposed to cytotoxic drugs. The outcomes of both models suggest that nongenetic instability, stress-induced adaptation, selection, and the interplay between these mechanisms can push an actively proliferating cell population to transition into a weakly proliferative and drug-tolerant state. Hence, the cell population experiences much less stress in the presence of the drugs and, in the long run, reacquires a proliferative phenotype, due to phenotypic fluctuations and selection pressure. These mechanisms can also reverse epigenetic drug tolerance following drug washout. Our study highlights how the transient appearance of the weakly proliferative and drug-tolerant cells is related to the use of high-dose therapy. Furthermore, we show how stem-like characteristics can act to stabilize the transient, weakly proliferative, and drug-tolerant subpopulation for a longer time window. Finally, using our models as in silico laboratories, we propose new testable hypotheses that could help uncover general principles underlying the emergence of cancer drug tolerance.
|
Bokodes explained...
Bokodes are Imperceptible Visual Tags for Camera Based Interaction from a Distance.
Put more simply, they're a visual data tag usually only 3mm wide but capable of holding thousands of times more information than a standard barcode. They can be read from a distance, up to a few meters away, by any standard digital camera including those built into about a billion mobile phones around the world which give this technology great potential for growth. They're so small that they appear as a tiny dot to the human eye or to a camera in sharp focus but an out of focus camera lens will see thousands of bits of information. The name 'Bokode' comes from an amalgamation of the words 'bokeh' (a Japanese photographic term describing image blur or an out of focus area in a photograph) and 'barcode'.
Bokodes, not spelt bocodes or borecodes, were developed by a team at the MIT Media Lab
(and wiki) who saw an opportunity to upgrade the standard barcode, which is relatively large, limited in the information it can carry and which can only be read from a short distance, to one that could help develop a new and more flexible interface between us and machines through visual sharing of information.
What the camera sees, the Bokode is the center object
How do they work?
The pattern in a Bokode is a tiled series of data matrix codes containing thousands of bits of information that are almost invisible to the naked eye. The lens causes the pattern to spread and become readable to a digital camera.
When the camera is pointed at a Bokode it only sees a small portion of the Bokode information at a time but the data is encoded in such a way that the camera knows it's relative position to the Bokode, more info....
What are the main advantages?
Can contain far more information than a standard barcode
Less obtrusive, classic barcodes are larger and take up more space on packaging
More private than RFID Radio frequency identification which can be read at a distance by any equipment that can receive radio signals
Can be read from a distance of a few meters by any digital camera
Can contain a variety of useful information
May lead to a new type of flexible interaction between machines and the human world
Can be used in multiple contexts including education, business presentations, libraries, shops, gaming and product tracking in factories
So how soon could Bokodes be used to replace barcodes? That depends on cost, currently Bokodes require a lens, LED and power source and cost around $5 to produce, but reflective Bokodes, like the hologram on a credit card, would only cost around 5c. The team has passive prototypes already in development.
|
styles:
- a.mss
source: mapbox:///mapbox.mapbox-streets-v2
name: tmp-1234
center:
- 0
- 0
- 3
minzoom: 0
maxzoom: 22
_prefs:
mapid: ""
saveCenter: true
attribution: ""
description: ""
bounds:
- -180
- -85.0511
- 180
- 85.0511
|
Five subtypes of receptors have been cloned and characterized in the melanocortin family. These G-protein coupled receptors (GPCR) stimulate the cAMP signal transduction pathway in many different tissues, mediating a wide range of physiological functions. Melanocortin 1 receptor (MC1R) is mainly expressed in melanocytes, monocytes, and mast cells, to mediate pigmentation of the hair and skin and to block inflammation. MC2R is expressed in adipocytes and adrenal cells, to mediate steroidogenesis in the adrenal gland. MC3R is present in the brain, hyphothalamus, heart, gut, and placenta, and has been associated with energy homeostasis and inflammation. MC4R is uniquely expressed in the brain, and controls feeding behavior, energy homeostasis, and erectile function. MC4R knock-out mice revealed the phenotype of hyperphasia and obesity. MC5R is found in a wide range of tissues and is considered to play a role for the exocrine gland system.
With a plethora of physiological functions of melanocortin receptors, a large number of compounds have been designed and synthesized in search for potent agonists and antagonists.
Early examples are synthetic peptides and peptide analogues that have been identified on the basis of endogenous agonist such as αMSH. These peptide agonists have been used to characterize the function of these receptors. NDP-αMSH is a highly potent and nonselective agonist of MC1R, 3R, 4R and 5R, and has been reported to attenuate food intake and body weight gain in rat models. A cyclic heptapeptide MT-II is an agonist with a similar non-selective profile, and its therapeutic use has been proven in clinical trials for the treatment of erectile dysfunction. HP-228, a peptide analogue with similar affinity for all four receptors, was in clinical trials for the treatment of pain and inflammation associated with surgery.
Several small molecule agonists for the melanocortin receptors have been discovered to have significant activity in drug trials to search MC4R agonists for the treatment of obesity, sexual dysfunction or inflamation. For example, the Merck research group has discovered a series of potent and selective MC4R agonists, one of which demonstrated significant effect for augmenting erectile response in mice (J. Med. Chem. 2002, 45, 4849). The Chiron research group has discovered a series of guanidine compounds as agonists that have hyphophasic activity and thus anti-obesity effect in the ob/ob mouse model (WO 02/18327). On the other hand, the Bristol-Myers Squibb group has discovered a highly potent selective MC 1R agonist, which showed efficacy in an acute mouse model of inflammation (J. Med. Chem. 2003, 46, 1123).
In view of the unresolved deficiencies of the various pharmaceutical compounds as discussed above, there is continuing need in the art for small molecule MCR agonists and pharmacological compositions that have improved pharmacological profiles. It is, therefore, an object of the present invention to provide novel compounds that are useful for the treatment of obesity, diabetes, sexual dysfunction, and inflammation.
Specifically, the present invention provides a compound of formula 1 having agonistic effect against MCRs, in particular selective agonistic effect against MCR4, and pharmaceutically acceptable salt, hydrate, solvate, and isomer thereof.
Another object of the present invention is to provide a melanocortin receptor agonistic composition comprising the compound of formula 1, and pharmaceutically acceptable salt, hydrate, solvate, and isomer thereof, as active ingredients, together with pharmaceutically acceptable carrier.
In particular, the composition according to the present invention has potent effect for the prevention and treatment of diabetes, erectile dysfunction, obesity, and inflammation.
|
Clinical findings in a family with familial adenomatous polyposis and a missense mutation of the adenomatous polyposis coli gene.
More than 100 different mutations in the adenomatous polyposis coli (APC) gene have been identified; virtually all lead to the production of a truncated protein. Clinical details of patients with missense mutations undoubtedly cosegregating with the disease have not been reported and may be relevant in understanding the APC protein function. In one family with familial adenomatous polyposis (FAP) the APC gene was analyzed by SSCP and sequencing of the aberrant SSCP band. A missense mutation in exon 15 at nucleotide 4921 segregating with the disease was observed. This predicts a tryptophan instead of an arginine at amino acid 1641 of the APC protein. No such mutation was present in 100 control subjects. In this family the colonic manifestations are as expected for classical FAP. However, the occurrence of congenital hypertrophy of the retinal pigment epithelium is unusual, owing to the inconsistency of this manifestation between family members and because congenital hypertrophy of the retinal pigment epithelium is generally absent when mutations are after codon 1387.
|
Negative pressure therapy (vacuum) for wound bed preparation among diabetic patients: case series.
Complications from diabetes mellitus affecting the lower limbs occur in 40 to 70% of such patients. Neuropathy is the main cause of ulceration and may be associated with vascular impairment. The wound evolves with necrosis and infection, and if not properly treated, amputation may be the end result. Surgical treatment is preferred in complex wounds without spontaneous healing. After debridement of the necrotic tissue, the wound bed needs to be prepared to receive a transplant of either a graft or a flap. Dressings can be used to prepare the wound bed, but this usually leads to longer duration of hospitalization. Negative pressure using a vacuum system has been proposed for speeding up the treatment. This paper had the objective of analyzing the effects of this therapy on wound bed preparation among diabetic patients. Eighty-four diabetic patients with wounds in their lower limbs were studied. A commercially available vacuum system was used for all patients after adequate debridement of necrotic tissues. For 65 patients, skin grafts completed the treatment and for the other 19, skin flaps were used. Wound bed preparation was achieved over an average time of 7.51 days for 65 patients and 10 days for 12 patients, and in only one case was not achieved. This experience suggests that negative pressure therapy may have an important role in wound bed preparation and as part of the treatment for wounds in the lower limbs of diabetic patients.
|
On the one hand, a great deal appears to have happened with respect to Brexit in the last two weeks, with David Davis and Boris Johnson resigning from Government and Theresa May stating that she will lead the Brexit negotiations. Despite the threat of an ouster, she’s still the last woman standing.
However, in reality little has happened, save some of the fog is lifting, so the profile of the terrain is becoming more visible. The odds of a crash out Brexit now appear to be 80%. I’m going to be more terse than I normally would be, so forgive me if my simplifications are arguably oversimplifications.
Some reasons why:
May’s rejection of the Irish backstop. Resolving Ireland was a precondition to sorting out other issues. EU chief negotiator Michel Barnier can’t change that order of battle nor can he change substantive parameters without going back to the EU Council. Barnier’s response to May’s renunciation, and her White Paper the trade deal the UK wants, has a thicker veneer of faux politeness than his earlier responses. Some commentators opined that the EU is taking more care so as not to give the UK fodder for blame-shifting (although they’ll do that aplenty regardless). Let’s be clear: no deal on the Irish border means no deal. As I read Barnier’s response, he hit the ball back over the net and told the UK that they’d committed to having a backstop, so if they didn’t like the one they’d signed on to, they needed to come up with another one. The EU has already rejected the UK Rube Goldberg machine of a techno-border as well as agreeing to have regulatory alignment, which is tantamount to creating special joint rules and joint oversight. As far as the EU is concerned, a divorce is a divorce, and they have made clear they are not going to set up new co-habitation arrangements, particularly since the UK’s barmycakes proposals would give it a better deal than it had in the EU. Incoherent White Paper on trade. The UK keeps asking for a special, novel arrangement with the EU when the EU ruled out anything like that the morning after Brexit. Barnier resorted to his old form with the the White Paper, and for good reason. From the Scottish Centre on European Relations: The white paper is a ramshackle affair: it attempts to keep the UK almost as close to the EU as it is as a member state, with the crucial exception of services, while denying that closeness and re-emphasising its red lines to Brexiters in the Conservative party and to ‘leave’ voters more widely. After all the drama, resignations, non-existent rebellions, threats, demands and dodgy dealing the Tory white paper falls at the first hurdle. Theresa May might just as well have said, "Oh do what you like, the country's screwed anyway." #Brexit #ToriesOuthttps://t.co/iRUlSuL6fG — Maxine Fisher #NHSLove (@Sargent_Sellers) July 20, 2018 Another EU nien on the UK’s request for a special financial services regime. From the Financial Times on Monday: Brussels has rejected the UK’s proposals on how to govern the City of London’s access to the European market after Brexit, saying Theresa May’s latest financial services plan would rob the EU of its “decision-making autonomy”… Mr Barnier told ministers that the plan would ride roughshod over the EU’s stance that equivalence decisions must be made unilaterally by Brussels. He said it would amount to a “system of generalised equivalence that would in reality be jointly run by the EU and UK”. The UK white paper called for equivalence to be “expanded”, saying it was “not sufficient to deal with a third country whose financial markets are as deeply interconnected with the EU’s as those of the UK are”. It also envisaged a unique system of joint governance and a “safeguard for acquired rights”, to prevent the UK’s access to the EU financial services market from being easily withdrawn. Let’s translate, as we did in January 2017, when the EU was even as of then re-rejecting a UK pitch for equivalence: This is tantamount to asking the EU to overturn its legal system to accommodate British bankers. Na ga happen. Lack of agreement among the Tories for any particular flavor of Brexit. This has long been apparent with the soft Brexit wing, led by Philip Hammond, at odds with the Ultras marching behind the likes of Johnson and Rees Mogg. But the press is now starting to admit that the deep divisions in the Tories mean no consensus, and that puts the UK on the default path of a crash out. Parliament also thinks it has a say over matters that are outside its power. For instance, May lost a vote on an amendment that obligated the UK to seek an agreement that would allow it to stay in the European medicines regulatory framework. But this is silly, since only members of the EEA can belong. This is part of a pattern, like some MPs pressing for the UK to remain in the EU customs union as if that would produce frictionless borders, when it won’t, of embarrassing lack of comprehension of basic issues. So the depth and pervasiveness of stupidity on the UK side is another major impediment to securing an agreement. May’s “no” to second referendum. We’ve already said it is too late to complete another referendum in time for the UK to back out of Brexit if the vote went the other way. But the Prime Minister’s pronouncement somewhat reduces the delusion factor among those holding it out as an option. Lousy negotiating dynamics. Recall that May to the Irish backstop in December, so she’s just shown the UK to be dealing with the EU in bad faith. Chris Grey explains why, even if the UK and EU actually do manage to start working on a deal, it will be even more difficult to agree on detailed terms: It would be a silly season story, but Brexit is now a year round silly story so when Dominic Raab pronounced that the UK might withhold paying its outstanding debts to the EU if there was no trade deal agreement it has to be taken seriously….This is a payment that Britain has already undertaken, in the phase 1 agreement, to make… Thus Raab’s threat is, in a sense, meaningless. But that does not mean it will have no effect. Its effect is to further undermine trust, just when it is most needed. Just as his predecessor David Davis’s airy dismissal of the phase 1 agreement on the Irish border backstop made it vital to the EU to nail that down in a legal text in the Withdrawal Agreement, so will Raab’s statement strengthen the case to make the agreement on the payment watertight. After all, this payment will not be made in one lump sum but over many years into the future. It is absurd to think that the EU would leave any wriggle room on it, especially with all the noises off from the Ultras that, once over the March 2019 line, anything agreed is up for grabs again…It is a posture which damages not just negotiations with the EU but to Britain’s more general credibility as a reliable negotiating partner. And trust matters in international negotiations.
If this isn’t distressing enough, consider:
May is putting herself at a further disadvantage by negotiating herself. The only time I’ve seen CEOs do well negotiating themselves is when they grew up in industries where pretty much everyone negotiates all the time. And the only industry where I’ve seen that to be the case is media. The top guys in that business are killers and run rings around people in financial services.
But it isn’t just that May flatters herself by thinking she’s up to going mano a mano with Barnier, or go over his head to Tusk or Merkel or Macron. It’s that principals should never negotiate with agents. Never.
May is a principal. She can commit her Government.
Barnier, by contrast, has negotiating parameters set by the EU27. He has to go back to his principals to go outside them.
The agent can use the need to go back to the principal to great advantage, for instance, by getting a concession from the other side in return for something it says it will try to get from its side, then coming back and saying it can only get 2/3 of what it hopes. The other side has already moves psychologically and has become more committed to the deal process by having made a concession. It will probably accept the only partial move from the other side, or will be satisfied by only a cosmetic addition.
But of course it will be the EU’s fault that the UK can’t get its fantasies met.
UK denial and worse inaction in the face of crash out downsides. I hope to address this at more length in later posts. One example is continued UK whinging about derivatives risk (see here for a recap). These remarks look designed to pressure the EU into giving UK banks the equivalence deal it keeps pushing.
The reality is all these UK firms have or will get EU licenses. The derivatives agreements are currently under UK law. That means Parliament and/or the regulators could solve this problem in any of a number of ways: forced reassignment of the agreements to EU entities (just as US courts interpret agreements written under the laws of other states, so too I imagine the European courts could enforce contracts under UK law although it might annoy the hell out of judges). Or the contracts could be force novated into EU-equivalent agreements as of, say, March 28, if the parties to the agreement has not substituted them or cancelled them of their own accord. And yes, there would no doubt be screw ups and hiccups and some chump customers who get exploited, but if the UK and ISDA wanted to solve this problem, as opposed to try to use it as a negotiating wedge for UK banks, I am sure they could come up with solutions for a very high proportion of the cases, and that assumes that contract parties would fail to get out of the way as much as they could themselves.
By contrast, the UK seems to be engaging in handwaves as far as dealing with requirements for ports and air traffic are concerned. Richard North has the patience to watch political TV, and in a series of recent posts, he chronicles how UK officials are acting as if the air transport issue will solve itself. By contrast, Heathrow has raised enough funds to enable it to ride out two months of no revenue. That means its leadership considers that to be a potential worst case scenario.
I suggest you read these posts, Brexit: dog days, Brexit: playing with fire, Brexit: arguing black is white, and Brexit: not an easy option, in full. One sobering tidbit:
One of the most interesting moments of the Dominic Raab (aka midair bacon) interview with Andrew Marr yesterday was the line of questioning on the EU-US open skies agreement. Marr specifically put to the Brexit secretary that: “with no deal we fall out of that”, to which Raab said quite simply, “Yes”. As a follow-up, Marr asked: “That does mean that the planes can’t carry on flying in at the moment doesn’t it?”, to which Raab responded: “I think we would resolve that issue”. There we have it in blunt terms. Yes, a “no deal” Brexit would mean that UK airlines would lose their access to US skies. And while Raab blandly assures us that “we would resolve that issue”, can we really be certain that President Trump would give us the access we want, immediately, and without asking for significant concessions elsewhere?
And another:
The thing is, though, if Rees-Mogg truly believes that the WTO option is “nothing to be frightened of”, we are dealing with a man who is either nurturing a staggering level of ignorance or is setting out to deceive. Either way, this has his co-conspirator, John Redwood, asserting that, under his fabulous WTO regime: “Planes will fly & lorries will move thru ports the day after we leave just as they did the day before. Bearing in mind just the one example of exports of foods of animal origin, where (when such exports are permitted) goods must be submitted for inspection at the ports to a Border Inspection Post, one wonders whether these ERG zealots have asked themselves why the Port of Calais has brought 17 hectares (42 acres) of land, which could house inspection posts for sanitary checks and logistics warehouses….. The same must also apply to his recent comments on aviation in the wake of Leo Varadkar’s observation that the UK is part of the single European sky. If we leave the EU a “no-deal”, hard Brexit next March, he said, the planes would not fly, adding: “You cannot have your cake and eat it. You can’t take back your waters and then expect to use other people’s sky”. This elicited a front-page headline from The Sun, proclaiming: “AIR HEAD Ireland’s PM has been branded ‘mad’ for threatening to stop British planes flying over Ireland as revenge for Brexit”. There are several issues which arise from this, not least the idea common in the media that somehow things such as restrictions on airline flying are something which are imposed on Britain, either by the EU or Member States such as Ireland, effectively amounting to a “ban”. The point, of course, is that freedom to fly for UK airlines, variously a right or a privilege, is specifically granted by virtue of EU legislation, in this case Regulation (EC) No 1008/2008. When we leave the EU, that regulation – as it applies to the UK – lapses. There is no ban as such. It is Brexit and the UK’s decision to leave the EU which will have the effect of removing the permissions for its airlines to operate outside domestic airspace. Some pundits who should know better point to the 1944 Chicago International Air Transport Agreement, arguing that such rights are conferred by this agreement, upon which the UK can rely. But here one has to understand that the Chicago Agreement does not in itself confer any rights. Rather, it requires contracting states to grant to the other contracting states what are known as the “freedoms of the air”. Thus, such rights do not take effect until contracting states formally agree between themselves bilateral or multi-lateral treaties, generically known as Air Service Agreements. In the EU context, as between Member States, these have been absorbed into the regulation, the benefits of which will no longer apply to the UK after Brexit. Unless there is then a specific air service agreement between the UK and the EU, there will be no reciprocal rights. The result, as Varadkar quite rightly says, is “planes would not fly”.
In other words, the UK would need to have a massive team trying to get Air Service Agreements in place now. There is no evidence anything of the kind is happening. And these agreements cover critical issues like safety standards. No airline is going to assume the liability of flying into a country and having its equipment serviced by airports who are not party to agreements setting forth the needed safety standards (among many other issues). In addition, aircraft leases would also prohibit it. The air transport issue is a massive Brexit risk that the Government is simply punting on, as if London is obviously so important that the rest of the world will surely bend to the UK’s needs.
The UK is about to get a very rude awakening, and it’s on track to begin on March 30, 2019.
|
Vec Object: 2 MPI processes
type: mpi
Process [0]
0.
1.
2.
6.
7.
8.
Process [1]
4.
5.
10.
11.
|
Q:
Should one really set pointers to `NULL` after freeing them?
There seem to be two arguments why one should set a pointer to NULL after freeing them.
Avoid crashing when double-freeing pointers.
Short: Calling free() a second time, by accident, doesn't crash when it's set to NULL.
Almost always this masks a logical bug because there is no reason to call free() a second time. It's safer to let the application crash and be able to fix it.
It's not guaranteed to crash because sometimes new memory is allocated at the same address.
Double free occurs mostly when there are two pointers pointing to the same address.
Logical errors can lead to data corruption too.
Avoid reusing freed pointers
Short: Accessing freed pointers can cause data corruption if malloc() allocates memory in the same spot unless the freed pointer is set to NULL
There's no guarantee that the program crashes when accessing the NULL pointer, if the offset is big enough (someStruct->lastMember, theArray[someBigNumber]). Instead of crashing there will be data corruption.
Setting the pointer to NULL cannot solve the problem of having a different pointer with the same pointer value.
The questions
Here's a post against blindly setting a pointer to NULL after freeing.
Which one is harder to debug?
Is there a possibility to catch both?
How likely is it, that such bugs lead to data corruption instead of crashing?
Feel free to expand this question.
A:
The second one is way more important: re-using a freed pointer can be a subtle error. Your code keeps right on working, and then crashes for no clear reason because some seemingly unrelated code wrote in the memory that the re-used pointer happens to be pointing at.
I once had to work on a really buggy program someone else wrote. My instincts told me that many of the bugs were related to sloppy attempts to keep using pointers after freeing the memory; I modified the code to set the pointers to NULL after freeing the memory, and bam, the null pointer exceptions started coming. After I fixed all the null pointer exceptions, suddenly the code was much more stable.
In my own code, I only call my own function that is a wrapper around free(). It takes a pointer-to-a-pointer, and nulls the pointer after freeing the memory. And before it calls free, it calls Assert(p != NULL); so it still catches attempts to double-free the same pointer.
My code does other things too, such as (in the DEBUG build only) filling memory with an obvious value immediately after allocating it, doing the same right before calling free() in case there is a copy of the pointer, etc. Details here.
EDIT: per a request, here is example code.
void
FreeAnything(void **pp)
{
void *p;
AssertWithMessage(pp != NULL, "need pointer-to-pointer, got null value");
if (!pp)
return;
p = *pp;
AssertWithMessage(p != NULL, "attempt to free a null pointer");
if (!p)
return;
free(p);
*pp = NULL;
}
// FOO is a typedef for a struct type
void
FreeInstanceOfFoo(FOO **pp)
{
FOO *p;
AssertWithMessage(pp != NULL, "need pointer-to-pointer, got null value");
if (!pp)
return;
p = *pp;
AssertWithMessage(p != NULL, "attempt to free a null FOO pointer");
if (!p)
return;
AssertWithMessage(p->signature == FOO_SIG, "bad signature... is this really a FOO instance?");
// free resources held by FOO instance
if (p->storage_buffer)
FreeAnything(&p->storage_buffer);
if (p->other_resource)
FreeAnything(&p->other_resource);
// free FOO instance itself
free(p);
*pp = NULL;
}
Comments:
You can see in the second function that I need to check the two resource pointers to see if they are not null, and then call FreeAnything(). This is because of the assert() that will complain about a null pointer. I have that assert in order to detect an attempt to double-free, but I don't think it has actually caught many bugs for me; if you want to leave out the asserts, then you can leave out the check and just always call FreeAnything(). Other than the assert, nothing bad happens when you try to free a null pointer with FreeAnything() because it checks the pointer and just returns if it was already null.
My actual function names are rather more terse, but I tried to pick self-documenting names for this example. Also, in my actual code, I have debug-only code that fills buffers with the value 0xDC before calling free() so that if I have an extra pointer to that same memory (one that doesn't get nulled out) it becomes really obvious that the data it's pointing to is bogus data. I have a macro, DEBUG_ONLY(), which compiles to nothing on a non-debug build; and a macro FILL() that does a sizeof() on a struct. These two work equally well: sizeof(FOO) or sizeof(*pfoo). So here is the FILL() macro:
#define FILL(p, b) \
(memset((p), b, sizeof(*(p)))
Here's an example of using FILL() to put the 0xDC values in before calling:
if (p->storage_buffer)
{
DEBUG_ONLY(FILL(pfoo->storage_buffer, 0xDC);)
FreeAnything(&p->storage_buffer);
}
An example of using this:
PFOO pfoo = ConstructNewInstanceOfFoo(arg0, arg1, arg2);
DoSomethingWithFooInstance(pfoo);
FreeInstanceOfFoo(&pfoo);
assert(pfoo == NULL); // FreeInstanceOfFoo() nulled the pointer so this never fires
A:
I don't do this. I don't particularly remember any bugs that would have been easier to deal with if I did. But it really depends on how you write your code. There are approximately three situations where I free anything:
When the pointer holding it is about to go out of scope, or is part of an object which is about to go out of scope or be freed.
When I am replacing the object with a new one (as with reallocation, for instance).
When I am releasing an object which is optionally present.
In the third case, you set the pointer to NULL. That's not specifically because you're freeing it, it's because the whatever-it-is is optional, so of course NULL is a special value meaning "I haven't got one".
In the first two cases, setting the pointer to NULL seems to me to be busy work with no particular purpose:
int doSomework() {
char *working_space = malloc(400*1000);
// lots of work
free(working_space);
working_space = NULL; // wtf? In case someone has a reference to my stack?
return result;
}
int doSomework2() {
char * const working_space = malloc(400*1000);
// lots of work
free(working_space);
working_space = NULL; // doesn't even compile, bad luck
return result;
}
void freeTree(node_type *node) {
for (int i = 0; i < node->numchildren; ++i) {
freeTree(node->children[i]);
node->children[i] = NULL; // stop wasting my time with this rubbish
}
free(node->children);
node->children = NULL; // who even still has a pointer to node?
// Should we do node->numchildren = 0 too, to keep
// our non-existent struct in a consistent state?
// After all, numchildren could be big enough
// to make NULL[numchildren-1] dereferencable,
// in which case we won't get our vital crash.
// But if we do set numchildren = 0, then we won't
// catch people iterating over our children after we're freed,
// because they won't ever dereference children.
// Apparently we're doomed. Maybe we should just not use
// objects after they're freed? Seems extreme!
free(node);
}
int replace(type **thing, size_t size) {
type *newthing = copyAndExpand(*thing, size);
if (newthing == NULL) return -1;
free(*thing);
*thing = NULL; // seriously? Always NULL after freeing?
*thing = newthing;
return 0;
}
It's true that NULL-ing the pointer can make it more obvious if you have a bug where you try to dereference it after freeing. Dereferencing probably does no immediate harm if you don't NULL the pointer, but is wrong in the long run.
It's also true that NULL-ing the pointer obscures bugs where you double-free. The second free does no immediate harm if you do NULL the pointer, but is wrong in the long run (because it betrays the fact that your object lifecycles are broken). You can assert things are non-null when you free them, but that results in the following code to free a struct which holds an optional value:
if (thing->cached != NULL) {
assert(thing->cached != NULL);
free(thing->cached);
thing->cached = NULL;
}
free(thing);
What that code tells you, is that you've got in too far. It should be:
free(thing->cached);
free(thing);
I say, NULL the pointer if it's supposed to remain usable. If it isn't usable any more, best not to make it falsely appear to be, by putting in a potentially-meaningful value like NULL. If you want to provoke a page fault, use a platform-dependent value which isn't dereferancable, but which the rest of your code won't treat as a special "everything is fine and dandy" value:
free(thing->cached);
thing->cached = (void*)(0xFEFEFEFE);
If you can't find any such constant on your system, you may be able to allocate a non-readable and/or non-writeable page, and use the address of that.
A:
If you don't set the pointer to NULL there is a not-so-small chance, that your application continues to run in an undefined state and crashes later on at a completely unrelated point. Then you will spend a lot of time with debugging a nonexistent error before you find out, that it's a memory-corruption from earlier.
I'd set the pointer to NULL because the chances are higher that you'll hit the correct spot of the error earlier than if you didn't set it to NULL. The logical error of freeing memory a second time is still to be thought of and the error that your application does NOT crash on null-pointer access with a large enough offset is in my opinion completely academic although not impossible.
Conclusion: I'd go for setting the pointer to NULL.
|
Rhythmic electrical activity in branches of the stellate ganglion in the cat during postnatal ontogenesis.
Electrical activity in branches of the stellate ganglion was studied in neonatal cats and cats aged 10, 20, and 30 days and two and six months, with subsequent spectral analysis. Maturation of the pattern of the baseline rhythmic activity in branches of the ganglion differed during ontogenesis in the kittens. The neonatal period until the end of the second month of life was accompanied by an increase in the amplitude of electrical oscillations. Synchronous discharges in postganglionic fibers consisted of slow, low-amplitude oscillations at the respiratory frequency and heart rate in neonatal and 10-day-old-kittens. Synchronous spike activity with a frequency of about 10 Hz appeared from day 20 of life. The formation of the pattern of sympathetic nerve fiber discharges was complete by the second month of life.
|
The name "Antimatter Catalyzed Micro Fission/Fusion" for this drive concept is a bit of a misnomer. Obviously, the antimatter is not actually a catalyst, but rather provides the energy necessary to achieve the desired nuclear reaction.
In the following section, the ideas behind the ACMF drive will be discussed, followed by a brief overview of the ICAN-II spacecraft that is being designed to use this drive concept.
As mentioned in the overview of Antimatter Drives, the world's production of antimatter is abysmally low. Currently it is on the order of 1 to 10 nanograms per year. While antimatter has a tremendous energy density, this is still completely insufficient for a pure antimatter/matter reactor drive.
That rules out manned interstellar travel using antimatter drives in the near future. However, a hybrid between antimatter and nuclear drives would allow humans to explore their own solar system with reasonable mission times and costs. One of the two hybrid designs is the ACMF.
The ACMF concept is being developed at Penn State University and is based on their findings that antimatter can induce a more efficient fission reaction than normal fission methods. For those that are unaware, fission is the nuclear process in which a heavy atom (such as plutonium) splits into two lighter atoms, thereby releasing energy.
On the other end of the scale is fusion, whereby two light atoms (such as deuterium and tritium, both hydrogen isotopes) fuse together to form a heavier atom, this also releases energy. Fusion can continue to release energy up to the point of Iron, similarly fission can release energy down to the point of Iron. Iron is the minimum bonding energy atom.
Antimatter annihilation, nuclear fission, and nuclear fusion all have major problems. Antimatter annihilation requires antimatter, which is hard to come by in this matter filled world. Fission produces a lot of radioactive waste, as well as being the least efficient of the three. Fusion is hard to get started, and sustain (the Sun is able to sustain its fusion reaction only because of its immense gravitational field).
However, in a wonderful example of the sum of the parts not being equal to the whole, by combining these three problematic energy sources, all of these problems are minimized. Very little antimatter is needed (just enough to start the fission reaction), very little fission occurs (just enough to start the fusion reaction), and the fusion reaction doesn't have to be sustained for very long (the drive uses pulses of thrust).
It has already been well demonstrated that a fission reaction can be sufficient to ignite a fusion reaction (i.e. the Hydrogen Bomb), and Penn State has recently demonstrated that a relatively small number of antiprotons can be used to ignite a fission reaction. Figure 7 gives a rough idea of how the ACMF drive would work:
A pellet of Deuterium, Tritium, and Uranium-238 (nine parts D-T for every one part U-238) is injected into the reaction chamber. First the pellet is compressed using ion particle beams [1], then irradiated with a 2ns burst of antiprotons [2]. The antiprotons annihilate some of the pellet, producing enough energy to cause the U-238 to fission [3]. In turn, the fission reaction ignites a fusion reaction within the Deuterium-Tritium (D-T) core [4]. The fusion reaction produces the desired engine thrust. A new pellet is than inserted, and the process repeats itself.
This drive concept seems to be the most efficient (as determined by NASA) for use in manned, planetary missions. A round-trip, manned mission to Mars using the ACMF drive would only take 120 days, and require approximately 140 nanograms of antimatter (which could be produced in one year by Fermilab after a few major upgrades are implemented). In addition, it would require approximately 362 metric tons of propellant (the D-T-U pellets).
Penn State University has designed a spacecraft, called ICAN-II, that would use the ACMF drive for omniplanetary missions within the Solar system. Currently, NASA has suspended all plans for manned missions to other planets until the International Space Station is completed (estimated 2003). By that time, the ICAN-II (or a similar design) may be adopted by NASA for a manned mission to Mars (since, by then, the antimatter storage problems may have been overcome). The design, however, is capable of manned missions to any of the planets within the solar system. Below, is a rendering of what the ICAN-II spacecraft would look like if built:
ICAN-II is similar to the ORION spacecraft design put forth by Stanislaw Ulam in the late 1950s. The ORION was intended to be used to send humans to Mars and Venus by 1968. It was to utilize a large number of nuclear bombs that would be set off one after the other, behind the ship to push it forward. It would, of course, require large shock-absorbers and ablative shielding for its pusher-plate. The ICAN-II also, in a sense, utilizes nuclear "bombs" for thrust. However, instead of regular fission bombs like the ORION would utilize; ICAN-II uses what are, essentially, a large number of very small hydrogen-bombs. Set off, of course, by a stream of antiprotons.
Ecological concerns would probably require that ICAN-II be assembled in space. Of course, a precedent for such large scale orbit-based assembly is already being set by the construction of the International Space Station.
The radiation from ICAN-II's ACMF engine would be intercepted by a 4 meter radius silicon carbide shell. Additionally, 1.2 meters of lithium hydride will shield the fuel rings from high-energy neutrons that are ejected from the nuclear explosions, and 2.2 meters of shielding will protect the crew modules. The spacecraft would have a total mass of 625 metric tons, with 82 additional metric tons available for payload. This is more than sufficient to carry a Mars Lander and exploration vehicles. Below is a diagram showing the layout of ICAN-IIs various components:
The ICAN-II is a viable spacecraft design that could be built within the next two decades. Currently, antiprotons can only be stored for a few weeks and production is very low; but, the problems with the storage and production are engineering problems, not physical problems. Humankind has shown, thus far, that any feats of engineering not expressly forbidden by the laws of physics, will be achieved.
|
The present invention relates to a device for use in the gearbox of an aircraft to help keep oil within the gearbox from leaking out into the atmosphere. During operation of the aircraft, pressures may build up within the gearbox. If these pressures are allowed to build up in excess, they may interfere with the normal operation of the various components of the gearbox. Accordingly, a vent usually is provided from the gearbox to relieve interior pressures.
|
{
"_from": "case-sensitive-paths-webpack-plugin@^2.1.1",
"_id": "[email protected]",
"_inBundle": false,
"_integrity": "sha1-PSnO2MHxJL9vU4Rvs/WJRzH9yQk=",
"_location": "/case-sensitive-paths-webpack-plugin",
"_phantomChildren": {},
"_requested": {
"type": "range",
"registry": true,
"raw": "case-sensitive-paths-webpack-plugin@^2.1.1",
"name": "case-sensitive-paths-webpack-plugin",
"escapedName": "case-sensitive-paths-webpack-plugin",
"rawSpec": "^2.1.1",
"saveSpec": null,
"fetchSpec": "^2.1.1"
},
"_requiredBy": [
"/@storybook/react"
],
"_resolved": "https://registry.npmjs.org/case-sensitive-paths-webpack-plugin/-/case-sensitive-paths-webpack-plugin-2.1.1.tgz",
"_shasum": "3d29ced8c1f124bf6f53846fb3f5894731fdc909",
"_spec": "case-sensitive-paths-webpack-plugin@^2.1.1",
"_where": "/home/aram/code/synp/test/fixtures/deps-with-scopes/node_modules/@storybook/react",
"author": {
"name": "Michael Pratt"
},
"bugs": {
"url": "https://github.com/Urthen/case-sensitive-paths-webpack-plugin/issues"
},
"bundleDependencies": false,
"deprecated": false,
"description": "Enforces module path case sensitivity in Webpack",
"devDependencies": {
"eslint": "^3.19.0",
"eslint-config-airbnb-base": "^11.2.0",
"eslint-plugin-import": "^2.3.0",
"fs-extra": "^2.1.2",
"mocha": "^3.0.1",
"webpack": "^1.13.1"
},
"engines": {
"node": ">4.0"
},
"files": [
"index.js"
],
"homepage": "https://github.com/Urthen/case-sensitive-paths-webpack-plugin#readme",
"keywords": [
"webpack",
"plugin",
"case sensitive",
"import",
"require"
],
"license": "MIT",
"main": "index.js",
"name": "case-sensitive-paths-webpack-plugin",
"repository": {
"type": "git",
"url": "git+https://github.com/Urthen/case-sensitive-paths-webpack-plugin.git"
},
"scripts": {
"lint": "eslint index.js",
"lintfix": "eslint --fix index.js",
"test": "mocha test/"
},
"version": "2.1.1"
}
|
LOS ANGELES, California (CNN) -- A court has ordered pop singer Britney Spears to give up custody of her children effective Wednesday at noon.
Kevin Federline and Britney Spears, here during happier times, have two children.
Spears' former husband, Kevin Federline, is to retain custody of their two sons "until further order of the court," according to a ruling by Superior Court Judge Scott Gordon.
It was not clear what led to Monday's decision awarding Federline full custody. A transcript of the court proceedings was ordered sealed.
Last month, a judge ordered Spears, 25, to submit to random drug tests after finding she engaged in "habitual, frequent, and continuous use of controlled substances and alcohol."
That order, also by Gordon, provided no details and did not name any drugs.
The former couple has been embroiled in a bitter custody fight over their sons, Sean Preston and Jayden.
The parents had split custody 50-50, but Federline then asked for the arrangements to be shifted to 70-30 in his favor. Watch how Spears became user of -- and prisoner to -- fame »
In addition to ordering the twice-weekly drug tests, Gordon ordered Spears to spend eight hours per week working with a "parenting coach," who was to observe her interactions with her children.
Gordon also told both parents to avoid alcohol or "other non-prescription controlled substances" 12 hours before taking custody of the children.
He also barred the exes from making "derogatory remarks about the other party and the other party's family or significant other" during the case.
And he ordered the parents to go through "joint co-parenting counseling" and barred them from using corporal punishment on the boys.
Spears and Federline were married for two years before their divorce became final in July.
Monday's order comes amid a career freefall for Spears, whose new album is due to be released November 13.
After her September 9 "comeback" performance on the MTV Video Music Awards, critics derided her singing and dancing as lackluster and said she appeared overweight in her sequined two-piece costume.
Her former divorce lawyer, Laura Wasser, resigned last month as her legal representative after telling reporters the singer "just wants to be a mom."
Spears' management company, the Firm, recently quit after representing the singer for little over a month. E-mail to a friend
All About Britney Spears
|
Induction of cytochrome P450 1A1 by ketoconazole and itraconazole but not fluconazole in murine and human hepatoma cell lines.
Azole antifungal agents are widely prescribed drugs for the treatment of systemic fungal infections; however, since their introduction into the market, increasing evidences of hepatotoxicity have been reported. Therefore, we examined here the ability of three structurally different antifungal drugs, ketoconazole (KTZ), itraconazole (ITZ), and fluconazole (FLZ) to induce the CYP1A1, an enzyme known to play an important role in chemical activation of xenobiotics to toxic metabolites. KTZ and ITZ, but not FLZ, induced the CYP1A1 in murine Hepa 1c1c7 and human HepG2 hepatoma cells at the mRNA, protein and activity levels in a concentration- and time-dependent manner. The increases in Cyp1a1 mRNA levels mediated by KTZ and ITZ were completely blocked by the RNA synthesis inhibitor, actinomycin D, whereas the level of existing mRNA was not altered, implying a requirement of de novo RNA synthesis through a transcriptional mechanism. The ability of these drugs to directly activate the aryl hydrocarbon receptor (AhR) transformation and hence xenobiotic responsive element's binding was strongly correlated with their abilities to induce luciferase activity. Inhibition studies showed that KTZ and ITZ, in addition to being CYP1A1 inducers, are substrates and competitive inhibitors. This study provides the first evidence for the ability of KTZ and ITZ to induce the CYP1A1 gene expression through an AhR-dependent mechanism, and suggests a novel mechanism of the KTZ- and ITZ-mediated toxicities.
|
Are Cape floral clades the same age? Contemporaneous origins of two lineages in the genistoids s.l. (Fabaceae).
The hypothesis that the elements of the modern species-rich flora of the Cape Floristic Region (CFR), South Africa, originated more or less simultaneously at the Miocene/Pliocene boundary, in response to the development of a mediterranean climate, has been challenged by numerous molecular dating estimates of Cape floral clades. These studies reveal a more gradual emergence, with the oldest clades originating in the Eocene, but others appearing later, some as recently as the Pliocene. That there are factors which might affect the dates recovered, such as choice of calibration point, analysis method, sampling density and the delimitation of Cape floral clades, suggests a need for further critical evaluation of the age estimates presented to date. In this study, the dates of origin of two Cape floral clades (the legume Crotalarieae p.p. and Podalyrieae) are estimated, constrained by a shared calibration point in a single analysis using an rDNA ITS phylogeny in which 633 taxa are sampled. The results indicate that these two clades arose contemporaneously 44-46 mya, not at the Miocene/Pliocene boundary as had been previously supposed. The contemporaneous origin of these Cape floral clades suggests that additional more inclusive analyses are needed before rejecting the hypothesis that a single environmental trigger explains the establishment of Cape floral clades.
|
Q:
pass object or object id?
Given the following code, which enroll method is better and why? Or should this code be improved some other way altogether?
My idea of "better" for the above basically boils down to 1) most philosophically correct (best practices) and 2) most efficient/performant.
Class Course < ActiveRecord::Base
has_many :enrollments # basically a join table
has_many :students, :source => :user, :through => :enrollments
def enroll_this_way(student)
self.enrollments << Enrollment.new(:course_id => self.id, :student_id => student.id)
end
# OR
def enroll_that_way(student_id)
self.enrollments << Enrollment.new(:course_id => self.id, :student_id => student_id)
end
end
A:
def enroll_this_way(student)
self.enrollments.build :student => student
end
|
Five Arrested Over Killing of Policeman in Lagos
The Lagos State Police Command said it has arrested five people in connection with the murder of a policeman at College Road, Ifako-Ijaiye area of Lagos, on Wednesday.
Irate mob had killed a policeman and vandalised a patrol vehicle following the death of a youth who was said to have had scuffle with the police two weeks ago and died early Wednesday.
Police Public Relations Officer (PPRO), Chike Oti, said that five people had been arrested in connection with the incident.
Oti said the suspects had been transferred to the Homicide section at the State Criminal Investigation and Intelligence Department.
He added that they would be charged for murder at the conclusion of investigation.
Irate mob had descended on some policemen inside a packed police vehicle and succeeded in clubbing one of them to death.
Oti had disclosed this in a statement, Wednesday, adding that “at about 1100hrs, at College Road, Ifako Ijaiye, Ogba, Lagos, a police patrol team stationed at a black spot in the location was attacked by an irate mob for a yet to be determined reason.
“In the process, Sergeant Esiabor Collins with service number 260326, was attacked and killed. Also, the patrol vehicle was not spared by the rampaging mob which they vandalised.”
Oti said preliminary investigation into the incident revealed that the mob, mainly youths had earlier that morning gone to Area ‘G’ Command, Ogba with the intention to overrun the police formation and commit arson but found it impregnable.
“However, the Area Commander in-charge, spoke to them, promising to cause an investigation into their grievances which bothered on the death of a youth who allegedly died today 29/08/18, two weeks after an alleged encounter with some policemen.
“At this juncture, it must be clearly stated that the police authorities in the state are unaware of any encounter with the deceased as no formal complaint was received to that effect,” he said.
According to Oti, the Commissioner of Police, Edgal Imohimi noted that the penchant to take laws into own hands by some people who easily constituted themselves into a mob was becoming worrisome to say the least.
“The Command wishes state that the deceased officer and indeed the entire patrol team had the option of defending themselves with their firearms against the mob but chose to show restraint in the face of provocation but unfortunately the rampaging mob never allowed them that option hence Sgt. Collins paid the supreme price.
“The Commissioner of Police, Lagos State, CP Edgal Imohimi, notes that policemen in the state had on several occasions shown restraints in the face of provocative actions. He therefore warns that policemen may be forced to use their firearms to defend themselves, other people about being killed by a mob and in the protection of government assets.
“He urges parents to warn their children to refrain from such acts which according to him may lead to a breach of the peace and unnecessary bloodletting,” Oti stated.
|
Carl Joseph Fast
Carl Joseph Fast (;(also written as 法士) Foochow Romanized: Huák-sê̤ṳ; October 8, 1822 – November 13, 1850) was the second Swedish missionary sent to China and the first Protestant missionary murdered in Fuzhou.
On January 1, 1850, Fast arrived in Foochow (today Fuzhou) as the missionary from the Lutheran Lund Missionary Society of Sweden, and was joined by Anders Elgqvist later that year. The mission they set up in China was short-lived. On November 13, 1850, the two missionaries were brutally assaulted by Chinese pirates when they were coming up the River Min after getting money from a ship. Armed with a pistol Elgqvist survived the attack, but Fast was killed on the spot.
Fast was buried in Fuzhou Nantai. An order was given by then-Fujian Governor Xu Jiyu (徐继畬) to capture the murderers within three days, and the case was finally settled on November 18, with three criminals brought to justice.
References
External links
Article at Svenskt biografiskt lexikon
Category:1822 births
Category:1850 deaths
Category:Swedish Lutheran missionaries
Category:Lutheran missionaries in China
Category:Christian missionaries in Fujian
Category:Swedish people murdered abroad
Category:People murdered in China
Category:Murdered missionaries
Category:Swedish expatriates in China
Category:People from Lilla Edet Municipality
|
Registered Nurse Salaries in Towson, MD
Salary estimated from 25 employees, users, and past and present job advertisements on Indeed in the past 36 months. Last updated: January 18, 2019
Location
Average in Towson, MD
$38.93 per hour
▲18% Above national average
Most Reported
$19.20
$65.35
Salary Distribution
How much does a Registered Nurse make in Towson, MD?
The average salary for a Registered Nurse is $38.93 per hour in Towson, MD, which is 18% above the national average. Salary estimates are based on 25 salaries submitted anonymously to Indeed by Registered Nurse employees, users, and collected from past and present job advertisements on Indeed in the past 36 months. The typical tenure for a Registered Nurse is 1-3 years.
Please note that all salary figures are approximations based upon third party submissions to Indeed. These figures are given to the Indeed users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures.
|
In just his third season as head coach of Kentucky women's soccer, Jon Lipsitz has helped lift the program to a banner season in 2011. The Wildcats (13-6-0, 6-5-0 Southeastern Conference) have won the most games overall and in SEC play of any UK team since 2006.
The Cats had high hopes for the season after doubling their 2009 win total in 2010, but Lipsitz doesn't mince words in saying he views this regular season as a success. Even so, the team is far from satisfied as it enters postseason play.
"If you had come to me on August 2, the first day of preseason, and said, 'You're going to be talking about going to Orange Beach, winning six games in the SEC and a No. 17 RPI, I would have taken it,' " Lipsitz said. "But we always want to do more, we always want to do better."
The postseason begins in Orange Beach, Ala., where UK will open the SEC Tournament against No. 20 Tennessee at 3:30 p.m. Wednesday. The Cats defeated the Lady Volunteers in a double-overtime affair by a score of 1-0, one of UK's signature regular season victories. Both teams figure to be focused and ready for the rematch, though Lipsitz can envision the game featuring more scoring this time around.
"They're a well-coached team by Coach (Angela) Kelly and a very dynamic attacking team," Lipsitz said. "The strange thing in our history is that the three games since I got here have all been 1-0. It doesn't make a lot of sense because both teams attack so much. I'd expect more like a 5-4 game when we play each other so we'll see what happens."
As Lipsitz referenced, the history between these two teams runs much deeper than the dramatic matchup in mid-October. In addition to three tight matches between UK and UT since he became a Wildcat, Lipsitz coached his former team, Charlotte, to a first round victory over the Lady Vols in the 2008 NCAA Tournament.
"It's become quite the rivalry since I arrived," Lipsitz said. "I think it started even before that. My next to last game at Charlotte was the first round of the NCAA Tournament against Tennessee, so I think it started way back then and it's continued."
The NCAA Tournament is exactly what the Cats hope to reach this season. Ranked No. 17 in the RPI, UK is well positioned for a berth, though the Wildcats won't rest easy until they see "Kentucky" on the bracket.
"Next Monday those announcements will be made by the NCAA and we find out who we'll play and where," Lipsitz said. "Until we see there's nervousness there, but it would be pretty stunning for us not to be in the NCAA right now with where we are."
Over the past two seasons, the Cats have consistently stated a goal of reaching the SEC Tournament. They now find themselves in somewhat of a unique position with the NCAA's on the horizon as well. UK heads to Orange Beach intently focused on winning the SEC, but it would be foolish not to take the NCAA's into account as well.
"We're going there to win and there isn't a moment in our thoughts about anything else," Lipsitz said. "But when you know there is something coming you think about going a little deeper on your bench to preserve players who are dinged up at this time of year."
Dealing with an ankle she injured in the regular season finale against Vanderbilt, midfielder Danielle Krohn (ankle) is one of a handful of players who have bumps and bruises. UK will not be without any of those players, but Lipsitz does expect to rely more on the bench he has worked all season to develop than he otherwise might.
"They'll play against Tennessee," Lipsitz said, "but we're not going to play them 90 minutes and we shouldn't have to because we've been developing every player on the team so any player is ready at any moment."
With a few days off between the 4-2 win over Vanderbilt and the trip to Orange Beach, UK has had a chance to heal a bit. During that time, Lipsitz has taken a moment to stop and appreciate how far his team has come.
"We've done a lot, and I need to show that to the players," Lipsitz said. "I'm very happy with where we are even though we'll never be satisfied with where we are, but I'm very pleased with what we've done as a program."
The Wildcats have reached many of their goals in 2011, but they have set a new one: hosting the first two rounds of the NCAA Tournament. UK's high RPI has them in position to potentially do that, but it's also going to take a strong performance in the SEC's to make it happen.
"They want to play at home," Lipsitz said. "They want to host in the NCAA's. Well, then they better show that against Tennessee."
Hunyadi, Gilliland earn SEC honors
On Monday, the SEC announced its 2011 women's soccer awards and a pair of Wildcats were recognized. Senior Kelsey Hunyadi and freshman Arin Gilliland were named second team All-SEC, becoming the 23rd and 24th players in school history to be named all-conference. Gilliland was also named to the All-Freshman team.
Hunyadi was in contention for first team honors, as she's had one of the best seasons in school history and assaulted the UK record book, but she'll settle for being a second teamer.
"She's having really an epic season in Kentucky women's soccer history," Lipsitz said. "She is third all-time in goals for a season; second in assists, one away from the record; and third in points. She's having an amazing season with some soccer left to be played."
Lipsitz was pleased to see two of his top players honored, especially since he knows the individual awards grow from what the team as a whole has accomplished.
"More importantly, these individual honors come from team success and we talk about that a lot," Lipsitz said. "The better the team does, the more individual honors that come."
|
About Men's Platinum Round Fathers Wedding Rings
No longer only plain vanilla, men's wedding rings today come in a wide range of styles as unique as you. Stylish men have discovered that a wedding band design with gems, interesting texture, or meaningful symbols expresses your own personality. Gemvara's wide selection of men's platinum round fathers wedding rings means you can find the perfect style. Gemvara selects the finest possible materials to make one of a kind men's platinum round fathers wedding rings to order, just for you. Our precious metals are recycled or responsibly mined. As its name suggests, the round brilliant shape is cut to sparkle, with proportions that make it dance with light. Naturally white and exceptionally rare, platinum's 95% purity makes it hypoallergenic too. You'll feel the difference: platinum weighs 40% more than 18k gold. Gemvara's beautifully custom-made men's platinum round fathers wedding rings are handcrafted to order, just for you, by skilled craftsmen in the United States.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.