context
stringlengths
219
15.8k
answer
stringlengths
201
11.4k
rd circuit city / state date championship challenge production 0 rd 1 adelaide street circuit adelaide , south australia 11 - 14 march david wall jordan ormsby mark o'connor 1 rd 2 albert park grand prix circuit melbourne , victoria 25 - 28 march max twigg damien flack mark o'connor 2 rd 3 eastern creek raceway sydney , new south wales 20 - 30 may david wall damien flack adrian flack paul freestone 3 rd 4 phillip island grand prix circuit phillip island , victoria 10 - 11 july james koundouris shane smollen tony alford 4 rd 5 mount panorama circuit bathurst , new south wales 7 - 10 october tony quinn shane smollen paul freestone
{"rd":{"0":"rd 1","1":"rd 2","2":"rd 3","3":"rd 4","4":"rd 5"},"circuit":{"0":"adelaide street circuit","1":"albert park grand prix circuit","2":"eastern creek raceway","3":"phillip island grand prix circuit","4":"mount panorama circuit"},"city \/ state":{"0":"adelaide , south australia","1":"melbourne , victoria","2":"sydney , new south wales","3":"phillip island , victoria","4":"bathurst , new south wales"},"date":{"0":"11 - 14 march","1":"25 - 28 march","2":"20 - 30 may","3":"10 - 11 july","4":"7 - 10 october"},"championship":{"0":"david wall","1":"max twigg","2":"david wall","3":"james koundouris","4":"tony quinn"},"challenge":{"0":"jordan ormsby","1":"damien flack","2":"damien flack adrian flack","3":"shane smollen","4":"shane smollen"},"production":{"0":"mark o'connor","1":"mark o'connor","2":"paul freestone","3":"tony alford","4":"paul freestone"}}
no in series no in season title director writer (s) original air date production code us viewers (million) 0 23 1 where were we pamela fryman carter bays & craig thomas september 18 , 2006 2alh01 10.48 1 24 2 the scorpion and the toad rob greenberg chris harris september 25 , 2006 2alh02 9.14 2 25 3 brunch pamela fryman stephen lloyd october 2 , 2006 2alh03 9.32 3 26 4 ted mosby : architect pamela fryman kristen newman october 9 , 2006 2alh04 9.09 4 27 5 world 's greatest couple pamela fryman brenda hsueh october 16 , 2006 2alh06 9.05 5 28 6 aldrin justice pamela fryman jamie rhonheimer october 23 , 2006 2alh05 9.59 6 29 7 swarley pamela fryman greg malins november 6 , 2006 2alh07 8.22 7 30 8 atlantic city pamela fryman maria ferrari november 13 , 2006 2alh08 9.33 8 31 9 slap bet pamela fryman kourtney kang november 20 , 2006 2alh09 8.85 9 32 10 single stamina pamela fryman kristen newman november 27 , 2006 2alh10 9.85 10 33 11 how lily stole christmas pamela fryman brenda hsueh december 11 , 2006 2alh11 8.81 11 34 12 first time in new york pamela fryman gloria calderon kellett january 8 , 2007 2alh12 8.37 12 35 13 columns rob greenberg matt kuhn january 22 , 2007 2alh13 9.42 13 36 14 monday night football rob greenberg carter bays & craig thomas february 5 , 2007 2alh14 10.61 14 37 15 lucky penny pamela fryman matt sorrentino & martynas prusevicius february 12 , 2007 2alh15 9.68 15 38 16 stuff pamela fryman kourtney kang february 19 , 2007 2alh16 8.95 16 39 17 arrivederci , fiero pamela fryman chris harris february 26 , 2007 2alh17 9.33 17 40 18 moving day pamela fryman maria ferrari march 19 , 2007 2alh18 7.27 18 41 19 bachelor party pamela fryman carter bays & craig thomas april 9 , 2007 2alh19 9.90 19 42 20 showdown pamela fryman gloria calderon kellett april 30 , 2007 2alh20 7.24 20 43 21 something borrowed pamela fryman greg malins may 7 , 2007 2alh21 7.69
{"no in series":{"0":23,"1":24,"2":25,"3":26,"4":27,"5":28,"6":29,"7":30,"8":31,"9":32,"10":33,"11":34,"12":35,"13":36,"14":37,"15":38,"16":39,"17":40,"18":41,"19":42,"20":43},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21},"title":{"0":"where were we","1":"the scorpion and the toad","2":"brunch","3":"ted mosby : architect","4":"world 's greatest couple","5":"aldrin justice","6":"swarley","7":"atlantic city","8":"slap bet","9":"single stamina","10":"how lily stole christmas","11":"first time in new york","12":"columns","13":"monday night football","14":"lucky penny","15":"stuff","16":"arrivederci , fiero","17":"moving day","18":"bachelor party","19":"showdown","20":"something borrowed"},"director":{"0":"pamela fryman","1":"rob greenberg","2":"pamela fryman","3":"pamela fryman","4":"pamela fryman","5":"pamela fryman","6":"pamela fryman","7":"pamela fryman","8":"pamela fryman","9":"pamela fryman","10":"pamela fryman","11":"pamela fryman","12":"rob greenberg","13":"rob greenberg","14":"pamela fryman","15":"pamela fryman","16":"pamela fryman","17":"pamela fryman","18":"pamela fryman","19":"pamela fryman","20":"pamela fryman"},"writer (s)":{"0":"carter bays & craig thomas","1":"chris harris","2":"stephen lloyd","3":"kristen newman","4":"brenda hsueh","5":"jamie rhonheimer","6":"greg malins","7":"maria ferrari","8":"kourtney kang","9":"kristen newman","10":"brenda hsueh","11":"gloria calderon kellett","12":"matt kuhn","13":"carter bays & craig thomas","14":"matt sorrentino & martynas prusevicius","15":"kourtney kang","16":"chris harris","17":"maria ferrari","18":"carter bays & craig thomas","19":"gloria calderon kellett","20":"greg malins"},"original air date":{"0":"september 18 , 2006","1":"september 25 , 2006","2":"october 2 , 2006","3":"october 9 , 2006","4":"october 16 , 2006","5":"october 23 , 2006","6":"november 6 , 2006","7":"november 13 , 2006","8":"november 20 , 2006","9":"november 27 , 2006","10":"december 11 , 2006","11":"january 8 , 2007","12":"january 22 , 2007","13":"february 5 , 2007","14":"february 12 , 2007","15":"february 19 , 2007","16":"february 26 , 2007","17":"march 19 , 2007","18":"april 9 , 2007","19":"april 30 , 2007","20":"may 7 , 2007"},"production code":{"0":"2alh01","1":"2alh02","2":"2alh03","3":"2alh04","4":"2alh06","5":"2alh05","6":"2alh07","7":"2alh08","8":"2alh09","9":"2alh10","10":"2alh11","11":"2alh12","12":"2alh13","13":"2alh14","14":"2alh15","15":"2alh16","16":"2alh17","17":"2alh18","18":"2alh19","19":"2alh20","20":"2alh21"},"us viewers (million)":{"0":10.48,"1":9.14,"2":9.32,"3":9.09,"4":9.05,"5":9.59,"6":8.22,"7":9.33,"8":8.85,"9":9.85,"10":8.81,"11":8.37,"12":9.42,"13":10.61,"14":9.68,"15":8.95,"16":9.33,"17":7.27,"18":9.9,"19":7.24,"20":7.69}}
no in series no in season title director writer (s) original air date production code us viewers (million) 0 45 1 wait for it pamela fryman carter bays & craig thomas september 24 , 2007 3alh01 8.12 1 46 2 we 're not from here pamela fryman chris harris october 1 , 2007 3alh02 7.88 2 47 3 third wheel pamela fryman david hemingson october 8 , 2007 3alh04 7.96 3 48 4 little boys rob greenberg kourtney kang october 15 , 2007 3alh03 7.71 4 49 5 how i met everyone else pamela fryman gloria calderon kellett october 22 , 2007 3alh05 8.50 5 50 6 i'm not that guy pamela fryman jonathan groff october 29 , 2007 3alh06 8.55 6 51 7 dowisetrepla pamela fryman brenda hsueh november 5 , 2007 3alh07 8.77 7 52 8 spoiler alert pamela fryman stephen lloyd november 12 , 2007 3alh08 8.58 8 53 9 slapsgiving pamela fryman matt kuhn november 19 , 2007 3alh09 8.06 9 54 10 the yips pamela fryman jamie rhonheimer november 26 , 2007 3alh10 7.91 10 55 11 the platinum rule pamela fryman carter bays & craig thomas december 10 , 2007 3alh11 8.49 11 56 12 no tomorrow pamela fryman carter bays & craig thomas march 17 , 2008 3alh12 9.73 12 57 13 ten sessions pamela fryman chris harris , carter bays & craig thomas march 24 , 2008 3alh14 10.67 13 58 14 the bracket pamela fryman joe kelly march 31 , 2008 3alh13 9.50 14 59 15 the chain of screaming pamela fryman carter bays & craig thomas april 14 , 2008 3alh15 7.99 15 60 16 sandcastles in the sand pamela fryman kourtney kang april 21 , 2008 3alh16 8.45 16 61 17 the goat pamela fryman stephen lloyd april 28 , 2008 3alh17 8.84 17 62 18 rebound bro pamela fryman jamie rhonheimer may 5 , 2008 3alh18 8.36 18 63 19 everything must go pamela fryman jonathan groff & chris harris may 12 , 2008 3alh19 8.93
{"no in series":{"0":45,"1":46,"2":47,"3":48,"4":49,"5":50,"6":51,"7":52,"8":53,"9":54,"10":55,"11":56,"12":57,"13":58,"14":59,"15":60,"16":61,"17":62,"18":63},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19},"title":{"0":"wait for it","1":"we 're not from here","2":"third wheel","3":"little boys","4":"how i met everyone else","5":"i'm not that guy","6":"dowisetrepla","7":"spoiler alert","8":"slapsgiving","9":"the yips","10":"the platinum rule","11":"no tomorrow","12":"ten sessions","13":"the bracket","14":"the chain of screaming","15":"sandcastles in the sand","16":"the goat","17":"rebound bro","18":"everything must go"},"director":{"0":"pamela fryman","1":"pamela fryman","2":"pamela fryman","3":"rob greenberg","4":"pamela fryman","5":"pamela fryman","6":"pamela fryman","7":"pamela fryman","8":"pamela fryman","9":"pamela fryman","10":"pamela fryman","11":"pamela fryman","12":"pamela fryman","13":"pamela fryman","14":"pamela fryman","15":"pamela fryman","16":"pamela fryman","17":"pamela fryman","18":"pamela fryman"},"writer (s)":{"0":"carter bays & craig thomas","1":"chris harris","2":"david hemingson","3":"kourtney kang","4":"gloria calderon kellett","5":"jonathan groff","6":"brenda hsueh","7":"stephen lloyd","8":"matt kuhn","9":"jamie rhonheimer","10":"carter bays & craig thomas","11":"carter bays & craig thomas","12":"chris harris , carter bays & craig thomas","13":"joe kelly","14":"carter bays & craig thomas","15":"kourtney kang","16":"stephen lloyd","17":"jamie rhonheimer","18":"jonathan groff & chris harris"},"original air date":{"0":"september 24 , 2007","1":"october 1 , 2007","2":"october 8 , 2007","3":"october 15 , 2007","4":"october 22 , 2007","5":"october 29 , 2007","6":"november 5 , 2007","7":"november 12 , 2007","8":"november 19 , 2007","9":"november 26 , 2007","10":"december 10 , 2007","11":"march 17 , 2008","12":"march 24 , 2008","13":"march 31 , 2008","14":"april 14 , 2008","15":"april 21 , 2008","16":"april 28 , 2008","17":"may 5 , 2008","18":"may 12 , 2008"},"production code":{"0":"3alh01","1":"3alh02","2":"3alh04","3":"3alh03","4":"3alh05","5":"3alh06","6":"3alh07","7":"3alh08","8":"3alh09","9":"3alh10","10":"3alh11","11":"3alh12","12":"3alh14","13":"3alh13","14":"3alh15","15":"3alh16","16":"3alh17","17":"3alh18","18":"3alh19"},"us viewers (million)":{"0":8.12,"1":7.88,"2":7.96,"3":7.71,"4":8.5,"5":8.55,"6":8.77,"7":8.58,"8":8.06,"9":7.91,"10":8.49,"11":9.73,"12":10.67,"13":9.5,"14":7.99,"15":8.45,"16":8.84,"17":8.36,"18":8.93}}
detailed family information from to anchor orientation conserved in mus musculus matrix sim sequence occurrence 0 cell cycle regulators : cell cycle homology element 137 149 143 + strand conserved 0.943 ggacttgaattca 1 1 gata binding factors 172 184 178 + strand conserved 0.946 taaagatttgagg 1 2 vertebrate tata binding protein factor 193 209 201 + strand conserved 0.983 tcctataaaatttggat 1 3 heat schock factors 291 315 303 + strand conserved 0.992 cacagaaacgttagaagcatctctt 4 4 human and murine ets1 factors 512 532 522 + strand conserved 0.984 taagccccggaagtacttgtt 3 5 zinc finger transcription factor ru49 , zipro1 522 528 525 + strand conserved 0.989 aagtact 2 6 krueppel like transcription factors 618 634 626 + strand conserved 0.925 tggaggggcagacaccc 1
{"detailed family information":{"0":"cell cycle regulators : cell cycle homology element","1":"gata binding factors","2":"vertebrate tata binding protein factor","3":"heat schock factors","4":"human and murine ets1 factors","5":"zinc finger transcription factor ru49 , zipro1","6":"krueppel like transcription factors"},"from":{"0":137,"1":172,"2":193,"3":291,"4":512,"5":522,"6":618},"to":{"0":149,"1":184,"2":209,"3":315,"4":532,"5":528,"6":634},"anchor":{"0":143,"1":178,"2":201,"3":303,"4":522,"5":525,"6":626},"orientation":{"0":"+ strand","1":"+ strand","2":"+ strand","3":"+ strand","4":"+ strand","5":"+ strand","6":"+ strand"},"conserved in mus musculus":{"0":"conserved","1":"conserved","2":"conserved","3":"conserved","4":"conserved","5":"conserved","6":"conserved"},"matrix sim":{"0":0.943,"1":0.946,"2":0.983,"3":0.992,"4":0.984,"5":0.989,"6":0.925},"sequence":{"0":"ggacttgaattca","1":"taaagatttgagg","2":"tcctataaaatttggat","3":"cacagaaacgttagaagcatctctt","4":"taagccccggaagtacttgtt","5":"aagtact","6":"tggaggggcagacaccc"},"occurrence":{"0":1,"1":1,"2":1,"3":4,"4":3,"5":2,"6":1}}
episode number air date guests three darts challenge musical performance 0 2 5 april 2010 aaron johnson , patsy palmer , sharleen spiteri joanna lumley sharleen spiteri - xandu 1 3 12 april 2010 katy brand , james corden , paloma faith ewan mcgregor paloma faith - upside down 2 7 10 may 2010 gok wan , yvette fielding , alphabeat sharon osbourne alphabeat - dj (i could be dancing) 3 8 17 may 2010 matthew horne , rihanna , the cast of jersey boys meat loaf the cast of jersey boys 4 9 7 june 2010 joe swash , arlene phillips , mary j blige jermaine jackson mary j blige - each tear
{"episode number":{"0":2,"1":3,"2":7,"3":8,"4":9},"air date":{"0":"5 april 2010","1":"12 april 2010","2":"10 may 2010","3":"17 may 2010","4":"7 june 2010"},"guests":{"0":"aaron johnson , patsy palmer , sharleen spiteri","1":"katy brand , james corden , paloma faith","2":"gok wan , yvette fielding , alphabeat","3":"matthew horne , rihanna , the cast of jersey boys","4":"joe swash , arlene phillips , mary j blige"},"three darts challenge":{"0":"joanna lumley","1":"ewan mcgregor","2":"sharon osbourne","3":"meat loaf","4":"jermaine jackson"},"musical performance":{"0":"sharleen spiteri - xandu","1":"paloma faith - upside down","2":"alphabeat - dj (i could be dancing)","3":"the cast of jersey boys","4":"mary j blige - each tear"}}
no in series no in season title directed by written by original air date us viewers (millions) 0 8 1 seven thirty - seven bryan cranston j roberts march 8 , 2009 1.66 1 9 2 grilled charles haid george mastras march 15 , 2009 n / a 2 10 3 bit by a dead bee terry mcdonough peter gould march 22 , 2009 1.13 3 11 4 down john dahl sam catlin march 29 , 2009 1.29 4 12 5 breakage johan renck moira walley - beckett april 5 , 2009 1.21 5 13 6 peekaboo peter medak j roberts & vince gilligan april 12 , 2009 1.41 6 14 7 negro y azul felix alcala john shiban april 19 , 2009 n / a 7 15 8 better call saul terry mcdonough peter gould april 26 , 2009 1.04 8 16 9 4 days out michelle maclaren sam catlin may 3 , 2009 n / a 9 17 10 over phil abraham moira walley - beckett may 10 , 2009 n / a 10 18 11 mandala adam bernstein george mastras may 17 , 2009 n / a 11 19 12 phoenix colin bucksey john shiban may 24 , 2009 n / a
{"no in series":{"0":8,"1":9,"2":10,"3":11,"4":12,"5":13,"6":14,"7":15,"8":16,"9":17,"10":18,"11":19},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12},"title":{"0":"seven thirty - seven","1":"grilled","2":"bit by a dead bee","3":"down","4":"breakage","5":"peekaboo","6":"negro y azul","7":"better call saul","8":"4 days out","9":"over","10":"mandala","11":"phoenix"},"directed by":{"0":"bryan cranston","1":"charles haid","2":"terry mcdonough","3":"john dahl","4":"johan renck","5":"peter medak","6":"felix alcala","7":"terry mcdonough","8":"michelle maclaren","9":"phil abraham","10":"adam bernstein","11":"colin bucksey"},"written by":{"0":"j roberts","1":"george mastras","2":"peter gould","3":"sam catlin","4":"moira walley - beckett","5":"j roberts & vince gilligan","6":"john shiban","7":"peter gould","8":"sam catlin","9":"moira walley - beckett","10":"george mastras","11":"john shiban"},"original air date":{"0":"march 8 , 2009","1":"march 15 , 2009","2":"march 22 , 2009","3":"march 29 , 2009","4":"april 5 , 2009","5":"april 12 , 2009","6":"april 19 , 2009","7":"april 26 , 2009","8":"may 3 , 2009","9":"may 10 , 2009","10":"may 17 , 2009","11":"may 24 , 2009"},"us viewers (millions)":{"0":"1.66","1":"n \/ a","2":"1.13","3":"1.29","4":"1.21","5":"1.41","6":"n \/ a","7":"1.04","8":"n \/ a","9":"n \/ a","10":"n \/ a","11":"n \/ a"}}
no in series no in season title directed by written by original air date us viewers (millions) 0 21 1 no más bryan cranston vince gilligan march 21 , 2010 1.95 1 22 2 caballo sin nombre adam bernstein peter gould march 28 , 2010 1.55 2 23 3 ift michelle maclaren george mastras april 4 , 2010 1.33 3 24 4 green light scott winant sam catlin april 11 , 2010 1.46 4 25 5 más johan renck moira walley - beckett april 18 , 2010 1.61 5 26 6 sunset john shiban john shiban april 25 , 2010 1.64 6 27 7 one minute michelle maclaren thomas schnauz may 2 , 2010 1.52 7 28 8 i see you colin bucksey gennifer hutchison may 9 , 2010 1.78 8 29 9 kafkaesque michael slovis peter gould & george mastras may 16 , 2010 1.61 9 30 10 fly rian johnson sam catlin & moira walley - beckett may 23 , 2010 1.20 10 31 11 abiquiu michelle maclaren john shiban & thomas schnauz may 30 , 2010 1.32 11 32 12 half measures adam bernstein sam catlin & peter gould june 6 , 2010 1.19
{"no in series":{"0":21,"1":22,"2":23,"3":24,"4":25,"5":26,"6":27,"7":28,"8":29,"9":30,"10":31,"11":32},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12},"title":{"0":"no más","1":"caballo sin nombre","2":"ift","3":"green light","4":"más","5":"sunset","6":"one minute","7":"i see you","8":"kafkaesque","9":"fly","10":"abiquiu","11":"half measures"},"directed by":{"0":"bryan cranston","1":"adam bernstein","2":"michelle maclaren","3":"scott winant","4":"johan renck","5":"john shiban","6":"michelle maclaren","7":"colin bucksey","8":"michael slovis","9":"rian johnson","10":"michelle maclaren","11":"adam bernstein"},"written by":{"0":"vince gilligan","1":"peter gould","2":"george mastras","3":"sam catlin","4":"moira walley - beckett","5":"john shiban","6":"thomas schnauz","7":"gennifer hutchison","8":"peter gould & george mastras","9":"sam catlin & moira walley - beckett","10":"john shiban & thomas schnauz","11":"sam catlin & peter gould"},"original air date":{"0":"march 21 , 2010","1":"march 28 , 2010","2":"april 4 , 2010","3":"april 11 , 2010","4":"april 18 , 2010","5":"april 25 , 2010","6":"may 2 , 2010","7":"may 9 , 2010","8":"may 16 , 2010","9":"may 23 , 2010","10":"may 30 , 2010","11":"june 6 , 2010"},"us viewers (millions)":{"0":1.95,"1":1.55,"2":1.33,"3":1.46,"4":1.61,"5":1.64,"6":1.52,"7":1.78,"8":1.61,"9":1.2,"10":1.32,"11":1.19}}
country skip w l pf pa ends won ends lost blank ends stolen ends shot % 0 sweden anette norberg 9 2 67 53 40 41 12 8 73% 1 china wang bingyu 8 3 64 43 44 30 14 16 82% 2 denmark lene nielsen 7 4 77 55 47 33 15 14 78% 3 canada amber holland 7 4 68 55 42 40 12 7 82% 4 switzerland mirjam ott 7 4 68 58 46 37 15 15 82% 5 russia anna sidorova 6 5 70 65 40 45 8 8 72% 6 united states patti lank 6 5 64 63 48 36 10 17 72% 7 germany andrea schöpp 5 6 61 67 40 49 12 13 78% 8 scotland anna sloan 4 7 49 69 33 43 15 6 76% 9 norway linn githmark 3 8 54 71 42 48 15 7 77% 10 czech republic anna kubešková 2 9 40 73 35 43 11 7 71%
{"country":{"0":"sweden","1":"china","2":"denmark","3":"canada","4":"switzerland","5":"russia","6":"united states","7":"germany","8":"scotland","9":"norway","10":"czech republic"},"skip":{"0":"anette norberg","1":"wang bingyu","2":"lene nielsen","3":"amber holland","4":"mirjam ott","5":"anna sidorova","6":"patti lank","7":"andrea schöpp","8":"anna sloan","9":"linn githmark","10":"anna kubešková"},"w":{"0":9,"1":8,"2":7,"3":7,"4":7,"5":6,"6":6,"7":5,"8":4,"9":3,"10":2},"l":{"0":2,"1":3,"2":4,"3":4,"4":4,"5":5,"6":5,"7":6,"8":7,"9":8,"10":9},"pf":{"0":67,"1":64,"2":77,"3":68,"4":68,"5":70,"6":64,"7":61,"8":49,"9":54,"10":40},"pa":{"0":53,"1":43,"2":55,"3":55,"4":58,"5":65,"6":63,"7":67,"8":69,"9":71,"10":73},"ends won":{"0":40,"1":44,"2":47,"3":42,"4":46,"5":40,"6":48,"7":40,"8":33,"9":42,"10":35},"ends lost":{"0":41,"1":30,"2":33,"3":40,"4":37,"5":45,"6":36,"7":49,"8":43,"9":48,"10":43},"blank ends":{"0":12,"1":14,"2":15,"3":12,"4":15,"5":8,"6":10,"7":12,"8":15,"9":15,"10":11},"stolen ends":{"0":8,"1":16,"2":14,"3":7,"4":15,"5":8,"6":17,"7":13,"8":6,"9":7,"10":7},"shot %":{"0":"73%","1":"82%","2":"78%","3":"82%","4":"82%","5":"72%","6":"72%","7":"78%","8":"76%","9":"77%","10":"71%"}}
dibrugarh kanyakumari vivek express / 15905 / 15906 indian railways 4286 km 55 weekly 82.30 hrs (~3.5 days) 0 jammutawi kanyakumari himsagar express / 6318 indian railways 3715 km 71 weekly 69 hrs 40 min (~3 days) 1 mangalore jammu navyug express / 16687 indian railways 3609 km 61 weekly 68 hrs (~3 days) 2 yeswanthpur ( bangalore ) dibrugarh dibrugarh express / 15901 indian railways 3578 km 70 weekly 68 hrs (~3 days) 3 tirunelveli jammu ten jammu express / 16787 indian railways 3561 km 70 biweekly 70 hrs (~3 days) 4 thiruvananthapuram guwahati guwahati express / 12515 indian railways 3552 km 50 weekly 65 hrs 5 dehradun kochuveli railway station ( thiruvananthapuram ) ddn kcvl sup express / 12288 indian railways 3459 km 25 weekly 61 hrs 10 mins 6 ernakulam barauni raptisagar express / 12522 indian railways 3441 km 61 weekly 62 hrs (~3 days) 7 chandigarh kochuveli railway station ( thiruvananthapuram ) keraka sampark kranti express / 12218 indian railways 3415 km 21 weekly 57 hrs 35 mins 8 guwahati ernakulam guwahati - ernakulam express / 12508 indian railways 3337 km 43 weekly 59 hrs 45 mins 9 amritsar kochuveli railway station ( thiruvananthapuram ) amritsar kochuveli express / 12484 indian railways 3296 km 22 weekly 57 hrs 10 min (~2.5 days) 10 okha rameswaram rameswaram - okha express / 16733 indian railways 3256 km 40 weekly 65 hrs 00 mins 11 thiruvananthapuram gorakhpur raptisagar express / 12512 indian railways 3248 km 60 tri - weekly 57hrs 5 mins 12 okha guwahati dwarka express / 15636 indian railways 3213 km 41 weekly 65 hrs 35 mins 13 dwarka guwahati dwarka express / 15636 indian railways 3213 km 41 weekly 65 hrs 35 mins 14 gandhidham kamakhya gimb kamakhya exp / 15667 indian railways 3111 km 33 weekly 64 hrs 45 min (~4 days) 15 dehradun madurai dehradun - madurai sf express / 12688 indian railways 3086 km 27 weekly 53 hrs 25 min (~3 days) 16 chandigarh madurai chandigarh - chennai - madurai link express / 22688 indian railways 3082 km 26 weekly 53 hrs 00 min (~3 days) 17 thiruvananthapuram new delhi thiruvananthapuram - new delhi kerala express / 12625 indian railways 3035 km 42 daily 50 hrs 25 mins (2 days) 18 dibrugarh chennai dibrugarh - chennai express / 15930 indian railways 3028 km 39 weekly 61.20 hrs (2.5 days) 19 patna ernakulam patna ernakulam exp / 16360 indian railways 2984 km 41 weekly 54h 30 m (~2. days + ) 20 kanyakumari new delhi thirukkural express / 12641 indian railways 2918 km 25 bi - weekly 46 hrs 45 mins (>2 days) 21 dibrugarh amritsar dibrugarh - amritsar express / 15933 indian railways 2853 km 33 weekly 61.50 hrs (2.5 days) 22 jammu chennai andaman express / 16032 indian railways 2798 km 77 tri - weekly 58 hrs 25 min (~2.5 days) 23 patna bangalore sanghmitra exp / 12296 indian railways 2727 km 35 daily 48 hrs 45 mins 24 bikaner kochuveli railway station ( thiruvananthapuram ) bikaner kochuveli express / 16311 indian railways 2706 km 39 weekly 54 hrs 35 mins (>2 days) 25 madurai new delhi tamil nadu sampark kranti / 12651 indian railways 2672 km 17 bi - weekly 42 hrs 5 mins (<2 days) 26 gandhidham nagercoil gandhidham exp / 16336 indian railways 2649 km 44 daily 48 hrs 50 mins (~2 days) 27 dibrugarh chandigarh dibrugarh - chandigarh express / 15903 indian railways 2597 km 31 weekly 51.50 hrs (>2 days) 28 amritsar visakhapatnam hirakud express / 18508 indian railways 2579 km 46 tri - weekly 48 hrs 5 min (2 days) 29 guwahati lalgarh junction (sujangarh , rajasthan) awadh - assam express / 15609 indian railways 2557 km 70 daily 56 hrs 15 mins 30 guwahati secunderabad railway station guwahati - secunderabad express / 12514 indian railways 2553.3 km 30 weekly 45 hrs 50 mins (3 days) 31 bikaner coimbatore bikaner - coimbatore exp / 22475 indian railways 2486 km 32 weekly 45 hrs 5 mins (~2 days) 32 barmer guwahati barmer - guwahati exp / 15631 indian railways 2453 km 29 bi - weekly 48 hrs 35 mins (~2 days) 33 puri jodhpur puri - jodhpur exp / 18473 indian railways 2434 km 39 weekly 46 hrs 30 mins (~2 days) 34 haridwar puri kalinga utkal exp / 18478 indian railways 2378 km 70 daily 49 hrs (~2 days) 35 jammu tavi guwahati lohit express / 15651 indian railways 2343 km 40 weekly 47 hrs 15 min (~3 days) 36 asansol bhavnagar parasnath exp / 12942 indian railways 2321 km 27 weekly 39 hrs 45 min (~1.6 days) 37 gandhidham puri gandhidham - puri sf express / 12993 indian railways 2286 km 25 weekly 41 hrs 30 min (~3 days) 38 korba thiruvananthapuram korba - thiruvananthapuram exp / 16327 indian railways 2276 km 46 bi - weekly 41 hrs (1.7 days)
{"dibrugarh":{"0":"jammutawi","1":"mangalore","2":"yeswanthpur ( bangalore )","3":"tirunelveli","4":"thiruvananthapuram","5":"dehradun","6":"ernakulam","7":"chandigarh","8":"guwahati","9":"amritsar","10":"okha","11":"thiruvananthapuram","12":"okha","13":"dwarka","14":"gandhidham","15":"dehradun","16":"chandigarh","17":"thiruvananthapuram","18":"dibrugarh","19":"patna","20":"kanyakumari","21":"dibrugarh","22":"jammu","23":"patna","24":"bikaner","25":"madurai","26":"gandhidham","27":"dibrugarh","28":"amritsar","29":"guwahati","30":"guwahati","31":"bikaner","32":"barmer","33":"puri","34":"haridwar","35":"jammu tavi","36":"asansol","37":"gandhidham","38":"korba"},"kanyakumari":{"0":"kanyakumari","1":"jammu","2":"dibrugarh","3":"jammu","4":"guwahati","5":"kochuveli railway station ( thiruvananthapuram )","6":"barauni","7":"kochuveli railway station ( thiruvananthapuram )","8":"ernakulam","9":"kochuveli railway station ( thiruvananthapuram )","10":"rameswaram","11":"gorakhpur","12":"guwahati","13":"guwahati","14":"kamakhya","15":"madurai","16":"madurai","17":"new delhi","18":"chennai","19":"ernakulam","20":"new delhi","21":"amritsar","22":"chennai","23":"bangalore","24":"kochuveli railway station ( thiruvananthapuram )","25":"new delhi","26":"nagercoil","27":"chandigarh","28":"visakhapatnam","29":"lalgarh junction (sujangarh , rajasthan)","30":"secunderabad railway station","31":"coimbatore","32":"guwahati","33":"jodhpur","34":"puri","35":"guwahati","36":"bhavnagar","37":"puri","38":"thiruvananthapuram"},"vivek express \/ 15905 \/ 15906":{"0":"himsagar express \/ 6318","1":"navyug express \/ 16687","2":"dibrugarh express \/ 15901","3":"ten jammu express \/ 16787","4":"guwahati express \/ 12515","5":"ddn kcvl sup express \/ 12288","6":"raptisagar express \/ 12522","7":"keraka sampark kranti express \/ 12218","8":"guwahati - ernakulam express \/ 12508","9":"amritsar kochuveli express \/ 12484","10":"rameswaram - okha express \/ 16733","11":"raptisagar express \/ 12512","12":"dwarka express \/ 15636","13":"dwarka express \/ 15636","14":"gimb kamakhya exp \/ 15667","15":"dehradun - madurai sf express \/ 12688","16":"chandigarh - chennai - madurai link express \/ 22688","17":"thiruvananthapuram - new delhi kerala express \/ 12625","18":"dibrugarh - chennai express \/ 15930","19":"patna ernakulam exp \/ 16360","20":"thirukkural express \/ 12641","21":"dibrugarh - amritsar express \/ 15933","22":"andaman express \/ 16032","23":"sanghmitra exp \/ 12296","24":"bikaner kochuveli express \/ 16311","25":"tamil nadu sampark kranti \/ 12651","26":"gandhidham exp \/ 16336","27":"dibrugarh - chandigarh express \/ 15903","28":"hirakud express \/ 18508","29":"awadh - assam express \/ 15609","30":"guwahati - secunderabad express \/ 12514","31":"bikaner - coimbatore exp \/ 22475","32":"barmer - guwahati exp \/ 15631","33":"puri - jodhpur exp \/ 18473","34":"kalinga utkal exp \/ 18478","35":"lohit express \/ 15651","36":"parasnath exp \/ 12942","37":"gandhidham - puri sf express \/ 12993","38":"korba - thiruvananthapuram exp \/ 16327"},"indian railways":{"0":"indian railways","1":"indian railways","2":"indian railways","3":"indian railways","4":"indian railways","5":"indian railways","6":"indian railways","7":"indian railways","8":"indian railways","9":"indian railways","10":"indian railways","11":"indian railways","12":"indian railways","13":"indian railways","14":"indian railways","15":"indian railways","16":"indian railways","17":"indian railways","18":"indian railways","19":"indian railways","20":"indian railways","21":"indian railways","22":"indian railways","23":"indian railways","24":"indian railways","25":"indian railways","26":"indian railways","27":"indian railways","28":"indian railways","29":"indian railways","30":"indian railways","31":"indian railways","32":"indian railways","33":"indian railways","34":"indian railways","35":"indian railways","36":"indian railways","37":"indian railways","38":"indian railways"},"4286 km":{"0":"3715 km","1":"3609 km","2":"3578 km","3":"3561 km","4":"3552 km","5":"3459 km","6":"3441 km","7":"3415 km","8":"3337 km","9":"3296 km","10":"3256 km","11":"3248 km","12":"3213 km","13":"3213 km","14":"3111 km","15":"3086 km","16":"3082 km","17":"3035 km","18":"3028 km","19":"2984 km","20":"2918 km","21":"2853 km","22":"2798 km","23":"2727 km","24":"2706 km","25":"2672 km","26":"2649 km","27":"2597 km","28":"2579 km","29":"2557 km","30":"2553.3 km","31":"2486 km","32":"2453 km","33":"2434 km","34":"2378 km","35":"2343 km","36":"2321 km","37":"2286 km","38":"2276 km"},"55":{"0":71,"1":61,"2":70,"3":70,"4":50,"5":25,"6":61,"7":21,"8":43,"9":22,"10":40,"11":60,"12":41,"13":41,"14":33,"15":27,"16":26,"17":42,"18":39,"19":41,"20":25,"21":33,"22":77,"23":35,"24":39,"25":17,"26":44,"27":31,"28":46,"29":70,"30":30,"31":32,"32":29,"33":39,"34":70,"35":40,"36":27,"37":25,"38":46},"weekly":{"0":"weekly","1":"weekly","2":"weekly","3":"biweekly","4":"weekly","5":"weekly","6":"weekly","7":"weekly","8":"weekly","9":"weekly","10":"weekly","11":"tri - weekly","12":"weekly","13":"weekly","14":"weekly","15":"weekly","16":"weekly","17":"daily","18":"weekly","19":"weekly","20":"bi - weekly","21":"weekly","22":"tri - weekly","23":"daily","24":"weekly","25":"bi - weekly","26":"daily","27":"weekly","28":"tri - weekly","29":"daily","30":"weekly","31":"weekly","32":"bi - weekly","33":"weekly","34":"daily","35":"weekly","36":"weekly","37":"weekly","38":"bi - weekly"},"82.30 hrs (~3.5 days)":{"0":"69 hrs 40 min (~3 days)","1":"68 hrs (~3 days)","2":"68 hrs (~3 days)","3":"70 hrs (~3 days)","4":"65 hrs","5":"61 hrs 10 mins","6":"62 hrs (~3 days)","7":"57 hrs 35 mins","8":"59 hrs 45 mins","9":"57 hrs 10 min (~2.5 days)","10":"65 hrs 00 mins","11":"57hrs 5 mins","12":"65 hrs 35 mins","13":"65 hrs 35 mins","14":"64 hrs 45 min (~4 days)","15":"53 hrs 25 min (~3 days)","16":"53 hrs 00 min (~3 days)","17":"50 hrs 25 mins (2 days)","18":"61.20 hrs (2.5 days)","19":"54h 30 m (~2. days + )","20":"46 hrs 45 mins (>2 days)","21":"61.50 hrs (2.5 days)","22":"58 hrs 25 min (~2.5 days)","23":"48 hrs 45 mins","24":"54 hrs 35 mins (>2 days)","25":"42 hrs 5 mins (<2 days)","26":"48 hrs 50 mins (~2 days)","27":"51.50 hrs (>2 days)","28":"48 hrs 5 min (2 days)","29":"56 hrs 15 mins","30":"45 hrs 50 mins (3 days)","31":"45 hrs 5 mins (~2 days)","32":"48 hrs 35 mins (~2 days)","33":"46 hrs 30 mins (~2 days)","34":"49 hrs (~2 days)","35":"47 hrs 15 min (~3 days)","36":"39 hrs 45 min (~1.6 days)","37":"41 hrs 30 min (~3 days)","38":"41 hrs (1.7 days)"}}
no in series no in season title directed by written by original air date us viewers (in millions) 0 44 1 reversals of fortune j miller tobin joshua safran september 14 , 2009 2.55 1 45 2 the freshman norman buckley amanda lasher september 21 , 2009 1.97 2 46 3 the lost boy jean de segonzac robert hull september 28 , 2009 2.36 3 47 4 dan de fleurette mark piznarski john stephens october 5 , 2009 2.08 4 48 5 rufus getting married ron fortunato leila gerstein october 12 , 2009 2.36 5 49 6 enough about eve john stephens jake coburn october 19 , 2009 1.98 6 50 7 how to succeed in bassness joe lazarov sara goodman october 26 , 2009 2.31 7 51 8 the grandfather : part ii mark piznarski lenn k rosenfeld november 2 , 2009 1.98 8 52 9 they shoot humphreys , don't they alison maclean amanda lasher november 9 , 2009 2.37 9 53 10 the last days of disco stick tony wharmby leila gerstein november 16 , 2009 2.24 10 54 11 the treasure of serena madre mark piznarski robert hull & joshua safran november 30 , 2009 2.23 11 55 12 the debarted jason ensler stephanie savage december 7 , 2009 2.21 12 56 13 the hurt locket tony wharmby sara goodman march 8 , 2010 1.74 13 57 14 the lady vanished andrew mccarthy amanda lasher & robert hull march 15 , 2010 1.73 14 58 15 the sixteen year old virgin wendey stanzler leila gerstein march 22 , 2010 1.90 15 59 16 the empire strikes jack joe lazarov jake coburn march 29 , 2010 1.69 16 60 17 inglourious bassterds jean de segonzac lenn k rosenfeld april 5 , 2010 1.74 17 61 18 the unblairable lightness of being janice cooke - leonard jeanne leitenberg april 12 , 2010 1.86 18 62 19 dr estrangeloved darnell martin robert hull april 26 , 2010 2.05 19 63 20 it™s a dad , dad , dad , dad world jeremiah chechik amanda lasher may 3 , 2010 1.74 20 64 21 ex - husbands and wives norman buckley sara goodman may 10 , 2010 1.79
{"no in series":{"0":44,"1":45,"2":46,"3":47,"4":48,"5":49,"6":50,"7":51,"8":52,"9":53,"10":54,"11":55,"12":56,"13":57,"14":58,"15":59,"16":60,"17":61,"18":62,"19":63,"20":64},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21},"title":{"0":"reversals of fortune","1":"the freshman","2":"the lost boy","3":"dan de fleurette","4":"rufus getting married","5":"enough about eve","6":"how to succeed in bassness","7":"the grandfather : part ii","8":"they shoot humphreys , don't they","9":"the last days of disco stick","10":"the treasure of serena madre","11":"the debarted","12":"the hurt locket","13":"the lady vanished","14":"the sixteen year old virgin","15":"the empire strikes jack","16":"inglourious bassterds","17":"the unblairable lightness of being","18":"dr estrangeloved","19":"it™s a dad , dad , dad , dad world","20":"ex - husbands and wives"},"directed by":{"0":"j miller tobin","1":"norman buckley","2":"jean de segonzac","3":"mark piznarski","4":"ron fortunato","5":"john stephens","6":"joe lazarov","7":"mark piznarski","8":"alison maclean","9":"tony wharmby","10":"mark piznarski","11":"jason ensler","12":"tony wharmby","13":"andrew mccarthy","14":"wendey stanzler","15":"joe lazarov","16":"jean de segonzac","17":"janice cooke - leonard","18":"darnell martin","19":"jeremiah chechik","20":"norman buckley"},"written by":{"0":"joshua safran","1":"amanda lasher","2":"robert hull","3":"john stephens","4":"leila gerstein","5":"jake coburn","6":"sara goodman","7":"lenn k rosenfeld","8":"amanda lasher","9":"leila gerstein","10":"robert hull & joshua safran","11":"stephanie savage","12":"sara goodman","13":"amanda lasher & robert hull","14":"leila gerstein","15":"jake coburn","16":"lenn k rosenfeld","17":"jeanne leitenberg","18":"robert hull","19":"amanda lasher","20":"sara goodman"},"original air date":{"0":"september 14 , 2009","1":"september 21 , 2009","2":"september 28 , 2009","3":"october 5 , 2009","4":"october 12 , 2009","5":"october 19 , 2009","6":"october 26 , 2009","7":"november 2 , 2009","8":"november 9 , 2009","9":"november 16 , 2009","10":"november 30 , 2009","11":"december 7 , 2009","12":"march 8 , 2010","13":"march 15 , 2010","14":"march 22 , 2010","15":"march 29 , 2010","16":"april 5 , 2010","17":"april 12 , 2010","18":"april 26 , 2010","19":"may 3 , 2010","20":"may 10 , 2010"},"us viewers (in millions)":{"0":2.55,"1":1.97,"2":2.36,"3":2.08,"4":2.36,"5":1.98,"6":2.31,"7":1.98,"8":2.37,"9":2.24,"10":2.23,"11":2.21,"12":1.74,"13":1.73,"14":1.9,"15":1.69,"16":1.74,"17":1.86,"18":2.05,"19":1.74,"20":1.79}}
proto - slavic russian ukrainian belarusian polish czech slovak slovene serbo - croatian bulgarian macedonian 0 uxo (ear) ухо (úkho) вухо (vúkho) вуха (vúkha) ucho ucho ucho uho уво / uvo , uho ухо (ukhó) уво (úvo) 1 ognь (fire) огонь (ogónʹ) вогонь (vohónʹ) агонь (ahónʹ) ogień oheň oheň ogenj огањ / oganj огън (ógǎn) оган / огин (ógan / ógin) 2 ryba (fish) рыба (rýba) риба (rýba) рыба (rýba) ryba ryba ryba riba риба / riba риба (ríba) риба (ríba) 3 gnězdo (nest) гнездо (gnezdó) гнiздо (hnizdó) гняздо (hnyazdó) gniazdo hnízdo hniezdo gnezdo гн (иј) ездо / gn (ij) ezdo гнездо (gnezdó) гнездо (gnézdo) 4 oko (eye) око (óko) (dated , poetic) око (óko) вока (vóka) oko oko oko oko око / oko око (óko) око (óko) 5 golva (head) голова (golová) голова (holová) галава (halavá) głowa hlava hlava glava глава / glava глава (glavá) глава (gláva) 6 rǫka (hand) рука (ruká) рука (ruká) рука (ruká) ręka ruka ruka roka рука / ruka ръка (rǎká) рака (ráka)
{"proto - slavic":{"0":"uxo (ear)","1":"ognь (fire)","2":"ryba (fish)","3":"gnězdo (nest)","4":"oko (eye)","5":"golva (head)","6":"rǫka (hand)"},"russian":{"0":"ухо (úkho)","1":"огонь (ogónʹ)","2":"рыба (rýba)","3":"гнездо (gnezdó)","4":"око (óko) (dated , poetic)","5":"голова (golová)","6":"рука (ruká)"},"ukrainian":{"0":"вухо (vúkho)","1":"вогонь (vohónʹ)","2":"риба (rýba)","3":"гнiздо (hnizdó)","4":"око (óko)","5":"голова (holová)","6":"рука (ruká)"},"belarusian":{"0":"вуха (vúkha)","1":"агонь (ahónʹ)","2":"рыба (rýba)","3":"гняздо (hnyazdó)","4":"вока (vóka)","5":"галава (halavá)","6":"рука (ruká)"},"polish":{"0":"ucho","1":"ogień","2":"ryba","3":"gniazdo","4":"oko","5":"głowa","6":"ręka"},"czech":{"0":"ucho","1":"oheň","2":"ryba","3":"hnízdo","4":"oko","5":"hlava","6":"ruka"},"slovak":{"0":"ucho","1":"oheň","2":"ryba","3":"hniezdo","4":"oko","5":"hlava","6":"ruka"},"slovene":{"0":"uho","1":"ogenj","2":"riba","3":"gnezdo","4":"oko","5":"glava","6":"roka"},"serbo - croatian":{"0":"уво \/ uvo , uho","1":"огањ \/ oganj","2":"риба \/ riba","3":"гн (иј) ездо \/ gn (ij) ezdo","4":"око \/ oko","5":"глава \/ glava","6":"рука \/ ruka"},"bulgarian":{"0":"ухо (ukhó)","1":"огън (ógǎn)","2":"риба (ríba)","3":"гнездо (gnezdó)","4":"око (óko)","5":"глава (glavá)","6":"ръка (rǎká)"},"macedonian":{"0":"уво (úvo)","1":"оган \/ огин (ógan \/ ógin)","2":"риба (ríba)","3":"гнездо (gnézdo)","4":"око (óko)","5":"глава (gláva)","6":"рака (ráka)"}}
district municipalities served judge of probate judges residence location of court 0 1 hartford robert k killian , jr (d) hartford hartford 1 2 west hartford sydney w elkin (d) west hartford west hartford 2 4 east windsor , south windsor , windsor marianne lassman fisher (d) south windsor south windsor 3 5 east hartford allan t driscoll (d) east hartford east hartford 4 6 glastonbury , hebron peter jay alter (d) south glastonbury (glastonbury) glastonbury 5 7 newington , rocky hill , wethersfield robert randich (d) newington newington 6 8 berlin , new britain walter a clebowicz (d) new britain new britain 7 9 avon , canton , granby , simsbury cynthia c becker (r) avon simsbury 8 10 burlington , farmington evelyn m daly (d) farmington farmington 9 11 enfield , somers , stafford timothy r keeney (r) somersville (somers) enfield 10 12 ellington , vernon james purnell , iii (r) vernon vernon 11 13 andover , bolton , columbia , manchester michael m darby (d) manchester manchester 12 15 cromwell , durham , middlefield , middletown joseph d marino (d) middletown middletown 13 16 meriden brian t mahon (d) meriden meriden 14 17 wallingford philip a wright , jr (d) wallingford wallingford 15 18 cheshire , southington matthew j jalowiec (r) cheshire cheshire 16 19 bristol , plainfield , plymouth andre d dorval (d) bristol bristol 17 20 waterbury , wolcott thomas p brunnock (d) waterbury waterbury 18 21 beacon falls , naugatuck , middlebury , prospect peter e mariano (r) naugatuck naugatuck 19 25 coventry , mansfield , tolland , willington claire c twerdy (d) coventry tolland 20 27 canterbury , killingly , plainfield , sterling david a griffiths (d) danielson (killingly) plainfield 21 30 groton , ledyard , north stonington , stonington nicholas kepple (d) stonington groton 22 31 new london , waterford mathew h greene (d) new london new london 23 32 east lyme , montville , old lyme , salem jeffrey a mcnamara (r) east lyme niantic (east lyme) 24 34 guilford , madison joel e helander (r) guilford madison 25 35 branford , north branford frank j forgione (r) northford (north branford) branford 26 36 east haven , north haven michael r brandt (r) north haven east haven 27 37 bethany , hamden salvatore l diglio (d) hamden hamden 28 38 new haven john a keyes (d) new haven new haven 29 39 west haven mark j degennaro (d) west haven west haven 30 40 milford , orange beverly streit - kefalas (d) milford milford 31 41 ansonia , derby , seymour , woodbridge clifford d hoyle (d) ansonia ansonia 32 42 shelton fred j anthony (r) shelton shelton 33 43 danbury dianne e yamin (r) danbury danbury 34 45 bethel , newtown , ridgefield , redding joseph a egan , jr (r) ridgefield bethel 35 46 easton , monroe , trumbull john p chiota (r) trumbull trumbull 36 47 stratford f paul kurmay (r) stratford stratford 37 48 bridgeport paul j ganim (d) bridgeport bridgeport 38 49 fairfield daniel f caruso (r) fairfiled fairfield 39 50 weston , westport kevin m o'grady (d) weston westport 40 51 norwalk , wilton anthony j depanfilis (r) westport norwalk 41 52 darien , new canaan michael p murray (r) darien darien 42 53 stamford gerald m fox , jr (d) stamford stamford
{"district":{"0":1,"1":2,"2":4,"3":5,"4":6,"5":7,"6":8,"7":9,"8":10,"9":11,"10":12,"11":13,"12":15,"13":16,"14":17,"15":18,"16":19,"17":20,"18":21,"19":25,"20":27,"21":30,"22":31,"23":32,"24":34,"25":35,"26":36,"27":37,"28":38,"29":39,"30":40,"31":41,"32":42,"33":43,"34":45,"35":46,"36":47,"37":48,"38":49,"39":50,"40":51,"41":52,"42":53},"municipalities served":{"0":"hartford","1":"west hartford","2":"east windsor , south windsor , windsor","3":"east hartford","4":"glastonbury , hebron","5":"newington , rocky hill , wethersfield","6":"berlin , new britain","7":"avon , canton , granby , simsbury","8":"burlington , farmington","9":"enfield , somers , stafford","10":"ellington , vernon","11":"andover , bolton , columbia , manchester","12":"cromwell , durham , middlefield , middletown","13":"meriden","14":"wallingford","15":"cheshire , southington","16":"bristol , plainfield , plymouth","17":"waterbury , wolcott","18":"beacon falls , naugatuck , middlebury , prospect","19":"coventry , mansfield , tolland , willington","20":"canterbury , killingly , plainfield , sterling","21":"groton , ledyard , north stonington , stonington","22":"new london , waterford","23":"east lyme , montville , old lyme , salem","24":"guilford , madison","25":"branford , north branford","26":"east haven , north haven","27":"bethany , hamden","28":"new haven","29":"west haven","30":"milford , orange","31":"ansonia , derby , seymour , woodbridge","32":"shelton","33":"danbury","34":"bethel , newtown , ridgefield , redding","35":"easton , monroe , trumbull","36":"stratford","37":"bridgeport","38":"fairfield","39":"weston , westport","40":"norwalk , wilton","41":"darien , new canaan","42":"stamford"},"judge of probate":{"0":"robert k killian , jr (d)","1":"sydney w elkin (d)","2":"marianne lassman fisher (d)","3":"allan t driscoll (d)","4":"peter jay alter (d)","5":"robert randich (d)","6":"walter a clebowicz (d)","7":"cynthia c becker (r)","8":"evelyn m daly (d)","9":"timothy r keeney (r)","10":"james purnell , iii (r)","11":"michael m darby (d)","12":"joseph d marino (d)","13":"brian t mahon (d)","14":"philip a wright , jr (d)","15":"matthew j jalowiec (r)","16":"andre d dorval (d)","17":"thomas p brunnock (d)","18":"peter e mariano (r)","19":"claire c twerdy (d)","20":"david a griffiths (d)","21":"nicholas kepple (d)","22":"mathew h greene (d)","23":"jeffrey a mcnamara (r)","24":"joel e helander (r)","25":"frank j forgione (r)","26":"michael r brandt (r)","27":"salvatore l diglio (d)","28":"john a keyes (d)","29":"mark j degennaro (d)","30":"beverly streit - kefalas (d)","31":"clifford d hoyle (d)","32":"fred j anthony (r)","33":"dianne e yamin (r)","34":"joseph a egan , jr (r)","35":"john p chiota (r)","36":"f paul kurmay (r)","37":"paul j ganim (d)","38":"daniel f caruso (r)","39":"kevin m o'grady (d)","40":"anthony j depanfilis (r)","41":"michael p murray (r)","42":"gerald m fox , jr (d)"},"judges residence":{"0":"hartford","1":"west hartford","2":"south windsor","3":"east hartford","4":"south glastonbury (glastonbury)","5":"newington","6":"new britain","7":"avon","8":"farmington","9":"somersville (somers)","10":"vernon","11":"manchester","12":"middletown","13":"meriden","14":"wallingford","15":"cheshire","16":"bristol","17":"waterbury","18":"naugatuck","19":"coventry","20":"danielson (killingly)","21":"stonington","22":"new london","23":"east lyme","24":"guilford","25":"northford (north branford)","26":"north haven","27":"hamden","28":"new haven","29":"west haven","30":"milford","31":"ansonia","32":"shelton","33":"danbury","34":"ridgefield","35":"trumbull","36":"stratford","37":"bridgeport","38":"fairfiled","39":"weston","40":"westport","41":"darien","42":"stamford"},"location of court":{"0":"hartford","1":"west hartford","2":"south windsor","3":"east hartford","4":"glastonbury","5":"newington","6":"new britain","7":"simsbury","8":"farmington","9":"enfield","10":"vernon","11":"manchester","12":"middletown","13":"meriden","14":"wallingford","15":"cheshire","16":"bristol","17":"waterbury","18":"naugatuck","19":"tolland","20":"plainfield","21":"groton","22":"new london","23":"niantic (east lyme)","24":"madison","25":"branford","26":"east haven","27":"hamden","28":"new haven","29":"west haven","30":"milford","31":"ansonia","32":"shelton","33":"danbury","34":"bethel","35":"trumbull","36":"stratford","37":"bridgeport","38":"fairfield","39":"westport","40":"norwalk","41":"darien","42":"stamford"}}
electoral district registered voters seats in congress candidates per party participating parties total candidates 0 amazonas 179331 2 3 17 47 1 ancash 611881 5 5 21 99 2 apurímac 195954 2 3 21 55 3 arequipa 770535 5 5 21 101 4 ayacucho 306662 3 3 20 58 5 cajamarca 721239 5 5 23 109 6 callao 541730 4 4 24 92 7 cusco 643629 5 5 22 98 8 huancavelica 203844 2 3 15 39 9 huánuco 354416 3 3 22 65 10 ica 451197 4 5 22 88 11 junín 701190 5 5 22 99 12 la libertad 942656 7 7 22 145 13 lambayeque 676735 5 5 22 101 14 lima 6063109 35 35 24 738 15 loreto 416419 3 3 22 60 16 madre de dios 47742 1 3 14 35 17 moquegua 99962 2 3 18 44 18 pasco 135670 2 3 17 51 19 piura 914912 6 6 23 136 20 puno 674865 5 5 23 106 21 san martín 357124 3 3 17 47 22 tacna 172427 2 3 18 57 23 tumbes 110335 2 3 19 57 24 ucayali 201342 2 3 22 60
{"electoral district":{"0":"amazonas","1":"ancash","2":"apurímac","3":"arequipa","4":"ayacucho","5":"cajamarca","6":"callao","7":"cusco","8":"huancavelica","9":"huánuco","10":"ica","11":"junín","12":"la libertad","13":"lambayeque","14":"lima","15":"loreto","16":"madre de dios","17":"moquegua","18":"pasco","19":"piura","20":"puno","21":"san martín","22":"tacna","23":"tumbes","24":"ucayali"},"registered voters":{"0":179331,"1":611881,"2":195954,"3":770535,"4":306662,"5":721239,"6":541730,"7":643629,"8":203844,"9":354416,"10":451197,"11":701190,"12":942656,"13":676735,"14":6063109,"15":416419,"16":47742,"17":99962,"18":135670,"19":914912,"20":674865,"21":357124,"22":172427,"23":110335,"24":201342},"seats in congress":{"0":2,"1":5,"2":2,"3":5,"4":3,"5":5,"6":4,"7":5,"8":2,"9":3,"10":4,"11":5,"12":7,"13":5,"14":35,"15":3,"16":1,"17":2,"18":2,"19":6,"20":5,"21":3,"22":2,"23":2,"24":2},"candidates per party":{"0":3,"1":5,"2":3,"3":5,"4":3,"5":5,"6":4,"7":5,"8":3,"9":3,"10":5,"11":5,"12":7,"13":5,"14":35,"15":3,"16":3,"17":3,"18":3,"19":6,"20":5,"21":3,"22":3,"23":3,"24":3},"participating parties":{"0":17,"1":21,"2":21,"3":21,"4":20,"5":23,"6":24,"7":22,"8":15,"9":22,"10":22,"11":22,"12":22,"13":22,"14":24,"15":22,"16":14,"17":18,"18":17,"19":23,"20":23,"21":17,"22":18,"23":19,"24":22},"total candidates":{"0":47,"1":99,"2":55,"3":101,"4":58,"5":109,"6":92,"7":98,"8":39,"9":65,"10":88,"11":99,"12":145,"13":101,"14":738,"15":60,"16":35,"17":44,"18":51,"19":136,"20":106,"21":47,"22":57,"23":57,"24":60}}
pick player position nationality nhl team college / junior / club team 0 1 brian lawton centre united states minnesota north stars mount st charles academy (ushs - ri) 1 2 sylvain turgeon left wing canada hartford whalers hull olympiques ( qmjhl ) 2 3 pat lafontaine centre united states new york islanders verdun juniors (qmjhl) 3 4 steve yzerman centre canada detroit red wings peterborough petes ( ohl ) 4 5 tom barrasso goaltender united states buffalo sabres acton - boxboro high school (ushs - ma) 5 6 john maclean right wing canada new jersey devils oshawa generals (ohl) 6 7 russ courtnall centre canada toronto maple leafs victoria cougars ( whl ) 7 8 andrew mcbain right wing canada winnipeg jets north bay centennials (ohl) 8 9 cam neely right wing canada vancouver canucks portland winter hawks (whl) 9 10 normand lacombe right wing canada buffalo sabres university of new hampshire ( hockey east ) 10 11 adam creighton centre canada buffalo sabres ottawa 67 's (ohl) 11 12 dave gagner centre canada new york rangers brantford alexanders (ohl) 12 13 dan quinn centre canada calgary flames belleville bulls (ohl) 13 14 bobby dollas defence canada winnipeg jets laval voisins (qmjhl) 14 15 bob errey left wing canada pittsburgh penguins peterborough petes (ohl) 15 16 gerald diduck defence canada new york islanders lethbridge broncos (whl) 16 17 alfie turcotte centre united states montreal canadiens portland winter hawks (whl) 17 18 bruce cassidy defence canada chicago black hawks ottawa 67 's (ohl) 18 19 jeff beukeboom defence canada edmonton oilers sault ste marie greyhounds (ohl) 19 20 david jensen centre united states hartford whalers lawrence academy (ushs - ma) 20 21 nevin markwart left wing canada boston bruins regina pats (whl)
{"pick":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21},"player":{"0":"brian lawton","1":"sylvain turgeon","2":"pat lafontaine","3":"steve yzerman","4":"tom barrasso","5":"john maclean","6":"russ courtnall","7":"andrew mcbain","8":"cam neely","9":"normand lacombe","10":"adam creighton","11":"dave gagner","12":"dan quinn","13":"bobby dollas","14":"bob errey","15":"gerald diduck","16":"alfie turcotte","17":"bruce cassidy","18":"jeff beukeboom","19":"david jensen","20":"nevin markwart"},"position":{"0":"centre","1":"left wing","2":"centre","3":"centre","4":"goaltender","5":"right wing","6":"centre","7":"right wing","8":"right wing","9":"right wing","10":"centre","11":"centre","12":"centre","13":"defence","14":"left wing","15":"defence","16":"centre","17":"defence","18":"defence","19":"centre","20":"left wing"},"nationality":{"0":"united states","1":"canada","2":"united states","3":"canada","4":"united states","5":"canada","6":"canada","7":"canada","8":"canada","9":"canada","10":"canada","11":"canada","12":"canada","13":"canada","14":"canada","15":"canada","16":"united states","17":"canada","18":"canada","19":"united states","20":"canada"},"nhl team":{"0":"minnesota north stars","1":"hartford whalers","2":"new york islanders","3":"detroit red wings","4":"buffalo sabres","5":"new jersey devils","6":"toronto maple leafs","7":"winnipeg jets","8":"vancouver canucks","9":"buffalo sabres","10":"buffalo sabres","11":"new york rangers","12":"calgary flames","13":"winnipeg jets","14":"pittsburgh penguins","15":"new york islanders","16":"montreal canadiens","17":"chicago black hawks","18":"edmonton oilers","19":"hartford whalers","20":"boston bruins"},"college \/ junior \/ club team":{"0":"mount st charles academy (ushs - ri)","1":"hull olympiques ( qmjhl )","2":"verdun juniors (qmjhl)","3":"peterborough petes ( ohl )","4":"acton - boxboro high school (ushs - ma)","5":"oshawa generals (ohl)","6":"victoria cougars ( whl )","7":"north bay centennials (ohl)","8":"portland winter hawks (whl)","9":"university of new hampshire ( hockey east )","10":"ottawa 67 's (ohl)","11":"brantford alexanders (ohl)","12":"belleville bulls (ohl)","13":"laval voisins (qmjhl)","14":"peterborough petes (ohl)","15":"lethbridge broncos (whl)","16":"portland winter hawks (whl)","17":"ottawa 67 's (ohl)","18":"sault ste marie greyhounds (ohl)","19":"lawrence academy (ushs - ma)","20":"regina pats (whl)"}}
pick player position nationality nhl team college / junior / club team 0 183 alex haidy right wing canada pittsburgh penguins sault ste marie greyhounds (ohl) 1 184 greg rolston right wing united states toronto maple leafs powers high school (ushs - mi) 2 185 aleksandr chernykh centre soviet union new jersey devils voskresensk (ussr) 3 186 stu grimson left wing canada detroit red wings regina pats (whl) 4 187 thomas ahlen defence sweden los angeles kings skellefteã aik (sweden) 5 188 brian ross defence canada toronto maple leafs kitchener rangers (ohl) 6 189 kory wright right wing united states winnipeg jets dubuque fighting saints (ushl) 7 190 roger grillo defence united states vancouver canucks university of maine (ecac) 8 191 tom pratt defence united states calgary flames kimball union academy (ushs - nh) 9 192 scott shaunessy defence united states quebec nordiques st john 's school (ushs - ma) 10 193 reine karlsson left wing sweden hartford whalers sodertalje (sweden) 11 194 mark ferner defence canada buffalo sabres kamloops blazers (whl) 12 195 yves beaudoin defence canada washington capitals shawinigan cataractes (qmjhl) 13 196 milos riha left wing czechoslovakia minnesota north stars vitkovice (czechoslovakia) 14 197 dave shellington left wing canada new york islanders cornwall royals (ohl) 15 198 thomas rundqvist left wing sweden montreal canadiens karlstad (sweden) 16 199 dominik hasek goaltender czechoslovakia chicago black hawks pardubice (czechoslovakia) 17 200 warren yadlowski centre canada edmonton oilers calgary wranglers (whl) 18 201 bill mccormack centre united states philadelphia flyers westminster school (ushs - ct) 19 202 paul fitzsimmons defence united states boston bruins northeastern university (ecac)
{"pick":{"0":183,"1":184,"2":185,"3":186,"4":187,"5":188,"6":189,"7":190,"8":191,"9":192,"10":193,"11":194,"12":195,"13":196,"14":197,"15":198,"16":199,"17":200,"18":201,"19":202},"player":{"0":"alex haidy","1":"greg rolston","2":"aleksandr chernykh","3":"stu grimson","4":"thomas ahlen","5":"brian ross","6":"kory wright","7":"roger grillo","8":"tom pratt","9":"scott shaunessy","10":"reine karlsson","11":"mark ferner","12":"yves beaudoin","13":"milos riha","14":"dave shellington","15":"thomas rundqvist","16":"dominik hasek","17":"warren yadlowski","18":"bill mccormack","19":"paul fitzsimmons"},"position":{"0":"right wing","1":"right wing","2":"centre","3":"left wing","4":"defence","5":"defence","6":"right wing","7":"defence","8":"defence","9":"defence","10":"left wing","11":"defence","12":"defence","13":"left wing","14":"left wing","15":"left wing","16":"goaltender","17":"centre","18":"centre","19":"defence"},"nationality":{"0":"canada","1":"united states","2":"soviet union","3":"canada","4":"sweden","5":"canada","6":"united states","7":"united states","8":"united states","9":"united states","10":"sweden","11":"canada","12":"canada","13":"czechoslovakia","14":"canada","15":"sweden","16":"czechoslovakia","17":"canada","18":"united states","19":"united states"},"nhl team":{"0":"pittsburgh penguins","1":"toronto maple leafs","2":"new jersey devils","3":"detroit red wings","4":"los angeles kings","5":"toronto maple leafs","6":"winnipeg jets","7":"vancouver canucks","8":"calgary flames","9":"quebec nordiques","10":"hartford whalers","11":"buffalo sabres","12":"washington capitals","13":"minnesota north stars","14":"new york islanders","15":"montreal canadiens","16":"chicago black hawks","17":"edmonton oilers","18":"philadelphia flyers","19":"boston bruins"},"college \/ junior \/ club team":{"0":"sault ste marie greyhounds (ohl)","1":"powers high school (ushs - mi)","2":"voskresensk (ussr)","3":"regina pats (whl)","4":"skellefteã aik (sweden)","5":"kitchener rangers (ohl)","6":"dubuque fighting saints (ushl)","7":"university of maine (ecac)","8":"kimball union academy (ushs - nh)","9":"st john 's school (ushs - ma)","10":"sodertalje (sweden)","11":"kamloops blazers (whl)","12":"shawinigan cataractes (qmjhl)","13":"vitkovice (czechoslovakia)","14":"cornwall royals (ohl)","15":"karlstad (sweden)","16":"pardubice (czechoslovakia)","17":"calgary wranglers (whl)","18":"westminster school (ushs - ct)","19":"northeastern university (ecac)"}}
pick player position nationality nhl team college / junior / club team 0 203 garth hildebrand left wing canada pittsburgh penguins calgary wranglers (whl) 1 204 allan acton left wing canada hartford whalers saskatoon blazers (whl) 2 205 alan stewart left wing canada new jersey devils prince albert raiders (whl) 3 206 jeff frank right wing canada / united states detroit red wings regina pats (whl) 4 207 jan blaha right wing czechoslovakia los angeles kings ceske budejovice (czechoslovakia) 5 208 mike tomlak centre canada toronto maple leafs cornwall royals (ohl) 6 209 eric cormier left wing canada winnipeg jets st george 's school (canadian hs - qc) 7 210 steve kayser defence canada vancouver canucks university of vermont (ecac) 8 211 jaroslav benak defence czechoslovakia calgary flames jihlava (czechoslovakia) 9 212 oldrich valek right wing czechoslovakia minnesota north stars jihlava (czechoslovakia) 10 213 bryan walker defence canada new york rangers portland winter halks (whl) 11 214 uwe krupp defence west germany buffalo sabres cologne (west germany) 12 215 alain raymond goaltender canada washington capitals trois - rivieres draveurs (qmjhl) 13 216 anders huss centre sweden washington capitals gavle (sweden) 14 217 john bjorkman centre united states new york islanders warroad high school (ushs - mn) 15 218 jeff perpich defence united states montreal canadiens hibbing high school (ushs - mn) 16 219 steve pepin centre canada chicago black hawks st jean castors (qmjhl) 17 220 john miner defence canada edmonton oilers regina pats (whl) 18 221 brian jopling goaltender united states philadelphia flyers rennssaeler polytechnic institute 19 222 norm foster goaltender canada boston bruins penticton knights (bcjhl)
{"pick":{"0":203,"1":204,"2":205,"3":206,"4":207,"5":208,"6":209,"7":210,"8":211,"9":212,"10":213,"11":214,"12":215,"13":216,"14":217,"15":218,"16":219,"17":220,"18":221,"19":222},"player":{"0":"garth hildebrand","1":"allan acton","2":"alan stewart","3":"jeff frank","4":"jan blaha","5":"mike tomlak","6":"eric cormier","7":"steve kayser","8":"jaroslav benak","9":"oldrich valek","10":"bryan walker","11":"uwe krupp","12":"alain raymond","13":"anders huss","14":"john bjorkman","15":"jeff perpich","16":"steve pepin","17":"john miner","18":"brian jopling","19":"norm foster"},"position":{"0":"left wing","1":"left wing","2":"left wing","3":"right wing","4":"right wing","5":"centre","6":"left wing","7":"defence","8":"defence","9":"right wing","10":"defence","11":"defence","12":"goaltender","13":"centre","14":"centre","15":"defence","16":"centre","17":"defence","18":"goaltender","19":"goaltender"},"nationality":{"0":"canada","1":"canada","2":"canada","3":"canada \/ united states","4":"czechoslovakia","5":"canada","6":"canada","7":"canada","8":"czechoslovakia","9":"czechoslovakia","10":"canada","11":"west germany","12":"canada","13":"sweden","14":"united states","15":"united states","16":"canada","17":"canada","18":"united states","19":"canada"},"nhl team":{"0":"pittsburgh penguins","1":"hartford whalers","2":"new jersey devils","3":"detroit red wings","4":"los angeles kings","5":"toronto maple leafs","6":"winnipeg jets","7":"vancouver canucks","8":"calgary flames","9":"minnesota north stars","10":"new york rangers","11":"buffalo sabres","12":"washington capitals","13":"washington capitals","14":"new york islanders","15":"montreal canadiens","16":"chicago black hawks","17":"edmonton oilers","18":"philadelphia flyers","19":"boston bruins"},"college \/ junior \/ club team":{"0":"calgary wranglers (whl)","1":"saskatoon blazers (whl)","2":"prince albert raiders (whl)","3":"regina pats (whl)","4":"ceske budejovice (czechoslovakia)","5":"cornwall royals (ohl)","6":"st george 's school (canadian hs - qc)","7":"university of vermont (ecac)","8":"jihlava (czechoslovakia)","9":"jihlava (czechoslovakia)","10":"portland winter halks (whl)","11":"cologne (west germany)","12":"trois - rivieres draveurs (qmjhl)","13":"gavle (sweden)","14":"warroad high school (ushs - mn)","15":"hibbing high school (ushs - mn)","16":"st jean castors (qmjhl)","17":"regina pats (whl)","18":"rennssaeler polytechnic institute","19":"penticton knights (bcjhl)"}}
pick player position nationality nhl team college / junior / club team 0 223 dave goertz defence canada pittsburgh penguins regina pats (whl) 1 224 darcy kaminski defence canada hartford whalers lethbridge broncos (whl) 2 225 alexei kasatonov defence soviet union new jersey devils moscow cska (ussr) 3 226 chuck chiatto centre united states detroit red wings cranbrook high school (ushs - mi 4 227 chad johnson centre united states los angeles kings roseau high school (ushs - mn) 5 228 ron choules left wing canada toronto maple leafs trois - rivieres draveurs (qmjhl) 6 229 jamie husgen defence united states winnipeg jets des moines buccaneers (ushl) 7 230 jay mazur right wing canada vancouver canucks breck school (ushs - mn) 8 231 sergei makarov right wing soviet union calgary flames moscow cska (ussr) 9 232 bo berglund right wing sweden quebec nordiques djurgardens if (sweden) 10 233 ulf nilsson goaltender sweden new york rangers skelleftea (sweden) 11 234 marc hamelin goaltender canada buffalo sabres shawinigan cataractes (qmjhl) 12 235 kermit salfi left wing united states buffalo sabres northwood school (ushs - ny) 13 236 paul roff right wing united states minnesota north stars edina high school (ushs - mn) 14 237 peter mcgeough defence united states new york islanders bishop hendricken high school (ushs - ri) 15 238 jean - guy bergeron defence canada montreal canadiens shawinigan cataractes (qmjhl) 16 239 jindrich kokrment centre czechoslovakia quebec nordiques litvinov (czechoslovakia) 17 240 steven woodburn defence canada edmonton oilers verdun juniors (qmjhl) 18 241 harold duvall left wing united states philadelphia flyers belmont hill school (ushs - ma) 19 242 greg murphy defence united states boston bruins trinity - pawling high school (ushs - ny)
{"pick":{"0":223,"1":224,"2":225,"3":226,"4":227,"5":228,"6":229,"7":230,"8":231,"9":232,"10":233,"11":234,"12":235,"13":236,"14":237,"15":238,"16":239,"17":240,"18":241,"19":242},"player":{"0":"dave goertz","1":"darcy kaminski","2":"alexei kasatonov","3":"chuck chiatto","4":"chad johnson","5":"ron choules","6":"jamie husgen","7":"jay mazur","8":"sergei makarov","9":"bo berglund","10":"ulf nilsson","11":"marc hamelin","12":"kermit salfi","13":"paul roff","14":"peter mcgeough","15":"jean - guy bergeron","16":"jindrich kokrment","17":"steven woodburn","18":"harold duvall","19":"greg murphy"},"position":{"0":"defence","1":"defence","2":"defence","3":"centre","4":"centre","5":"left wing","6":"defence","7":"right wing","8":"right wing","9":"right wing","10":"goaltender","11":"goaltender","12":"left wing","13":"right wing","14":"defence","15":"defence","16":"centre","17":"defence","18":"left wing","19":"defence"},"nationality":{"0":"canada","1":"canada","2":"soviet union","3":"united states","4":"united states","5":"canada","6":"united states","7":"canada","8":"soviet union","9":"sweden","10":"sweden","11":"canada","12":"united states","13":"united states","14":"united states","15":"canada","16":"czechoslovakia","17":"canada","18":"united states","19":"united states"},"nhl team":{"0":"pittsburgh penguins","1":"hartford whalers","2":"new jersey devils","3":"detroit red wings","4":"los angeles kings","5":"toronto maple leafs","6":"winnipeg jets","7":"vancouver canucks","8":"calgary flames","9":"quebec nordiques","10":"new york rangers","11":"buffalo sabres","12":"buffalo sabres","13":"minnesota north stars","14":"new york islanders","15":"montreal canadiens","16":"quebec nordiques","17":"edmonton oilers","18":"philadelphia flyers","19":"boston bruins"},"college \/ junior \/ club team":{"0":"regina pats (whl)","1":"lethbridge broncos (whl)","2":"moscow cska (ussr)","3":"cranbrook high school (ushs - mi","4":"roseau high school (ushs - mn)","5":"trois - rivieres draveurs (qmjhl)","6":"des moines buccaneers (ushl)","7":"breck school (ushs - mn)","8":"moscow cska (ussr)","9":"djurgardens if (sweden)","10":"skelleftea (sweden)","11":"shawinigan cataractes (qmjhl)","12":"northwood school (ushs - ny)","13":"edina high school (ushs - mn)","14":"bishop hendricken high school (ushs - ri)","15":"shawinigan cataractes (qmjhl)","16":"litvinov (czechoslovakia)","17":"verdun juniors (qmjhl)","18":"belmont hill school (ushs - ma)","19":"trinity - pawling high school (ushs - ny)"}}
pick player position nationality nhl team college / junior / club team 0 63 frank pietrangelo goaltender canada pittsburgh penguins university of minnesota (wcha) 1 64 dave maclean right wing canada hartford whalers belleville bulls (ohl) 2 65 mikko makela right wing finland new york islanders ilves tampere (finland) 3 66 john bekkers centre canada calgary flames regina pats (whl) 4 67 guy benoit centre canada los angeles kings shawinigan cataractes (qmjhl) 5 68 dave korol defence canada detroit red wings winnipeg warriors (whl) 6 69 bob essensa goaltender canada winnipeg jets henry carr crusaders (metjhl) 7 70 tim lorenz left wing canada vancouver canucks portland winter hawks (whl) 8 71 kevan guy defence canada calgary flames medicine hat tigers (whl) 9 72 ron chyzowski centre canada hartford whalers st albert saints (ajhl) 10 73 peter andersson defence sweden new york rangers orebro (sweden) 11 74 daren puppa goaltender canada buffalo sabres kirkland lake midget all - stars (coaaamhl) 12 75 tim bergland centre united states washington capitals thief river falls high school (ushs - mn) 13 76 brian durand centre united states minnesota north stars cloquet high school (ushs - mn) 14 77 bill claviter left wing united states calgary flames virginia high school (ushs - mn) 15 78 john kordic defence canada montreal canadiens portland winter hawks (whl) 16 79 tarek howard defence canada chicago black hawks olds grizzlys (ajhl) 17 80 esa tikkanen left wing finland edmonton oilers hifk helsinki (finland) 18 81 allen bourbeau centre united states philadelphia flyers acton - boxborough high school (ushs - ma) 19 82 allan larochelle goaltender canada boston bruins saskatoon blades (whl)
{"pick":{"0":63,"1":64,"2":65,"3":66,"4":67,"5":68,"6":69,"7":70,"8":71,"9":72,"10":73,"11":74,"12":75,"13":76,"14":77,"15":78,"16":79,"17":80,"18":81,"19":82},"player":{"0":"frank pietrangelo","1":"dave maclean","2":"mikko makela","3":"john bekkers","4":"guy benoit","5":"dave korol","6":"bob essensa","7":"tim lorenz","8":"kevan guy","9":"ron chyzowski","10":"peter andersson","11":"daren puppa","12":"tim bergland","13":"brian durand","14":"bill claviter","15":"john kordic","16":"tarek howard","17":"esa tikkanen","18":"allen bourbeau","19":"allan larochelle"},"position":{"0":"goaltender","1":"right wing","2":"right wing","3":"centre","4":"centre","5":"defence","6":"goaltender","7":"left wing","8":"defence","9":"centre","10":"defence","11":"goaltender","12":"centre","13":"centre","14":"left wing","15":"defence","16":"defence","17":"left wing","18":"centre","19":"goaltender"},"nationality":{"0":"canada","1":"canada","2":"finland","3":"canada","4":"canada","5":"canada","6":"canada","7":"canada","8":"canada","9":"canada","10":"sweden","11":"canada","12":"united states","13":"united states","14":"united states","15":"canada","16":"canada","17":"finland","18":"united states","19":"canada"},"nhl team":{"0":"pittsburgh penguins","1":"hartford whalers","2":"new york islanders","3":"calgary flames","4":"los angeles kings","5":"detroit red wings","6":"winnipeg jets","7":"vancouver canucks","8":"calgary flames","9":"hartford whalers","10":"new york rangers","11":"buffalo sabres","12":"washington capitals","13":"minnesota north stars","14":"calgary flames","15":"montreal canadiens","16":"chicago black hawks","17":"edmonton oilers","18":"philadelphia flyers","19":"boston bruins"},"college \/ junior \/ club team":{"0":"university of minnesota (wcha)","1":"belleville bulls (ohl)","2":"ilves tampere (finland)","3":"regina pats (whl)","4":"shawinigan cataractes (qmjhl)","5":"winnipeg warriors (whl)","6":"henry carr crusaders (metjhl)","7":"portland winter hawks (whl)","8":"medicine hat tigers (whl)","9":"st albert saints (ajhl)","10":"orebro (sweden)","11":"kirkland lake midget all - stars (coaaamhl)","12":"thief river falls high school (ushs - mn)","13":"cloquet high school (ushs - mn)","14":"virginia high school (ushs - mn)","15":"portland winter hawks (whl)","16":"olds grizzlys (ajhl)","17":"hifk helsinki (finland)","18":"acton - boxborough high school (ushs - ma)","19":"saskatoon blades (whl)"}}
pick player position nationality nhl team college / junior / club team 0 143 christian duperron defence canada hartford whalers chicoutimi sagueneens (qmjhl) 1 144 jamie falle goaltender canada hartford whalers clarkson university (ecac) 2 145 viacheslav fetisov defence soviet union new jersey devils moscow cska (ussr) 3 146 craig butz defence canada detroit red wings kelowna wings (whl) 4 147 ken hammond defence canada los angeles kings rensselaer polytechnic institute (ecac) 5 148 paul bifano left wing canada toronto maple leafs burnaby bluehawks (bcjhl) 6 149 ron pesetti defence canada winnipeg jets western michigan university (ccha) 7 150 john labatt centre united states vancouver canucks minnetonka high school (ushs - mn) 8 151 chris macdonald defence canada calgary flames western michigan university (ccha) 9 152 tommy albelin defence sweden quebec nordiques djurgardens if (sweden) 10 153 pete marcov left wing canada new york rangers welland cougars (ghjhl) 11 154 don mcsween defence united states buffalo sabres redford royals (najhl) 12 155 marty abrams goaltender canada washington capitals pembroke lumber kings (cjahl) 13 156 don biggs centre canada minnesota north stars oshawa generals (ohl) 14 157 dale henry left wing canada new york islanders saskatoon blades (whl) 15 158 rob bryden left wing canada montreal canadiens henry carr crusaders (metjhl) 16 159 kent paynter defence canada chicago black hawks kitchener rangers (ohl) 17 160 ralph vos goaltender canada edmonton oilers abbotsford flyers (bcjhl) 18 161 pelle eklund centre sweden philadelphia flyers solna (sweden) 19 162 francois olivier left wing canada boston bruins st - jean castors (qmjhl)
{"pick":{"0":143,"1":144,"2":145,"3":146,"4":147,"5":148,"6":149,"7":150,"8":151,"9":152,"10":153,"11":154,"12":155,"13":156,"14":157,"15":158,"16":159,"17":160,"18":161,"19":162},"player":{"0":"christian duperron","1":"jamie falle","2":"viacheslav fetisov","3":"craig butz","4":"ken hammond","5":"paul bifano","6":"ron pesetti","7":"john labatt","8":"chris macdonald","9":"tommy albelin","10":"pete marcov","11":"don mcsween","12":"marty abrams","13":"don biggs","14":"dale henry","15":"rob bryden","16":"kent paynter","17":"ralph vos","18":"pelle eklund","19":"francois olivier"},"position":{"0":"defence","1":"goaltender","2":"defence","3":"defence","4":"defence","5":"left wing","6":"defence","7":"centre","8":"defence","9":"defence","10":"left wing","11":"defence","12":"goaltender","13":"centre","14":"left wing","15":"left wing","16":"defence","17":"goaltender","18":"centre","19":"left wing"},"nationality":{"0":"canada","1":"canada","2":"soviet union","3":"canada","4":"canada","5":"canada","6":"canada","7":"united states","8":"canada","9":"sweden","10":"canada","11":"united states","12":"canada","13":"canada","14":"canada","15":"canada","16":"canada","17":"canada","18":"sweden","19":"canada"},"nhl team":{"0":"hartford whalers","1":"hartford whalers","2":"new jersey devils","3":"detroit red wings","4":"los angeles kings","5":"toronto maple leafs","6":"winnipeg jets","7":"vancouver canucks","8":"calgary flames","9":"quebec nordiques","10":"new york rangers","11":"buffalo sabres","12":"washington capitals","13":"minnesota north stars","14":"new york islanders","15":"montreal canadiens","16":"chicago black hawks","17":"edmonton oilers","18":"philadelphia flyers","19":"boston bruins"},"college \/ junior \/ club team":{"0":"chicoutimi sagueneens (qmjhl)","1":"clarkson university (ecac)","2":"moscow cska (ussr)","3":"kelowna wings (whl)","4":"rensselaer polytechnic institute (ecac)","5":"burnaby bluehawks (bcjhl)","6":"western michigan university (ccha)","7":"minnetonka high school (ushs - mn)","8":"western michigan university (ccha)","9":"djurgardens if (sweden)","10":"welland cougars (ghjhl)","11":"redford royals (najhl)","12":"pembroke lumber kings (cjahl)","13":"oshawa generals (ohl)","14":"saskatoon blades (whl)","15":"henry carr crusaders (metjhl)","16":"kitchener rangers (ohl)","17":"abbotsford flyers (bcjhl)","18":"solna (sweden)","19":"st - jean castors (qmjhl)"}}
pick player position nationality nhl team college / junior / club team 0 163 marty ketola right wing united states pittsburgh penguins cloquet high school (ushs - mn) 1 164 bill fordy left wing canada hartford whalers guelph platers (ohl) 2 165 jay octeau defence united states new jersey devils mount st charles academy (ushs - ri) 3 166 dave sikorski defence united states detroit red wings cornwall royals (ohl) 4 167 bruce fishback centre united states los angeles kings white bear lake high school (ushs - mn) 5 168 cliff abrecht defence canada toronto maple leafs princeton university (ecac) 6 169 todd flichel defence canada winnipeg jets gloucester rangers (cojhl) 7 170 allan measures defence canada vancouver canucks calgary wranglers (whl) 8 171 rob kivell defence canada calgary flames victoria cougars (whl) 9 172 wayne groulx centre canada quebec nordiques sault ste marie greyhounds (ohl) 10 173 paul jerrard right wing canada new york rangers notre dame hounds (sjhl) 11 174 tim hoover defence canada buffalo sabres sault ste marie greyhounds (ohl) 12 175 dave cowan left wing united states washington capitals washburn high school (ushs - mn) 13 176 paul pulis right wing united states minnesota north stars hibbing high school (ushs - mn) 14 177 kevin vescio defence canada new york islanders north bay centennials (ohl) 15 178 grant mckay defence canada montreal canadiens university of calgary (ciau) 16 179 brian noonan centre united states chicago black hawks archbishop williams high school (ushs - ma) 17 180 dave roach goaltender canada edmonton oilers new westminster royals (bcjhl) 18 181 robbie nichols left wing canada philadelphia flyers kitchener rangers (ohl) 19 182 harri laurila defence finland boston bruins lahti (finland)
{"pick":{"0":163,"1":164,"2":165,"3":166,"4":167,"5":168,"6":169,"7":170,"8":171,"9":172,"10":173,"11":174,"12":175,"13":176,"14":177,"15":178,"16":179,"17":180,"18":181,"19":182},"player":{"0":"marty ketola","1":"bill fordy","2":"jay octeau","3":"dave sikorski","4":"bruce fishback","5":"cliff abrecht","6":"todd flichel","7":"allan measures","8":"rob kivell","9":"wayne groulx","10":"paul jerrard","11":"tim hoover","12":"dave cowan","13":"paul pulis","14":"kevin vescio","15":"grant mckay","16":"brian noonan","17":"dave roach","18":"robbie nichols","19":"harri laurila"},"position":{"0":"right wing","1":"left wing","2":"defence","3":"defence","4":"centre","5":"defence","6":"defence","7":"defence","8":"defence","9":"centre","10":"right wing","11":"defence","12":"left wing","13":"right wing","14":"defence","15":"defence","16":"centre","17":"goaltender","18":"left wing","19":"defence"},"nationality":{"0":"united states","1":"canada","2":"united states","3":"united states","4":"united states","5":"canada","6":"canada","7":"canada","8":"canada","9":"canada","10":"canada","11":"canada","12":"united states","13":"united states","14":"canada","15":"canada","16":"united states","17":"canada","18":"canada","19":"finland"},"nhl team":{"0":"pittsburgh penguins","1":"hartford whalers","2":"new jersey devils","3":"detroit red wings","4":"los angeles kings","5":"toronto maple leafs","6":"winnipeg jets","7":"vancouver canucks","8":"calgary flames","9":"quebec nordiques","10":"new york rangers","11":"buffalo sabres","12":"washington capitals","13":"minnesota north stars","14":"new york islanders","15":"montreal canadiens","16":"chicago black hawks","17":"edmonton oilers","18":"philadelphia flyers","19":"boston bruins"},"college \/ junior \/ club team":{"0":"cloquet high school (ushs - mn)","1":"guelph platers (ohl)","2":"mount st charles academy (ushs - ri)","3":"cornwall royals (ohl)","4":"white bear lake high school (ushs - mn)","5":"princeton university (ecac)","6":"gloucester rangers (cojhl)","7":"calgary wranglers (whl)","8":"victoria cougars (whl)","9":"sault ste marie greyhounds (ohl)","10":"notre dame hounds (sjhl)","11":"sault ste marie greyhounds (ohl)","12":"washburn high school (ushs - mn)","13":"hibbing high school (ushs - mn)","14":"north bay centennials (ohl)","15":"university of calgary (ciau)","16":"archbishop williams high school (ushs - ma)","17":"new westminster royals (bcjhl)","18":"kitchener rangers (ohl)","19":"lahti (finland)"}}
season series team name races poles wins podiums f / laps points final placing 0 2008 formula bmw americas amir nasr racing 2 0 0 0 0 6 13th 1 2009 formula 3 sudamericana cesário fórmula 17 1 1 7 1 81 3rd 2 2010 toyota racing series giles motorsport 12 0 1 3 1 536 8th 3 2010 british formula three carlin 30 0 0 1 0 45 13th 4 2010 gp3 series carlin 10 0 0 1 0 7 19th 5 2010 masters of formula 3 carlin 1 0 0 0 0 n / a 7th 6 2010 formula three sudamericana cesário fórmula 7 0 3 5 2 128 8th 7 2010 macau grand prix fortec motorsport 1 0 0 0 0 n / a 22nd 8 2011 formula 3 brazil open cesário fórmula 1 1 1 1 1 n / a 1st 9 2011 british formula three fortec motorsport 30 1 3 7 2 170 7th 10 2011 macau grand prix fortec motorsport 1 0 0 0 0 n / a 7th 11 2011 masters of formula 3 mucke motorsport 1 0 0 0 0 n / a 8th 12 2012 formula renault 3.5 series dams 17 0 0 0 0 8 23rd 13 2012 formula 3 brazil open cesário fórmula 1 1 1 1 1 n / a 1st
{"season":{"0":2008,"1":2009,"2":2010,"3":2010,"4":2010,"5":2010,"6":2010,"7":2010,"8":2011,"9":2011,"10":2011,"11":2011,"12":2012,"13":2012},"series":{"0":"formula bmw americas","1":"formula 3 sudamericana","2":"toyota racing series","3":"british formula three","4":"gp3 series","5":"masters of formula 3","6":"formula three sudamericana","7":"macau grand prix","8":"formula 3 brazil open","9":"british formula three","10":"macau grand prix","11":"masters of formula 3","12":"formula renault 3.5 series","13":"formula 3 brazil open"},"team name":{"0":"amir nasr racing","1":"cesário fórmula","2":"giles motorsport","3":"carlin","4":"carlin","5":"carlin","6":"cesário fórmula","7":"fortec motorsport","8":"cesário fórmula","9":"fortec motorsport","10":"fortec motorsport","11":"mucke motorsport","12":"dams","13":"cesário fórmula"},"races":{"0":2,"1":17,"2":12,"3":30,"4":10,"5":1,"6":7,"7":1,"8":1,"9":30,"10":1,"11":1,"12":17,"13":1},"poles":{"0":0,"1":1,"2":0,"3":0,"4":0,"5":0,"6":0,"7":0,"8":1,"9":1,"10":0,"11":0,"12":0,"13":1},"wins":{"0":0,"1":1,"2":1,"3":0,"4":0,"5":0,"6":3,"7":0,"8":1,"9":3,"10":0,"11":0,"12":0,"13":1},"podiums":{"0":0,"1":7,"2":3,"3":1,"4":1,"5":0,"6":5,"7":0,"8":1,"9":7,"10":0,"11":0,"12":0,"13":1},"f \/ laps":{"0":0,"1":1,"2":1,"3":0,"4":0,"5":0,"6":2,"7":0,"8":1,"9":2,"10":0,"11":0,"12":0,"13":1},"points":{"0":"6","1":"81","2":"536","3":"45","4":"7","5":"n \/ a","6":"128","7":"n \/ a","8":"n \/ a","9":"170","10":"n \/ a","11":"n \/ a","12":"8","13":"n \/ a"},"final placing":{"0":"13th","1":"3rd","2":"8th","3":"13th","4":"19th","5":"7th","6":"8th","7":"22nd","8":"1st","9":"7th","10":"7th","11":"8th","12":"23rd","13":"1st"}}
no in series title directed by written by original air date production code us viewers (millions) 0 1 pilot greg yaitanes hart hanson september 13 , 2005 1aky79 10.79 1 2 the man in the suv allan kroeker stephen nathan september 20 , 2005 1aky02 7.39 2 3 a boy in a tree patrick norris hart hanson september 27 , 2005 1aky01 7.87 3 4 the man in the bear allan kroeker laura wolner november 1 , 2005 1aky04 7.99 4 5 a boy in a bush jesús salvador treviño steve blackman & greg ball november 8 , 2005 1aky05 6.86 5 6 the man in the wall tawnia mckiernan elizabeth benjamin november 15 , 2005 1aky06 8.84 6 7 a man on death row david jones noah hawley november 22 , 2005 1aky03 7.25 7 8 the girl in the fridge sanford bookstaver dana coen november 29 , 2005 1aky07 7.64 8 9 the man in the fallout shelter greg yaitanes hart hanson december 13 , 2005 1aky08 7.12 9 10 the woman at the airport greg yaitanes teresa lin january 25 , 2006 1aky10 11.37 10 11 the woman in the car dwight little noah hawley february 1 , 2006 1aky09 12.64 11 12 the superhero in the alley james whitmore , jr elizabeth benjamin february 8 , 2006 1aky12 11.91 12 13 the woman in the garden sanford bookstaver laura wolner february 15 , 2006 1aky13 11.87 13 14 the man on the fairway tony wharmby steve blackman march 8 , 2006 1aky14 11.82 14 15 two bodies in the lab allan kroeker stephen nathan march 15 , 2006 1aky15 12.07 15 16 the woman in the tunnel joe napolitano greg ball & steve blackman march 22 , 2006 1aky11 11.14 16 17 the skull in the desert donna deitch jeff rake march 29 , 2006 1aky17 11.24 17 18 the man with the bone jesús salvador treviño craig silverstein april 5 , 2006 1aky16 10.14 18 19 the man in the morgue james whitmore , jr noah hawley & elizabeth benjamin april 19 , 2006 1aky18 10.28 19 20 the graft in the girl sanford bookstaver laura wolner & greg ball april 26 , 2006 1aky19 10.33 20 21 the soldier on the grave jonathan pontell stephen nathan may 10 , 2006 1aky20 9.50
{"no in series":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21},"title":{"0":"pilot","1":"the man in the suv","2":"a boy in a tree","3":"the man in the bear","4":"a boy in a bush","5":"the man in the wall","6":"a man on death row","7":"the girl in the fridge","8":"the man in the fallout shelter","9":"the woman at the airport","10":"the woman in the car","11":"the superhero in the alley","12":"the woman in the garden","13":"the man on the fairway","14":"two bodies in the lab","15":"the woman in the tunnel","16":"the skull in the desert","17":"the man with the bone","18":"the man in the morgue","19":"the graft in the girl","20":"the soldier on the grave"},"directed by":{"0":"greg yaitanes","1":"allan kroeker","2":"patrick norris","3":"allan kroeker","4":"jesús salvador treviño","5":"tawnia mckiernan","6":"david jones","7":"sanford bookstaver","8":"greg yaitanes","9":"greg yaitanes","10":"dwight little","11":"james whitmore , jr","12":"sanford bookstaver","13":"tony wharmby","14":"allan kroeker","15":"joe napolitano","16":"donna deitch","17":"jesús salvador treviño","18":"james whitmore , jr","19":"sanford bookstaver","20":"jonathan pontell"},"written by":{"0":"hart hanson","1":"stephen nathan","2":"hart hanson","3":"laura wolner","4":"steve blackman & greg ball","5":"elizabeth benjamin","6":"noah hawley","7":"dana coen","8":"hart hanson","9":"teresa lin","10":"noah hawley","11":"elizabeth benjamin","12":"laura wolner","13":"steve blackman","14":"stephen nathan","15":"greg ball & steve blackman","16":"jeff rake","17":"craig silverstein","18":"noah hawley & elizabeth benjamin","19":"laura wolner & greg ball","20":"stephen nathan"},"original air date":{"0":"september 13 , 2005","1":"september 20 , 2005","2":"september 27 , 2005","3":"november 1 , 2005","4":"november 8 , 2005","5":"november 15 , 2005","6":"november 22 , 2005","7":"november 29 , 2005","8":"december 13 , 2005","9":"january 25 , 2006","10":"february 1 , 2006","11":"february 8 , 2006","12":"february 15 , 2006","13":"march 8 , 2006","14":"march 15 , 2006","15":"march 22 , 2006","16":"march 29 , 2006","17":"april 5 , 2006","18":"april 19 , 2006","19":"april 26 , 2006","20":"may 10 , 2006"},"production code":{"0":"1aky79","1":"1aky02","2":"1aky01","3":"1aky04","4":"1aky05","5":"1aky06","6":"1aky03","7":"1aky07","8":"1aky08","9":"1aky10","10":"1aky09","11":"1aky12","12":"1aky13","13":"1aky14","14":"1aky15","15":"1aky11","16":"1aky17","17":"1aky16","18":"1aky18","19":"1aky19","20":"1aky20"},"us viewers (millions)":{"0":10.79,"1":7.39,"2":7.87,"3":7.99,"4":6.86,"5":8.84,"6":7.25,"7":7.64,"8":7.12,"9":11.37,"10":12.64,"11":11.91,"12":11.87,"13":11.82,"14":12.07,"15":11.14,"16":11.24,"17":10.14,"18":10.28,"19":10.33,"20":9.5}}
series episode title directed by written by original air date us viewers (millions) 0 27 1 the captain clark mathis eric falconer september 21 , 2011 0.891 1 28 2 dic pics john fortenberry jd ryznar september 21 , 2011 n / a 2 29 3 thad 's back clark mathis heather flanders september 28 , 2011 0.884 3 30 4 the peak jay chandrasekhar drew hancock october 5 , 2011 0.871 4 31 5 training day eric appel heather flanders october 12 , 2011 0.852 5 32 6 blackout john fortenberry kristofor brown october 19 , 2011 0.645 6 33 7 superstition jay chandrasekhar kristofor brown october 26 , 2011 0.884 7 34 8 fun facts eric appel jd ryznar november 2 , 2011 0.944 8 35 9 the c - word dean holland chris romano november 5 , 2011 n / a 9 36 10 one week dean holland ryan ridley november 9 , 2011 n / a
{"series":{"0":27,"1":28,"2":29,"3":30,"4":31,"5":32,"6":33,"7":34,"8":35,"9":36},"episode":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10},"title":{"0":"the captain","1":"dic pics","2":"thad 's back","3":"the peak","4":"training day","5":"blackout","6":"superstition","7":"fun facts","8":"the c - word","9":"one week"},"directed by":{"0":"clark mathis","1":"john fortenberry","2":"clark mathis","3":"jay chandrasekhar","4":"eric appel","5":"john fortenberry","6":"jay chandrasekhar","7":"eric appel","8":"dean holland","9":"dean holland"},"written by":{"0":"eric falconer","1":"jd ryznar","2":"heather flanders","3":"drew hancock","4":"heather flanders","5":"kristofor brown","6":"kristofor brown","7":"jd ryznar","8":"chris romano","9":"ryan ridley"},"original air date":{"0":"september 21 , 2011","1":"september 21 , 2011","2":"september 28 , 2011","3":"october 5 , 2011","4":"october 12 , 2011","5":"october 19 , 2011","6":"october 26 , 2011","7":"november 2 , 2011","8":"november 5 , 2011","9":"november 9 , 2011"},"us viewers (millions)":{"0":"0.891","1":"n \/ a","2":"0.884","3":"0.871","4":"0.852","5":"0.645","6":"0.884","7":"0.944","8":"n \/ a","9":"n \/ a"}}
season series team name races wins poles podiums points final placing 0 2007 formula palmer audi audi russia motorsport 20 0 0 0 74 19th 1 2007 formula palmer audi autumn trophy audi russia motorsport 6 0 0 0 41 12th 2 2008 formula palmer audi audi russia motorsport 20 0 0 0 137 11th 3 2008 formula palmer audi autumn trophy audi russia motorsport 6 0 0 0 42 10th 4 2008 formula renault uk winter series falcon motorsport 2 0 0 0 10 22nd 5 2009 british formula three national class team west - tec 16 0 0 4 108 4th 6 2009 formula renault uk tempus sport 2 0 0 0 0 32nd 7 2009 formula palmer audi audi russia motorsport 1 0 0 0 5 33rd 8 2010 british formula three fortec motorsport 30 0 0 0 1 18th 9 2010 formula palmer audi motorsport vision 7 1 0 3 104 13th 10 2011 fia formula two championship motorsport vision 16 0 0 0 14 18th 11 2011 british formula three hitech racing 9 0 0 0 2 24th 12 2012 auto gp world series campos racing 14 0 0 0 34 13th
{"season":{"0":2007,"1":2007,"2":2008,"3":2008,"4":2008,"5":2009,"6":2009,"7":2009,"8":2010,"9":2010,"10":2011,"11":2011,"12":2012},"series":{"0":"formula palmer audi","1":"formula palmer audi autumn trophy","2":"formula palmer audi","3":"formula palmer audi autumn trophy","4":"formula renault uk winter series","5":"british formula three national class","6":"formula renault uk","7":"formula palmer audi","8":"british formula three","9":"formula palmer audi","10":"fia formula two championship","11":"british formula three","12":"auto gp world series"},"team name":{"0":"audi russia motorsport","1":"audi russia motorsport","2":"audi russia motorsport","3":"audi russia motorsport","4":"falcon motorsport","5":"team west - tec","6":"tempus sport","7":"audi russia motorsport","8":"fortec motorsport","9":"motorsport vision","10":"motorsport vision","11":"hitech racing","12":"campos racing"},"races":{"0":20,"1":6,"2":20,"3":6,"4":2,"5":16,"6":2,"7":1,"8":30,"9":7,"10":16,"11":9,"12":14},"wins":{"0":0,"1":0,"2":0,"3":0,"4":0,"5":0,"6":0,"7":0,"8":0,"9":1,"10":0,"11":0,"12":0},"poles":{"0":0,"1":0,"2":0,"3":0,"4":0,"5":0,"6":0,"7":0,"8":0,"9":0,"10":0,"11":0,"12":0},"podiums":{"0":0,"1":0,"2":0,"3":0,"4":0,"5":4,"6":0,"7":0,"8":0,"9":3,"10":0,"11":0,"12":0},"points":{"0":74,"1":41,"2":137,"3":42,"4":10,"5":108,"6":0,"7":5,"8":1,"9":104,"10":14,"11":2,"12":34},"final placing":{"0":"19th","1":"12th","2":"11th","3":"10th","4":"22nd","5":"4th","6":"32nd","7":"33rd","8":"18th","9":"13th","10":"18th","11":"24th","12":"13th"}}
no in series no in season title directed by written by original air date production code us viewers (millions) 0 44 1 the widow 's son in the windshield ian toynton hart hanson september 25 , 2007 3aky01 8.40 1 45 2 soccer mom in the mini - van allan kroeker elizabeth benjamin october 2 , 2007 3aky03 7.98 2 46 3 death in the saddle craig ross , jr josh berman october 9 , 2007 3aky02 8.48 3 47 4 the secret in the soil steven depaul karine rosenthal october 23 , 2007 3aky04 8.94 4 48 5 mummy in the maze marita grabiak scott williams october 30 , 2007 3aky05 8.85 5 49 6 intern in the incinerator jeff woolnough christopher ambrose november 6 , 2007 3aky06 9.52 6 50 7 the boy in the time capsule chad lowe janet lin november 13 , 2007 3aky07 9.12 7 51 8 the knight on the grid dwight little noah hawley november 20 , 2007 3aky08 8.70 8 52 9 the santa in the slush jeff woolnough elizabeth benjamin & scott williams november 27 , 2007 3aky10 9.62 9 53 10 the man in the mud scott lautanen janet tamaro april 14 , 2008 3aky11 8.54 10 54 11 player under pressure jessica landaw janet tamaro april 21 , 2008 2aky19 8.64 11 55 12 the baby in the bough ian toynton karine rosenthal april 28 , 2008 3aky09 9.68 12 56 13 the verdict in the story jeannot szwarc christopher ambrose may 5 , 2008 3aky13 8.13 13 57 14 the wannabe in the weeds gordon c lonsdale josh berman may 12 , 2008 3aky12 9.42
{"no in series":{"0":44,"1":45,"2":46,"3":47,"4":48,"5":49,"6":50,"7":51,"8":52,"9":53,"10":54,"11":55,"12":56,"13":57},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14},"title":{"0":"the widow 's son in the windshield","1":"soccer mom in the mini - van","2":"death in the saddle","3":"the secret in the soil","4":"mummy in the maze","5":"intern in the incinerator","6":"the boy in the time capsule","7":"the knight on the grid","8":"the santa in the slush","9":"the man in the mud","10":"player under pressure","11":"the baby in the bough","12":"the verdict in the story","13":"the wannabe in the weeds"},"directed by":{"0":"ian toynton","1":"allan kroeker","2":"craig ross , jr","3":"steven depaul","4":"marita grabiak","5":"jeff woolnough","6":"chad lowe","7":"dwight little","8":"jeff woolnough","9":"scott lautanen","10":"jessica landaw","11":"ian toynton","12":"jeannot szwarc","13":"gordon c lonsdale"},"written by":{"0":"hart hanson","1":"elizabeth benjamin","2":"josh berman","3":"karine rosenthal","4":"scott williams","5":"christopher ambrose","6":"janet lin","7":"noah hawley","8":"elizabeth benjamin & scott williams","9":"janet tamaro","10":"janet tamaro","11":"karine rosenthal","12":"christopher ambrose","13":"josh berman"},"original air date":{"0":"september 25 , 2007","1":"october 2 , 2007","2":"october 9 , 2007","3":"october 23 , 2007","4":"october 30 , 2007","5":"november 6 , 2007","6":"november 13 , 2007","7":"november 20 , 2007","8":"november 27 , 2007","9":"april 14 , 2008","10":"april 21 , 2008","11":"april 28 , 2008","12":"may 5 , 2008","13":"may 12 , 2008"},"production code":{"0":"3aky01","1":"3aky03","2":"3aky02","3":"3aky04","4":"3aky05","5":"3aky06","6":"3aky07","7":"3aky08","8":"3aky10","9":"3aky11","10":"2aky19","11":"3aky09","12":"3aky13","13":"3aky12"},"us viewers (millions)":{"0":8.4,"1":7.98,"2":8.48,"3":8.94,"4":8.85,"5":9.52,"6":9.12,"7":8.7,"8":9.62,"9":8.54,"10":8.64,"11":9.68,"12":8.13,"13":9.42}}
no in series no in season title directed by written by original air date production code us viewers (millions) 0 59 1 yanks in the uk (part 1) ian toynton hart hanson & karine rosenthal september 3 , 2008 3aky19 9.17 1 60 2 yanks in the uk (part 2) ian toynton stephen nathan & scott williams september 3 , 2008 3aky20 10.22 2 61 3 man in the outhouse steven depaul carla kettner & mark lisson september 10 , 2008 3aky16 8.91 3 62 4 the finger in the nest jeff woolnough lyla oliver september 17 , 2008 3aky17 9.71 4 63 5 the perfect pieces in the purple pond jeannot szwarc josh berman september 24 , 2008 4aky01 9.61 5 64 6 the crank in the shaft steven depaul elizabeth benjamin october 1 , 2008 3aky18 9.82 6 65 7 the he in the she craig ross , jr karina csolty october 8 , 2008 3aky15 10.34 7 66 8 the skull in the sculpture allan kroeker janet lin november 5 , 2008 4aky03 10.09 8 67 9 the con man in the meth lab allison liddi - brown karine rosenthal november 12 , 2008 4aky04 10.87 9 68 10 the passenger in the oven steven depaul carla kettner november 19 , 2008 4aky05 10.73 10 69 11 the bone that blew jessica landaw carla kettner november 26 , 2008 4aky02 9.76 11 70 12 double trouble in the panhandle dwight little lyla oliver january 22 , 2009 4aky06 9.97 12 71 13 fire in the ice chad lowe scott williams january 22 , 2009 4aky07 7.52 13 72 14 the hero in the hold ian toynton janet lin & karine rosenthal february 5 , 2009 4aky08 10.76 14 73 15 the princess and the pear steven depaul matthew donlan & jeremy martin february 19 , 2009 4aky09 9.50 15 74 16 the bones that foam david boreanaz elizabeth benjamin march 12 , 2009 4aky10 9.55 16 75 17 the salt in the wounds steven depaul carla kettner & josh berman march 19 , 2009 4aky11 10.19 17 76 18 the doctor in the den ian toynton janet lin & karine rosenthal april 2 , 2009 4aky12 8.98 18 77 19 the science in the physicist brad turner karina csolty april 9 , 2009 4aky13 8.88 19 78 20 cinderella in the cardboard steven depaul carla kettner & josh berman april 15 , 2009 4aky14 10.76 20 79 21 mayhem on a cross jeff woolnough dean lopata april 16 , 2009 4aky15 8.72 21 80 22 the double death of the dearly departed milan cheylov craig silverstein april 20 , 2009 4aky16 8.38 22 81 23 the girl in the mask ian toynton michael peterson april 23 , 2009 4aky17 8.22 23 82 24 the beaver in the otter brad turner scott williams april 30 , 2009 4aky18 8.83 24 83 25 the critic in the cabernet kevin hooks stephen nathan may 7 , 2009 4aky19 8.62
{"no in series":{"0":59,"1":60,"2":61,"3":62,"4":63,"5":64,"6":65,"7":66,"8":67,"9":68,"10":69,"11":70,"12":71,"13":72,"14":73,"15":74,"16":75,"17":76,"18":77,"19":78,"20":79,"21":80,"22":81,"23":82,"24":83},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21,"21":22,"22":23,"23":24,"24":25},"title":{"0":"yanks in the uk (part 1)","1":"yanks in the uk (part 2)","2":"man in the outhouse","3":"the finger in the nest","4":"the perfect pieces in the purple pond","5":"the crank in the shaft","6":"the he in the she","7":"the skull in the sculpture","8":"the con man in the meth lab","9":"the passenger in the oven","10":"the bone that blew","11":"double trouble in the panhandle","12":"fire in the ice","13":"the hero in the hold","14":"the princess and the pear","15":"the bones that foam","16":"the salt in the wounds","17":"the doctor in the den","18":"the science in the physicist","19":"cinderella in the cardboard","20":"mayhem on a cross","21":"the double death of the dearly departed","22":"the girl in the mask","23":"the beaver in the otter","24":"the critic in the cabernet"},"directed by":{"0":"ian toynton","1":"ian toynton","2":"steven depaul","3":"jeff woolnough","4":"jeannot szwarc","5":"steven depaul","6":"craig ross , jr","7":"allan kroeker","8":"allison liddi - brown","9":"steven depaul","10":"jessica landaw","11":"dwight little","12":"chad lowe","13":"ian toynton","14":"steven depaul","15":"david boreanaz","16":"steven depaul","17":"ian toynton","18":"brad turner","19":"steven depaul","20":"jeff woolnough","21":"milan cheylov","22":"ian toynton","23":"brad turner","24":"kevin hooks"},"written by":{"0":"hart hanson & karine rosenthal","1":"stephen nathan & scott williams","2":"carla kettner & mark lisson","3":"lyla oliver","4":"josh berman","5":"elizabeth benjamin","6":"karina csolty","7":"janet lin","8":"karine rosenthal","9":"carla kettner","10":"carla kettner","11":"lyla oliver","12":"scott williams","13":"janet lin & karine rosenthal","14":"matthew donlan & jeremy martin","15":"elizabeth benjamin","16":"carla kettner & josh berman","17":"janet lin & karine rosenthal","18":"karina csolty","19":"carla kettner & josh berman","20":"dean lopata","21":"craig silverstein","22":"michael peterson","23":"scott williams","24":"stephen nathan"},"original air date":{"0":"september 3 , 2008","1":"september 3 , 2008","2":"september 10 , 2008","3":"september 17 , 2008","4":"september 24 , 2008","5":"october 1 , 2008","6":"october 8 , 2008","7":"november 5 , 2008","8":"november 12 , 2008","9":"november 19 , 2008","10":"november 26 , 2008","11":"january 22 , 2009","12":"january 22 , 2009","13":"february 5 , 2009","14":"february 19 , 2009","15":"march 12 , 2009","16":"march 19 , 2009","17":"april 2 , 2009","18":"april 9 , 2009","19":"april 15 , 2009","20":"april 16 , 2009","21":"april 20 , 2009","22":"april 23 , 2009","23":"april 30 , 2009","24":"may 7 , 2009"},"production code":{"0":"3aky19","1":"3aky20","2":"3aky16","3":"3aky17","4":"4aky01","5":"3aky18","6":"3aky15","7":"4aky03","8":"4aky04","9":"4aky05","10":"4aky02","11":"4aky06","12":"4aky07","13":"4aky08","14":"4aky09","15":"4aky10","16":"4aky11","17":"4aky12","18":"4aky13","19":"4aky14","20":"4aky15","21":"4aky16","22":"4aky17","23":"4aky18","24":"4aky19"},"us viewers (millions)":{"0":9.17,"1":10.22,"2":8.91,"3":9.71,"4":9.61,"5":9.82,"6":10.34,"7":10.09,"8":10.87,"9":10.73,"10":9.76,"11":9.97,"12":7.52,"13":10.76,"14":9.5,"15":9.55,"16":10.19,"17":8.98,"18":8.88,"19":10.76,"20":8.72,"21":8.38,"22":8.22,"23":8.83,"24":8.62}}
district region communes population (2002 census) % of total population vap enrolled total votes valid votes turnout e / vap t / vap v / vap 0 1 arica and parinacota arica , camarones , putre , general lagos 189644 1.3% 131900 111699 82438 74721 73.8% 84.7% 62.5% 56.6% 1 4 antofagasta antofagasta , mejillones , sierra gorda , taltal 318779 2.1% 274313 148543 124270 110858 83.7% 54.2% 45.3% 40.4% 2 5 atacama chañaral , diego de almagro , copiapó 161223 1.1% 128050 79247 66737 61076 84.2% 61.9% 52.1% 47.7% 3 8 coquimbo coquimbo , ovalle , río hurtado 265896 1.8% 229291 129887 114297 106372 88.0% 56.6% 49.8% 46.4% 4 12 valparaíso olmué , limache , villa alemana , quilpué 277525 1.8% 253998 155295 136331 121650 87.8% 61.1% 53.7% 47.9% 5 13 valparaíso valparaíso , juan fernández , isla de pascua 280406 1.9% 210529 173947 145787 130751 83.8% 82.6% 69.2% 62.1% 6 14 valparaíso viña del mar , concón 319204 2.1% 261273 202518 174962 159004 86.4% 77.5% 67.0% 60.9% 7 16 santiago colina , lampa , tiltil , quilicura , pudahuel 454969 3.0% 442415 196354 181399 164475 92.4% 44.4% 41.0% 37.2% 8 17 santiago conchalí , renca , huechuraba 340844 2.3% 237603 174946 157655 140469 90.1% 73.6% 66.4% 59.1% 9 18 santiago cerro navia , quinta normal , lo prado 356640 2.4% 236121 185340 166885 150425 90.0% 78.5% 70.7% 63.7% 10 19 santiago recoleta , independencia 213699 1.4% 138808 131104 115167 102642 87.8% 94.4% 83.0% 73.9% 11 20 santiago estación central , cerrillos , maipú 670690 4.4% 699393 294624 267571 241446 90.8% 42.1% 38.3% 34.5% 12 21 santiago providencia , ñuñoa 284385 1.9% 224404 219453 190697 177839 86.9% 97.8% 85.0% 79.2% 13 22 santiago santiago 200792 1.3% 138022 139240 119474 108786 85.8% 100.9% 86.6% 78.8% 14 23 santiago las condes , vitacura , lo barnechea 406141 2.7% 356860 256711 228983 215643 89.2% 71.9% 64.2% 60.4% 15 24 santiago la reina , peñalolén 312822 2.1% 248132 163297 148120 135303 90.7% 65.8% 59.7% 54.5% 16 25 santiago macul , san joaquín , la granja 342680 2.3% 232383 181069 161616 142146 89.3% 77.9% 69.5% 61.2% 17 26 santiago la florida 365674 2.4% 303912 168849 154173 141103 91.3% 55.6% 50.7% 46.4% 18 27 santiago el bosque , la cisterna , san ramón 355618 2.4% 243119 189698 169440 149776 89.3% 78.0% 69.7% 61.6% 19 28 santiago pedro aguirre cerda , san miguel , lo espejo 306232 2.0% 203393 183352 162779 146294 88.8% 90.1% 80.0% 71.9% 20 30 santiago san bernardo , buin , paine , calera de tango 378444 2.5% 322710 185875 169866 152201 91.4% 57.6% 52.6% 47.2% 21 32 o'higgins rancagua 214344 1.4% 175330 108471 98630 90298 90.9% 61.9% 56.3% 51.5% 22 37 maule talca 201797 1.3% 171840 101083 90845 83967 89.9% 58.8% 52.9% 48.9% 23 43 biobío talcahuano , hualpén 250348 1.7% 192901 137077 118209 107257 86.2% 71.1% 61.3% 55.6% 24 44 biobío concepción , san pedro de la paz , chiguayante 377810 2.5% 320848 206846 180532 167843 87.3% 64.5% 56.3% 52.3% 25 50 araucanía temuco , padre las casas 304142 2.0% 265574 150388 128930 120052 85.7% 56.6% 48.5% 45.2% 26 53 los ríos valdivia , lanco , mariquina , máfil , corral 186565 1.2% 149295 107308 90736 83776 84.6% 71.9% 60.8% 56.1% 27 55 los lagos osorno , san juan de la costa , san pablo 164468 1.1% 129621 97096 84502 77595 87.0% 74.9% 65.2% 59.9%
{"district":{"0":1,"1":4,"2":5,"3":8,"4":12,"5":13,"6":14,"7":16,"8":17,"9":18,"10":19,"11":20,"12":21,"13":22,"14":23,"15":24,"16":25,"17":26,"18":27,"19":28,"20":30,"21":32,"22":37,"23":43,"24":44,"25":50,"26":53,"27":55},"region":{"0":"arica and parinacota","1":"antofagasta","2":"atacama","3":"coquimbo","4":"valparaíso","5":"valparaíso","6":"valparaíso","7":"santiago","8":"santiago","9":"santiago","10":"santiago","11":"santiago","12":"santiago","13":"santiago","14":"santiago","15":"santiago","16":"santiago","17":"santiago","18":"santiago","19":"santiago","20":"santiago","21":"o'higgins","22":"maule","23":"biobío","24":"biobío","25":"araucanía","26":"los ríos","27":"los lagos"},"communes":{"0":"arica , camarones , putre , general lagos","1":"antofagasta , mejillones , sierra gorda , taltal","2":"chañaral , diego de almagro , copiapó","3":"coquimbo , ovalle , río hurtado","4":"olmué , limache , villa alemana , quilpué","5":"valparaíso , juan fernández , isla de pascua","6":"viña del mar , concón","7":"colina , lampa , tiltil , quilicura , pudahuel","8":"conchalí , renca , huechuraba","9":"cerro navia , quinta normal , lo prado","10":"recoleta , independencia","11":"estación central , cerrillos , maipú","12":"providencia , ñuñoa","13":"santiago","14":"las condes , vitacura , lo barnechea","15":"la reina , peñalolén","16":"macul , san joaquín , la granja","17":"la florida","18":"el bosque , la cisterna , san ramón","19":"pedro aguirre cerda , san miguel , lo espejo","20":"san bernardo , buin , paine , calera de tango","21":"rancagua","22":"talca","23":"talcahuano , hualpén","24":"concepción , san pedro de la paz , chiguayante","25":"temuco , padre las casas","26":"valdivia , lanco , mariquina , máfil , corral","27":"osorno , san juan de la costa , san pablo"},"population (2002 census)":{"0":189644,"1":318779,"2":161223,"3":265896,"4":277525,"5":280406,"6":319204,"7":454969,"8":340844,"9":356640,"10":213699,"11":670690,"12":284385,"13":200792,"14":406141,"15":312822,"16":342680,"17":365674,"18":355618,"19":306232,"20":378444,"21":214344,"22":201797,"23":250348,"24":377810,"25":304142,"26":186565,"27":164468},"% of total population":{"0":"1.3%","1":"2.1%","2":"1.1%","3":"1.8%","4":"1.8%","5":"1.9%","6":"2.1%","7":"3.0%","8":"2.3%","9":"2.4%","10":"1.4%","11":"4.4%","12":"1.9%","13":"1.3%","14":"2.7%","15":"2.1%","16":"2.3%","17":"2.4%","18":"2.4%","19":"2.0%","20":"2.5%","21":"1.4%","22":"1.3%","23":"1.7%","24":"2.5%","25":"2.0%","26":"1.2%","27":"1.1%"},"vap":{"0":131900,"1":274313,"2":128050,"3":229291,"4":253998,"5":210529,"6":261273,"7":442415,"8":237603,"9":236121,"10":138808,"11":699393,"12":224404,"13":138022,"14":356860,"15":248132,"16":232383,"17":303912,"18":243119,"19":203393,"20":322710,"21":175330,"22":171840,"23":192901,"24":320848,"25":265574,"26":149295,"27":129621},"enrolled":{"0":111699,"1":148543,"2":79247,"3":129887,"4":155295,"5":173947,"6":202518,"7":196354,"8":174946,"9":185340,"10":131104,"11":294624,"12":219453,"13":139240,"14":256711,"15":163297,"16":181069,"17":168849,"18":189698,"19":183352,"20":185875,"21":108471,"22":101083,"23":137077,"24":206846,"25":150388,"26":107308,"27":97096},"total votes":{"0":82438,"1":124270,"2":66737,"3":114297,"4":136331,"5":145787,"6":174962,"7":181399,"8":157655,"9":166885,"10":115167,"11":267571,"12":190697,"13":119474,"14":228983,"15":148120,"16":161616,"17":154173,"18":169440,"19":162779,"20":169866,"21":98630,"22":90845,"23":118209,"24":180532,"25":128930,"26":90736,"27":84502},"valid votes":{"0":74721,"1":110858,"2":61076,"3":106372,"4":121650,"5":130751,"6":159004,"7":164475,"8":140469,"9":150425,"10":102642,"11":241446,"12":177839,"13":108786,"14":215643,"15":135303,"16":142146,"17":141103,"18":149776,"19":146294,"20":152201,"21":90298,"22":83967,"23":107257,"24":167843,"25":120052,"26":83776,"27":77595},"turnout":{"0":"73.8%","1":"83.7%","2":"84.2%","3":"88.0%","4":"87.8%","5":"83.8%","6":"86.4%","7":"92.4%","8":"90.1%","9":"90.0%","10":"87.8%","11":"90.8%","12":"86.9%","13":"85.8%","14":"89.2%","15":"90.7%","16":"89.3%","17":"91.3%","18":"89.3%","19":"88.8%","20":"91.4%","21":"90.9%","22":"89.9%","23":"86.2%","24":"87.3%","25":"85.7%","26":"84.6%","27":"87.0%"},"e \/ vap":{"0":"84.7%","1":"54.2%","2":"61.9%","3":"56.6%","4":"61.1%","5":"82.6%","6":"77.5%","7":"44.4%","8":"73.6%","9":"78.5%","10":"94.4%","11":"42.1%","12":"97.8%","13":"100.9%","14":"71.9%","15":"65.8%","16":"77.9%","17":"55.6%","18":"78.0%","19":"90.1%","20":"57.6%","21":"61.9%","22":"58.8%","23":"71.1%","24":"64.5%","25":"56.6%","26":"71.9%","27":"74.9%"},"t \/ vap":{"0":"62.5%","1":"45.3%","2":"52.1%","3":"49.8%","4":"53.7%","5":"69.2%","6":"67.0%","7":"41.0%","8":"66.4%","9":"70.7%","10":"83.0%","11":"38.3%","12":"85.0%","13":"86.6%","14":"64.2%","15":"59.7%","16":"69.5%","17":"50.7%","18":"69.7%","19":"80.0%","20":"52.6%","21":"56.3%","22":"52.9%","23":"61.3%","24":"56.3%","25":"48.5%","26":"60.8%","27":"65.2%"},"v \/ vap":{"0":"56.6%","1":"40.4%","2":"47.7%","3":"46.4%","4":"47.9%","5":"62.1%","6":"60.9%","7":"37.2%","8":"59.1%","9":"63.7%","10":"73.9%","11":"34.5%","12":"79.2%","13":"78.8%","14":"60.4%","15":"54.5%","16":"61.2%","17":"46.4%","18":"61.6%","19":"71.9%","20":"47.2%","21":"51.5%","22":"48.9%","23":"55.6%","24":"52.3%","25":"45.2%","26":"56.1%","27":"59.9%"}}
date time visiting team home team site broadcast result attendance 0 september 25 12:21 pm uab tennessee neyland stadium knoxville , tn sec network w 32 - 29 2ot 95183 1 september 25 3:30 pm 1 alabama 10 arkansas razorback stadium fayetteville , ar cbs ala 24 - 20 76808 2 september 25 7:00 pm kentucky 9 florida ben hill griffin stadium gainesville , fl espnu fla 48 - 14 90547 3 september 25 7:00 pm georgia mississippi state davis wade stadium starkville , ms fsn msst 24 - 12 56721 4 september 25 7:30 pm fresno state ole miss vaught - hemingway stadium oxford , ms css w 55 - 38 55267 5 september 25 7:45 pm 12 south carolina 17 auburn jordan - hare stadium auburn , al espn aub 35 - 27 87237
{"date":{"0":"september 25","1":"september 25","2":"september 25","3":"september 25","4":"september 25","5":"september 25"},"time":{"0":"12:21 pm","1":"3:30 pm","2":"7:00 pm","3":"7:00 pm","4":"7:30 pm","5":"7:45 pm"},"visiting team":{"0":"uab","1":"1 alabama","2":"kentucky","3":"georgia","4":"fresno state","5":"12 south carolina"},"home team":{"0":"tennessee","1":"10 arkansas","2":"9 florida","3":"mississippi state","4":"ole miss","5":"17 auburn"},"site":{"0":"neyland stadium knoxville , tn","1":"razorback stadium fayetteville , ar","2":"ben hill griffin stadium gainesville , fl","3":"davis wade stadium starkville , ms","4":"vaught - hemingway stadium oxford , ms","5":"jordan - hare stadium auburn , al"},"broadcast":{"0":"sec network","1":"cbs","2":"espnu","3":"fsn","4":"css","5":"espn"},"result":{"0":"w 32 - 29 2ot","1":"ala 24 - 20","2":"fla 48 - 14","3":"msst 24 - 12","4":"w 55 - 38","5":"aub 35 - 27"},"attendance":{"0":95183,"1":76808,"2":90547,"3":56721,"4":55267,"5":87237}}
date time visiting team home team site broadcast result attendance 0 october 2 12:00 pm louisiana - monroe 10 auburn jordan - hare stadium auburn , al espnu w 52 - 3 80759 1 october 2 12:00 pm alcorn state mississippi state davis wade stadium starkville , ms fsn w 49 - 16 50439 2 october 2 12:00 pm vanderbilt connecticut rentschler field storrs , ct big east network l 21 - 40 40000 3 october 2 12:21 pm kentucky ole miss vaught - hemingway stadium oxford , ms sec network mis 42 - 35 55344 4 october 2 3:30 pm tennessee 12 lsu tiger stadium baton rouge , la cbs lsu 16 - 14 92932 5 october 2 4:30 pm georgia colorado folsom field boulder , co fsn l 27 - 29 52855
{"date":{"0":"october 2","1":"october 2","2":"october 2","3":"october 2","4":"october 2","5":"october 2"},"time":{"0":"12:00 pm","1":"12:00 pm","2":"12:00 pm","3":"12:21 pm","4":"3:30 pm","5":"4:30 pm"},"visiting team":{"0":"louisiana - monroe","1":"alcorn state","2":"vanderbilt","3":"kentucky","4":"tennessee","5":"georgia"},"home team":{"0":"10 auburn","1":"mississippi state","2":"connecticut","3":"ole miss","4":"12 lsu","5":"colorado"},"site":{"0":"jordan - hare stadium auburn , al","1":"davis wade stadium starkville , ms","2":"rentschler field storrs , ct","3":"vaught - hemingway stadium oxford , ms","4":"tiger stadium baton rouge , la","5":"folsom field boulder , co"},"broadcast":{"0":"espnu","1":"fsn","2":"big east network","3":"sec network","4":"cbs","5":"fsn"},"result":{"0":"w 52 - 3","1":"w 49 - 16","2":"l 21 - 40","3":"mis 42 - 35","4":"lsu 16 - 14","5":"l 27 - 29"},"attendance":{"0":80759,"1":50439,"2":40000,"3":55344,"4":92932,"5":52855}}
date time visiting team home team site broadcast result attendance 0 october 16 12:21 pm vanderbilt georgia sanford stadium athens , ga sec network uga 43 - 0 92746 1 october 16 3:30 pm no 12 arkansas no 7 auburn jordan - hare stadium auburn , al cbs aub 65 - 43 87451 2 october 16 6:00 pm no 10 south carolina kentucky commonwealth stadium lexington , ky espn2 uk 31 - 28 67955 3 october 16 7:00 pm mississippi state no 22 florida ben hill griffin stadium gainesville , fl espnu msst 10 - 7 90517 4 october 16 7:00 pm mcneese state lsu tiger stadium baton rouge , la fsn lsu 32 - 10 92576
{"date":{"0":"october 16","1":"october 16","2":"october 16","3":"october 16","4":"october 16"},"time":{"0":"12:21 pm","1":"3:30 pm","2":"6:00 pm","3":"7:00 pm","4":"7:00 pm"},"visiting team":{"0":"vanderbilt","1":"no 12 arkansas","2":"no 10 south carolina","3":"mississippi state","4":"mcneese state"},"home team":{"0":"georgia","1":"no 7 auburn","2":"kentucky","3":"no 22 florida","4":"lsu"},"site":{"0":"sanford stadium athens , ga","1":"jordan - hare stadium auburn , al","2":"commonwealth stadium lexington , ky","3":"ben hill griffin stadium gainesville , fl","4":"tiger stadium baton rouge , la"},"broadcast":{"0":"sec network","1":"cbs","2":"espn2","3":"espnu","4":"fsn"},"result":{"0":"uga 43 - 0","1":"aub 65 - 43","2":"uk 31 - 28","3":"msst 10 - 7","4":"lsu 32 - 10"},"attendance":{"0":92746,"1":87451,"2":67955,"3":90517,"4":92576}}
date time visiting team home team site broadcast result attendance 0 october 23 12:21 pm ole miss arkansas razorback stadium fayetteville , ar sec network ark 38 - 24 73619 1 october 23 3:30 pm lsu auburn jordan - hare stadium auburn , al cbs aub 24 - 17 87451 2 october 23 7:00 pm alabama tennessee neyland stadium knoxville , tn espn ala 41 - 10 102455 3 october 23 7:00 pm uab mississippi state davis - wade stadium starkville ms espnu msst 29 - 24 56423 4 october 23 7:00 pm south carolina vanderbilt vanderbilt stadium nashville , tn fsn usc 21 - 7 33425
{"date":{"0":"october 23","1":"october 23","2":"october 23","3":"october 23","4":"october 23"},"time":{"0":"12:21 pm","1":"3:30 pm","2":"7:00 pm","3":"7:00 pm","4":"7:00 pm"},"visiting team":{"0":"ole miss","1":"lsu","2":"alabama","3":"uab","4":"south carolina"},"home team":{"0":"arkansas","1":"auburn","2":"tennessee","3":"mississippi state","4":"vanderbilt"},"site":{"0":"razorback stadium fayetteville , ar","1":"jordan - hare stadium auburn , al","2":"neyland stadium knoxville , tn","3":"davis - wade stadium starkville ms","4":"vanderbilt stadium nashville , tn"},"broadcast":{"0":"sec network","1":"cbs","2":"espn","3":"espnu","4":"fsn"},"result":{"0":"ark 38 - 24","1":"aub 24 - 17","2":"ala 41 - 10","3":"msst 29 - 24","4":"usc 21 - 7"},"attendance":{"0":73619,"1":87451,"2":102455,"3":56423,"4":33425}}
date time visiting team home team site broadcast result attendance 0 september 2 7:30 pm southern miss south carolina williams - brice stadium columbia , sc espn w 41 - 13 70438 1 september 4 12:00 pm miami (oh) 4 florida ben hill griffin stadium gainesville , fl espn w 34 - 12 90178 2 september 4 12:21 pm louisiana - lafayette 23 georgia sanford stadium athens , ga sec network w 55 - 7 92746 3 september 4 3:30 pm kentucky louisville papa john 's cardinal stadium louisville , ky abc w 23 - 16 55327 4 september 4 3:30 pm jacksonville state mississippi vaught - hemingway stadium oxford , ms css l 48 - 49 2ot 55768 5 september 4 6:00 pm tennessee - martin tennessee neyland stadium knoxville , tn ppv w 50 - 0 99123 6 september 4 7:00 pm san jose state 1 alabama bryant - denny stadium tuscaloosa , al ppv w 48 - 3 101821 7 september 4 7:00 pm arkansas state 22 auburn jordan - hare stadium auburn , al fsn south w 52 - 26 83441 8 september 4 7:00 pm tennessee tech 17 arkansas razorback stadium fayetteville , ar ppv w 44 - 3 69596 9 september 4 7:00 pm memphis mississippi state davis wade stadium starkville , ms espnu w 49 - 7 56032 10 september 4 7:30 pm northwestern vanderbilt vanderbilt stadium nashville , tn css l 21 - 23 37210
{"date":{"0":"september 2","1":"september 4","2":"september 4","3":"september 4","4":"september 4","5":"september 4","6":"september 4","7":"september 4","8":"september 4","9":"september 4","10":"september 4"},"time":{"0":"7:30 pm","1":"12:00 pm","2":"12:21 pm","3":"3:30 pm","4":"3:30 pm","5":"6:00 pm","6":"7:00 pm","7":"7:00 pm","8":"7:00 pm","9":"7:00 pm","10":"7:30 pm"},"visiting team":{"0":"southern miss","1":"miami (oh)","2":"louisiana - lafayette","3":"kentucky","4":"jacksonville state","5":"tennessee - martin","6":"san jose state","7":"arkansas state","8":"tennessee tech","9":"memphis","10":"northwestern"},"home team":{"0":"south carolina","1":"4 florida","2":"23 georgia","3":"louisville","4":"mississippi","5":"tennessee","6":"1 alabama","7":"22 auburn","8":"17 arkansas","9":"mississippi state","10":"vanderbilt"},"site":{"0":"williams - brice stadium columbia , sc","1":"ben hill griffin stadium gainesville , fl","2":"sanford stadium athens , ga","3":"papa john 's cardinal stadium louisville , ky","4":"vaught - hemingway stadium oxford , ms","5":"neyland stadium knoxville , tn","6":"bryant - denny stadium tuscaloosa , al","7":"jordan - hare stadium auburn , al","8":"razorback stadium fayetteville , ar","9":"davis wade stadium starkville , ms","10":"vanderbilt stadium nashville , tn"},"broadcast":{"0":"espn","1":"espn","2":"sec network","3":"abc","4":"css","5":"ppv","6":"ppv","7":"fsn south","8":"ppv","9":"espnu","10":"css"},"result":{"0":"w 41 - 13","1":"w 34 - 12","2":"w 55 - 7","3":"w 23 - 16","4":"l 48 - 49 2ot","5":"w 50 - 0","6":"w 48 - 3","7":"w 52 - 26","8":"w 44 - 3","9":"w 49 - 7","10":"l 21 - 23"},"attendance":{"0":70438,"1":90178,"2":92746,"3":55327,"4":55768,"5":99123,"6":101821,"7":83441,"8":69596,"9":56032,"10":37210}}
date time visiting team home team site broadcast result attendance 0 september 9 7:30 pm 21 auburn mississippi state davis wade stadium starkville , ms espn aub 17 - 14 54806 1 september 11 12:00 pm 22 georgia 24 south carolina williams - brice stadium columbia , sc espn usc 17 - 6 80974 2 september 11 12:21 pm south florida 8 florida ben hill griffin stadium gainesville , fl sec network w 38 - 14 90612 3 september 11 7:00 pm 19 lsu vanderbilt vanderbilt stadium nashville , tn espnu lsu 27 - 3 36940 4 september 11 7:00 pm 19 penn state 1 alabama bryant - denny stadium tuscaloosa , al espn w 24 - 3 101821 5 september 11 7:00 pm louisiana - monroe 14 arkansas war memorial stadium little rock , ar fsn w 31 - 7 55705 6 september 11 7:00 pm 7 oregon tennessee neyland stadium knoxville , tn espn2 l 48 - 13 102035 7 september 11 7:30 pm western kentucky kentucky commonwealth stadium lexington , ky css w 63 - 28 66584
{"date":{"0":"september 9","1":"september 11","2":"september 11","3":"september 11","4":"september 11","5":"september 11","6":"september 11","7":"september 11"},"time":{"0":"7:30 pm","1":"12:00 pm","2":"12:21 pm","3":"7:00 pm","4":"7:00 pm","5":"7:00 pm","6":"7:00 pm","7":"7:30 pm"},"visiting team":{"0":"21 auburn","1":"22 georgia","2":"south florida","3":"19 lsu","4":"19 penn state","5":"louisiana - monroe","6":"7 oregon","7":"western kentucky"},"home team":{"0":"mississippi state","1":"24 south carolina","2":"8 florida","3":"vanderbilt","4":"1 alabama","5":"14 arkansas","6":"tennessee","7":"kentucky"},"site":{"0":"davis wade stadium starkville , ms","1":"williams - brice stadium columbia , sc","2":"ben hill griffin stadium gainesville , fl","3":"vanderbilt stadium nashville , tn","4":"bryant - denny stadium tuscaloosa , al","5":"war memorial stadium little rock , ar","6":"neyland stadium knoxville , tn","7":"commonwealth stadium lexington , ky"},"broadcast":{"0":"espn","1":"espn","2":"sec network","3":"espnu","4":"espn","5":"fsn","6":"espn2","7":"css"},"result":{"0":"aub 17 - 14","1":"usc 17 - 6","2":"w 38 - 14","3":"lsu 27 - 3","4":"w 24 - 3","5":"w 31 - 7","6":"l 48 - 13","7":"w 63 - 28"},"attendance":{"0":54806,"1":80974,"2":90612,"3":36940,"4":101821,"5":55705,"6":102035,"7":66584}}
date time visiting team home team site broadcast result attendance 0 september 18 12:00 pm 12 arkansas georgia sanford stadium athens , ga espn ark 31 - 24 92746 1 september 18 12:21 pm vanderbilt ole miss vaught - hemingway stadium oxford , ms sec network van 28 - 14 51667 2 september 18 3:30 pm 10 florida tennessee neyland stadium knoxville , tn cbs fla 31 - 17 102455 3 september 18 3:30 pm 1 alabama duke wallace wade stadium durham , nc abc w 62 - 13 39042 4 september 18 7:00 pm mississippi state 15 lsu tiger stadium baton rouge , la espnu lsu 29 - 7 92538 5 september 18 7:00 pm clemson 16 auburn jordan - hare stadium auburn , al espn w 27 - 24 ot 87451 6 september 18 7:00 pm akron kentucky commonwealth stadium lexington , ky fsn w 47 - 10 64014
{"date":{"0":"september 18","1":"september 18","2":"september 18","3":"september 18","4":"september 18","5":"september 18","6":"september 18"},"time":{"0":"12:00 pm","1":"12:21 pm","2":"3:30 pm","3":"3:30 pm","4":"7:00 pm","5":"7:00 pm","6":"7:00 pm"},"visiting team":{"0":"12 arkansas","1":"vanderbilt","2":"10 florida","3":"1 alabama","4":"mississippi state","5":"clemson","6":"akron"},"home team":{"0":"georgia","1":"ole miss","2":"tennessee","3":"duke","4":"15 lsu","5":"16 auburn","6":"kentucky"},"site":{"0":"sanford stadium athens , ga","1":"vaught - hemingway stadium oxford , ms","2":"neyland stadium knoxville , tn","3":"wallace wade stadium durham , nc","4":"tiger stadium baton rouge , la","5":"jordan - hare stadium auburn , al","6":"commonwealth stadium lexington , ky"},"broadcast":{"0":"espn","1":"sec network","2":"cbs","3":"abc","4":"espnu","5":"espn","6":"fsn"},"result":{"0":"ark 31 - 24","1":"van 28 - 14","2":"fla 31 - 17","3":"w 62 - 13","4":"lsu 29 - 7","5":"w 27 - 24 ot","6":"w 47 - 10"},"attendance":{"0":92746,"1":51667,"2":102455,"3":39042,"4":92538,"5":87451,"6":64014}}
no in series no in season title directed by written by original air date production code us viewers (millions) 0 45 1 friends and enemies tim matheson matt nix june 3 , 2010 bn401 6.62 1 46 2 fast friends dennie gordon rashad raisani june 10 , 2010 bn402 5.67 2 47 3 made man jeffrey donovan alfredo barrios , jr june 17 , 2010 bn403 5.31 3 48 4 breach of faith jeremiah chechik ben watkins june 24 , 2010 bn404 5.33 4 49 5 neighborhood watch kevin bray michael horowitz july 1 , 2010 bn405 5.21 5 50 6 entry point jeffrey hunt craig o'neill july 15 , 2010 bn406 5.65 6 51 7 past & future tense jeremiah chechik jason tracey july 22 , 2010 bn407 5.87 7 52 8 where there 's smoke kevin bray lisa joy july 29 , 2010 bn408 5.38 8 53 9 center of the storm colin bucksey ryan johnson & peter lalayanis august 5 , 2010 bn409 5.69 9 54 10 hard time dennie gordon alfredo barrios , jr august 12 , 2010 bn410 5.57 10 55 11 blind spot michael smith michael horowitz august 19 , 2010 bn411 5.50 11 56 12 guilty as charged jeremiah chechik matt nix august 26 , 2010 bn412 6.29 12 57 13 eyes open dennie gordon jason tracey november 11 , 2010 bn413 4.32 13 58 14 hot property jonathan frakes rashad raisani november 18 , 2010 bn414 3.50 14 59 15 brotherly love terry miller ben watkins december 2 , 2010 bn415 3.70 15 60 16 dead or alive peter markle lisa joy december 9 , 2010 bn416 4.34 16 61 17 out of the fire marc roskin craig o'neill december 16 , 2010 bn417 4.77
{"no in series":{"0":45,"1":46,"2":47,"3":48,"4":49,"5":50,"6":51,"7":52,"8":53,"9":54,"10":55,"11":56,"12":57,"13":58,"14":59,"15":60,"16":61},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17},"title":{"0":"friends and enemies","1":"fast friends","2":"made man","3":"breach of faith","4":"neighborhood watch","5":"entry point","6":"past & future tense","7":"where there 's smoke","8":"center of the storm","9":"hard time","10":"blind spot","11":"guilty as charged","12":"eyes open","13":"hot property","14":"brotherly love","15":"dead or alive","16":"out of the fire"},"directed by":{"0":"tim matheson","1":"dennie gordon","2":"jeffrey donovan","3":"jeremiah chechik","4":"kevin bray","5":"jeffrey hunt","6":"jeremiah chechik","7":"kevin bray","8":"colin bucksey","9":"dennie gordon","10":"michael smith","11":"jeremiah chechik","12":"dennie gordon","13":"jonathan frakes","14":"terry miller","15":"peter markle","16":"marc roskin"},"written by":{"0":"matt nix","1":"rashad raisani","2":"alfredo barrios , jr","3":"ben watkins","4":"michael horowitz","5":"craig o'neill","6":"jason tracey","7":"lisa joy","8":"ryan johnson & peter lalayanis","9":"alfredo barrios , jr","10":"michael horowitz","11":"matt nix","12":"jason tracey","13":"rashad raisani","14":"ben watkins","15":"lisa joy","16":"craig o'neill"},"original air date":{"0":"june 3 , 2010","1":"june 10 , 2010","2":"june 17 , 2010","3":"june 24 , 2010","4":"july 1 , 2010","5":"july 15 , 2010","6":"july 22 , 2010","7":"july 29 , 2010","8":"august 5 , 2010","9":"august 12 , 2010","10":"august 19 , 2010","11":"august 26 , 2010","12":"november 11 , 2010","13":"november 18 , 2010","14":"december 2 , 2010","15":"december 9 , 2010","16":"december 16 , 2010"},"production code":{"0":"bn401","1":"bn402","2":"bn403","3":"bn404","4":"bn405","5":"bn406","6":"bn407","7":"bn408","8":"bn409","9":"bn410","10":"bn411","11":"bn412","12":"bn413","13":"bn414","14":"bn415","15":"bn416","16":"bn417"},"us viewers (millions)":{"0":6.62,"1":5.67,"2":5.31,"3":5.33,"4":5.21,"5":5.65,"6":5.87,"7":5.38,"8":5.69,"9":5.57,"10":5.5,"11":6.29,"12":4.32,"13":3.5,"14":3.7,"15":4.34,"16":4.77}}
round home team win / loss score opposition location 0 round 1 wanganui win 71 - 6 east coast wanganui 1 round 2 wanganui win 43 - 0 thames valley paeroa 2 round 3 wanganui win 36 - 16 poverty bay wanganui 3 round 4 wanganui win 47 - 19 king country te kuiti 4 round 5 wanganui win 43 - 12 mid canterbury wanganui 5 round 6 wanganui win 42 - 10 buller wanganui 6 round 7 wanganui win 52 - 7 west coast westport 7 round 8 wanganui win 19 - 8 north otago wanganui 8 semi final wanganui win 40 - 18 west coast wanganui
{"round":{"0":"round 1","1":"round 2","2":"round 3","3":"round 4","4":"round 5","5":"round 6","6":"round 7","7":"round 8","8":"semi final"},"home team":{"0":"wanganui","1":"wanganui","2":"wanganui","3":"wanganui","4":"wanganui","5":"wanganui","6":"wanganui","7":"wanganui","8":"wanganui"},"win \/ loss":{"0":"win","1":"win","2":"win","3":"win","4":"win","5":"win","6":"win","7":"win","8":"win"},"score":{"0":"71 - 6","1":"43 - 0","2":"36 - 16","3":"47 - 19","4":"43 - 12","5":"42 - 10","6":"52 - 7","7":"19 - 8","8":"40 - 18"},"opposition":{"0":"east coast","1":"thames valley","2":"poverty bay","3":"king country","4":"mid canterbury","5":"buller","6":"west coast","7":"north otago","8":"west coast"},"location":{"0":"wanganui","1":"paeroa","2":"wanganui","3":"te kuiti","4":"wanganui","5":"wanganui","6":"westport","7":"wanganui","8":"wanganui"}}
round home team win / loss score opposition location 0 round 1 wanganui win 46 - 6 east coast wanganui 1 round 2 wanganui loss 17 - 21 wairarapa bush masterton 2 round 3 wanganui win 37 - 28 horowhenua kapiti wanganui 3 round 4 wanganui win 13 - 7 buller westport 4 round 5 wanganui win 33 - 9 west coast wanganui 5 round 6 wanganui win 59 - 14 south canterbury wanganui 6 round 7 wanganui loss 14 - 23 mid canterbury ashburton 7 round 8 wanganui win 56 - 0 poverty bay wanganui 8 semi final wanganui win 48 - 13 poverty bay wanganui
{"round":{"0":"round 1","1":"round 2","2":"round 3","3":"round 4","4":"round 5","5":"round 6","6":"round 7","7":"round 8","8":"semi final"},"home team":{"0":"wanganui","1":"wanganui","2":"wanganui","3":"wanganui","4":"wanganui","5":"wanganui","6":"wanganui","7":"wanganui","8":"wanganui"},"win \/ loss":{"0":"win","1":"loss","2":"win","3":"win","4":"win","5":"win","6":"loss","7":"win","8":"win"},"score":{"0":"46 - 6","1":"17 - 21","2":"37 - 28","3":"13 - 7","4":"33 - 9","5":"59 - 14","6":"14 - 23","7":"56 - 0","8":"48 - 13"},"opposition":{"0":"east coast","1":"wairarapa bush","2":"horowhenua kapiti","3":"buller","4":"west coast","5":"south canterbury","6":"mid canterbury","7":"poverty bay","8":"poverty bay"},"location":{"0":"wanganui","1":"masterton","2":"wanganui","3":"westport","4":"wanganui","5":"wanganui","6":"ashburton","7":"wanganui","8":"wanganui"}}
series episode title director writer original airdate 0 12 1 interview with an angel helaine heed marilyn osborn martha williamson september 23 , 1995 1 13 2 trust victor lobl julie sebo september 30 , 1995 2 14 3 sympathy for the devil tim van patten rj colleary october 7 , 1995 3 15 4 the driver tim van patten glenn berenbeim october 14 , 1995 4 16 5 angels on the air bruce bilson rj colleary october 21 , 1995 5 17 6 in the name of god tim van patten martha williamson october 28 , 1995 6 18 7 reunion victor lobl valerie woods november 4 , 1995 7 19 8 operation smile nancy malone glen berenbeim rj colleary martha williamson november 11 , 1995 8 20 9 the big bang chuck bowman ken lazebnik november 25 , 1995 9 21 10 unidentified female michael schultz martha williamson december 2 , 1995 10 22 11 the feather gene reynolds valerie woods ken lazebnik robin sheets december 16 , 1995 11 23 12 the one that got away victoria hochberg debbie smith danna doyle january 6 , 1996 12 24 13 'til we meet again tim van patten martha williamson january 13 , 1996 13 25 14 rock n' roll dad tim van patten andrew smith january 20 , 1996 14 26 15 indigo angel jon andersen glenn berenbeim rj colleary february 3 , 1996 15 27 16 jacob 's ladder michael schultz martha williamson february 10 , 1996 16 28 17 out of the darkness victoria hochberg rj colleary february 17 , 1996 17 29 18 lost and found bethany rooney debbie smith danna doyle february 24 , 1996 18 30 19 dear god tim van patten glenn berenbeim march 9 , 1996 19 31 20 portrait of mrs campbell victor lobl susan cridland wick march 23 , 1996 20 32 21 the quality of mercy chuck bowman andrew smith april 27 , 1996 21 33 22 flesh and blood jon andersen rj colleary may 4 , 1996 22 34 23 birthmarks peter hunt ken lazebnik may 11 , 1996
{"series":{"0":12,"1":13,"2":14,"3":15,"4":16,"5":17,"6":18,"7":19,"8":20,"9":21,"10":22,"11":23,"12":24,"13":25,"14":26,"15":27,"16":28,"17":29,"18":30,"19":31,"20":32,"21":33,"22":34},"episode":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21,"21":22,"22":23},"title":{"0":"interview with an angel","1":"trust","2":"sympathy for the devil","3":"the driver","4":"angels on the air","5":"in the name of god","6":"reunion","7":"operation smile","8":"the big bang","9":"unidentified female","10":"the feather","11":"the one that got away","12":"'til we meet again","13":"rock n' roll dad","14":"indigo angel","15":"jacob 's ladder","16":"out of the darkness","17":"lost and found","18":"dear god","19":"portrait of mrs campbell","20":"the quality of mercy","21":"flesh and blood","22":"birthmarks"},"director":{"0":"helaine heed","1":"victor lobl","2":"tim van patten","3":"tim van patten","4":"bruce bilson","5":"tim van patten","6":"victor lobl","7":"nancy malone","8":"chuck bowman","9":"michael schultz","10":"gene reynolds","11":"victoria hochberg","12":"tim van patten","13":"tim van patten","14":"jon andersen","15":"michael schultz","16":"victoria hochberg","17":"bethany rooney","18":"tim van patten","19":"victor lobl","20":"chuck bowman","21":"jon andersen","22":"peter hunt"},"writer":{"0":"marilyn osborn martha williamson","1":"julie sebo","2":"rj colleary","3":"glenn berenbeim","4":"rj colleary","5":"martha williamson","6":"valerie woods","7":"glen berenbeim rj colleary martha williamson","8":"ken lazebnik","9":"martha williamson","10":"valerie woods ken lazebnik robin sheets","11":"debbie smith danna doyle","12":"martha williamson","13":"andrew smith","14":"glenn berenbeim rj colleary","15":"martha williamson","16":"rj colleary","17":"debbie smith danna doyle","18":"glenn berenbeim","19":"susan cridland wick","20":"andrew smith","21":"rj colleary","22":"ken lazebnik"},"original airdate":{"0":"september 23 , 1995","1":"september 30 , 1995","2":"october 7 , 1995","3":"october 14 , 1995","4":"october 21 , 1995","5":"october 28 , 1995","6":"november 4 , 1995","7":"november 11 , 1995","8":"november 25 , 1995","9":"december 2 , 1995","10":"december 16 , 1995","11":"january 6 , 1996","12":"january 13 , 1996","13":"january 20 , 1996","14":"february 3 , 1996","15":"february 10 , 1996","16":"february 17 , 1996","17":"february 24 , 1996","18":"march 9 , 1996","19":"march 23 , 1996","20":"april 27 , 1996","21":"may 4 , 1996","22":"may 11 , 1996"}}
series episode title director writer original airdate 0 36 1 promised land michael schultz martha williamson september 15 , 1996 1 37 2 a joyful noise peter h hunt katherine ann jones september 21 , 1996 2 38 3 random acts tim van patten rj colleary martha williamson september 22 , 1996 3 39 4 sins of the father tim van patten debbie smith danna doyle september 29 , 1996 4 40 5 written in dust peter hunt ken lazebnik october 6 , 1996 5 41 6 secret service bethany rooney kathleen mcghee - anderson october 13 , 1996 6 42 7 groundrush peter hunt burt pearl october 27 , 1996 7 43 8 the sky is falling victor lobl glenn berenbeim november 3 , 1996 8 44 9 something blue terrence o'hara susan cridland wick jennifer wharton november 10 , 1996 9 45 10 into the light victor lobl rj colleary november 17 , 1996 10 46 11 homecoming (1) peter hunt martha williamson william schwartz november 24 , 1996 11 47 12 the journalist tim van patten ken lazebnik december 1 , 1996 12 48 13 the violin lesson peter hunt glenn berenbeim december 22 , 1996 13 49 14 forget me not michael schultz burt pearl january 12 , 1997 14 50 15 smokescreen victor lobl christine pettit rosanne welch january 19 , 1997 15 51 16 crisis of faith peter hunt william schwartz february 2 , 1997 16 52 17 angel of death tim van patten glenn berenbeim february 9 , 1997 17 53 18 clipped wings robert j visciglia jr rj colleary february 16 , 1997 18 54 19 amazing grace (1) victor lobl martha williamson february 23 , 1997 19 55 20 amazing grace (2) victor lobl martha williamson ef wallengren william schwartz february 25 , 1997 20 56 21 labor of love jim johnston susan cridland wick march 9 , 1997 21 57 22 have you seen me stuart margolin pamela redford russell march 16 , 1997 22 58 23 last call gene reynolds ken lazebnik march 30 , 1997 23 59 24 missing in action tim van patten rosanne welch christine pettit april 13 , 1997 24 60 25 risk victor lobl kathleen mcghee - anderson april 27 , 1997 25 61 26 full moon tim van patten glenn berenbeim may 4 , 1997 26 62 27 an angel by any other name gabrielle beaumont burt pearl may 10 , 1997 27 63 28 inherit the wind michael schultz rj colleary may 11 , 1997
{"series":{"0":36,"1":37,"2":38,"3":39,"4":40,"5":41,"6":42,"7":43,"8":44,"9":45,"10":46,"11":47,"12":48,"13":49,"14":50,"15":51,"16":52,"17":53,"18":54,"19":55,"20":56,"21":57,"22":58,"23":59,"24":60,"25":61,"26":62,"27":63},"episode":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21,"21":22,"22":23,"23":24,"24":25,"25":26,"26":27,"27":28},"title":{"0":"promised land","1":"a joyful noise","2":"random acts","3":"sins of the father","4":"written in dust","5":"secret service","6":"groundrush","7":"the sky is falling","8":"something blue","9":"into the light","10":"homecoming (1)","11":"the journalist","12":"the violin lesson","13":"forget me not","14":"smokescreen","15":"crisis of faith","16":"angel of death","17":"clipped wings","18":"amazing grace (1)","19":"amazing grace (2)","20":"labor of love","21":"have you seen me","22":"last call","23":"missing in action","24":"risk","25":"full moon","26":"an angel by any other name","27":"inherit the wind"},"director":{"0":"michael schultz","1":"peter h hunt","2":"tim van patten","3":"tim van patten","4":"peter hunt","5":"bethany rooney","6":"peter hunt","7":"victor lobl","8":"terrence o'hara","9":"victor lobl","10":"peter hunt","11":"tim van patten","12":"peter hunt","13":"michael schultz","14":"victor lobl","15":"peter hunt","16":"tim van patten","17":"robert j visciglia jr","18":"victor lobl","19":"victor lobl","20":"jim johnston","21":"stuart margolin","22":"gene reynolds","23":"tim van patten","24":"victor lobl","25":"tim van patten","26":"gabrielle beaumont","27":"michael schultz"},"writer":{"0":"martha williamson","1":"katherine ann jones","2":"rj colleary martha williamson","3":"debbie smith danna doyle","4":"ken lazebnik","5":"kathleen mcghee - anderson","6":"burt pearl","7":"glenn berenbeim","8":"susan cridland wick jennifer wharton","9":"rj colleary","10":"martha williamson william schwartz","11":"ken lazebnik","12":"glenn berenbeim","13":"burt pearl","14":"christine pettit rosanne welch","15":"william schwartz","16":"glenn berenbeim","17":"rj colleary","18":"martha williamson","19":"martha williamson ef wallengren william schwartz","20":"susan cridland wick","21":"pamela redford russell","22":"ken lazebnik","23":"rosanne welch christine pettit","24":"kathleen mcghee - anderson","25":"glenn berenbeim","26":"burt pearl","27":"rj colleary"},"original airdate":{"0":"september 15 , 1996","1":"september 21 , 1996","2":"september 22 , 1996","3":"september 29 , 1996","4":"october 6 , 1996","5":"october 13 , 1996","6":"october 27 , 1996","7":"november 3 , 1996","8":"november 10 , 1996","9":"november 17 , 1996","10":"november 24 , 1996","11":"december 1 , 1996","12":"december 22 , 1996","13":"january 12 , 1997","14":"january 19 , 1997","15":"february 2 , 1997","16":"february 9 , 1997","17":"february 16 , 1997","18":"february 23 , 1997","19":"february 25 , 1997","20":"march 9 , 1997","21":"march 16 , 1997","22":"march 30 , 1997","23":"april 13 , 1997","24":"april 27 , 1997","25":"may 4 , 1997","26":"may 10 , 1997","27":"may 11 , 1997"}}
series season title director writer original airdate 0 65 1 the road home (1) tim van patten ef wallengren mimi schmir september 21 , 1997 1 67 3 nothing but net victor lobl daniel h forer rj colleary october 5 , 1997 2 68 4 children of the night victor lobl suzonne stirling october 12 , 1997 3 69 5 jones vs god sandor stern ken lazebnik october 19 , 1997 4 70 6 the pact bethany rooney jennifer wharton melissa milne october 26 , 1997 5 71 7 sandcastles victor lobl burt pearl november 2 , 1997 6 72 8 my dinner with andrew gabrielle beaumont martha williamson november 9 , 1997 7 73 9 charades victor lobl glenn berenbeim november 16 , 1997 8 74 10 the comeback sandor stern kenny solms november 23 , 1997 9 75 11 venice gabrielle beaumont rj colleary december 7 , 1997 10 76 12 it came upon a midnight clear michael schultz ken lazebnik december 21 , 1997 11 77 13 deconstructing harry burt brinckerhoff burt pearl january 4 , 1998 12 78 14 the trigger peter hunt rosanne welch christine pettit january 11 , 1998 13 79 15 doodlebugs terrance o'hara ken lazebnik january 18 , 1998 14 80 16 redeeming love burt brinckerhoff marilyn osborn kathleen mcghee - anderson february 1 , 1998 15 81 17 flights of angels peter hunt sally storch bunkall sally howell march 1 , 1998 16 82 18 breaking bread peter hunt burt pearl march 8 , 1998 17 83 19 god and country bethany rooney rj colleary glenn berenbeim march 15 , 1998 18 84 20 how do you spell faith bethany rooney michael glassberg march 29 , 1998 19 85 21 seek and ye shall find victor lobl glenn berenbeim april 5 , 1998 20 86 22 cry , and you cry alone rj colleary gene reynolds april 12 , 1998 21 87 23 perfect little angel terrence o'hara susan cridland wick ann elder jeannine tree april 26 , 1998 22 88 24 elijah peter h hunt glenn berenbeim may 3 , 1998
{"series":{"0":65,"1":67,"2":68,"3":69,"4":70,"5":71,"6":72,"7":73,"8":74,"9":75,"10":76,"11":77,"12":78,"13":79,"14":80,"15":81,"16":82,"17":83,"18":84,"19":85,"20":86,"21":87,"22":88},"season":{"0":1,"1":3,"2":4,"3":5,"4":6,"5":7,"6":8,"7":9,"8":10,"9":11,"10":12,"11":13,"12":14,"13":15,"14":16,"15":17,"16":18,"17":19,"18":20,"19":21,"20":22,"21":23,"22":24},"title":{"0":"the road home (1)","1":"nothing but net","2":"children of the night","3":"jones vs god","4":"the pact","5":"sandcastles","6":"my dinner with andrew","7":"charades","8":"the comeback","9":"venice","10":"it came upon a midnight clear","11":"deconstructing harry","12":"the trigger","13":"doodlebugs","14":"redeeming love","15":"flights of angels","16":"breaking bread","17":"god and country","18":"how do you spell faith","19":"seek and ye shall find","20":"cry , and you cry alone","21":"perfect little angel","22":"elijah"},"director":{"0":"tim van patten","1":"victor lobl","2":"victor lobl","3":"sandor stern","4":"bethany rooney","5":"victor lobl","6":"gabrielle beaumont","7":"victor lobl","8":"sandor stern","9":"gabrielle beaumont","10":"michael schultz","11":"burt brinckerhoff","12":"peter hunt","13":"terrance o'hara","14":"burt brinckerhoff","15":"peter hunt","16":"peter hunt","17":"bethany rooney","18":"bethany rooney","19":"victor lobl","20":"rj colleary","21":"terrence o'hara","22":"peter h hunt"},"writer":{"0":"ef wallengren mimi schmir","1":"daniel h forer rj colleary","2":"suzonne stirling","3":"ken lazebnik","4":"jennifer wharton melissa milne","5":"burt pearl","6":"martha williamson","7":"glenn berenbeim","8":"kenny solms","9":"rj colleary","10":"ken lazebnik","11":"burt pearl","12":"rosanne welch christine pettit","13":"ken lazebnik","14":"marilyn osborn kathleen mcghee - anderson","15":"sally storch bunkall sally howell","16":"burt pearl","17":"rj colleary glenn berenbeim","18":"michael glassberg","19":"glenn berenbeim","20":"gene reynolds","21":"susan cridland wick ann elder jeannine tree","22":"glenn berenbeim"},"original airdate":{"0":"september 21 , 1997","1":"october 5 , 1997","2":"october 12 , 1997","3":"october 19 , 1997","4":"october 26 , 1997","5":"november 2 , 1997","6":"november 9 , 1997","7":"november 16 , 1997","8":"november 23 , 1997","9":"december 7 , 1997","10":"december 21 , 1997","11":"january 4 , 1998","12":"january 11 , 1998","13":"january 18 , 1998","14":"february 1 , 1998","15":"march 1 , 1998","16":"march 8 , 1998","17":"march 15 , 1998","18":"march 29 , 1998","19":"april 5 , 1998","20":"april 12 , 1998","21":"april 26 , 1998","22":"may 3 , 1998"}}
series episode title director writer original airdate 0 91 1 miles to go before i sleep peter h hunt peter h hunt september 20 , 1998 1 92 2 vengeance is mine (1 and 2) victor lobl steven phillip smith september 27 , 1998 2 93 3 what are friends for peter h hunt martha williamson october 4 , 1998 3 94 4 only connect tim van patten ken lazebnik october 11 , 1998 4 95 5 the lady of the lake michael scott burt pearl october 18 , 1998 5 96 6 beautiful dreamer peter h hunt martha williamson glenn berenbeim october 25 , 1998 6 97 7 i do victor lobl rj colleary november 1 , 1998 7 98 8 the wind beneath our wings stuart margolin rosanne welch november 8 , 1998 8 99 9 the peacemaker peter h hunt christine pettit november 15 , 1998 9 100 10 psalm 151 sandor stern martha williamson november 22 , 1998 10 101 11 an angel on the roof stuart margolin ken lazebnik december 13 , 1998 11 102 12 fool for love peter h hunt susan cridland wick burt pearl january 3 , 1999 12 103 13 the medium and the message noel nosseck rj colleary january 10 , 1999 13 104 14 my brother 's keeper peter h hunt hoot maynard jennifer wharton february 7 , 1999 14 105 15 on edge tim van patten rj colleary february 14 , 1999 15 106 16 the man upstairs peter h hunt glenn berenbeim february 21 , 1999 16 107 17 family business tim van patten martha williamson rj colleary february 28 , 1999 17 108 18 anatomy lesson sandor stern ken lazebnik march 7 , 1999 18 109 19 jagged edges gregory harrison jennifer wharton burt pearl march 28 , 1999 19 110 20 into the fire tim van patten brian bird april 4 , 1999 20 111 21 made in the usa bethany rooney christine pettit rosanne welch april 11 , 1999 21 112 22 full circle victor lobl daniel h forer april 25 , 1999 22 113 23 black like monica tim van patten martha williamson may 2 , 1999 23 114 24 fighting the good fight tim van patten michael glassberg may 9 , 1999 24 115 25 hearts victor lobl susan cridland wick rj colleary may 16 , 1999
{"series":{"0":91,"1":92,"2":93,"3":94,"4":95,"5":96,"6":97,"7":98,"8":99,"9":100,"10":101,"11":102,"12":103,"13":104,"14":105,"15":106,"16":107,"17":108,"18":109,"19":110,"20":111,"21":112,"22":113,"23":114,"24":115},"episode":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21,"21":22,"22":23,"23":24,"24":25},"title":{"0":"miles to go before i sleep","1":"vengeance is mine (1 and 2)","2":"what are friends for","3":"only connect","4":"the lady of the lake","5":"beautiful dreamer","6":"i do","7":"the wind beneath our wings","8":"the peacemaker","9":"psalm 151","10":"an angel on the roof","11":"fool for love","12":"the medium and the message","13":"my brother 's keeper","14":"on edge","15":"the man upstairs","16":"family business","17":"anatomy lesson","18":"jagged edges","19":"into the fire","20":"made in the usa","21":"full circle","22":"black like monica","23":"fighting the good fight","24":"hearts"},"director":{"0":"peter h hunt","1":"victor lobl","2":"peter h hunt","3":"tim van patten","4":"michael scott","5":"peter h hunt","6":"victor lobl","7":"stuart margolin","8":"peter h hunt","9":"sandor stern","10":"stuart margolin","11":"peter h hunt","12":"noel nosseck","13":"peter h hunt","14":"tim van patten","15":"peter h hunt","16":"tim van patten","17":"sandor stern","18":"gregory harrison","19":"tim van patten","20":"bethany rooney","21":"victor lobl","22":"tim van patten","23":"tim van patten","24":"victor lobl"},"writer":{"0":"peter h hunt","1":"steven phillip smith","2":"martha williamson","3":"ken lazebnik","4":"burt pearl","5":"martha williamson glenn berenbeim","6":"rj colleary","7":"rosanne welch","8":"christine pettit","9":"martha williamson","10":"ken lazebnik","11":"susan cridland wick burt pearl","12":"rj colleary","13":"hoot maynard jennifer wharton","14":"rj colleary","15":"glenn berenbeim","16":"martha williamson rj colleary","17":"ken lazebnik","18":"jennifer wharton burt pearl","19":"brian bird","20":"christine pettit rosanne welch","21":"daniel h forer","22":"martha williamson","23":"michael glassberg","24":"susan cridland wick rj colleary"},"original airdate":{"0":"september 20 , 1998","1":"september 27 , 1998","2":"october 4 , 1998","3":"october 11 , 1998","4":"october 18 , 1998","5":"october 25 , 1998","6":"november 1 , 1998","7":"november 8 , 1998","8":"november 15 , 1998","9":"november 22 , 1998","10":"december 13 , 1998","11":"january 3 , 1999","12":"january 10 , 1999","13":"february 7 , 1999","14":"february 14 , 1999","15":"february 21 , 1999","16":"february 28 , 1999","17":"march 7 , 1999","18":"march 28 , 1999","19":"april 4 , 1999","20":"april 11 , 1999","21":"april 25 , 1999","22":"may 2 , 1999","23":"may 9 , 1999","24":"may 16 , 1999"}}
series season title director writer original air date 0 117 1 such a time as this martha mitchell martha williamson september 26 , 1999 1 118 2 the compass peter h hunt glenn berenbeim martha williamson october 3 , 1999 2 119 3 the last day of the rest of your life rj visciglia , jr burt pearl october 10 , 1999 3 120 4 the letter peter h hunt danna doyle october 17 , 1999 4 121 5 til death do us part tim van patten rosanne welch christine pettit october 24 , 1999 5 122 6 the occupant larry peerce jon andersen october 31 , 1999 6 123 7 voice of an angel peter h hunt glenn berenbeim november 14 , 1999 7 124 8 the whole truth and nothing but sandor stern kenny solms brian bird november 21 , 1999 8 125 9 then sings my soul peter h hunt burt pearl glenn berenbeim november 28 , 1999 9 126 10 the christmas gift stuart margolin ken lazebnik patrice chanel december 12 , 1999 10 127 11 millennium robert j visciglia , jr martha williamson january 2 , 2000 11 128 12 with god as my witness stuart margolin rj colleary january 9 , 2000 12 129 13 a house divided bethany rooney rosanne welch january 23 , 2000 13 130 14 buy me a rose peter h hunt rj colleary february 6 , 2000 14 131 15 life before death martha mitchell glenn berenbeim february 6 , 2000 15 132 16 the perfect game martha mitchell burt pearl february 20 , 2000 16 133 17 here i am joel j feigenbaum ken lazebnik february 27 , 2000 17 134 18 bar mitzvah jeff kanew allen estrin joseph telushkin march 12 , 2000 18 135 19 true confessions larry peerce brian bird march 19 , 2000 19 136 20 quality time rosanne welch peter h hunt april 2 , 2000 20 137 21 living the rest of my life tim van patten della reese april 9 , 2000 21 138 22 stealing hope peter h hunt jason jersey april 23 , 2000 22 139 23 monica 's bad day tim van patten rj colleary april 30 , 2000 23 140 24 a clown 's prayer larry peerce glenn berenbeim may 7 , 2000 24 141 25 mother 's day victor lobl martha williamson may 14 , 2000
{"series":{"0":117,"1":118,"2":119,"3":120,"4":121,"5":122,"6":123,"7":124,"8":125,"9":126,"10":127,"11":128,"12":129,"13":130,"14":131,"15":132,"16":133,"17":134,"18":135,"19":136,"20":137,"21":138,"22":139,"23":140,"24":141},"season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21,"21":22,"22":23,"23":24,"24":25},"title":{"0":"such a time as this","1":"the compass","2":"the last day of the rest of your life","3":"the letter","4":"til death do us part","5":"the occupant","6":"voice of an angel","7":"the whole truth and nothing but","8":"then sings my soul","9":"the christmas gift","10":"millennium","11":"with god as my witness","12":"a house divided","13":"buy me a rose","14":"life before death","15":"the perfect game","16":"here i am","17":"bar mitzvah","18":"true confessions","19":"quality time","20":"living the rest of my life","21":"stealing hope","22":"monica 's bad day","23":"a clown 's prayer","24":"mother 's day"},"director":{"0":"martha mitchell","1":"peter h hunt","2":"rj visciglia , jr","3":"peter h hunt","4":"tim van patten","5":"larry peerce","6":"peter h hunt","7":"sandor stern","8":"peter h hunt","9":"stuart margolin","10":"robert j visciglia , jr","11":"stuart margolin","12":"bethany rooney","13":"peter h hunt","14":"martha mitchell","15":"martha mitchell","16":"joel j feigenbaum","17":"jeff kanew","18":"larry peerce","19":"rosanne welch","20":"tim van patten","21":"peter h hunt","22":"tim van patten","23":"larry peerce","24":"victor lobl"},"writer":{"0":"martha williamson","1":"glenn berenbeim martha williamson","2":"burt pearl","3":"danna doyle","4":"rosanne welch christine pettit","5":"jon andersen","6":"glenn berenbeim","7":"kenny solms brian bird","8":"burt pearl glenn berenbeim","9":"ken lazebnik patrice chanel","10":"martha williamson","11":"rj colleary","12":"rosanne welch","13":"rj colleary","14":"glenn berenbeim","15":"burt pearl","16":"ken lazebnik","17":"allen estrin joseph telushkin","18":"brian bird","19":"peter h hunt","20":"della reese","21":"jason jersey","22":"rj colleary","23":"glenn berenbeim","24":"martha williamson"},"original air date":{"0":"september 26 , 1999","1":"october 3 , 1999","2":"october 10 , 1999","3":"october 17 , 1999","4":"october 24 , 1999","5":"october 31 , 1999","6":"november 14 , 1999","7":"november 21 , 1999","8":"november 28 , 1999","9":"december 12 , 1999","10":"january 2 , 2000","11":"january 9 , 2000","12":"january 23 , 2000","13":"february 6 , 2000","14":"february 6 , 2000","15":"february 20 , 2000","16":"february 27 , 2000","17":"march 12 , 2000","18":"march 19 , 2000","19":"april 2 , 2000","20":"april 9 , 2000","21":"april 23 , 2000","22":"april 30 , 2000","23":"may 7 , 2000","24":"may 14 , 2000"}}
series season title director writer original airdate 0 190 1 a rock and a hard place kevin dowling martha williamson burt pearl september 28 , 2002 1 191 2 the sixteenth minute jim charleston john wierick october 5 , 2002 2 192 3 two sides to every angel larry peerce brian bird rj colleary october 12 , 2002 3 193 4 the word stuart margolin ken lazebnik october 19 , 2002 4 194 5 a feather on the breath of god victor lobl glenn berenbeim october 26 , 2002 5 195 6 jump! john dye brian bird november 2 , 2002 6 196 7 bring on the rain! armand mastroianni rj colleary burt pearl november 9 , 2002 7 197 8 remembering me (1) bethany rooney burt pearl november 16 , 2002 8 198 9 remembering me (2) armand mastroianni luke schelhaas november 23 , 2002 9 199 10 the christmas watch peter h hunt ken lazebnik december 21 , 2002 10 200 11 private eyes julia rask rj colleary ken lazebnik january 11 , 2003 11 201 12 the root of all evil michael schultz rj colleary january 25 , 2003 12 202 13 a time for every purpose john behring john wierick february 1 , 2003 13 203 14 and a nightingale sang peter h hunt burt pearl ken lazebnik february 8 , 2003 14 204 15 as it is in heaven victor lobl martha williamson luke schelhaas february 15 , 2003 15 205 16 song for my father ricardo mendez matta brian bird february 22 , 2003 16 206 17 the good earth ben lewin luke schelhaas march 1 , 2003 17 207 18 virtual reality larry peerce burt pearl daniel h forer march 15 , 2003 18 208 19 the show must not go on frank e johnson brian bird ken lazebnik april 12 , 2003 19 209 20 the end of the aisle jim charleston burt pearl luke schelhaas april 19 , 2003 20 210 21 i will walk with you (1) larry peerce martha williamson & burt pearl & luke schelhaas april 26 , 2003
{"series":{"0":190,"1":191,"2":192,"3":193,"4":194,"5":195,"6":196,"7":197,"8":198,"9":199,"10":200,"11":201,"12":202,"13":203,"14":204,"15":205,"16":206,"17":207,"18":208,"19":209,"20":210},"season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21},"title":{"0":"a rock and a hard place","1":"the sixteenth minute","2":"two sides to every angel","3":"the word","4":"a feather on the breath of god","5":"jump!","6":"bring on the rain!","7":"remembering me (1)","8":"remembering me (2)","9":"the christmas watch","10":"private eyes","11":"the root of all evil","12":"a time for every purpose","13":"and a nightingale sang","14":"as it is in heaven","15":"song for my father","16":"the good earth","17":"virtual reality","18":"the show must not go on","19":"the end of the aisle","20":"i will walk with you (1)"},"director":{"0":"kevin dowling","1":"jim charleston","2":"larry peerce","3":"stuart margolin","4":"victor lobl","5":"john dye","6":"armand mastroianni","7":"bethany rooney","8":"armand mastroianni","9":"peter h hunt","10":"julia rask","11":"michael schultz","12":"john behring","13":"peter h hunt","14":"victor lobl","15":"ricardo mendez matta","16":"ben lewin","17":"larry peerce","18":"frank e johnson","19":"jim charleston","20":"larry peerce"},"writer":{"0":"martha williamson burt pearl","1":"john wierick","2":"brian bird rj colleary","3":"ken lazebnik","4":"glenn berenbeim","5":"brian bird","6":"rj colleary burt pearl","7":"burt pearl","8":"luke schelhaas","9":"ken lazebnik","10":"rj colleary ken lazebnik","11":"rj colleary","12":"john wierick","13":"burt pearl ken lazebnik","14":"martha williamson luke schelhaas","15":"brian bird","16":"luke schelhaas","17":"burt pearl daniel h forer","18":"brian bird ken lazebnik","19":"burt pearl luke schelhaas","20":"martha williamson & burt pearl & luke schelhaas"},"original airdate":{"0":"september 28 , 2002","1":"october 5 , 2002","2":"october 12 , 2002","3":"october 19 , 2002","4":"october 26 , 2002","5":"november 2 , 2002","6":"november 9 , 2002","7":"november 16 , 2002","8":"november 23 , 2002","9":"december 21 , 2002","10":"january 11 , 2003","11":"january 25 , 2003","12":"february 1 , 2003","13":"february 8 , 2003","14":"february 15 , 2003","15":"february 22 , 2003","16":"march 1 , 2003","17":"march 15 , 2003","18":"april 12 , 2003","19":"april 19 , 2003","20":"april 26 , 2003"}}
season games wins losses ties points goals for goals against standing playoffs 0 1965 - 66 70 27 32 11 65 221 244 5th missed 1 1966 - 67 70 32 28 10 74 255 229 3rd lost semi 2 1967 - 68 70 28 31 11 67 220 216 4th south missed 3 1968 - 69 72 34 26 12 80 224 204 3rd south lost quarter 4 1979 - 80 80 32 38 10 74 300 319 6th lost quarter
{"season":{"0":"1965 - 66","1":"1966 - 67","2":"1967 - 68","3":"1968 - 69","4":"1979 - 80"},"games":{"0":70,"1":70,"2":70,"3":72,"4":80},"wins":{"0":27,"1":32,"2":28,"3":34,"4":32},"losses":{"0":32,"1":28,"2":31,"3":26,"4":38},"ties":{"0":11,"1":10,"2":11,"3":12,"4":10},"points":{"0":65,"1":74,"2":67,"3":80,"4":74},"goals for":{"0":221,"1":255,"2":220,"3":224,"4":300},"goals against":{"0":244,"1":229,"2":216,"3":204,"4":319},"standing":{"0":"5th","1":"3rd","2":"4th south","3":"3rd south","4":"6th"},"playoffs":{"0":"missed","1":"lost semi","2":"missed","3":"lost quarter","4":"lost quarter"}}
event start date finish date start finish distance abu dhabi camper groupama puma sanya telefónica 0 in - port race 29 october 2011 29 october 2011 alicante alicante alicante 6 4 2 5 3 1 1 leg 1 5 november 2011 25 november 2011 alicante cape town 6500nmi 0 (dnf) 25 20 0 (dnf) 0 (dnf) 30 2 in - port race 10 december 2011 10 december 2011 cape town cape town cape town 3 5 2 4 1 6 3 leg 2 11 december 2011 4 january 2012 cape town malé 5430nmi 8 20 12 16 4 24 4 leg 2 11 december 2011 4 january 2012 sharjah abu dhabi 5430nmi 2 4 6 3 1 5 5 in - port race 13 january 2012 13 january 2012 abu dhabi abu dhabi abu dhabi 6 4 5 3 2 2 6 leg 3 14 january 2012 4 february 2012 abu dhabi sharjah 106nmi 6 2 4 5 1 3 7 leg 3 14 january 2012 4 february 2012 malé sanya 3051nmi 8 16 20 12 4 24 8 in - port race 18 february 2012 18 february 2012 sanya sanya sanya 4 3 2 5 1 6 9 leg 4 19 february 2012 8 march 2012 sanya auckland 5220nmi 10 15 30 25 5 20 10 in - port race 17 march 2012 17 march 2012 auckland auckland auckland 2 6 4 5 3 1 11 leg 5 18 march 2012 4 april 2012 auckland itajaí 6705nmi 0 (dnf) 15 20 30 0 (dnf) 25 12 in - port race 21 april 2012 21 april 2012 itajaí itajaí itajaí 3 5 6 4 0 (dns) 2 13 leg 6 22 april 2012 6 may 2012 itajaí miami 4800nmi 10 25 20 30 0 (dns) 15 14 in - port race 19 may 2012 19 may 2012 miami miami miami 6 3 5 4 2 1 15 leg 7 20 may 2012 31 may 2012 miami lisbon 3590nmi 30 10 25 20 5 15 16 in - port race 9 june 2012 9 june 2012 lisbon lisbon lisbon 3 4 6 5 2 1 17 leg 8 10 june 2012 17 june 2012 lisbon lorient 1940nmi 15 25 30 20 5 10 18 in - port race 30 june 2012 30 june 2012 lorient lorient lorient 2 5 6 4 1 3 19 leg 9 1 july 2012 3 july 2012 lorient galway 485nmi 5 30 25 20 10 15 20 in - port race 7 july 2012 7 july 2012 galway galway galway 2 5 3 6 1 4
{"event":{"0":"in - port race","1":"leg 1","2":"in - port race","3":"leg 2","4":"leg 2","5":"in - port race","6":"leg 3","7":"leg 3","8":"in - port race","9":"leg 4","10":"in - port race","11":"leg 5","12":"in - port race","13":"leg 6","14":"in - port race","15":"leg 7","16":"in - port race","17":"leg 8","18":"in - port race","19":"leg 9","20":"in - port race"},"start date":{"0":"29 october 2011","1":"5 november 2011","2":"10 december 2011","3":"11 december 2011","4":"11 december 2011","5":"13 january 2012","6":"14 january 2012","7":"14 january 2012","8":"18 february 2012","9":"19 february 2012","10":"17 march 2012","11":"18 march 2012","12":"21 april 2012","13":"22 april 2012","14":"19 may 2012","15":"20 may 2012","16":"9 june 2012","17":"10 june 2012","18":"30 june 2012","19":"1 july 2012","20":"7 july 2012"},"finish date":{"0":"29 october 2011","1":"25 november 2011","2":"10 december 2011","3":"4 january 2012","4":"4 january 2012","5":"13 january 2012","6":"4 february 2012","7":"4 february 2012","8":"18 february 2012","9":"8 march 2012","10":"17 march 2012","11":"4 april 2012","12":"21 april 2012","13":"6 may 2012","14":"19 may 2012","15":"31 may 2012","16":"9 june 2012","17":"17 june 2012","18":"30 june 2012","19":"3 july 2012","20":"7 july 2012"},"start":{"0":"alicante","1":"alicante","2":"cape town","3":"cape town","4":"sharjah","5":"abu dhabi","6":"abu dhabi","7":"malé","8":"sanya","9":"sanya","10":"auckland","11":"auckland","12":"itajaí","13":"itajaí","14":"miami","15":"miami","16":"lisbon","17":"lisbon","18":"lorient","19":"lorient","20":"galway"},"finish":{"0":"alicante","1":"cape town","2":"cape town","3":"malé","4":"abu dhabi","5":"abu dhabi","6":"sharjah","7":"sanya","8":"sanya","9":"auckland","10":"auckland","11":"itajaí","12":"itajaí","13":"miami","14":"miami","15":"lisbon","16":"lisbon","17":"lorient","18":"lorient","19":"galway","20":"galway"},"distance":{"0":"alicante","1":"6500nmi","2":"cape town","3":"5430nmi","4":"5430nmi","5":"abu dhabi","6":"106nmi","7":"3051nmi","8":"sanya","9":"5220nmi","10":"auckland","11":"6705nmi","12":"itajaí","13":"4800nmi","14":"miami","15":"3590nmi","16":"lisbon","17":"1940nmi","18":"lorient","19":"485nmi","20":"galway"},"abu dhabi":{"0":"6","1":"0 (dnf)","2":"3","3":"8","4":"2","5":"6","6":"6","7":"8","8":"4","9":"10","10":"2","11":"0 (dnf)","12":"3","13":"10","14":"6","15":"30","16":"3","17":"15","18":"2","19":"5","20":"2"},"camper":{"0":4,"1":25,"2":5,"3":20,"4":4,"5":4,"6":2,"7":16,"8":3,"9":15,"10":6,"11":15,"12":5,"13":25,"14":3,"15":10,"16":4,"17":25,"18":5,"19":30,"20":5},"groupama":{"0":2,"1":20,"2":2,"3":12,"4":6,"5":5,"6":4,"7":20,"8":2,"9":30,"10":4,"11":20,"12":6,"13":20,"14":5,"15":25,"16":6,"17":30,"18":6,"19":25,"20":3},"puma":{"0":"5","1":"0 (dnf)","2":"4","3":"16","4":"3","5":"3","6":"5","7":"12","8":"5","9":"25","10":"5","11":"30","12":"4","13":"30","14":"4","15":"20","16":"5","17":"20","18":"4","19":"20","20":"6"},"sanya":{"0":"3","1":"0 (dnf)","2":"1","3":"4","4":"1","5":"2","6":"1","7":"4","8":"1","9":"5","10":"3","11":"0 (dnf)","12":"0 (dns)","13":"0 (dns)","14":"2","15":"5","16":"2","17":"5","18":"1","19":"10","20":"1"},"telefónica":{"0":1,"1":30,"2":6,"3":24,"4":5,"5":2,"6":3,"7":24,"8":6,"9":20,"10":1,"11":25,"12":2,"13":15,"14":1,"15":15,"16":1,"17":10,"18":3,"19":15,"20":4}}
country skip w l pf pa ends won ends lost blank ends stolen ends shot pct 0 canada jeff stoughton 10 1 84 49 47 37 17 11 90 1 scotland tom brewster 9 2 72 54 42 38 22 10 83 2 sweden niklas edin 7 4 81 58 50 39 9 13 90 3 norway thomas ulsrud 7 4 64 63 47 42 18 13 84 4 france thomas dufour 7 4 75 64 48 37 10 13 83 5 germany andy kapp 6 5 71 64 48 46 13 11 80 6 switzerland christof schwaller 6 5 68 67 47 43 15 16 85 7 czech republic jiri snã­til 5 6 58 72 38 43 14 7 81 8 china chen lu'an 4 7 51 71 35 47 24 4 83 9 united states pete fenson 3 8 59 67 40 47 14 9 85 10 south korea lee dong - keun 2 9 61 85 39 47 13 7 80
{"country":{"0":"canada","1":"scotland","2":"sweden","3":"norway","4":"france","5":"germany","6":"switzerland","7":"czech republic","8":"china","9":"united states","10":"south korea"},"skip":{"0":"jeff stoughton","1":"tom brewster","2":"niklas edin","3":"thomas ulsrud","4":"thomas dufour","5":"andy kapp","6":"christof schwaller","7":"jiri snã­til","8":"chen lu'an","9":"pete fenson","10":"lee dong - keun"},"w":{"0":10,"1":9,"2":7,"3":7,"4":7,"5":6,"6":6,"7":5,"8":4,"9":3,"10":2},"l":{"0":1,"1":2,"2":4,"3":4,"4":4,"5":5,"6":5,"7":6,"8":7,"9":8,"10":9},"pf":{"0":84,"1":72,"2":81,"3":64,"4":75,"5":71,"6":68,"7":58,"8":51,"9":59,"10":61},"pa":{"0":49,"1":54,"2":58,"3":63,"4":64,"5":64,"6":67,"7":72,"8":71,"9":67,"10":85},"ends won":{"0":47,"1":42,"2":50,"3":47,"4":48,"5":48,"6":47,"7":38,"8":35,"9":40,"10":39},"ends lost":{"0":37,"1":38,"2":39,"3":42,"4":37,"5":46,"6":43,"7":43,"8":47,"9":47,"10":47},"blank ends":{"0":17,"1":22,"2":9,"3":18,"4":10,"5":13,"6":15,"7":14,"8":24,"9":14,"10":13},"stolen ends":{"0":11,"1":10,"2":13,"3":13,"4":13,"5":11,"6":16,"7":7,"8":4,"9":9,"10":7},"shot pct":{"0":90,"1":83,"2":90,"3":84,"4":83,"5":80,"6":85,"7":81,"8":83,"9":85,"10":80}}
no - title directed by story by teleplay by original air date us viewers (millions) 0 11 1 accentuate the positive anthony hemingway eric overmyer & anthony bourdain eric overmyer april 24 , 2011 0.61 1 12 2 everything i do gonh be funky tim robbins david simon david simon may 1 , 2011 0.56 2 13 3 on your way down simon cellan jones james yoshimura james yoshimura may 8 , 2011 0.52 3 14 4 santa claus , do you ever get the blues alex zakrzewski eric overmyer & lolis eric elie lolis eric elie may 15 , 2011 0.56 4 15 5 slip away rob bailey david simon & mari kornhauser mari kornhauser may 22 , 2011 0.59 5 16 6 feels like rain roxann dawson eric overmyer & tom piazza tom piazza may 29 , 2011 0.53 6 17 7 carnival time brad anderson david simon & eric overmyer david simon & eric overmyer june 5 , 2011 0.55 7 18 8 can i change my mind ernest dickerson eric overmyer & james yoshimura james yoshimura june 12 , 2011 0.44 8 19 9 what is new orleans adam davidson david simon & george pelecanos george pelecanos june 19 , 2011 0.57 9 20 10 that 's what lovers do agnieszka holland eric overmyer eric overmyer june 26 , 2011 0.72
{"no":{"0":11,"1":12,"2":13,"3":14,"4":15,"5":16,"6":17,"7":18,"8":19,"9":20},"-":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10},"title":{"0":"accentuate the positive","1":"everything i do gonh be funky","2":"on your way down","3":"santa claus , do you ever get the blues","4":"slip away","5":"feels like rain","6":"carnival time","7":"can i change my mind","8":"what is new orleans","9":"that 's what lovers do"},"directed by":{"0":"anthony hemingway","1":"tim robbins","2":"simon cellan jones","3":"alex zakrzewski","4":"rob bailey","5":"roxann dawson","6":"brad anderson","7":"ernest dickerson","8":"adam davidson","9":"agnieszka holland"},"story by":{"0":"eric overmyer & anthony bourdain","1":"david simon","2":"james yoshimura","3":"eric overmyer & lolis eric elie","4":"david simon & mari kornhauser","5":"eric overmyer & tom piazza","6":"david simon & eric overmyer","7":"eric overmyer & james yoshimura","8":"david simon & george pelecanos","9":"eric overmyer"},"teleplay by":{"0":"eric overmyer","1":"david simon","2":"james yoshimura","3":"lolis eric elie","4":"mari kornhauser","5":"tom piazza","6":"david simon & eric overmyer","7":"james yoshimura","8":"george pelecanos","9":"eric overmyer"},"original air date":{"0":"april 24 , 2011","1":"may 1 , 2011","2":"may 8 , 2011","3":"may 15 , 2011","4":"may 22 , 2011","5":"may 29 , 2011","6":"june 5 , 2011","7":"june 12 , 2011","8":"june 19 , 2011","9":"june 26 , 2011"},"us viewers (millions)":{"0":0.61,"1":0.56,"2":0.52,"3":0.56,"4":0.59,"5":0.53,"6":0.55,"7":0.44,"8":0.57,"9":0.72}}
team outgoing manager manner of departure date of vacancy incoming manager date of appointment position in table 0 milton keynes dons paul ince resigned 16 april 2010 karl robinson 10 may 2010 pre - season 1 plymouth argyle paul mariner became head coach 6 may 2010 peter reid 24 june 2010 pre - season 2 notts county steve cotterill end of contract 27 may 2010 craig short 4 june 2010 pre - season 3 southampton alan pardew sacked 30 august 2010 nigel adkins 12 september 2010 21st 4 notts county craig short sacked 24 october 2010 paul ince 28 october 2010 16th 5 bristol rovers paul trollope sacked 15 december 2010 dave penney 10 january 2011 21st 6 walsall chris hutchings sacked 4 january 2011 dean smith 21 january 2011 24th 7 charlton athletic phil parkinson sacked 4 january 2011 chris powell 14 january 2011 5th 8 peterborough united gary johnson mutual consent 10 january 2011 darren ferguson 12 january 2011 7th 9 bournemouth eddie howe signed by burnley 16 january 2011 lee bradbury 28 january 2011 4th 10 sheffield wednesday alan irvine sacked 3 february 2011 gary megson 4 february 2011 12th 11 brentford andy scott sacked 3 february 2011 nicky forster 1 march 2011 19th 12 swindon town danny wilson resigned 2 march 2011 paul hart 3 march 2011 22nd 13 notts county paul ince mutual consent 3 march 2011 martin allen 11 april 2011 19th 14 bristol rovers dave penney sacked 7 march 2011 paul buckle 30 may 2011 23rd
{"team":{"0":"milton keynes dons","1":"plymouth argyle","2":"notts county","3":"southampton","4":"notts county","5":"bristol rovers","6":"walsall","7":"charlton athletic","8":"peterborough united","9":"bournemouth","10":"sheffield wednesday","11":"brentford","12":"swindon town","13":"notts county","14":"bristol rovers"},"outgoing manager":{"0":"paul ince","1":"paul mariner","2":"steve cotterill","3":"alan pardew","4":"craig short","5":"paul trollope","6":"chris hutchings","7":"phil parkinson","8":"gary johnson","9":"eddie howe","10":"alan irvine","11":"andy scott","12":"danny wilson","13":"paul ince","14":"dave penney"},"manner of departure":{"0":"resigned","1":"became head coach","2":"end of contract","3":"sacked","4":"sacked","5":"sacked","6":"sacked","7":"sacked","8":"mutual consent","9":"signed by burnley","10":"sacked","11":"sacked","12":"resigned","13":"mutual consent","14":"sacked"},"date of vacancy":{"0":"16 april 2010","1":"6 may 2010","2":"27 may 2010","3":"30 august 2010","4":"24 october 2010","5":"15 december 2010","6":"4 january 2011","7":"4 january 2011","8":"10 january 2011","9":"16 january 2011","10":"3 february 2011","11":"3 february 2011","12":"2 march 2011","13":"3 march 2011","14":"7 march 2011"},"incoming manager":{"0":"karl robinson","1":"peter reid","2":"craig short","3":"nigel adkins","4":"paul ince","5":"dave penney","6":"dean smith","7":"chris powell","8":"darren ferguson","9":"lee bradbury","10":"gary megson","11":"nicky forster","12":"paul hart","13":"martin allen","14":"paul buckle"},"date of appointment":{"0":"10 may 2010","1":"24 june 2010","2":"4 june 2010","3":"12 september 2010","4":"28 october 2010","5":"10 january 2011","6":"21 january 2011","7":"14 january 2011","8":"12 january 2011","9":"28 january 2011","10":"4 february 2011","11":"1 march 2011","12":"3 march 2011","13":"11 april 2011","14":"30 may 2011"},"position in table":{"0":"pre - season","1":"pre - season","2":"pre - season","3":"21st","4":"16th","5":"21st","6":"24th","7":"5th","8":"7th","9":"4th","10":"12th","11":"19th","12":"22nd","13":"19th","14":"23rd"}}
team outgoing manager manner of departure date of vacancy incoming manager date of appointment position in table 0 hereford united graham turner resigned 16 april 2010 simon davey 22 june 2010 pre - season 1 barnet ian hendon sacked 28 april 2010 mark stimson 1 june 2010 pre - season 2 shrewsbury town paul simpson sacked 30 april 2010 graham turner 11 june 2010 pre - season 3 gillingham mark stimson mutual consent 10 may 2010 andy hessenthaler 22 may 2010 pre - season 4 stockport gary ablett sacked 17 june 2010 paul simpson 12 july 2010 pre - season 5 lincoln city chris sutton resigned 29 september 2010 steve tilson 15 october 2010 21st 6 hereford united simon davey sacked 4 october 2010 jamie pitman 19 december 2010 24th 7 port vale micky adams signed by sheffield united 30 december 2010 jim gannon 6 january 2011 2nd 8 barnet mark stimson sacked 1 january 2011 martin allen 23 march 2011 23rd 9 stockport county paul simpson sacked 4 january 2011 ray mathias 9 march 2011 21st 10 aldershot town kevin dillon sacked 10 january 2011 dean holdsworth 12 january 2011 20th 11 bradford city peter taylor stepped down 26 february 2011 peter jackson 28 february 2011 20th 12 northampton town ian sampson sacked 2 march 2011 gary johnson 4 march 2011 16th 13 port vale jim gannon sacked 21 march 2011 micky adams 13 may 2011 8th 14 rotherham united ronnie moore mutual consent 22 march 2011 andy scott 13 april 2011 9th 15 bury alan knill signed by scunthorpe united 31 march 2011 richard barker (caretaker) 31 march 2011 4th
{"team":{"0":"hereford united","1":"barnet","2":"shrewsbury town","3":"gillingham","4":"stockport","5":"lincoln city","6":"hereford united","7":"port vale","8":"barnet","9":"stockport county","10":"aldershot town","11":"bradford city","12":"northampton town","13":"port vale","14":"rotherham united","15":"bury"},"outgoing manager":{"0":"graham turner","1":"ian hendon","2":"paul simpson","3":"mark stimson","4":"gary ablett","5":"chris sutton","6":"simon davey","7":"micky adams","8":"mark stimson","9":"paul simpson","10":"kevin dillon","11":"peter taylor","12":"ian sampson","13":"jim gannon","14":"ronnie moore","15":"alan knill"},"manner of departure":{"0":"resigned","1":"sacked","2":"sacked","3":"mutual consent","4":"sacked","5":"resigned","6":"sacked","7":"signed by sheffield united","8":"sacked","9":"sacked","10":"sacked","11":"stepped down","12":"sacked","13":"sacked","14":"mutual consent","15":"signed by scunthorpe united"},"date of vacancy":{"0":"16 april 2010","1":"28 april 2010","2":"30 april 2010","3":"10 may 2010","4":"17 june 2010","5":"29 september 2010","6":"4 october 2010","7":"30 december 2010","8":"1 january 2011","9":"4 january 2011","10":"10 january 2011","11":"26 february 2011","12":"2 march 2011","13":"21 march 2011","14":"22 march 2011","15":"31 march 2011"},"incoming manager":{"0":"simon davey","1":"mark stimson","2":"graham turner","3":"andy hessenthaler","4":"paul simpson","5":"steve tilson","6":"jamie pitman","7":"jim gannon","8":"martin allen","9":"ray mathias","10":"dean holdsworth","11":"peter jackson","12":"gary johnson","13":"micky adams","14":"andy scott","15":"richard barker (caretaker)"},"date of appointment":{"0":"22 june 2010","1":"1 june 2010","2":"11 june 2010","3":"22 may 2010","4":"12 july 2010","5":"15 october 2010","6":"19 december 2010","7":"6 january 2011","8":"23 march 2011","9":"9 march 2011","10":"12 january 2011","11":"28 february 2011","12":"4 march 2011","13":"13 may 2011","14":"13 april 2011","15":"31 march 2011"},"position in table":{"0":"pre - season","1":"pre - season","2":"pre - season","3":"pre - season","4":"pre - season","5":"21st","6":"24th","7":"2nd","8":"23rd","9":"21st","10":"20th","11":"20th","12":"16th","13":"8th","14":"9th","15":"4th"}}
name position height weight age home town team / school 0 jay arnette guard 6 - 2 175 21 austin , tx texas 1 walt bellamy center 6 - 11 217 21 baltimore , md indiana 2 bob boozer forward 6 - 8 220 23 omaha , ne peoria caterpillars ( kansas state ) 3 terry dischinger forward 6 - 6 190 19 terre haute , in purdue 4 burdette haldorson forward 6 - 7 207 26 austin , mn phillips 66ers ( colorado ) 5 darrall imhoff center 6 - 11 220 21 berkeley , ca california 6 allen kelley guard 5 - 11 164 27 mccune , ks peoria caterpillars ( kansas ) 7 lester lane guard 5 - 11 165 28 purcell , ok wichita vickers ( oklahoma ) 8 jerry lucas forward 6 - 8 220 20 middletown , oh ohio state 9 oscar robertson forward 6 - 5 220 21 indianapolis , in cincinnati 10 adrian smith guard 6 - 0 175 23 farmington , ky us armed forces ( kentucky )
{"name":{"0":"jay arnette","1":"walt bellamy","2":"bob boozer","3":"terry dischinger","4":"burdette haldorson","5":"darrall imhoff","6":"allen kelley","7":"lester lane","8":"jerry lucas","9":"oscar robertson","10":"adrian smith"},"position":{"0":"guard","1":"center","2":"forward","3":"forward","4":"forward","5":"center","6":"guard","7":"guard","8":"forward","9":"forward","10":"guard"},"height":{"0":"6 - 2","1":"6 - 11","2":"6 - 8","3":"6 - 6","4":"6 - 7","5":"6 - 11","6":"5 - 11","7":"5 - 11","8":"6 - 8","9":"6 - 5","10":"6 - 0"},"weight":{"0":175,"1":217,"2":220,"3":190,"4":207,"5":220,"6":164,"7":165,"8":220,"9":220,"10":175},"age":{"0":21,"1":21,"2":23,"3":19,"4":26,"5":21,"6":27,"7":28,"8":20,"9":21,"10":23},"home town":{"0":"austin , tx","1":"baltimore , md","2":"omaha , ne","3":"terre haute , in","4":"austin , mn","5":"berkeley , ca","6":"mccune , ks","7":"purcell , ok","8":"middletown , oh","9":"indianapolis , in","10":"farmington , ky"},"team \/ school":{"0":"texas","1":"indiana","2":"peoria caterpillars ( kansas state )","3":"purdue","4":"phillips 66ers ( colorado )","5":"california","6":"peoria caterpillars ( kansas )","7":"wichita vickers ( oklahoma )","8":"ohio state","9":"cincinnati","10":"us armed forces ( kentucky )"}}
date (yyyy - mm - dd) time ( utc ) latitude longitude depth magnitude 0 2010 - 04 - 13 21:40:00 33.183 degree n 96.623 degree e - 5.0 (m w ) 1 2010 - 04 - 13 23:49:39 33.224 degree n 96.666 degree e - 6.9 (m w ) 2 2010 - 04 - 14 00:01:17 32.875 degree n 96.999 degree e - 5.3 (m w ) 3 2010 - 04 - 14 00:12:25 33.159 degree n 96.580 degree e - 5.2 (m w ) 4 2010 - 04 - 14 01:25:15 33.179 degree n 96.448 degree e - 5.8 (m w ) 5 2010 - 04 - 14 03:15:46 33.151 degree n 96.701 degree e - 4.7 (m w ) 6 2010 - 04 - 14 12:19:36 33.077 degree n 96.846 degree e - 4.1 (m w )
{"date (yyyy - mm - dd)":{"0":"2010 - 04 - 13","1":"2010 - 04 - 13","2":"2010 - 04 - 14","3":"2010 - 04 - 14","4":"2010 - 04 - 14","5":"2010 - 04 - 14","6":"2010 - 04 - 14"},"time ( utc )":{"0":"21:40:00","1":"23:49:39","2":"00:01:17","3":"00:12:25","4":"01:25:15","5":"03:15:46","6":"12:19:36"},"latitude":{"0":"33.183 degree n","1":"33.224 degree n","2":"32.875 degree n","3":"33.159 degree n","4":"33.179 degree n","5":"33.151 degree n","6":"33.077 degree n"},"longitude":{"0":"96.623 degree e","1":"96.666 degree e","2":"96.999 degree e","3":"96.580 degree e","4":"96.448 degree e","5":"96.701 degree e","6":"96.846 degree e"},"depth":{"0":"-","1":"-","2":"-","3":"-","4":"-","5":"-","6":"-"},"magnitude":{"0":"5.0 (m w )","1":"6.9 (m w )","2":"5.3 (m w )","3":"5.2 (m w )","4":"5.8 (m w )","5":"4.7 (m w )","6":"4.1 (m w )"}}
no in total no in series title directed by written by original air date 0 27 / 28 1 / 2 into the mystic / the crucible tony tilse felicity packard 11 april 2010 1 29 3 kingdom come tony tilse greg haddrick 18 april 2010 2 30 4 fall guy tony tilse kris mrska 25 april 2010 3 31 / 32 5 / 6 saving face / women in uniform shawn seet kris mrska / peter gawler 9 may 2010 4 33 7 full force gale shawn seet peter gawler 16 may 2010 5 34 8 crossroads shawn seet felicity packard 23 may 2010 6 35 9 dog eat dog shawn seet kris mrksa 30 may 2010 7 36 10 hurt on duty tony tilse kris mrksa 6 june 2010 8 37 11 beauty and the beast tony tilse peter gawler 13 june 2010 9 38 12 the good lieutenant tony tilse felicity packard 20 june 2010
{"no in total":{"0":"27 \/ 28","1":"29","2":"30","3":"31 \/ 32","4":"33","5":"34","6":"35","7":"36","8":"37","9":"38"},"no in series":{"0":"1 \/ 2","1":"3","2":"4","3":"5 \/ 6","4":"7","5":"8","6":"9","7":"10","8":"11","9":"12"},"title":{"0":"into the mystic \/ the crucible","1":"kingdom come","2":"fall guy","3":"saving face \/ women in uniform","4":"full force gale","5":"crossroads","6":"dog eat dog","7":"hurt on duty","8":"beauty and the beast","9":"the good lieutenant"},"directed by":{"0":"tony tilse","1":"tony tilse","2":"tony tilse","3":"shawn seet","4":"shawn seet","5":"shawn seet","6":"shawn seet","7":"tony tilse","8":"tony tilse","9":"tony tilse"},"written by":{"0":"felicity packard","1":"greg haddrick","2":"kris mrska","3":"kris mrska \/ peter gawler","4":"peter gawler","5":"felicity packard","6":"kris mrksa","7":"kris mrksa","8":"peter gawler","9":"felicity packard"},"original air date":{"0":"11 april 2010","1":"18 april 2010","2":"25 april 2010","3":"9 may 2010","4":"16 may 2010","5":"23 may 2010","6":"30 may 2010","7":"6 june 2010","8":"13 june 2010","9":"20 june 2010"}}
common name genus & species ncbi accession number length (aa) % identity to c7orf38 % similarity to c7orf38 0 chimp pan troglodytes xp_001139775.1 573 99 99 1 monkey macaque macaca fascicularis bae01234.1 573 96 98 2 horse equus caballus xp_001915370.1 573 81 84 3 pig sus scrofa xp_001929194 1323 39 61 4 cow bos taurus xp_875656.2 1320 38 61 5 mouse mus musculus cam15594.1 1157 37 60 6 domestic dog canis lupus familiaris abf22701.1 609 37 60 7 rat rattus rattus np_001102151.1 1249 37 59 8 opossum monodelphis domestica xp_001372983.1 608 37 59 9 chicken gallus gallus xp_424913.2 641 37 58 10 frog xenopus (silurana) tropicalis abf20551.1 656 37 56 11 zebra fish danio rerio xp_001340213.1 609 37 56 12 pea aphid acyrthosiphon pisum xp_001943527.1 659 36 54 13 beatle tribolium castaneum abf20545.1 599 35 55 14 sea squirt ciona intestinalis xp_002119512.1 524 34 52 15 hydra hydra magnipapillata xp_002165429.1 572 29 52 16 puffer fish tetraodon nigroviridis caf95678.1 539 28 47 17 mosquito anopheles gambiae xp_558399.5 591 28 47 18 sea urchin strongylocentrotus purpuratus abf20546.1 625 27 47 19 grass plant sorghum bicolor xp_002439156.1 524 25 40
{"common name":{"0":"chimp","1":"monkey macaque","2":"horse","3":"pig","4":"cow","5":"mouse","6":"domestic dog","7":"rat","8":"opossum","9":"chicken","10":"frog","11":"zebra fish","12":"pea aphid","13":"beatle","14":"sea squirt","15":"hydra","16":"puffer fish","17":"mosquito","18":"sea urchin","19":"grass plant"},"genus & species":{"0":"pan troglodytes","1":"macaca fascicularis","2":"equus caballus","3":"sus scrofa","4":"bos taurus","5":"mus musculus","6":"canis lupus familiaris","7":"rattus rattus","8":"monodelphis domestica","9":"gallus gallus","10":"xenopus (silurana) tropicalis","11":"danio rerio","12":"acyrthosiphon pisum","13":"tribolium castaneum","14":"ciona intestinalis","15":"hydra magnipapillata","16":"tetraodon nigroviridis","17":"anopheles gambiae","18":"strongylocentrotus purpuratus","19":"sorghum bicolor"},"ncbi accession number":{"0":"xp_001139775.1","1":"bae01234.1","2":"xp_001915370.1","3":"xp_001929194","4":"xp_875656.2","5":"cam15594.1","6":"abf22701.1","7":"np_001102151.1","8":"xp_001372983.1","9":"xp_424913.2","10":"abf20551.1","11":"xp_001340213.1","12":"xp_001943527.1","13":"abf20545.1","14":"xp_002119512.1","15":"xp_002165429.1","16":"caf95678.1","17":"xp_558399.5","18":"abf20546.1","19":"xp_002439156.1"},"length (aa)":{"0":573,"1":573,"2":573,"3":1323,"4":1320,"5":1157,"6":609,"7":1249,"8":608,"9":641,"10":656,"11":609,"12":659,"13":599,"14":524,"15":572,"16":539,"17":591,"18":625,"19":524},"% identity to c7orf38":{"0":99,"1":96,"2":81,"3":39,"4":38,"5":37,"6":37,"7":37,"8":37,"9":37,"10":37,"11":37,"12":36,"13":35,"14":34,"15":29,"16":28,"17":28,"18":27,"19":25},"% similarity to c7orf38":{"0":99,"1":98,"2":84,"3":61,"4":61,"5":60,"6":60,"7":59,"8":59,"9":58,"10":56,"11":56,"12":54,"13":55,"14":52,"15":52,"16":47,"17":47,"18":47,"19":40}}
edition round date venue partering against surface opponents w / l result team result 0 2005 fed cup gi relegation play - offs 23 april 2005 antalya hanne skak jensen greece clay asimina kaplani anna koumantou win 7 - 6 (7 - 5) , 6 - 4 win (2 - 1) 1 2007 fed cup gi round robin 19 april 2007 plovdiv eva dyrberg netherlands clay elise tamaëla nicole thyssen win 4 - 6 , 6 - 3 , 6 - 4 win (2 - 1) 2 2007 fed cup gi round robin 20 april 2007 plovdiv eva dyrberg romania clay mădălina gojnea monica niculescu lose 4 - 6 , 5 - 7 lose (1 - 2) 3 2008 fed cup gi round robin 1 february 2008 budapest eva dyrberg great britain carpet (i) elena baltacha anne keothavong win 6 - 3 , 6 - 2 win (2 - 1) 4 2009 fed cup gi round robin 4 february 2009 tallinn eva dyrberg belarus hard (i) victoria azarenka olga govortsova lose 0 - 6 , 4 - 6 lose (1 - 2) 5 2010 fed cup gi round robin 3 february 2010 lisbon karina - ildor jacobsgaard sweden hard (i) sofia arvidsson johanna larsson lose 0 - 6 , 0 - 6 lose (1 - 2) 6 2011 fed cup gi round robin 3 february 2011 eilat mai grage switzerland hard timea bacsinszky patty schnyder lose 3 - 6 , 2 - 6 lose (1 - 2) 7 2011 fed cup gi round robin 4 february 2011 eilat mai grage great britain hard jocelyn rae heather watson lose 7 - 5 , 5 - 7 , 5 - 7 lose (1 - 2)
{"edition":{"0":"2005 fed cup","1":"2007 fed cup","2":"2007 fed cup","3":"2008 fed cup","4":"2009 fed cup","5":"2010 fed cup","6":"2011 fed cup","7":"2011 fed cup"},"round":{"0":"gi relegation play - offs","1":"gi round robin","2":"gi round robin","3":"gi round robin","4":"gi round robin","5":"gi round robin","6":"gi round robin","7":"gi round robin"},"date":{"0":"23 april 2005","1":"19 april 2007","2":"20 april 2007","3":"1 february 2008","4":"4 february 2009","5":"3 february 2010","6":"3 february 2011","7":"4 february 2011"},"venue":{"0":"antalya","1":"plovdiv","2":"plovdiv","3":"budapest","4":"tallinn","5":"lisbon","6":"eilat","7":"eilat"},"partering":{"0":"hanne skak jensen","1":"eva dyrberg","2":"eva dyrberg","3":"eva dyrberg","4":"eva dyrberg","5":"karina - ildor jacobsgaard","6":"mai grage","7":"mai grage"},"against":{"0":"greece","1":"netherlands","2":"romania","3":"great britain","4":"belarus","5":"sweden","6":"switzerland","7":"great britain"},"surface":{"0":"clay","1":"clay","2":"clay","3":"carpet (i)","4":"hard (i)","5":"hard (i)","6":"hard","7":"hard"},"opponents":{"0":"asimina kaplani anna koumantou","1":"elise tamaëla nicole thyssen","2":"mădălina gojnea monica niculescu","3":"elena baltacha anne keothavong","4":"victoria azarenka olga govortsova","5":"sofia arvidsson johanna larsson","6":"timea bacsinszky patty schnyder","7":"jocelyn rae heather watson"},"w \/ l":{"0":"win","1":"win","2":"lose","3":"win","4":"lose","5":"lose","6":"lose","7":"lose"},"result":{"0":"7 - 6 (7 - 5) , 6 - 4","1":"4 - 6 , 6 - 3 , 6 - 4","2":"4 - 6 , 5 - 7","3":"6 - 3 , 6 - 2","4":"0 - 6 , 4 - 6","5":"0 - 6 , 0 - 6","6":"3 - 6 , 2 - 6","7":"7 - 5 , 5 - 7 , 5 - 7"},"team result":{"0":"win (2 - 1)","1":"win (2 - 1)","2":"lose (1 - 2)","3":"win (2 - 1)","4":"lose (1 - 2)","5":"lose (1 - 2)","6":"lose (1 - 2)","7":"lose (1 - 2)"}}
no in series no in season title directed by written by original air date us viewers (million) 0 25 1 game on steve buscemi liz brixius & linda wallem march 28 , 2011 0.61 1 26 2 enough rope steve buscemi liz brixius april 4 , 2011 0.49 2 27 3 play me michael lehmann linda wallem april 11 , 2011 0.57 3 28 4 mitten michael lehmann liz flahive april 18 , 2011 0.60 4 29 5 rat falls tristram shapeero alison mcdonald april 25 , 2011 0.65 5 30 6 when the saints go tristram shapeero liz brixius may 2 , 2011 0.53 6 31 7 orchids and salami bob balaban ellen fairey may 9 , 2011 0.47 7 32 8 the astonishing bob balaban rajiv joseph may 16 , 2011 0.43 8 33 9 have you met ms jones daisy von scherler mayer liz brixius & wyndham lewis may 23 , 2011 0.60 9 34 10 fuck the lemurs daisy von scherler mayer liz brixius june 6 , 2011 0.56 10 35 11 batting practice linda wallem liz flahive june 13 , 2011 0.58
{"no in series":{"0":25,"1":26,"2":27,"3":28,"4":29,"5":30,"6":31,"7":32,"8":33,"9":34,"10":35},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11},"title":{"0":"game on","1":"enough rope","2":"play me","3":"mitten","4":"rat falls","5":"when the saints go","6":"orchids and salami","7":"the astonishing","8":"have you met ms jones","9":"fuck the lemurs","10":"batting practice"},"directed by":{"0":"steve buscemi","1":"steve buscemi","2":"michael lehmann","3":"michael lehmann","4":"tristram shapeero","5":"tristram shapeero","6":"bob balaban","7":"bob balaban","8":"daisy von scherler mayer","9":"daisy von scherler mayer","10":"linda wallem"},"written by":{"0":"liz brixius & linda wallem","1":"liz brixius","2":"linda wallem","3":"liz flahive","4":"alison mcdonald","5":"liz brixius","6":"ellen fairey","7":"rajiv joseph","8":"liz brixius & wyndham lewis","9":"liz brixius","10":"liz flahive"},"original air date":{"0":"march 28 , 2011","1":"april 4 , 2011","2":"april 11 , 2011","3":"april 18 , 2011","4":"april 25 , 2011","5":"may 2 , 2011","6":"may 9 , 2011","7":"may 16 , 2011","8":"may 23 , 2011","9":"june 6 , 2011","10":"june 13 , 2011"},"us viewers (million)":{"0":0.61,"1":0.49,"2":0.57,"3":0.6,"4":0.65,"5":0.53,"6":0.47,"7":0.43,"8":0.6,"9":0.56,"10":0.58}}
chambering p1 diameter (mm) a external (cm 2 ) p max ( bar ) f bolt ( kgf ) f bolt 0 .22 long rifle 5.74 0.2587 1650 435 n (lbf) 1 9x19 mm parabellum 9.93 0.7744 2350 1820 n ( lbf ) 2 .357 sig 10.77 0.9110 3050 2779 n (lbf) 3 .380 acp 9.70 0.7390 1500 1130 n (lbf) 4 .40 s&w 10.77 0.9110 2250 2050 n (lbf) 5 10 mm auto 10.81 0.9178 2300 2111 n (lbf) 6 .45 acp 12.09 1.1671 1300 1517 n (lbf) 7 .454 casull 12.13 1.1556 3900 4507 n (lbf)
{"chambering":{"0":".22 long rifle","1":"9x19 mm parabellum","2":".357 sig","3":".380 acp","4":".40 s&w","5":"10 mm auto","6":".45 acp","7":".454 casull"},"p1 diameter (mm)":{"0":5.74,"1":9.93,"2":10.77,"3":9.7,"4":10.77,"5":10.81,"6":12.09,"7":12.13},"a external (cm 2 )":{"0":0.2587,"1":0.7744,"2":0.911,"3":0.739,"4":0.911,"5":0.9178,"6":1.1671,"7":1.1556},"p max ( bar )":{"0":1650,"1":2350,"2":3050,"3":1500,"4":2250,"5":2300,"6":1300,"7":3900},"f bolt ( kgf )":{"0":435,"1":1820,"2":2779,"3":1130,"4":2050,"5":2111,"6":1517,"7":4507},"f bolt":{"0":"n (lbf)","1":"n ( lbf )","2":"n (lbf)","3":"n (lbf)","4":"n (lbf)","5":"n (lbf)","6":"n (lbf)","7":"n (lbf)"}}
chambering p1 diameter (mm) a external (cm 2 ) p max ( bar ) f bolt ( kgf ) f bolt 0 5.45x39 mm 10.00 0.7854 3800 2985 n ( lbf ) 1 .223 remington 9.58 0.7208 4300 3099 n (lbf) 2 7.62x39 mm 11.35 1.0118 3550 3592 n (lbf) 3 .308 winchester 11.96 1.1234 4150 4662 n (lbf) 4 .300 winchester magnum 13.03 1.3335 4300 5734 n (lbf) 5 .300 wsm 14.12 1.5659 4450 6968 n (lbf) 6 .300 remington ultra magnum 13.97 1.5328 4480 6876 n (lbf) 7 .338 lapua magnum 14.91 1.7460 4200 7333 n (lbf) 8 .300 lapua magnum 14.91 1.7460 4700 8339 n (lbf) 9 .50 bmg 20.42 3.2749 3700 12117 n (lbf)
{"chambering":{"0":"5.45x39 mm","1":".223 remington","2":"7.62x39 mm","3":".308 winchester","4":".300 winchester magnum","5":".300 wsm","6":".300 remington ultra magnum","7":".338 lapua magnum","8":".300 lapua magnum","9":".50 bmg"},"p1 diameter (mm)":{"0":10.0,"1":9.58,"2":11.35,"3":11.96,"4":13.03,"5":14.12,"6":13.97,"7":14.91,"8":14.91,"9":20.42},"a external (cm 2 )":{"0":0.7854,"1":0.7208,"2":1.0118,"3":1.1234,"4":1.3335,"5":1.5659,"6":1.5328,"7":1.746,"8":1.746,"9":3.2749},"p max ( bar )":{"0":3800,"1":4300,"2":3550,"3":4150,"4":4300,"5":4450,"6":4480,"7":4200,"8":4700,"9":3700},"f bolt ( kgf )":{"0":2985,"1":3099,"2":3592,"3":4662,"4":5734,"5":6968,"6":6876,"7":7333,"8":8339,"9":12117},"f bolt":{"0":"n ( lbf )","1":"n (lbf)","2":"n (lbf)","3":"n (lbf)","4":"n (lbf)","5":"n (lbf)","6":"n (lbf)","7":"n (lbf)","8":"n (lbf)","9":"n (lbf)"}}
series season title directed by : written by : original airdate 0 27 1 safe at first base michael lembeck earl pomerantz , rick hawkins september 17 , 1990 1 28 2 welcome to hollister michael lembeck jim evering september 24 , 1990 2 29 3 get a job michael lembeck barry gold october 1 , 1990 3 30 4 the goat michael lembeck earl pomerantz october 8 , 1990 4 31 5 first anniversary michael lembeck renee phillips , carrie hornigblum october 15 , 1990 5 32 6 wetting down michael lembeck miriam trogdon october 22 , 1990 6 33 7 infant - ry michael lembeck peter garcia , rick parks october 29 , 1990 7 34 8 birthday ball michael lembeck rick hawkins november 5 , 1990 8 35 9 wish you were here michael lembeck barry gold november 12 , 1990 9 36 10 love on the run michael lembeck janet leahy november 19 , 1990 10 37 11 operation fun run michael lembeck jim evering november 26 , 1990 11 38 12 gift of the major michael lembeck rick hawkins december 19 , 1990 12 39 13 flying solo michael lembeck leslie rieder january 7 , 1991 13 40 14 a bird in the hand michael lembeck renee phillips , carrie hornigblum january 14 , 1991 14 41 15 learning to drive michael lembeck lisa albert january 21 , 1991 15 42 16 the name is over here michael lembeck rick hawkins february 4 , 1991 16 43 17 valentine 's day michael lembeck jim evering february 11 , 1991 17 44 18 sins of the father michael lembeck barry gold february 18 , 1991 18 45 19 the possible dream michael lembeck mary basanese february 25 , 1991 19 46 20 private affair michael lembeck renee phillips , carrie hornigblum march 11 , 1991 20 47 21 polly 's choice michael lembeck miriam trogdon march 18 , 1991 21 48 22 silent drill team michael lembeck barry gold april 8 , 1991 22 49 23 elmo come home michael lembeck jim evering april 29 , 1991
{"series":{"0":27,"1":28,"2":29,"3":30,"4":31,"5":32,"6":33,"7":34,"8":35,"9":36,"10":37,"11":38,"12":39,"13":40,"14":41,"15":42,"16":43,"17":44,"18":45,"19":46,"20":47,"21":48,"22":49},"season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21,"21":22,"22":23},"title":{"0":"safe at first base","1":"welcome to hollister","2":"get a job","3":"the goat","4":"first anniversary","5":"wetting down","6":"infant - ry","7":"birthday ball","8":"wish you were here","9":"love on the run","10":"operation fun run","11":"gift of the major","12":"flying solo","13":"a bird in the hand","14":"learning to drive","15":"the name is over here","16":"valentine 's day","17":"sins of the father","18":"the possible dream","19":"private affair","20":"polly 's choice","21":"silent drill team","22":"elmo come home"},"directed by :":{"0":"michael lembeck","1":"michael lembeck","2":"michael lembeck","3":"michael lembeck","4":"michael lembeck","5":"michael lembeck","6":"michael lembeck","7":"michael lembeck","8":"michael lembeck","9":"michael lembeck","10":"michael lembeck","11":"michael lembeck","12":"michael lembeck","13":"michael lembeck","14":"michael lembeck","15":"michael lembeck","16":"michael lembeck","17":"michael lembeck","18":"michael lembeck","19":"michael lembeck","20":"michael lembeck","21":"michael lembeck","22":"michael lembeck"},"written by :":{"0":"earl pomerantz , rick hawkins","1":"jim evering","2":"barry gold","3":"earl pomerantz","4":"renee phillips , carrie hornigblum","5":"miriam trogdon","6":"peter garcia , rick parks","7":"rick hawkins","8":"barry gold","9":"janet leahy","10":"jim evering","11":"rick hawkins","12":"leslie rieder","13":"renee phillips , carrie hornigblum","14":"lisa albert","15":"rick hawkins","16":"jim evering","17":"barry gold","18":"mary basanese","19":"renee phillips , carrie hornigblum","20":"miriam trogdon","21":"barry gold","22":"jim evering"},"original airdate":{"0":"september 17 , 1990","1":"september 24 , 1990","2":"october 1 , 1990","3":"october 8 , 1990","4":"october 15 , 1990","5":"october 22 , 1990","6":"october 29 , 1990","7":"november 5 , 1990","8":"november 12 , 1990","9":"november 19 , 1990","10":"november 26 , 1990","11":"december 19 , 1990","12":"january 7 , 1991","13":"january 14 , 1991","14":"january 21 , 1991","15":"february 4 , 1991","16":"february 11 , 1991","17":"february 18 , 1991","18":"february 25 , 1991","19":"march 11 , 1991","20":"march 18 , 1991","21":"april 8 , 1991","22":"april 29 , 1991"}}
team outgoing manager manner of departure date of vacancy incoming manager date of appointment 0 steaua bucureşti victor piţurcă resigned 9 august 2010 ilie dumitrescu 12 august 2010 1 unirea urziceni ronny levy resigned 21 august 2010 octavian grigore 12 september 2010 2 universitatea craiova aurel ţicleanu sacked 22 august 2010 victor piţurcă 26 august 2010 3 astra ploieşti mihai stoichiţă sacked 31 august 2010 tibor selymes 6 september 2010 4 trgu mureş adrian falub mutual termination 31 august 2010 ioan ovidiu sabău 3 september 2010 5 sportul studenţesc tibor selymes signed by astra ploieşti 6 september 2010 viorel moldovan 9 september 2010 6 cfr cluj andrea mandorlini sacked 12 september 2010 sorin crţu 13 september 2010 7 timişoara vladimir petrović signed by serbia 15 september 2010 cosmin contra 15 september 2010 8 steaua bucureşti ilie dumitrescu resigned 21 september 2010 marius lăcătuş 28 september 2010 9 pandurii trgu jiu ionuţ badea sacked 2 october 2010 petre grigoraş 2 october 2010 10 vaslui juan ramón lópez caro sacked 8 october 2010 viorel hizo 8 october 2010 11 gloria bistriţa laurenţiu reghecampf sacked 22 october 2010 nicolae manea 23 october 2010 12 sportul studenţesc viorel moldovan resigned 31 october 2010 florin tene 1 november 2010 13 universitatea cluj marian pană resigned 8 november 2010 ionuţ badea 25 november 2010 14 cfr cluj sorin crţu sacked 24 november 2010 alin minteuan 24 november 2010 15 timişoara cosmin contra sacked 4 december 2010 dušan uhrin , jr 13 december 2010 16 braşov daniel isăilă made assistant manager 18 december 2010 antónio conceição 18 december 2010 17 unirea urziceni octavian grigore resigned 10 january 2011 marian pană 26 february 2011 18 universitatea craiova victor piţurcă sacked 13 january 2011 nicolò napoli 15 january 2011 19 steaua bucureşti marius lăcătuş resigned 7 march 2011 sorin crţu 8 march 2011 20 sportul studenţesc florin tene resigned 13 march 2011 gheorghe mulţescu 15 march 2011 21 universitatea craiova nicolò napoli promoted director of football 7 april 2011 laurenţiu reghecampf 8 april 2011 22 victoria brăneşti ilie stan resigned 19 april 2011 ciprian urican 20 april 2011 23 rapid bucureşti marius şumudică sacked 27 april 2011 marian rada (interim) 28 may 2011 24 universitatea craiova laurenţiu reghecampf sacked 2 may 2011 aurel ţicleanu 2 may 2011 25 steaua bucureşti sorin crţu resigned 4 may 2011 gabriel caramarin (interim) 5 may 2011
{"team":{"0":"steaua bucureşti","1":"unirea urziceni","2":"universitatea craiova","3":"astra ploieşti","4":"trgu mureş","5":"sportul studenţesc","6":"cfr cluj","7":"timişoara","8":"steaua bucureşti","9":"pandurii trgu jiu","10":"vaslui","11":"gloria bistriţa","12":"sportul studenţesc","13":"universitatea cluj","14":"cfr cluj","15":"timişoara","16":"braşov","17":"unirea urziceni","18":"universitatea craiova","19":"steaua bucureşti","20":"sportul studenţesc","21":"universitatea craiova","22":"victoria brăneşti","23":"rapid bucureşti","24":"universitatea craiova","25":"steaua bucureşti"},"outgoing manager":{"0":"victor piţurcă","1":"ronny levy","2":"aurel ţicleanu","3":"mihai stoichiţă","4":"adrian falub","5":"tibor selymes","6":"andrea mandorlini","7":"vladimir petrović","8":"ilie dumitrescu","9":"ionuţ badea","10":"juan ramón lópez caro","11":"laurenţiu reghecampf","12":"viorel moldovan","13":"marian pană","14":"sorin crţu","15":"cosmin contra","16":"daniel isăilă","17":"octavian grigore","18":"victor piţurcă","19":"marius lăcătuş","20":"florin tene","21":"nicolò napoli","22":"ilie stan","23":"marius şumudică","24":"laurenţiu reghecampf","25":"sorin crţu"},"manner of departure":{"0":"resigned","1":"resigned","2":"sacked","3":"sacked","4":"mutual termination","5":"signed by astra ploieşti","6":"sacked","7":"signed by serbia","8":"resigned","9":"sacked","10":"sacked","11":"sacked","12":"resigned","13":"resigned","14":"sacked","15":"sacked","16":"made assistant manager","17":"resigned","18":"sacked","19":"resigned","20":"resigned","21":"promoted director of football","22":"resigned","23":"sacked","24":"sacked","25":"resigned"},"date of vacancy":{"0":"9 august 2010","1":"21 august 2010","2":"22 august 2010","3":"31 august 2010","4":"31 august 2010","5":"6 september 2010","6":"12 september 2010","7":"15 september 2010","8":"21 september 2010","9":"2 october 2010","10":"8 october 2010","11":"22 october 2010","12":"31 october 2010","13":"8 november 2010","14":"24 november 2010","15":"4 december 2010","16":"18 december 2010","17":"10 january 2011","18":"13 january 2011","19":"7 march 2011","20":"13 march 2011","21":"7 april 2011","22":"19 april 2011","23":"27 april 2011","24":"2 may 2011","25":"4 may 2011"},"incoming manager":{"0":"ilie dumitrescu","1":"octavian grigore","2":"victor piţurcă","3":"tibor selymes","4":"ioan ovidiu sabău","5":"viorel moldovan","6":"sorin crţu","7":"cosmin contra","8":"marius lăcătuş","9":"petre grigoraş","10":"viorel hizo","11":"nicolae manea","12":"florin tene","13":"ionuţ badea","14":"alin minteuan","15":"dušan uhrin , jr","16":"antónio conceição","17":"marian pană","18":"nicolò napoli","19":"sorin crţu","20":"gheorghe mulţescu","21":"laurenţiu reghecampf","22":"ciprian urican","23":"marian rada (interim)","24":"aurel ţicleanu","25":"gabriel caramarin (interim)"},"date of appointment":{"0":"12 august 2010","1":"12 september 2010","2":"26 august 2010","3":"6 september 2010","4":"3 september 2010","5":"9 september 2010","6":"13 september 2010","7":"15 september 2010","8":"28 september 2010","9":"2 october 2010","10":"8 october 2010","11":"23 october 2010","12":"1 november 2010","13":"25 november 2010","14":"24 november 2010","15":"13 december 2010","16":"18 december 2010","17":"26 february 2011","18":"15 january 2011","19":"8 march 2011","20":"15 march 2011","21":"8 april 2011","22":"20 april 2011","23":"28 may 2011","24":"2 may 2011","25":"5 may 2011"}}
team stadium capacity total highest lowest average 0 aberdeen pittodrie stadium 22199 173460 15307 5955 9129 1 celtic celtic park 60832 930395 58874 40750 48968 2 dundee united tannadice park 14209 140391 11790 4918 7389 3 hamilton academical new douglas park 6096 55056 5356 2011 2898 4 heart of midlothian tynecastle stadium 17420 269506 17420 12009 14185 5 inverness ct caledonian stadium 7500 85998 7547 3241 4526 6 kilmarnock rugby park 18128 122106 16173 4214 6427 7 motherwell fir park 13742 99838 9716 3324 5255 8 rangers ibrox stadium 51082 860793 50248 41514 45305 9 st johnstone mcdiarmid park 10673 72982 6866 2253 3841
{"team":{"0":"aberdeen","1":"celtic","2":"dundee united","3":"hamilton academical","4":"heart of midlothian","5":"inverness ct","6":"kilmarnock","7":"motherwell","8":"rangers","9":"st johnstone"},"stadium":{"0":"pittodrie stadium","1":"celtic park","2":"tannadice park","3":"new douglas park","4":"tynecastle stadium","5":"caledonian stadium","6":"rugby park","7":"fir park","8":"ibrox stadium","9":"mcdiarmid park"},"capacity":{"0":22199,"1":60832,"2":14209,"3":6096,"4":17420,"5":7500,"6":18128,"7":13742,"8":51082,"9":10673},"total":{"0":173460,"1":930395,"2":140391,"3":55056,"4":269506,"5":85998,"6":122106,"7":99838,"8":860793,"9":72982},"highest":{"0":15307,"1":58874,"2":11790,"3":5356,"4":17420,"5":7547,"6":16173,"7":9716,"8":50248,"9":6866},"lowest":{"0":5955,"1":40750,"2":4918,"3":2011,"4":12009,"5":3241,"6":4214,"7":3324,"8":41514,"9":2253},"average":{"0":9129,"1":48968,"2":7389,"3":2898,"4":14185,"5":4526,"6":6427,"7":5255,"8":45305,"9":3841}}
no in series title directed by written by original airdate production code 0 1 the day that everything changed sam montes man of action april 23 , 2010 693 - 001 1 2 string theory rick morales man of action april 30 , 2010 693 - 002 2 3 beyond the sea chris graham man of action may 7 , 2010 693 - 003 3 4 lockdown sam montes scott sonneborn may 14 , 2010 693 - 004 4 5 the architect rick morales amy wolfram may 21 , 2010 693 - 005 5 6 frostbite chris graham marty isenberg may 28 , 2010 693 - 006 6 7 leader of the pack sam montes alexx van dyne june 4 , 2010 693 - 007 7 8 breach chris graham adam beechen june 11 , 2010 693 - 009 8 9 dark passage sam montes marsha griffin june 18 , 2010 693 - 010 9 10 the forgotten rick morales paul giacoppo september 17 , 2010 693 - 011 10 11 operation : wingman chris graham eugene son september 24 , 2010 693 - 012 11 12 rabble sam montes rob hoegee october 1 , 2010 693 - 013 12 13 the hunter rick morales michael ryan october 8 , 2010 693 - 008 13 14 gravity rick morales andrew robinson october 15 , 2010 693 - 014 14 15 what lies beneath chris graham marsha griffin october 22 , 2010 693 - 015 15 16 the swarm sam montes paul giacoppo october 29 , 2010 693 - 016 16 17 basic rick morales scott sonneborn november 5 , 2010 693 - 017 17 18 plague chris graham tad stones november 12 , 2010 693 - 018 18 19 promises , promises sam montes man of action november 19 , 2010 693 - 019 19 20 badlands rick morales eugene son december 3 , 2010 693 - 021
{"no in series":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20},"title":{"0":"the day that everything changed","1":"string theory","2":"beyond the sea","3":"lockdown","4":"the architect","5":"frostbite","6":"leader of the pack","7":"breach","8":"dark passage","9":"the forgotten","10":"operation : wingman","11":"rabble","12":"the hunter","13":"gravity","14":"what lies beneath","15":"the swarm","16":"basic","17":"plague","18":"promises , promises","19":"badlands"},"directed by":{"0":"sam montes","1":"rick morales","2":"chris graham","3":"sam montes","4":"rick morales","5":"chris graham","6":"sam montes","7":"chris graham","8":"sam montes","9":"rick morales","10":"chris graham","11":"sam montes","12":"rick morales","13":"rick morales","14":"chris graham","15":"sam montes","16":"rick morales","17":"chris graham","18":"sam montes","19":"rick morales"},"written by":{"0":"man of action","1":"man of action","2":"man of action","3":"scott sonneborn","4":"amy wolfram","5":"marty isenberg","6":"alexx van dyne","7":"adam beechen","8":"marsha griffin","9":"paul giacoppo","10":"eugene son","11":"rob hoegee","12":"michael ryan","13":"andrew robinson","14":"marsha griffin","15":"paul giacoppo","16":"scott sonneborn","17":"tad stones","18":"man of action","19":"eugene son"},"original airdate":{"0":"april 23 , 2010","1":"april 30 , 2010","2":"may 7 , 2010","3":"may 14 , 2010","4":"may 21 , 2010","5":"may 28 , 2010","6":"june 4 , 2010","7":"june 11 , 2010","8":"june 18 , 2010","9":"september 17 , 2010","10":"september 24 , 2010","11":"october 1 , 2010","12":"october 8 , 2010","13":"october 15 , 2010","14":"october 22 , 2010","15":"october 29 , 2010","16":"november 5 , 2010","17":"november 12 , 2010","18":"november 19 , 2010","19":"december 3 , 2010"},"production code":{"0":"693 - 001","1":"693 - 002","2":"693 - 003","3":"693 - 004","4":"693 - 005","5":"693 - 006","6":"693 - 007","7":"693 - 009","8":"693 - 010","9":"693 - 011","10":"693 - 012","11":"693 - 013","12":"693 - 008","13":"693 - 014","14":"693 - 015","15":"693 - 016","16":"693 - 017","17":"693 - 018","18":"693 - 019","19":"693 - 021"}}
rank rider sat 21 aug mon 23 aug tues 24 aug wed 25 aug thurs 26 aug fri 27 aug sat 28 aug 0 1 michael sweeney 600cc yamaha untimed practice 26'57.82 89.957 mph 19'29.69 116.123 mph 19'17.77 104.021 mph 19'00.92 119.051 mph 18'54.41 119.734 mph -- no time 1 2 simon fulton 599cc yamaha untimed practice 23'31.88 96.203 mph 19'19.83 117.110 mph 19'13.11 117.793 mph 19'03.33 118.800 mph 18'59.25 119.226 mph -- no time 2 3 wayne kirwan 600cc yamaha untimed practice 22'38.60 99.977 mph 19'38.41 115.386 mph 19'29.39 116.153 mph 19'06.92 118.429 mph 19'08.49 118.267 mph -- no time 3 4 dan sayle 600cc yamaha untimed practice 23'08.44 97.828 mph 20'03.70 112.842 mph -- no time 19'09.10 119.204 mph 19'24.69 116.622 mph 21'40.20 104.467 mph 4 5 andrew brady 748cc suzuki untimed practice -- no time 19'22.55 116.836 mph 19'34.24 115.673 mph -- no time 19'09.88 118.123 mph -- no time 5 6 ivan lintin 750cc suzuki untimed practice 19'24.69 116.622 mph 19'37.17 115.386 mph 19'20.32 117.061 mph 19'15.30 117.570 mph -- no time -- no time 6 7 david lumsden 600cc yamaha untimed practice 24'38.98 91.839 mph 20'28.61 110.554 mph 20'09.25 112.324 mph 19'19.68 117.125 mph 19'15.66 117.553 mph -- no time 7 8 jules croft 600c honda untimed practice 25'45.94 87.961 mph 20'03.37 112.873 mph 20'10.73 112.187 mph 19'52.18 113.932 mph 19'28.57 116.234 mph -- no time 8 9 philip mcgurk 600cc honda untimed practice 23'43.94 95.389 mph 19'48.52 115.386 mph 19'50.42 115.386 mph 19'36.97 115.405 mph 19'38.87 115.219 mph -- no time 9 10 stephen mcknight 599cc yamaha untimed practice 23'08.68 97.811 mph 20'24.84 110.894 mph 20'08.43 112.401 mph 19'47.23 114.407 mph 19'46.36 114.491 mph -- no time 10 11 grant wagstaff 749cc suzuki untimed practice 22'03.28 102.645 mph 20'21.23 111.222 mph 19'50.39 114.103 mph -- no time 19'49.48 114.191 mph -- no time 11 12 shaun anderson 750cc suzuki untimed practice -- no time 20'47.83 108.851 mph 20'28.34 110.579 mph 20'06.39 112.591 mph 19'50.67 114.077 mph 22'45.53 99.469 mph 12 13 dave moffitt 600cc honda untimed practice 24'26.35 92.630 mph 20'52.96 108.406 mph 19'53.18 113.837 mph 19'40.40 115.570 mph 19'50.82 114.062 mph -- no time 13 14 tim venables 600cc honda untimed practice -- no time 20'49.46 108.709 mph 20'11.23 112.141 mph 20'05.19 112.703 mph 19'52.29 113.922 mph 23'32.62 96.153 mph 14 15 paul smyth 600cc yamaha untimed practice 21'45.78 104.021 mph 20'32.93 110.167 mph 20'30.08 110.422 mph 19'57.51 113.426 mph 20'13.71 111.912 mph 21'17.59 106.316 mph 15 16 jon kennaugh 750cc suzuki untimed practice 23'48.49 95.085 mph 21'06.84 107.218 mph 20'30.93 110.346 mph 20'36.14 109.881 mph 20'02.90 112.917 mph 23'41.65 95.542 mph 16 17 sebastian buch 600cc yamaha untimed practice 24'09.96 93.677 mph 20'58.89 107.895 mph 20'30.47 110.388 mph 20'17.58 111.556 mph 20'04.99 112.722 mph 24'11.51 93.577 mph 17 18 andrew farrell 750cc suzuki untimed practice 23'48.60 95.077 mph -- no time 20'20.84 111.258 mph -- no time 20'04.57 112.761 mph -- no time 18 19 ross johnson 600cc yamaha untimed practice 26'23.91 85.755 mph 20'35.56 109.932 mph 20'25.54 110.831 mph 20'09.55 112.297 mph 20'21.07 111.237 mph -- no time
{"rank":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19},"rider":{"0":"michael sweeney 600cc yamaha","1":"simon fulton 599cc yamaha","2":"wayne kirwan 600cc yamaha","3":"dan sayle 600cc yamaha","4":"andrew brady 748cc suzuki","5":"ivan lintin 750cc suzuki","6":"david lumsden 600cc yamaha","7":"jules croft 600c honda","8":"philip mcgurk 600cc honda","9":"stephen mcknight 599cc yamaha","10":"grant wagstaff 749cc suzuki","11":"shaun anderson 750cc suzuki","12":"dave moffitt 600cc honda","13":"tim venables 600cc honda","14":"paul smyth 600cc yamaha","15":"jon kennaugh 750cc suzuki","16":"sebastian buch 600cc yamaha","17":"andrew farrell 750cc suzuki","18":"ross johnson 600cc yamaha"},"sat 21 aug":{"0":"untimed practice","1":"untimed practice","2":"untimed practice","3":"untimed practice","4":"untimed practice","5":"untimed practice","6":"untimed practice","7":"untimed practice","8":"untimed practice","9":"untimed practice","10":"untimed practice","11":"untimed practice","12":"untimed practice","13":"untimed practice","14":"untimed practice","15":"untimed practice","16":"untimed practice","17":"untimed practice","18":"untimed practice"},"mon 23 aug":{"0":"26'57.82 89.957 mph","1":"23'31.88 96.203 mph","2":"22'38.60 99.977 mph","3":"23'08.44 97.828 mph","4":"-- no time","5":"19'24.69 116.622 mph","6":"24'38.98 91.839 mph","7":"25'45.94 87.961 mph","8":"23'43.94 95.389 mph","9":"23'08.68 97.811 mph","10":"22'03.28 102.645 mph","11":"-- no time","12":"24'26.35 92.630 mph","13":"-- no time","14":"21'45.78 104.021 mph","15":"23'48.49 95.085 mph","16":"24'09.96 93.677 mph","17":"23'48.60 95.077 mph","18":"26'23.91 85.755 mph"},"tues 24 aug":{"0":"19'29.69 116.123 mph","1":"19'19.83 117.110 mph","2":"19'38.41 115.386 mph","3":"20'03.70 112.842 mph","4":"19'22.55 116.836 mph","5":"19'37.17 115.386 mph","6":"20'28.61 110.554 mph","7":"20'03.37 112.873 mph","8":"19'48.52 115.386 mph","9":"20'24.84 110.894 mph","10":"20'21.23 111.222 mph","11":"20'47.83 108.851 mph","12":"20'52.96 108.406 mph","13":"20'49.46 108.709 mph","14":"20'32.93 110.167 mph","15":"21'06.84 107.218 mph","16":"20'58.89 107.895 mph","17":"-- no time","18":"20'35.56 109.932 mph"},"wed 25 aug":{"0":"19'17.77 104.021 mph","1":"19'13.11 117.793 mph","2":"19'29.39 116.153 mph","3":"-- no time","4":"19'34.24 115.673 mph","5":"19'20.32 117.061 mph","6":"20'09.25 112.324 mph","7":"20'10.73 112.187 mph","8":"19'50.42 115.386 mph","9":"20'08.43 112.401 mph","10":"19'50.39 114.103 mph","11":"20'28.34 110.579 mph","12":"19'53.18 113.837 mph","13":"20'11.23 112.141 mph","14":"20'30.08 110.422 mph","15":"20'30.93 110.346 mph","16":"20'30.47 110.388 mph","17":"20'20.84 111.258 mph","18":"20'25.54 110.831 mph"},"thurs 26 aug":{"0":"19'00.92 119.051 mph","1":"19'03.33 118.800 mph","2":"19'06.92 118.429 mph","3":"19'09.10 119.204 mph","4":"-- no time","5":"19'15.30 117.570 mph","6":"19'19.68 117.125 mph","7":"19'52.18 113.932 mph","8":"19'36.97 115.405 mph","9":"19'47.23 114.407 mph","10":"-- no time","11":"20'06.39 112.591 mph","12":"19'40.40 115.570 mph","13":"20'05.19 112.703 mph","14":"19'57.51 113.426 mph","15":"20'36.14 109.881 mph","16":"20'17.58 111.556 mph","17":"-- no time","18":"20'09.55 112.297 mph"},"fri 27 aug":{"0":"18'54.41 119.734 mph","1":"18'59.25 119.226 mph","2":"19'08.49 118.267 mph","3":"19'24.69 116.622 mph","4":"19'09.88 118.123 mph","5":"-- no time","6":"19'15.66 117.553 mph","7":"19'28.57 116.234 mph","8":"19'38.87 115.219 mph","9":"19'46.36 114.491 mph","10":"19'49.48 114.191 mph","11":"19'50.67 114.077 mph","12":"19'50.82 114.062 mph","13":"19'52.29 113.922 mph","14":"20'13.71 111.912 mph","15":"20'02.90 112.917 mph","16":"20'04.99 112.722 mph","17":"20'04.57 112.761 mph","18":"20'21.07 111.237 mph"},"sat 28 aug":{"0":"-- no time","1":"-- no time","2":"-- no time","3":"21'40.20 104.467 mph","4":"-- no time","5":"-- no time","6":"-- no time","7":"-- no time","8":"-- no time","9":"-- no time","10":"-- no time","11":"22'45.53 99.469 mph","12":"-- no time","13":"23'32.62 96.153 mph","14":"21'17.59 106.316 mph","15":"23'41.65 95.542 mph","16":"24'11.51 93.577 mph","17":"-- no time","18":"-- no time"}}
rank rider sat 21 aug mon 23 aug tues 24 aug wed 25 aug thurs 26 aug fri 27 aug sat 29 aug 0 1 michael sweeney 600cc yamaha untimed practice 26'57.82 89.957 mph 19'29.69 116.123 mph 19'17.77 104.021 mph 19'00.92 119.051 mph 18'54.41 119.734 mph -- no time 1 2 simon fulton 599cc yamaha untimed practice 23'31.88 96.203 mph 19'19.83 117.110 mph 19'13.11 117.793 mph 19'03.33 118.800 mph 18'59.25 119.226 mph -- no time 2 3 wayne kirwan 600cc yamaha untimed practice 22'38.60 99.977 mph 19'38.41 115.386 mph 19'29.39 116.153 mph 19'06.92 118.429 mph 19'08.49 118.267 mph -- no time 3 4 dan sayle 600cc yamaha untimed practice 23'08.44 97.828 mph 20'03.70 112.842 mph -- no time 19'09.10 119.204 mph 19'24.69 116.622 mph 21'40.20 104.467 mph 4 5 david lumsden 600cc yamaha untimed practice 24'38.98 91.839 mph 20'28.61 110.554 mph 20'09.25 112.324 mph 19'19.68 117.125 mph 19'15.66 117.553 mph -- no time 5 6 andrew brady 599cc honda untimed practice -- no time 20'31.13 110.328 mph 20'38.38 109.682 mph 19'21.45 116.947 mph 19'36.65 115.436 mph -- no time 6 7 jules croft 600c honda untimed practice 25'45.94 87.961 mph 20'03.37 112.873 mph 20'10.73 112.187 mph 19'52.18 113.932 mph 19'28.57 116.234 mph -- no time 7 8 philip mcgurk 600cc honda untimed practice 23'43.94 95.389 mph 19'48.52 115.386 mph 19'50.42 115.386 mph 19'36.97 115.405 mph 19'38.87 115.219 mph -- no time 8 9 andy fenton 600cc yamaha untimed practice 21'58.61 103.009 mph 19'57.44 113.432 mph 19'59.98 113.192 mph 19'50.53 114.090 mph 19'41.91 114.992 mph -- no time
{"rank":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9},"rider":{"0":"michael sweeney 600cc yamaha","1":"simon fulton 599cc yamaha","2":"wayne kirwan 600cc yamaha","3":"dan sayle 600cc yamaha","4":"david lumsden 600cc yamaha","5":"andrew brady 599cc honda","6":"jules croft 600c honda","7":"philip mcgurk 600cc honda","8":"andy fenton 600cc yamaha"},"sat 21 aug":{"0":"untimed practice","1":"untimed practice","2":"untimed practice","3":"untimed practice","4":"untimed practice","5":"untimed practice","6":"untimed practice","7":"untimed practice","8":"untimed practice"},"mon 23 aug":{"0":"26'57.82 89.957 mph","1":"23'31.88 96.203 mph","2":"22'38.60 99.977 mph","3":"23'08.44 97.828 mph","4":"24'38.98 91.839 mph","5":"-- no time","6":"25'45.94 87.961 mph","7":"23'43.94 95.389 mph","8":"21'58.61 103.009 mph"},"tues 24 aug":{"0":"19'29.69 116.123 mph","1":"19'19.83 117.110 mph","2":"19'38.41 115.386 mph","3":"20'03.70 112.842 mph","4":"20'28.61 110.554 mph","5":"20'31.13 110.328 mph","6":"20'03.37 112.873 mph","7":"19'48.52 115.386 mph","8":"19'57.44 113.432 mph"},"wed 25 aug":{"0":"19'17.77 104.021 mph","1":"19'13.11 117.793 mph","2":"19'29.39 116.153 mph","3":"-- no time","4":"20'09.25 112.324 mph","5":"20'38.38 109.682 mph","6":"20'10.73 112.187 mph","7":"19'50.42 115.386 mph","8":"19'59.98 113.192 mph"},"thurs 26 aug":{"0":"19'00.92 119.051 mph","1":"19'03.33 118.800 mph","2":"19'06.92 118.429 mph","3":"19'09.10 119.204 mph","4":"19'19.68 117.125 mph","5":"19'21.45 116.947 mph","6":"19'52.18 113.932 mph","7":"19'36.97 115.405 mph","8":"19'50.53 114.090 mph"},"fri 27 aug":{"0":"18'54.41 119.734 mph","1":"18'59.25 119.226 mph","2":"19'08.49 118.267 mph","3":"19'24.69 116.622 mph","4":"19'15.66 117.553 mph","5":"19'36.65 115.436 mph","6":"19'28.57 116.234 mph","7":"19'38.87 115.219 mph","8":"19'41.91 114.992 mph"},"sat 29 aug":{"0":"-- no time","1":"-- no time","2":"-- no time","3":"21'40.20 104.467 mph","4":"-- no time","5":"-- no time","6":"-- no time","7":"-- no time","8":"-- no time"}}
rank rider sat 21 aug mon 23 aug tues 24 aug wed 25 aug thurs 26 aug fri 27 aug sat 29 aug 0 1 dan sayle 250cc honda untimed practice 23'34.55 96.022 mph 20'08.34 112.409 mph 19'45.20 114.603 mph 19'43.42 114.776 mph 19'25.91 116.500 mph -- no time 1 2 neil kent 250cc yamaha untimed practice 23'59.95 94.328 mph 20'55.08 108.223 mph 20'12.27 112.044 mph 20'16.65 111.641 mph 20'27.09 110.691 mph 27'38.40 81.903 mph 2 3 roy richardson 249cc yamaha untimed practice 24'30.41 92.374 mph 20'26.79 110.718 mph -- no time 21'43.13 104.232 mph -- no time -- no time 3 4 nigel moore 250cc honda untimed practice 24'00.81 94.272 mph 20'56.25 108.122 mph 20'43.95 108.122 mph -- no time -- no time -- no time 4 5 davy morgan 250cc honda untimed practice -- no time -- no time -- no time -- no time 20'58.50 107.929 mph -- no time 5 6 stuart garton 250cc yamaha untimed practice 25'02.86 90.380 mph -- no time 20'58.09 107.964 mph 20'58.26 107.949 mph -- no time -- no time 6 7 tom snow 250cc honda untimed practice 24'42.96 91.592 mph 21'18.87 106.209 mph 21'05.83 107.304 mph 21'07.32 107.177 mph -- no time -- no time 7 8 phil harvey 250cc honda untimed practice -- no time 21'10.25 106.930 mph 21'15.61 106.481 mph -- no time 21'09.64 106.981 mph 27'38.40 81.903 mph 8 9 dean martin 250cc honda untimed practice -- no time -- no time -- no time 21'50.38 103.655 mph -- no time -- no time
{"rank":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9},"rider":{"0":"dan sayle 250cc honda","1":"neil kent 250cc yamaha","2":"roy richardson 249cc yamaha","3":"nigel moore 250cc honda","4":"davy morgan 250cc honda","5":"stuart garton 250cc yamaha","6":"tom snow 250cc honda","7":"phil harvey 250cc honda","8":"dean martin 250cc honda"},"sat 21 aug":{"0":"untimed practice","1":"untimed practice","2":"untimed practice","3":"untimed practice","4":"untimed practice","5":"untimed practice","6":"untimed practice","7":"untimed practice","8":"untimed practice"},"mon 23 aug":{"0":"23'34.55 96.022 mph","1":"23'59.95 94.328 mph","2":"24'30.41 92.374 mph","3":"24'00.81 94.272 mph","4":"-- no time","5":"25'02.86 90.380 mph","6":"24'42.96 91.592 mph","7":"-- no time","8":"-- no time"},"tues 24 aug":{"0":"20'08.34 112.409 mph","1":"20'55.08 108.223 mph","2":"20'26.79 110.718 mph","3":"20'56.25 108.122 mph","4":"-- no time","5":"-- no time","6":"21'18.87 106.209 mph","7":"21'10.25 106.930 mph","8":"-- no time"},"wed 25 aug":{"0":"19'45.20 114.603 mph","1":"20'12.27 112.044 mph","2":"-- no time","3":"20'43.95 108.122 mph","4":"-- no time","5":"20'58.09 107.964 mph","6":"21'05.83 107.304 mph","7":"21'15.61 106.481 mph","8":"-- no time"},"thurs 26 aug":{"0":"19'43.42 114.776 mph","1":"20'16.65 111.641 mph","2":"21'43.13 104.232 mph","3":"-- no time","4":"-- no time","5":"20'58.26 107.949 mph","6":"21'07.32 107.177 mph","7":"-- no time","8":"21'50.38 103.655 mph"},"fri 27 aug":{"0":"19'25.91 116.500 mph","1":"20'27.09 110.691 mph","2":"-- no time","3":"-- no time","4":"20'58.50 107.929 mph","5":"-- no time","6":"-- no time","7":"21'09.64 106.981 mph","8":"-- no time"},"sat 29 aug":{"0":"-- no time","1":"27'38.40 81.903 mph","2":"-- no time","3":"-- no time","4":"-- no time","5":"-- no time","6":"-- no time","7":"27'38.40 81.903 mph","8":"-- no time"}}
rank rider sat 21 aug mon 23 aug tues 24 aug wed 25 aug thurs 26 aug fri 27 aug sat 28 aug 0 1 michael dunlop 997cc suzuki xr69 untimed practice 24'28.12 92.518 mph 21'12.70 106.725 mph 19'40.12 115.097 mph 19'11.80 117.927 mph 18'55.78 119.590 mph 22'47.27 99.3435 mph 1 2 oliver linsdell 746cc yamaha fz untimed practice -- no time 20'34.41 110.035 mph 19'41.82 114.931 mph -- no time -- no time -- no time 2 3 mark buckley 997cc suzuki xr69 untimed practice 24'30.82 92.349 mph 20'38.40 109.680 mph 20'24.55 110.920 mph 20'45.21 109.081 mph 20'02.56 112.949 mph 22'40.04 99.871 mph 3 4 john barton 749cc suzuki gsx - r untimed practice -- no time 21'18.05 106.278 mph 20'59.91 107.808 mph 20'56.01 108.143 mph 20'35.96 109.897 mph -- no time 4 5 mick godfrey 1000cc suzuki gsx - r untimed practice 27'09.87 83.337 mph 22'07.70 102.303 mph 22'20.01 101.363 mph 21'13.75 106.636 mph -- no time 24'07.75 93.820 mph 5 6 neil vicars 750cc suzuki gsx - r untimed practice 24'39.44 91.811 mph -- no time 22'35.91 100.175 mph 21'58.65 103.005 mph 22'23.97 101.065 mph -- no time 6 7 david taylor 1000cc suzuki gs untimed practice 26'04.68 86.809 mph 23'39.23 95.706 mph 23'02.31 98.262 mph 22'03.33 98.189 mph 23'06.12 97.992 mph -- no time 7 8 andy lovett 750cc suzuki untimed practice -- no time -- no time 23'40.76 99.817 mph 22'28.61 100.717 mph 22'05.33 102.486 mph 25'88.494 110.035 mph 8 9 geoff martin 750cc suzuki untimed practice -- no time 22'43.21 99.639 mph 23'23.80 96.758 mph 22'05.58 102.467 mph 23'33.97 96.061 mph 26'01.51 86.985 mph
{"rank":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9},"rider":{"0":"michael dunlop 997cc suzuki xr69","1":"oliver linsdell 746cc yamaha fz","2":"mark buckley 997cc suzuki xr69","3":"john barton 749cc suzuki gsx - r","4":"mick godfrey 1000cc suzuki gsx - r","5":"neil vicars 750cc suzuki gsx - r","6":"david taylor 1000cc suzuki gs","7":"andy lovett 750cc suzuki","8":"geoff martin 750cc suzuki"},"sat 21 aug":{"0":"untimed practice","1":"untimed practice","2":"untimed practice","3":"untimed practice","4":"untimed practice","5":"untimed practice","6":"untimed practice","7":"untimed practice","8":"untimed practice"},"mon 23 aug":{"0":"24'28.12 92.518 mph","1":"-- no time","2":"24'30.82 92.349 mph","3":"-- no time","4":"27'09.87 83.337 mph","5":"24'39.44 91.811 mph","6":"26'04.68 86.809 mph","7":"-- no time","8":"-- no time"},"tues 24 aug":{"0":"21'12.70 106.725 mph","1":"20'34.41 110.035 mph","2":"20'38.40 109.680 mph","3":"21'18.05 106.278 mph","4":"22'07.70 102.303 mph","5":"-- no time","6":"23'39.23 95.706 mph","7":"-- no time","8":"22'43.21 99.639 mph"},"wed 25 aug":{"0":"19'40.12 115.097 mph","1":"19'41.82 114.931 mph","2":"20'24.55 110.920 mph","3":"20'59.91 107.808 mph","4":"22'20.01 101.363 mph","5":"22'35.91 100.175 mph","6":"23'02.31 98.262 mph","7":"23'40.76 99.817 mph","8":"23'23.80 96.758 mph"},"thurs 26 aug":{"0":"19'11.80 117.927 mph","1":"-- no time","2":"20'45.21 109.081 mph","3":"20'56.01 108.143 mph","4":"21'13.75 106.636 mph","5":"21'58.65 103.005 mph","6":"22'03.33 98.189 mph","7":"22'28.61 100.717 mph","8":"22'05.58 102.467 mph"},"fri 27 aug":{"0":"18'55.78 119.590 mph","1":"-- no time","2":"20'02.56 112.949 mph","3":"20'35.96 109.897 mph","4":"-- no time","5":"22'23.97 101.065 mph","6":"23'06.12 97.992 mph","7":"22'05.33 102.486 mph","8":"23'33.97 96.061 mph"},"sat 28 aug":{"0":"22'47.27 99.3435 mph","1":"-- no time","2":"22'40.04 99.871 mph","3":"-- no time","4":"24'07.75 93.820 mph","5":"-- no time","6":"-- no time","7":"25'88.494 110.035 mph","8":"26'01.51 86.985 mph"}}
rank rider sat 21 aug mon 23 aug tues 24 aug wed 25 aug thurs 26 aug fri 27 aug sat 28 aug 0 1 andy fenton 600cc yamaha untimed practice 21'58.61 103.009 mph 19'57.44 113.432 mph 19'59.98 113.192 mph 19'50.53 114.090 mph 19'41.91 114.922 mph -- no time 1 2 james coward 600cc yamaha untimed practice 23'22.43 96.852 mph 20'46.35 108.981 mph 20'41.21 109.432 mph 20'08.79 112.367 mph 19'46.70 114.459 mph 22'43.36 99.627 mph 2 3 shaun anderson 750cc suzuki untimed practice 24'24.44 92.751 mph 20'47.83 108.851 mph 20'28.34 110.579 mph 20'06.39 112.591 mph 19'50.67 114.077 mph 22'45.53 99.469 mph 3 4 tim venables 600cc honda untimed practice -- no time 20'49.46 108.709 mph 20'11.23 112.141 mph 20'05.19 112.703 mph 19'52.29 113.922 mph 23'32.62 96.153 mph 4 5 jon kennaugh 750cc suzuki untimed practice 23'48.49 95.085 mph 21'06.84 107.218 mph 20'30.93 110.346 mph 20'36.14 109.881 mph 20'02.90 112.917 mph 23'41.65 95.542 mph 5 6 sebastian buch 600cc yamaha untimed practice 24'09.96 93.677 mph 20'58.89 107.895 mph 20'30.47 110.388 mph 20'17.58 111.556 mph 20'04.99 112.722 mph 24'11.51 93.577 mph 6 7 tommaso totti 600cc yamaha untimed practice 24'38.87 91.846 mph 22'09.44 93.840 mph 21'38.19 104.629 mph 20'47.61 108.871 mph 20'23.66 111.002 mph -- no time 7 8 billy byrne 600cc honda untimed practice 23'02.47 98.250 mph 21'13.17 106.685 mph 20'50.62 108.609 mph 20'53.89 108.325 mph 20'30.61 110.375 mph 23'12.93 97.512 mph 8 9 robert simcock 750cc suzuki untimed practice 24'24.44 92.751 mph 21'06.16 107.275 mph -- no time -- no time 20'47.48 108.882 mph -- no time
{"rank":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9},"rider":{"0":"andy fenton 600cc yamaha","1":"james coward 600cc yamaha","2":"shaun anderson 750cc suzuki","3":"tim venables 600cc honda","4":"jon kennaugh 750cc suzuki","5":"sebastian buch 600cc yamaha","6":"tommaso totti 600cc yamaha","7":"billy byrne 600cc honda","8":"robert simcock 750cc suzuki"},"sat 21 aug":{"0":"untimed practice","1":"untimed practice","2":"untimed practice","3":"untimed practice","4":"untimed practice","5":"untimed practice","6":"untimed practice","7":"untimed practice","8":"untimed practice"},"mon 23 aug":{"0":"21'58.61 103.009 mph","1":"23'22.43 96.852 mph","2":"24'24.44 92.751 mph","3":"-- no time","4":"23'48.49 95.085 mph","5":"24'09.96 93.677 mph","6":"24'38.87 91.846 mph","7":"23'02.47 98.250 mph","8":"24'24.44 92.751 mph"},"tues 24 aug":{"0":"19'57.44 113.432 mph","1":"20'46.35 108.981 mph","2":"20'47.83 108.851 mph","3":"20'49.46 108.709 mph","4":"21'06.84 107.218 mph","5":"20'58.89 107.895 mph","6":"22'09.44 93.840 mph","7":"21'13.17 106.685 mph","8":"21'06.16 107.275 mph"},"wed 25 aug":{"0":"19'59.98 113.192 mph","1":"20'41.21 109.432 mph","2":"20'28.34 110.579 mph","3":"20'11.23 112.141 mph","4":"20'30.93 110.346 mph","5":"20'30.47 110.388 mph","6":"21'38.19 104.629 mph","7":"20'50.62 108.609 mph","8":"-- no time"},"thurs 26 aug":{"0":"19'50.53 114.090 mph","1":"20'08.79 112.367 mph","2":"20'06.39 112.591 mph","3":"20'05.19 112.703 mph","4":"20'36.14 109.881 mph","5":"20'17.58 111.556 mph","6":"20'47.61 108.871 mph","7":"20'53.89 108.325 mph","8":"-- no time"},"fri 27 aug":{"0":"19'41.91 114.922 mph","1":"19'46.70 114.459 mph","2":"19'50.67 114.077 mph","3":"19'52.29 113.922 mph","4":"20'02.90 112.917 mph","5":"20'04.99 112.722 mph","6":"20'23.66 111.002 mph","7":"20'30.61 110.375 mph","8":"20'47.48 108.882 mph"},"sat 28 aug":{"0":"-- no time","1":"22'43.36 99.627 mph","2":"22'45.53 99.469 mph","3":"23'32.62 96.153 mph","4":"23'41.65 95.542 mph","5":"24'11.51 93.577 mph","6":"-- no time","7":"23'12.93 97.512 mph","8":"-- no time"}}
city / municipality no of s barangay population (2010) area (km square) pop density (per km square) 0 adams 1 1785 159.31 11.2 1 bacarra 43 31648 65.32 484.5 2 badoc 31 30708 76.68 400.5 3 bangui 15 15025 112.98 133.0 4 banna (espiritu) 20 19051 92.73 205.4 5 batac city 43 53542 161.06 332.4 6 burgos 11 9687 128.90 75.2 7 carasi 3 1473 82.97 17.8 8 currimao 23 11970 34.08 351.2 9 dingras 31 37021 96.00 385.6 10 dumalneg 1 1814 88.48 20.5 11 laoag city 80 104904 116.08 903.7 12 marcos 13 16984 72.77 233.4 13 nueva era 11 7837 515.02 15.2 14 pagudpud 16 21877 194.90 112.2 15 paoay 31 23956 76.24 314.2 16 pasuquin 33 27952 210.54 132.8 17 piddig 23 20606 216.20 95.3 18 pinili 25 16732 89.48 187.0 19 san nicolas 24 34237 40.18 852.1 20 sarrat 24 24770 57.39 431.6 21 solsona 22 22990 166.23 138.3
{"city \/ municipality":{"0":"adams","1":"bacarra","2":"badoc","3":"bangui","4":"banna (espiritu)","5":"batac city","6":"burgos","7":"carasi","8":"currimao","9":"dingras","10":"dumalneg","11":"laoag city","12":"marcos","13":"nueva era","14":"pagudpud","15":"paoay","16":"pasuquin","17":"piddig","18":"pinili","19":"san nicolas","20":"sarrat","21":"solsona"},"no of s barangay":{"0":1,"1":43,"2":31,"3":15,"4":20,"5":43,"6":11,"7":3,"8":23,"9":31,"10":1,"11":80,"12":13,"13":11,"14":16,"15":31,"16":33,"17":23,"18":25,"19":24,"20":24,"21":22},"population (2010)":{"0":1785,"1":31648,"2":30708,"3":15025,"4":19051,"5":53542,"6":9687,"7":1473,"8":11970,"9":37021,"10":1814,"11":104904,"12":16984,"13":7837,"14":21877,"15":23956,"16":27952,"17":20606,"18":16732,"19":34237,"20":24770,"21":22990},"area (km square)":{"0":159.31,"1":65.32,"2":76.68,"3":112.98,"4":92.73,"5":161.06,"6":128.9,"7":82.97,"8":34.08,"9":96.0,"10":88.48,"11":116.08,"12":72.77,"13":515.02,"14":194.9,"15":76.24,"16":210.54,"17":216.2,"18":89.48,"19":40.18,"20":57.39,"21":166.23},"pop density (per km square)":{"0":11.2,"1":484.5,"2":400.5,"3":133.0,"4":205.4,"5":332.4,"6":75.2,"7":17.8,"8":351.2,"9":385.6,"10":20.5,"11":903.7,"12":233.4,"13":15.2,"14":112.2,"15":314.2,"16":132.8,"17":95.3,"18":187.0,"19":852.1,"20":431.6,"21":138.3}}
model speed (ghz) l3 cache (mb) qpi speed (gt / s) ddr3 clock (mhz) tdp (w) cores threads turbo - boost 0 w3503 2.40 4 4.8 1066 130 2 2 no 1 w3505 2.53 4 4.8 1066 130 2 2 no 2 w3520 2.66 8 4.8 1066 130 4 8 yes 3 w3530 2.80 8 4.8 1066 130 4 8 yes 4 w3540 2.93 8 4.8 1066 130 4 8 yes 5 w3550 3.06 8 4.8 1066 130 4 8 yes 6 w3565 3.20 8 4.8 1066 130 4 8 yes 7 w3570 3.20 8 6.4 1333 130 4 8 yes
{"model":{"0":"w3503","1":"w3505","2":"w3520","3":"w3530","4":"w3540","5":"w3550","6":"w3565","7":"w3570"},"speed (ghz)":{"0":2.4,"1":2.53,"2":2.66,"3":2.8,"4":2.93,"5":3.06,"6":3.2,"7":3.2},"l3 cache (mb)":{"0":4,"1":4,"2":8,"3":8,"4":8,"5":8,"6":8,"7":8},"qpi speed (gt \/ s)":{"0":4.8,"1":4.8,"2":4.8,"3":4.8,"4":4.8,"5":4.8,"6":4.8,"7":6.4},"ddr3 clock (mhz)":{"0":1066,"1":1066,"2":1066,"3":1066,"4":1066,"5":1066,"6":1066,"7":1333},"tdp (w)":{"0":130,"1":130,"2":130,"3":130,"4":130,"5":130,"6":130,"7":130},"cores":{"0":2,"1":2,"2":4,"3":4,"4":4,"5":4,"6":4,"7":4},"threads":{"0":2,"1":2,"2":8,"3":8,"4":8,"5":8,"6":8,"7":8},"turbo - boost":{"0":"no","1":"no","2":"yes","3":"yes","4":"yes","5":"yes","6":"yes","7":"yes"}}
pick cfl team player position college 0 1 calgary (1) via winnipeg wayne holm qb simon fraser 1 2 hamilton (1) via montreal dave fahrner fb western 2 3 edmonton (1) evald timusk ot waterloo lutheran 3 4 bc (1) john mcmanus de alberta 4 5 hamilton (2) jim bennett ot toronto 5 6 calgary (2) barry jamieson ot waterloo lutheran 6 7 winnipeg (1) via toronto bob larose hb western 7 8 saskatchewan (1) bob schmidt ot alberta
{"pick":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8},"cfl team":{"0":"calgary (1) via winnipeg","1":"hamilton (1) via montreal","2":"edmonton (1)","3":"bc (1)","4":"hamilton (2)","5":"calgary (2)","6":"winnipeg (1) via toronto","7":"saskatchewan (1)"},"player":{"0":"wayne holm","1":"dave fahrner","2":"evald timusk","3":"john mcmanus","4":"jim bennett","5":"barry jamieson","6":"bob larose","7":"bob schmidt"},"position":{"0":"qb","1":"fb","2":"ot","3":"de","4":"ot","5":"ot","6":"hb","7":"ot"},"college":{"0":"simon fraser","1":"western","2":"waterloo lutheran","3":"alberta","4":"toronto","5":"waterloo lutheran","6":"western","7":"alberta"}}
pick cfl team player position college 0 10 winnipeg (2) john senst fl simon fraser 1 11 montreal (1) burns mcpherson hb st francis xavier 2 12 edmonton (2) jim henshall hb western 3 13 bc lions (2) tony d'aloisio fb windsor 4 14 winnipeg (3) via hamilton rick sugden hb simon fraser 5 15 calgary (3) don lumb ot british columbia 6 16 toronto (1) paul brown ot waterloo lutheran 7 17 saskatchewan (2) andre rancourt de ottawa
{"pick":{"0":10,"1":11,"2":12,"3":13,"4":14,"5":15,"6":16,"7":17},"cfl team":{"0":"winnipeg (2)","1":"montreal (1)","2":"edmonton (2)","3":"bc lions (2)","4":"winnipeg (3) via hamilton","5":"calgary (3)","6":"toronto (1)","7":"saskatchewan (2)"},"player":{"0":"john senst","1":"burns mcpherson","2":"jim henshall","3":"tony d'aloisio","4":"rick sugden","5":"don lumb","6":"paul brown","7":"andre rancourt"},"position":{"0":"fl","1":"hb","2":"hb","3":"fb","4":"hb","5":"ot","6":"ot","7":"de"},"college":{"0":"simon fraser","1":"st francis xavier","2":"western","3":"windsor","4":"simon fraser","5":"british columbia","6":"waterloo lutheran","7":"ottawa"}}
pick cfl team player position college 0 19 winnipeg (4) wayne powell og ottawa 1 20 montreal (2) andy smith lb mount allison 2 21 edmonton (3) paul hendershot hb waterloo lutheran 3 22 bc lions (3) pete raham db toronto 4 23 hamilton (3) paul mckay hb toronto 5 24 calgary (4) tom schultz de ottawa 6 25 toronto (2) john candiotto de - pk dalhousie 7 26 saskatchewan (3) bob mcculla ot ottawa
{"pick":{"0":19,"1":20,"2":21,"3":22,"4":23,"5":24,"6":25,"7":26},"cfl team":{"0":"winnipeg (4)","1":"montreal (2)","2":"edmonton (3)","3":"bc lions (3)","4":"hamilton (3)","5":"calgary (4)","6":"toronto (2)","7":"saskatchewan (3)"},"player":{"0":"wayne powell","1":"andy smith","2":"paul hendershot","3":"pete raham","4":"paul mckay","5":"tom schultz","6":"john candiotto","7":"bob mcculla"},"position":{"0":"og","1":"lb","2":"hb","3":"db","4":"hb","5":"de","6":"de - pk","7":"ot"},"college":{"0":"ottawa","1":"mount allison","2":"waterloo lutheran","3":"toronto","4":"toronto","5":"ottawa","6":"dalhousie","7":"ottawa"}}
pick cfl team player position college 0 28 winnipeg (5) john storey hb saskatchewan 1 29 montreal (3) john proter ot st mary 's 2 30 edmonton (4) carl lindros de western 3 31 bc lions (4) don warrington hb simon fraser 4 32 hamilton (5) jay graydon db mcmaster 5 33 calgary (5) dave sterritt ot waterloo 6 34 toronto (3) vince lyons hb mcmaster 7 35 saskatchewan (4) greg hunter hb alberta
{"pick":{"0":28,"1":29,"2":30,"3":31,"4":32,"5":33,"6":34,"7":35},"cfl team":{"0":"winnipeg (5)","1":"montreal (3)","2":"edmonton (4)","3":"bc lions (4)","4":"hamilton (5)","5":"calgary (5)","6":"toronto (3)","7":"saskatchewan (4)"},"player":{"0":"john storey","1":"john proter","2":"carl lindros","3":"don warrington","4":"jay graydon","5":"dave sterritt","6":"vince lyons","7":"greg hunter"},"position":{"0":"hb","1":"ot","2":"de","3":"hb","4":"db","5":"ot","6":"hb","7":"hb"},"college":{"0":"saskatchewan","1":"st mary 's","2":"western","3":"simon fraser","4":"mcmaster","5":"waterloo","6":"mcmaster","7":"alberta"}}
team outgoing manager manner of departure date of vacancy replaced by date of appointment 0 mke ankaragücü roger lemerre mutual consent 23 may 2010 ümit özat 24 may 2010 1 beşiktaş mustafa denizli retired 2 june 2010 bernd schuster 10 june 2010 2 fenerbahçe christoph daum sacked 25 june 2010 aykut kocaman 26 june 2010 3 manisaspor hakan kutlu resigned 12 september 2010 hikmet karaman 13 september 2010 4 eskişehirspor rıza çalımbay sacked 27 september 2010 bülent uygun 6 october 2010 5 bucaspor bülent uygun resigned 4 october 2010 samet aybaba 7 october 2010 6 galatasaray sk frank rijkaard mutual consent 20 october 2010 gheorghe hagi 22 october 2010 7 gençlerbirliği sk thomas doll mutual consent 21 october 2010 ralf zumdick 21 october 2010 8 sivasspor mesut bakkal sacked 23 october 2010 rıza çalımbay 24 october 2010 9 kasımpaşa yılmaz vural retired 27 december 2010 fuat çapa 27 december 2010 10 konyaspor ziya doğan resigned 14 february 2011 yılmaz vural 15 february 2011 11 ankaragücü ümit özat resigned 26 february 2011 mesut bakkal 28 february 2011 12 beşiktaş bernd schuster resigned 15 march 2011 tayfur havutçu 15 march 2011
{"team":{"0":"mke ankaragücü","1":"beşiktaş","2":"fenerbahçe","3":"manisaspor","4":"eskişehirspor","5":"bucaspor","6":"galatasaray sk","7":"gençlerbirliği sk","8":"sivasspor","9":"kasımpaşa","10":"konyaspor","11":"ankaragücü","12":"beşiktaş"},"outgoing manager":{"0":"roger lemerre","1":"mustafa denizli","2":"christoph daum","3":"hakan kutlu","4":"rıza çalımbay","5":"bülent uygun","6":"frank rijkaard","7":"thomas doll","8":"mesut bakkal","9":"yılmaz vural","10":"ziya doğan","11":"ümit özat","12":"bernd schuster"},"manner of departure":{"0":"mutual consent","1":"retired","2":"sacked","3":"resigned","4":"sacked","5":"resigned","6":"mutual consent","7":"mutual consent","8":"sacked","9":"retired","10":"resigned","11":"resigned","12":"resigned"},"date of vacancy":{"0":"23 may 2010","1":"2 june 2010","2":"25 june 2010","3":"12 september 2010","4":"27 september 2010","5":"4 october 2010","6":"20 october 2010","7":"21 october 2010","8":"23 october 2010","9":"27 december 2010","10":"14 february 2011","11":"26 february 2011","12":"15 march 2011"},"replaced by":{"0":"ümit özat","1":"bernd schuster","2":"aykut kocaman","3":"hikmet karaman","4":"bülent uygun","5":"samet aybaba","6":"gheorghe hagi","7":"ralf zumdick","8":"rıza çalımbay","9":"fuat çapa","10":"yılmaz vural","11":"mesut bakkal","12":"tayfur havutçu"},"date of appointment":{"0":"24 may 2010","1":"10 june 2010","2":"26 june 2010","3":"13 september 2010","4":"6 october 2010","5":"7 october 2010","6":"22 october 2010","7":"21 october 2010","8":"24 october 2010","9":"27 december 2010","10":"15 february 2011","11":"28 february 2011","12":"15 march 2011"}}
city population registered voters democratic republican dr spread other no party preference 0 banning 29414 42.9% 38.9% 40.8% - 1.9% 8.2% 15.4% 1 beaumont 34737 46.4% 33.6% 40.8% - 7.2% 10.3% 19.4% 2 blythe 21102 23.1% 40.3% 36.0% + 4.3% 9.2% 18.3% 3 calimesa 7923 53.7% 29.0% 48.8% - 19.8% 10.1% 16.2% 4 canyon lake 10663 57.3% 19.9% 57.5% - 37.6% 9.7% 16.8% 5 cathedral city 51130 37.6% 46.9% 31.8% + 15.1% 6.2% 17.5% 6 coachella 39442 25.0% 72.1% 13.1% + 59.0% 2.9% 12.8% 7 corona 152111 43.0% 32.9% 43.3% - 10.4% 7.2% 19.2% 8 desert hot springs 25793 35.5% 44.0% 32.7% + 11.3% 8.3% 18.0% 9 eastvale 53437 40.6% 38.0% 34.2% + 3.8% 6.9% 23.6% 10 hemet 77752 44.8% 34.0% 42.4% - 8.4% 9.3% 18.1% 11 indian wells 4937 59.8% 19.0% 62.7% - 43.7% 6.5% 14.4% 12 indio 74402 39.7% 47.9% 33.0% + 14.9% 6.0% 15.4% 13 jurupa valley 57464 58.4% 40.1% 37.1% + 3.0% 7.1% 18.3% 14 la quinta 36600 52.8% 30.6% 47.4% - 16.8% 8.1% 17.2% 15 lake elsinore 50405 38.1% 33.8% 36.8% - 3.0% 9.7% 23.4% 16 menifee 75023 52.0% 31.1% 44.2% - 13.1% 9.6% 19.0% 17 moreno valley 190977 43.5% 48.1% 33.5% + 14.6% 5.6% 14.8% 18 murrieta 99476 48.8% 25.3% 48.2% - 22.9% 9.2% 20.8% 19 norco 27131 45.0% 25.2% 52.5% - 27.3% 8.2% 17.2% 20 palm desert 48769 50.7% 31.5% 45.8% - 14.3% 7.6% 18.1% 21 palm springs 45045 53.7% 50.9% 26.7% + 24.2% 7.3% 17.9% 22 perris 65993 36.3% 54.2% 27.8% + 26.4% 5.1% 14.6% 23 rancho mirage 17022 58.8% 33.2% 45.3% - 12.1% 5.8% 18.0% 24 riverside 303569 44.0% 38.5% 39.0% - 0.5% 7.5% 17.6% 25 san jacinto 42722 38.0% 36.5% 38.6% - 2.1% 9.3% 19.1% 26 temecula 98189 48.0% 25.2% 47.6% - 22.4% 9.7% 21.4%
{"city":{"0":"banning","1":"beaumont","2":"blythe","3":"calimesa","4":"canyon lake","5":"cathedral city","6":"coachella","7":"corona","8":"desert hot springs","9":"eastvale","10":"hemet","11":"indian wells","12":"indio","13":"jurupa valley","14":"la quinta","15":"lake elsinore","16":"menifee","17":"moreno valley","18":"murrieta","19":"norco","20":"palm desert","21":"palm springs","22":"perris","23":"rancho mirage","24":"riverside","25":"san jacinto","26":"temecula"},"population":{"0":29414,"1":34737,"2":21102,"3":7923,"4":10663,"5":51130,"6":39442,"7":152111,"8":25793,"9":53437,"10":77752,"11":4937,"12":74402,"13":57464,"14":36600,"15":50405,"16":75023,"17":190977,"18":99476,"19":27131,"20":48769,"21":45045,"22":65993,"23":17022,"24":303569,"25":42722,"26":98189},"registered voters":{"0":"42.9%","1":"46.4%","2":"23.1%","3":"53.7%","4":"57.3%","5":"37.6%","6":"25.0%","7":"43.0%","8":"35.5%","9":"40.6%","10":"44.8%","11":"59.8%","12":"39.7%","13":"58.4%","14":"52.8%","15":"38.1%","16":"52.0%","17":"43.5%","18":"48.8%","19":"45.0%","20":"50.7%","21":"53.7%","22":"36.3%","23":"58.8%","24":"44.0%","25":"38.0%","26":"48.0%"},"democratic":{"0":"38.9%","1":"33.6%","2":"40.3%","3":"29.0%","4":"19.9%","5":"46.9%","6":"72.1%","7":"32.9%","8":"44.0%","9":"38.0%","10":"34.0%","11":"19.0%","12":"47.9%","13":"40.1%","14":"30.6%","15":"33.8%","16":"31.1%","17":"48.1%","18":"25.3%","19":"25.2%","20":"31.5%","21":"50.9%","22":"54.2%","23":"33.2%","24":"38.5%","25":"36.5%","26":"25.2%"},"republican":{"0":"40.8%","1":"40.8%","2":"36.0%","3":"48.8%","4":"57.5%","5":"31.8%","6":"13.1%","7":"43.3%","8":"32.7%","9":"34.2%","10":"42.4%","11":"62.7%","12":"33.0%","13":"37.1%","14":"47.4%","15":"36.8%","16":"44.2%","17":"33.5%","18":"48.2%","19":"52.5%","20":"45.8%","21":"26.7%","22":"27.8%","23":"45.3%","24":"39.0%","25":"38.6%","26":"47.6%"},"dr spread":{"0":"- 1.9%","1":"- 7.2%","2":"+ 4.3%","3":"- 19.8%","4":"- 37.6%","5":"+ 15.1%","6":"+ 59.0%","7":"- 10.4%","8":"+ 11.3%","9":"+ 3.8%","10":"- 8.4%","11":"- 43.7%","12":"+ 14.9%","13":"+ 3.0%","14":"- 16.8%","15":"- 3.0%","16":"- 13.1%","17":"+ 14.6%","18":"- 22.9%","19":"- 27.3%","20":"- 14.3%","21":"+ 24.2%","22":"+ 26.4%","23":"- 12.1%","24":"- 0.5%","25":"- 2.1%","26":"- 22.4%"},"other":{"0":"8.2%","1":"10.3%","2":"9.2%","3":"10.1%","4":"9.7%","5":"6.2%","6":"2.9%","7":"7.2%","8":"8.3%","9":"6.9%","10":"9.3%","11":"6.5%","12":"6.0%","13":"7.1%","14":"8.1%","15":"9.7%","16":"9.6%","17":"5.6%","18":"9.2%","19":"8.2%","20":"7.6%","21":"7.3%","22":"5.1%","23":"5.8%","24":"7.5%","25":"9.3%","26":"9.7%"},"no party preference":{"0":"15.4%","1":"19.4%","2":"18.3%","3":"16.2%","4":"16.8%","5":"17.5%","6":"12.8%","7":"19.2%","8":"18.0%","9":"23.6%","10":"18.1%","11":"14.4%","12":"15.4%","13":"18.3%","14":"17.2%","15":"23.4%","16":"19.0%","17":"14.8%","18":"20.8%","19":"17.2%","20":"18.1%","21":"17.9%","22":"14.6%","23":"18.0%","24":"17.6%","25":"19.1%","26":"21.4%"}}
city population registered voters democratic republican dr spread other no party preference 0 carlsbad 102342 64.7% 28.0% 42.0% - 14.0% 8.5% 24.9% 1 chula vista 236218 48.2% 42.0% 27.7% + 14.3% 6.9% 26.1% 2 coronado 19423 55.0% 24.5% 47.3% - 22.8% 8.0% 23.5% 3 del mar 4175 77.2% 34.2% 34.7% - 0.5% 7.4% 26.7% 4 el cajon 98813 40.9% 33.7% 37.4% - 3.7% 9.5% 23.2% 5 encinitas 59223 67.8% 35.1% 32.8% + 2.3% 9.0% 26.4% 6 escondido 142573 41.8% 28.3% 42.4% - 14.1% 9.3% 23.7% 7 imperial beach 26348 42.9% 37.1% 26.7% + 10.4% 10.4% 29.6% 8 la mesa 56722 58.3% 37.9% 32.5% + 5.4% 9.8% 23.6% 9 lemon grove 25250 51.2% 44.5% 27.7% + 16.8% 8.4% 22.6% 10 national city 58015 32.9% 48.9% 19.5% + 29.4% 7.0% 27.2% 11 oceanside 166139 50.5% 31.6% 37.8% - 6.2% 9.2% 25.1% 12 poway 47762 61.5% 24.8% 45.7% - 20.9% 7.8% 24.8% 13 san diego 1296437 52.6% 40.2% 27.0% + 13.2% 8.2% 27.7% 14 san marcos 80709 48.5% 29.3% 40.6% - 11.3% 9.1% 24.8% 15 santee 53302 59.2% 27.0% 43.9% - 16.9% 9.7% 23.2% 16 solana beach 12864 68.0% 32.4% 37.1% - 4.7% 7.4% 26.0%
{"city":{"0":"carlsbad","1":"chula vista","2":"coronado","3":"del mar","4":"el cajon","5":"encinitas","6":"escondido","7":"imperial beach","8":"la mesa","9":"lemon grove","10":"national city","11":"oceanside","12":"poway","13":"san diego","14":"san marcos","15":"santee","16":"solana beach"},"population":{"0":102342,"1":236218,"2":19423,"3":4175,"4":98813,"5":59223,"6":142573,"7":26348,"8":56722,"9":25250,"10":58015,"11":166139,"12":47762,"13":1296437,"14":80709,"15":53302,"16":12864},"registered voters":{"0":"64.7%","1":"48.2%","2":"55.0%","3":"77.2%","4":"40.9%","5":"67.8%","6":"41.8%","7":"42.9%","8":"58.3%","9":"51.2%","10":"32.9%","11":"50.5%","12":"61.5%","13":"52.6%","14":"48.5%","15":"59.2%","16":"68.0%"},"democratic":{"0":"28.0%","1":"42.0%","2":"24.5%","3":"34.2%","4":"33.7%","5":"35.1%","6":"28.3%","7":"37.1%","8":"37.9%","9":"44.5%","10":"48.9%","11":"31.6%","12":"24.8%","13":"40.2%","14":"29.3%","15":"27.0%","16":"32.4%"},"republican":{"0":"42.0%","1":"27.7%","2":"47.3%","3":"34.7%","4":"37.4%","5":"32.8%","6":"42.4%","7":"26.7%","8":"32.5%","9":"27.7%","10":"19.5%","11":"37.8%","12":"45.7%","13":"27.0%","14":"40.6%","15":"43.9%","16":"37.1%"},"dr spread":{"0":"- 14.0%","1":"+ 14.3%","2":"- 22.8%","3":"- 0.5%","4":"- 3.7%","5":"+ 2.3%","6":"- 14.1%","7":"+ 10.4%","8":"+ 5.4%","9":"+ 16.8%","10":"+ 29.4%","11":"- 6.2%","12":"- 20.9%","13":"+ 13.2%","14":"- 11.3%","15":"- 16.9%","16":"- 4.7%"},"other":{"0":"8.5%","1":"6.9%","2":"8.0%","3":"7.4%","4":"9.5%","5":"9.0%","6":"9.3%","7":"10.4%","8":"9.8%","9":"8.4%","10":"7.0%","11":"9.2%","12":"7.8%","13":"8.2%","14":"9.1%","15":"9.7%","16":"7.4%"},"no party preference":{"0":"24.9%","1":"26.1%","2":"23.5%","3":"26.7%","4":"23.2%","5":"26.4%","6":"23.7%","7":"29.6%","8":"23.6%","9":"22.6%","10":"27.2%","11":"25.1%","12":"24.8%","13":"27.7%","14":"24.8%","15":"23.2%","16":"26.0%"}}
train no train name arrival departure days platform no 0 5037 kanpur - farrukhabad express 10:55 11:05 daily platform no2 1 5038 farrukhabad - kanpur express 17:25 17:30 daily platform no2 2 4723 kanpur - bhiwani kalindi express 17:15 17:25 daily platform no2 3 4724 bhiwani - kanpur kalindi express 11:00 10:55 daily platform no1 4 15037 kanpur - kasganj express 10:45 10:55 daily platform no3
{"train no":{"0":5037,"1":5038,"2":4723,"3":4724,"4":15037},"train name":{"0":"kanpur - farrukhabad express","1":"farrukhabad - kanpur express","2":"kanpur - bhiwani kalindi express","3":"bhiwani - kanpur kalindi express","4":"kanpur - kasganj express"},"arrival":{"0":"10:55","1":"17:25","2":"17:15","3":"11:00","4":"10:45"},"departure":{"0":"11:05","1":"17:30","2":"17:25","3":"10:55","4":"10:55"},"days":{"0":"daily","1":"daily","2":"daily","3":"daily","4":"daily"},"platform no":{"0":"platform no2","1":"platform no2","2":"platform no2","3":"platform no1","4":"platform no3"}}
no in series title directed by written by original air date production code 0 1 the switching hour jim duffy marcy gray rubin & david adam silverman october 29 , 1994 101 1 2b snorched if you do , snorched if you don't jim duffy lawrence h levy november 5 , 1994 102b 2 3a curse of the krumm andrei svislotski bruce kalish november 12 , 1994 103a 3 3b krumm goes hollywood jim duffy david litt november 12 , 1994 103b 4 4a monstrous make - over igor kovalyov david litt november 19 , 1994 104a 5 4b a wing and a scare jim duffy peter gaffney november 19 , 1994 104b 6 5a krumm 's pimple andrei svislotski michael price & cydne clark & steve granat november 26 , 1994 105a 7 5b monster hunter jim duffy susan meyers november 26 , 1994 105b 8 6a monsters don't dance igor kovalyov eric mintz december 3 , 1994 106a 9 6b gone shopp'n jim duffy david litt december 3 , 1994 106b 10 7a old monster andrei svislotski marcy gray rubin & david adam silverman december 10 , 1994 107a 11 7b mother , may i jim duffy michael price december 10 , 1994 107b 12 8a don't just do it jim duffy david litt december 17 , 1994 108a 13 8b joined at the hip igor kovalyov michael karnow & lance khazei december 17 , 1994 108b 14 9a smile and say oblina andrei svislotski gary clasberg december 24 , 1994 109a 15 9b the great wave jim duffy scott kregor & david pavoni december 24 , 1994 109b 16 10a cold hard toenails jim duffy peter gaffney december 31 , 1994 110a 17 10b attack of the blobs igor kovalyov lawrence h levy december 31 , 1994 110b 18 11a chip off the old beast andrei svislotski richard marcus january 7 , 1995 111a 19 11b the war 's over jim duffy william schifrin january 7 , 1995 111b 20 13a simon strikes back jim duffy susan myers january 21 , 1995 113a
{"no in series":{"0":"1","1":"2b","2":"3a","3":"3b","4":"4a","5":"4b","6":"5a","7":"5b","8":"6a","9":"6b","10":"7a","11":"7b","12":"8a","13":"8b","14":"9a","15":"9b","16":"10a","17":"10b","18":"11a","19":"11b","20":"13a"},"title":{"0":"the switching hour","1":"snorched if you do , snorched if you don't","2":"curse of the krumm","3":"krumm goes hollywood","4":"monstrous make - over","5":"a wing and a scare","6":"krumm 's pimple","7":"monster hunter","8":"monsters don't dance","9":"gone shopp'n","10":"old monster","11":"mother , may i","12":"don't just do it","13":"joined at the hip","14":"smile and say oblina","15":"the great wave","16":"cold hard toenails","17":"attack of the blobs","18":"chip off the old beast","19":"the war 's over","20":"simon strikes back"},"directed by":{"0":"jim duffy","1":"jim duffy","2":"andrei svislotski","3":"jim duffy","4":"igor kovalyov","5":"jim duffy","6":"andrei svislotski","7":"jim duffy","8":"igor kovalyov","9":"jim duffy","10":"andrei svislotski","11":"jim duffy","12":"jim duffy","13":"igor kovalyov","14":"andrei svislotski","15":"jim duffy","16":"jim duffy","17":"igor kovalyov","18":"andrei svislotski","19":"jim duffy","20":"jim duffy"},"written by":{"0":"marcy gray rubin & david adam silverman","1":"lawrence h levy","2":"bruce kalish","3":"david litt","4":"david litt","5":"peter gaffney","6":"michael price & cydne clark & steve granat","7":"susan meyers","8":"eric mintz","9":"david litt","10":"marcy gray rubin & david adam silverman","11":"michael price","12":"david litt","13":"michael karnow & lance khazei","14":"gary clasberg","15":"scott kregor & david pavoni","16":"peter gaffney","17":"lawrence h levy","18":"richard marcus","19":"william schifrin","20":"susan myers"},"original air date":{"0":"october 29 , 1994","1":"november 5 , 1994","2":"november 12 , 1994","3":"november 12 , 1994","4":"november 19 , 1994","5":"november 19 , 1994","6":"november 26 , 1994","7":"november 26 , 1994","8":"december 3 , 1994","9":"december 3 , 1994","10":"december 10 , 1994","11":"december 10 , 1994","12":"december 17 , 1994","13":"december 17 , 1994","14":"december 24 , 1994","15":"december 24 , 1994","16":"december 31 , 1994","17":"december 31 , 1994","18":"january 7 , 1995","19":"january 7 , 1995","20":"january 21 , 1995"},"production code":{"0":"101","1":"102b","2":"103a","3":"103b","4":"104a","5":"104b","6":"105a","7":"105b","8":"106a","9":"106b","10":"107a","11":"107b","12":"108a","13":"108b","14":"109a","15":"109b","16":"110a","17":"110b","18":"111a","19":"111b","20":"113a"}}
no in series no in season title directed by written by original air date production code 0 14a 1a spontaneously combustible igor kovalyov mark steen & mark palmer september 9 , 1995 201a 1 14b 1b curse of katana jim duffy mark palmer september 9 , 1995 201b 2 15a 2a monsters are real igor kovalyov david adam silverman september 16 , 1995 202a 3 15b 2b this is your brain on ickis jim duffy spencer green & mary elizabeth williams september 16 , 1995 202b 4 16b 3b krumm gets the dreaded nolox igor kovalvov mary elizabeth williams & spencer green september 23 , 1995 203b 5 17a 4a mayberry ufo jim duffy mary elizabeth williams & spencer green september 30 , 1995 204a 6 17b 4b i dream of snorch with the long golden hair igor kovalyov spencer green & mary elizabeth williams september 30 , 1995 204b 7 18a 5a garbage ahoy jim duffy steve skrovan & david adam silverman october 7 , 1995 205a 8 18b 5b goin' (way) south igor kovalyov mark steen october 7 , 1995 205b 9 19b 6b puppy ciao jim duffy steve skrovan october 14 , 1995 206b 10 20a 7a the rival igor kovalyov roger eschbacher october 21 , 1995 207a 11 20b 7b hats off jim duffy mark palmer october 21 , 1995 207b 12 21a 8a eau de krumm jim duffy spencer green & mary elizabeth williams october 28 , 1995 208a 13 21b 8b o'lucky monster igor kovalyov mark palmer & marcy gray rubin october 28 , 1995 208b 14 22a 9a rosh - o - monster jim duffy michael palmer november 4 , 1995 209a 15 22b 9b the tree of ickis igor kovalyov steve skrovan november 4 , 1995 209b 16 23a 10a history of the monster world igor kovalyov spencer green & mary elizabeth williams november 11 , 1995 210a 17 23b 10b fear thy name is ickis igor kovalyov steve skrovan november 11 , 1995 210b 18 24a 11a quest for the holy pail jim duffy mark palmer november 18 , 1995 211a 19 24b 11b garbage in , garbage out jim duffy roger eschbacher november 18 , 1995 211b 20 25a 12a a room with no viewfinder andrei svislotski spencer green & mary elizabeth williams november 25 , 1995 212a 21 25b 12b krumm rises to the top igor kovalyov steve skrovan , lance khazei & michael karnow november 25 , 1995 212b 22 26a 13a the five faces of ickis jim duffy michael karnow , lance khazei & steve skrovan december 2 , 1995 213a
{"no in series":{"0":"14a","1":"14b","2":"15a","3":"15b","4":"16b","5":"17a","6":"17b","7":"18a","8":"18b","9":"19b","10":"20a","11":"20b","12":"21a","13":"21b","14":"22a","15":"22b","16":"23a","17":"23b","18":"24a","19":"24b","20":"25a","21":"25b","22":"26a"},"no in season":{"0":"1a","1":"1b","2":"2a","3":"2b","4":"3b","5":"4a","6":"4b","7":"5a","8":"5b","9":"6b","10":"7a","11":"7b","12":"8a","13":"8b","14":"9a","15":"9b","16":"10a","17":"10b","18":"11a","19":"11b","20":"12a","21":"12b","22":"13a"},"title":{"0":"spontaneously combustible","1":"curse of katana","2":"monsters are real","3":"this is your brain on ickis","4":"krumm gets the dreaded nolox","5":"mayberry ufo","6":"i dream of snorch with the long golden hair","7":"garbage ahoy","8":"goin' (way) south","9":"puppy ciao","10":"the rival","11":"hats off","12":"eau de krumm","13":"o'lucky monster","14":"rosh - o - monster","15":"the tree of ickis","16":"history of the monster world","17":"fear thy name is ickis","18":"quest for the holy pail","19":"garbage in , garbage out","20":"a room with no viewfinder","21":"krumm rises to the top","22":"the five faces of ickis"},"directed by":{"0":"igor kovalyov","1":"jim duffy","2":"igor kovalyov","3":"jim duffy","4":"igor kovalvov","5":"jim duffy","6":"igor kovalyov","7":"jim duffy","8":"igor kovalyov","9":"jim duffy","10":"igor kovalyov","11":"jim duffy","12":"jim duffy","13":"igor kovalyov","14":"jim duffy","15":"igor kovalyov","16":"igor kovalyov","17":"igor kovalyov","18":"jim duffy","19":"jim duffy","20":"andrei svislotski","21":"igor kovalyov","22":"jim duffy"},"written by":{"0":"mark steen & mark palmer","1":"mark palmer","2":"david adam silverman","3":"spencer green & mary elizabeth williams","4":"mary elizabeth williams & spencer green","5":"mary elizabeth williams & spencer green","6":"spencer green & mary elizabeth williams","7":"steve skrovan & david adam silverman","8":"mark steen","9":"steve skrovan","10":"roger eschbacher","11":"mark palmer","12":"spencer green & mary elizabeth williams","13":"mark palmer & marcy gray rubin","14":"michael palmer","15":"steve skrovan","16":"spencer green & mary elizabeth williams","17":"steve skrovan","18":"mark palmer","19":"roger eschbacher","20":"spencer green & mary elizabeth williams","21":"steve skrovan , lance khazei & michael karnow","22":"michael karnow , lance khazei & steve skrovan"},"original air date":{"0":"september 9 , 1995","1":"september 9 , 1995","2":"september 16 , 1995","3":"september 16 , 1995","4":"september 23 , 1995","5":"september 30 , 1995","6":"september 30 , 1995","7":"october 7 , 1995","8":"october 7 , 1995","9":"october 14 , 1995","10":"october 21 , 1995","11":"october 21 , 1995","12":"october 28 , 1995","13":"october 28 , 1995","14":"november 4 , 1995","15":"november 4 , 1995","16":"november 11 , 1995","17":"november 11 , 1995","18":"november 18 , 1995","19":"november 18 , 1995","20":"november 25 , 1995","21":"november 25 , 1995","22":"december 2 , 1995"},"production code":{"0":"201a","1":"201b","2":"202a","3":"202b","4":"203b","5":"204a","6":"204b","7":"205a","8":"205b","9":"206b","10":"207a","11":"207b","12":"208a","13":"208b","14":"209a","15":"209b","16":"210a","17":"210b","18":"211a","19":"211b","20":"212a","21":"212b","22":"213a"}}
district incumbent party elected status result 0 georgia 's 1st jack kingston republican 1992 re - elected jack kingston (r) unopposed 1 georgia 's 2nd sanford bishop democratic 1992 re - elected sanford bishop (d) 57% joseph mccormick (r) 43% 2 georgia 's 3rd mac collins republican 1992 re - elected mac collins (r) unopposed 3 georgia 's 4th cynthia mckinney democratic 1992 re - elected cynthia mckinney (d) 61% sunny warren (r) 39% 4 georgia 's 5th john lewis democratic 1986 re - elected john lewis (d) 79% john lewis sr (r) 21% 5 georgia 's 6th johnny isakson republican 1999 re - elected newt gingrich (r) 71% gary pelphrey (d) 29% 6 georgia 's 7th bob barr republican 1994 re - elected bob barr (r) 55% james williams (d) 45% 7 georgia 's 8th saxby chambliss republican 1994 re - elected saxby chambliss (r) 62% ronald cain (d) 38% 8 georgia 's 9th nathan deal republican 1992 re - elected nathan deal (r) unopposed 9 georgia 's 10th charlie norwood republican 1994 re - elected charlie norwood (r) 59% marion freeman (d) 41%
{"district":{"0":"georgia 's 1st","1":"georgia 's 2nd","2":"georgia 's 3rd","3":"georgia 's 4th","4":"georgia 's 5th","5":"georgia 's 6th","6":"georgia 's 7th","7":"georgia 's 8th","8":"georgia 's 9th","9":"georgia 's 10th"},"incumbent":{"0":"jack kingston","1":"sanford bishop","2":"mac collins","3":"cynthia mckinney","4":"john lewis","5":"johnny isakson","6":"bob barr","7":"saxby chambliss","8":"nathan deal","9":"charlie norwood"},"party":{"0":"republican","1":"democratic","2":"republican","3":"democratic","4":"democratic","5":"republican","6":"republican","7":"republican","8":"republican","9":"republican"},"elected":{"0":1992,"1":1992,"2":1992,"3":1992,"4":1986,"5":1999,"6":1994,"7":1994,"8":1992,"9":1994},"status":{"0":"re - elected","1":"re - elected","2":"re - elected","3":"re - elected","4":"re - elected","5":"re - elected","6":"re - elected","7":"re - elected","8":"re - elected","9":"re - elected"},"result":{"0":"jack kingston (r) unopposed","1":"sanford bishop (d) 57% joseph mccormick (r) 43%","2":"mac collins (r) unopposed","3":"cynthia mckinney (d) 61% sunny warren (r) 39%","4":"john lewis (d) 79% john lewis sr (r) 21%","5":"newt gingrich (r) 71% gary pelphrey (d) 29%","6":"bob barr (r) 55% james williams (d) 45%","7":"saxby chambliss (r) 62% ronald cain (d) 38%","8":"nathan deal (r) unopposed","9":"charlie norwood (r) 59% marion freeman (d) 41%"}}
no in series title directed by written by original air date us viewers (in millions) 0 1 pilot lesli linka glatter i marlene king june 8 , 2010 2.47 1 2 the jenna thing liz friedlander i marlene king june 15 , 2010 2.48 2 3 to kill a mocking girl elodie keene oliver goldstick june 22 , 2010 2.74 3 4 can you hear me now norman buckley joseph dougherty june 29 , 2010 2.08 4 5 reality bites me wendey stanzler bryan m holdman july 6 , 2010 2.62 5 6 there 's no place like homecoming norman buckley maya goldsmith july 13 , 2010 2.69 6 7 the homecoming hangover chris grismer tamar laddy july 20 , 2010 2.55 7 8 please , do talk about me when i'm gone arlene sanford joseph dougherty july 27 , 2010 2.52 8 9 the perfect storm jamie babbit oliver goldstick august 3 , 2010 2.55 9 10 keep your friends close ron lagomarsino i marlene king august 10 , 2010 3.07 10 11 moments later norman buckley joseph dougherty january 3 , 2011 4.22 11 12 salt meets wound norman buckley oliver goldstick january 10 , 2011 3.21 12 13 know your frenemies ron lagomarsino i marlene king january 17 , 2011 2.99 13 14 careful what u wish 4 norman buckley tamar laddy january 24 , 2011 3.17 14 15 if at first you don't succeed , lie , lie again ron lagomarsino maya goldsmith january 31 , 2011 3.19 15 16 je suis une amie chris grismer bryan m holdman february 7 , 2011 3.14 16 17 the new normal michael grossman joseph dougherty february 14 , 2011 2.35 17 18 the badass seed paul lazarus oliver goldstick & francesca rollins february 21 , 2011 2.90 18 19 a person of interest ron lagomarsino i marlene king & jonell lennon february 28 , 2011 2.69 19 20 someone to watch over me arlene sanford joseph dougherty march 7 , 2011 2.95 20 21 monsters in the end chris grismer oliver goldstick march 14 , 2011 2.94
{"no in series":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21},"title":{"0":"pilot","1":"the jenna thing","2":"to kill a mocking girl","3":"can you hear me now","4":"reality bites me","5":"there 's no place like homecoming","6":"the homecoming hangover","7":"please , do talk about me when i'm gone","8":"the perfect storm","9":"keep your friends close","10":"moments later","11":"salt meets wound","12":"know your frenemies","13":"careful what u wish 4","14":"if at first you don't succeed , lie , lie again","15":"je suis une amie","16":"the new normal","17":"the badass seed","18":"a person of interest","19":"someone to watch over me","20":"monsters in the end"},"directed by":{"0":"lesli linka glatter","1":"liz friedlander","2":"elodie keene","3":"norman buckley","4":"wendey stanzler","5":"norman buckley","6":"chris grismer","7":"arlene sanford","8":"jamie babbit","9":"ron lagomarsino","10":"norman buckley","11":"norman buckley","12":"ron lagomarsino","13":"norman buckley","14":"ron lagomarsino","15":"chris grismer","16":"michael grossman","17":"paul lazarus","18":"ron lagomarsino","19":"arlene sanford","20":"chris grismer"},"written by":{"0":"i marlene king","1":"i marlene king","2":"oliver goldstick","3":"joseph dougherty","4":"bryan m holdman","5":"maya goldsmith","6":"tamar laddy","7":"joseph dougherty","8":"oliver goldstick","9":"i marlene king","10":"joseph dougherty","11":"oliver goldstick","12":"i marlene king","13":"tamar laddy","14":"maya goldsmith","15":"bryan m holdman","16":"joseph dougherty","17":"oliver goldstick & francesca rollins","18":"i marlene king & jonell lennon","19":"joseph dougherty","20":"oliver goldstick"},"original air date":{"0":"june 8 , 2010","1":"june 15 , 2010","2":"june 22 , 2010","3":"june 29 , 2010","4":"july 6 , 2010","5":"july 13 , 2010","6":"july 20 , 2010","7":"july 27 , 2010","8":"august 3 , 2010","9":"august 10 , 2010","10":"january 3 , 2011","11":"january 10 , 2011","12":"january 17 , 2011","13":"january 24 , 2011","14":"january 31 , 2011","15":"february 7 , 2011","16":"february 14 , 2011","17":"february 21 , 2011","18":"february 28 , 2011","19":"march 7 , 2011","20":"march 14 , 2011"},"us viewers (in millions)":{"0":2.47,"1":2.48,"2":2.74,"3":2.08,"4":2.62,"5":2.69,"6":2.55,"7":2.52,"8":2.55,"9":3.07,"10":4.22,"11":3.21,"12":2.99,"13":3.17,"14":3.19,"15":3.14,"16":2.35,"17":2.9,"18":2.69,"19":2.95,"20":2.94}}
team outgoing manager manner of departure date of vacancy replaced by date of appointment 0 gabala ramiz mammadov end of contract 10 may 2010 tony adams 12 may 2010 1 fk baku cüneyt biçer end of contract 10 june 2010 winfried schäfer 10 june 2010 2 simurq pfc roman pokora sacked 18 june 2010 gjoko hadžievski 18 june 2010 3 turan tovuz nizami sadygov sacked 29 june 2010 sakit aliyev 29 june 2010 4 khazar lankaran agaselim mirjavadov resigned 8 july 2010 mircea rednic 15 july 2010 5 turan tovuz sakit aliyev sacked 30 september 2010 revaz dzodzuashvili 30 september 2010 6 fk mughan almir hurtić resigned 13 november 2010 bahman hasanov 13 november 7 turan tovuz revaz dzodzuashvili end of contract 23 december 2010 naci şensoy 25 december 2010 8 fk baku winfried schäfer sacked 6 january 2011 aleksandrs starkovs 16 january 2011 9 fk ganja fuad ismayilov resigned 17 march 2011 mehman allahverdiyev 18 march 2011
{"team":{"0":"gabala","1":"fk baku","2":"simurq pfc","3":"turan tovuz","4":"khazar lankaran","5":"turan tovuz","6":"fk mughan","7":"turan tovuz","8":"fk baku","9":"fk ganja"},"outgoing manager":{"0":"ramiz mammadov","1":"cüneyt biçer","2":"roman pokora","3":"nizami sadygov","4":"agaselim mirjavadov","5":"sakit aliyev","6":"almir hurtić","7":"revaz dzodzuashvili","8":"winfried schäfer","9":"fuad ismayilov"},"manner of departure":{"0":"end of contract","1":"end of contract","2":"sacked","3":"sacked","4":"resigned","5":"sacked","6":"resigned","7":"end of contract","8":"sacked","9":"resigned"},"date of vacancy":{"0":"10 may 2010","1":"10 june 2010","2":"18 june 2010","3":"29 june 2010","4":"8 july 2010","5":"30 september 2010","6":"13 november 2010","7":"23 december 2010","8":"6 january 2011","9":"17 march 2011"},"replaced by":{"0":"tony adams","1":"winfried schäfer","2":"gjoko hadžievski","3":"sakit aliyev","4":"mircea rednic","5":"revaz dzodzuashvili","6":"bahman hasanov","7":"naci şensoy","8":"aleksandrs starkovs","9":"mehman allahverdiyev"},"date of appointment":{"0":"12 may 2010","1":"10 june 2010","2":"18 june 2010","3":"29 june 2010","4":"15 july 2010","5":"30 september 2010","6":"13 november","7":"25 december 2010","8":"16 january 2011","9":"18 march 2011"}}
position building city height number of floors completion 0 1 gran torre santiago santiago 300 m 70 2012 1 2 titanium la portada santiago - 55 2010 2 3 costanera center torre 1 santiago 170 m 41 2012 3 3 costanera center torre 2 santiago 170 m 41 2012 4 4 boulevard kennedy (marriot) santiago 140 m 40 1999 5 5 torre telefã cubicnica chile santiago 132 m 32 1994 6 6 torre entel santiago 127 m 0 1974 7 7 torre de la industria santiago 120 m 33 1994 8 8 territoria 3000 santiago 118 m 31 2008 9 9 torre mall center concepciã cubicn 115 m 31 2009 10 9 torre centenario santiago 115 m 31 2000
{"position":{"0":1,"1":2,"2":3,"3":3,"4":4,"5":5,"6":6,"7":7,"8":8,"9":9,"10":9},"building":{"0":"gran torre santiago","1":"titanium la portada","2":"costanera center torre 1","3":"costanera center torre 2","4":"boulevard kennedy (marriot)","5":"torre telefã cubicnica chile","6":"torre entel","7":"torre de la industria","8":"territoria 3000","9":"torre mall center","10":"torre centenario"},"city":{"0":"santiago","1":"santiago","2":"santiago","3":"santiago","4":"santiago","5":"santiago","6":"santiago","7":"santiago","8":"santiago","9":"concepciã cubicn","10":"santiago"},"height":{"0":"300 m","1":"-","2":"170 m","3":"170 m","4":"140 m","5":"132 m","6":"127 m","7":"120 m","8":"118 m","9":"115 m","10":"115 m"},"number of floors":{"0":70,"1":55,"2":41,"3":41,"4":40,"5":32,"6":0,"7":33,"8":31,"9":31,"10":31},"completion":{"0":2012,"1":2010,"2":2012,"3":2012,"4":1999,"5":1994,"6":1974,"7":1994,"8":2008,"9":2009,"10":2000}}
season coach conf record overall standings postseason 0 1997 - 98 howie draper none 3 - 1 - 0 does not apply fifth , cis tournament 1 1998 - 99 howie draper 4 - 1 - 1 20 - 8 - 3 first second , cis tournament 2 1999 - 00 howie draper 15 - 1 - 1 26 - 3 - 1 first cis tournament champions 3 2000 - 01 howie draper 13 - 1 - 2 20 - 6 - 2 second did not qualify 4 2001 - 02 howie draper 16 - 0 - 0 33 - 1 - 0 first cis tournament champions 5 2002 - 03 howie draper 19 - 0 - 1 34 - 0 - 1 first cis tournament champions 6 2003 - 04 howie draper 20 - 0 - 0 35 - 0 - 0 first cis tournament champions 7 2004 - 05 howie draper 20 - 0 - 0 28 - 1 - 0 first second , cis tournament 8 2005 - 06 howie draper 16 - 1 - 3 27 - 3 - 3 first cis tournament champions 9 2006 - 07 howie draper 21 - 3 - 0 33 - 4 - 1 first cis tournament champions 10 2007 - 08 howie draper 21 - 2 - 1 29 - 5 - 1 first fourth , cis tournament 11 2008 - 09 howie draper 22 - 2 - 0 26 - 5 - 0 second did not qualify
{"season":{"0":"1997 - 98","1":"1998 - 99","2":"1999 - 00","3":"2000 - 01","4":"2001 - 02","5":"2002 - 03","6":"2003 - 04","7":"2004 - 05","8":"2005 - 06","9":"2006 - 07","10":"2007 - 08","11":"2008 - 09"},"coach":{"0":"howie draper","1":"howie draper","2":"howie draper","3":"howie draper","4":"howie draper","5":"howie draper","6":"howie draper","7":"howie draper","8":"howie draper","9":"howie draper","10":"howie draper","11":"howie draper"},"conf record":{"0":"none","1":"4 - 1 - 1","2":"15 - 1 - 1","3":"13 - 1 - 2","4":"16 - 0 - 0","5":"19 - 0 - 1","6":"20 - 0 - 0","7":"20 - 0 - 0","8":"16 - 1 - 3","9":"21 - 3 - 0","10":"21 - 2 - 1","11":"22 - 2 - 0"},"overall":{"0":"3 - 1 - 0","1":"20 - 8 - 3","2":"26 - 3 - 1","3":"20 - 6 - 2","4":"33 - 1 - 0","5":"34 - 0 - 1","6":"35 - 0 - 0","7":"28 - 1 - 0","8":"27 - 3 - 3","9":"33 - 4 - 1","10":"29 - 5 - 1","11":"26 - 5 - 0"},"standings":{"0":"does not apply","1":"first","2":"first","3":"second","4":"first","5":"first","6":"first","7":"first","8":"first","9":"first","10":"first","11":"second"},"postseason":{"0":"fifth , cis tournament","1":"second , cis tournament","2":"cis tournament champions","3":"did not qualify","4":"cis tournament champions","5":"cis tournament champions","6":"cis tournament champions","7":"second , cis tournament","8":"cis tournament champions","9":"cis tournament champions","10":"fourth , cis tournament","11":"did not qualify"}}
week theme song choice original artist order result 0 audition n / a the climb miley cyrus n / a advanced 1 hollywood group round get ready the temptations n / a advanced 2 hollywood second solo angel sarah mclachlan n / a advanced 3 top 24 (12 men) billboard hot 100 hits here comes goodbye rascal flatts 2 safe 4 top 20 (10 men) billboard hot 100 hits my girl the temptations 8 safe 5 top 16 (8 men) billboard hot 100 hits i'm already there lonestar 6 safe 6 top 12 the rolling stones angie the rolling stones 11 safe 7 top 11 billboard number 1 hits i don't want to miss a thing aerosmith 4 safe 8 top 10 r&b / soul ain't no sunshine bill withers 10 safe 9 top 9 lennonmccartney the long and winding road the beatles 1 bottom 3 10 top 9 elvis presley blue suede shoes carl perkins 5 safe 11 top 7 inspirational i believe i can fly r kelly 4 bottom 3 12 top 6 shania twain you've got a way shania twain 5 safe
{"week":{"0":"audition","1":"hollywood","2":"hollywood","3":"top 24 (12 men)","4":"top 20 (10 men)","5":"top 16 (8 men)","6":"top 12","7":"top 11","8":"top 10","9":"top 9","10":"top 9","11":"top 7","12":"top 6"},"theme":{"0":"n \/ a","1":"group round","2":"second solo","3":"billboard hot 100 hits","4":"billboard hot 100 hits","5":"billboard hot 100 hits","6":"the rolling stones","7":"billboard number 1 hits","8":"r&b \/ soul","9":"lennonmccartney","10":"elvis presley","11":"inspirational","12":"shania twain"},"song choice":{"0":"the climb","1":"get ready","2":"angel","3":"here comes goodbye","4":"my girl","5":"i'm already there","6":"angie","7":"i don't want to miss a thing","8":"ain't no sunshine","9":"the long and winding road","10":"blue suede shoes","11":"i believe i can fly","12":"you've got a way"},"original artist":{"0":"miley cyrus","1":"the temptations","2":"sarah mclachlan","3":"rascal flatts","4":"the temptations","5":"lonestar","6":"the rolling stones","7":"aerosmith","8":"bill withers","9":"the beatles","10":"carl perkins","11":"r kelly","12":"shania twain"},"order":{"0":"n \/ a","1":"n \/ a","2":"n \/ a","3":"2","4":"8","5":"6","6":"11","7":"4","8":"10","9":"1","10":"5","11":"4","12":"5"},"result":{"0":"advanced","1":"advanced","2":"advanced","3":"safe","4":"safe","5":"safe","6":"safe","7":"safe","8":"safe","9":"bottom 3","10":"safe","11":"bottom 3","12":"safe"}}
episode no episode no refers to the episodes number in the overall series , whereas series no refers to the episodes number in this particular series series no episode director writer (s) original airdate 0 16 1 a little lobbying antonia bird jeremy brock and paul unwin 12 september 1987 1 17 2 a drop of the hard stuff antonia bird roy mitchell 19 september 1987 2 18 3 shades of love michael brayshaw wally k daly 26 september 1987 3 19 4 cry for help alan wareing paul unwin and jeremy brock 3 october 1987 4 20 5 anaconda michael brayshaw ray brennan 10 october 1987 5 21 6 lifelines sharon miller jeremy brock 17 october 1987 6 22 7 the raid sharon miller susan wilkins 24 october 1987 7 23 8 cross fingers alan wareing david ashton 31 october 1987 8 24 9 seeking heat christopher menaul ray brennan and jeremy brock 7 november 1987 9 25 10 rock - a - bye - baby sharon miller ginnie hole 14 november 1987 10 26 11 hooked michael brayshaw billy hamon 21 november 1987 11 27 12 fun night alan wareing al hunter ashton 28 november 1987 12 28 13 peace , brother michael brayshaw david ashton 5 december 1987 13 29 14 burning cases christopher menaul jeremy brock and paul unwin 12 december 1987
{"episode no episode no refers to the episodes number in the overall series , whereas series no refers to the episodes number in this particular series":{"0":16,"1":17,"2":18,"3":19,"4":20,"5":21,"6":22,"7":23,"8":24,"9":25,"10":26,"11":27,"12":28,"13":29},"series no":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14},"episode":{"0":"a little lobbying","1":"a drop of the hard stuff","2":"shades of love","3":"cry for help","4":"anaconda","5":"lifelines","6":"the raid","7":"cross fingers","8":"seeking heat","9":"rock - a - bye - baby","10":"hooked","11":"fun night","12":"peace , brother","13":"burning cases"},"director":{"0":"antonia bird","1":"antonia bird","2":"michael brayshaw","3":"alan wareing","4":"michael brayshaw","5":"sharon miller","6":"sharon miller","7":"alan wareing","8":"christopher menaul","9":"sharon miller","10":"michael brayshaw","11":"alan wareing","12":"michael brayshaw","13":"christopher menaul"},"writer (s)":{"0":"jeremy brock and paul unwin","1":"roy mitchell","2":"wally k daly","3":"paul unwin and jeremy brock","4":"ray brennan","5":"jeremy brock","6":"susan wilkins","7":"david ashton","8":"ray brennan and jeremy brock","9":"ginnie hole","10":"billy hamon","11":"al hunter ashton","12":"david ashton","13":"jeremy brock and paul unwin"},"original airdate":{"0":"12 september 1987","1":"19 september 1987","2":"26 september 1987","3":"3 october 1987","4":"10 october 1987","5":"17 october 1987","6":"24 october 1987","7":"31 october 1987","8":"7 november 1987","9":"14 november 1987","10":"21 november 1987","11":"28 november 1987","12":"5 december 1987","13":"12 december 1987"}}
frequency call sign name format owner target city / market city of license 0 89.7 fm k209fr effect radio christian rock the river christian fellowship aberdeen aberdeen 1 90.9 fm kdsd south dakota public broadcasting public radio south dakota public broadcasting aberdeen pierpont 2 91.7 fm k219 cm south dakota public broadcasting public radio south dakota public broadcasting aberdeen aberdeen 3 94.1 fm ksdn 94.1 the rock mainstream rock armada media aberdeen aberdeen 4 94.5 fm k233bn life 97.9 christian northwestern college aberdeen aberdeen 5 94.9 fm klrj k - love christian educational media foundation aberdeen aberdeen 6 97.7 fm knbz sunny 97.7 adult contemporary armada media aberdeen redfield 7 98.5 fm k253ab praise fm christian christian heritage broadcasting aberdeen aberdeen 8 103.7 fm kgim - fm pheasant country 103 country armada media aberdeen redfield 9 105.5 fm kmom dakota 105.5 country dakota broadcasting aberdeen roscoe 10 106.7 fm kbfo point fm top 40 armada media aberdeen aberdeen 11 107.1 fm k296fw espn radio 1420 / 107.1 sports armada media aberdeen aberdeen
{"frequency":{"0":"89.7 fm","1":"90.9 fm","2":"91.7 fm","3":"94.1 fm","4":"94.5 fm","5":"94.9 fm","6":"97.7 fm","7":"98.5 fm","8":"103.7 fm","9":"105.5 fm","10":"106.7 fm","11":"107.1 fm"},"call sign":{"0":"k209fr","1":"kdsd","2":"k219 cm","3":"ksdn","4":"k233bn","5":"klrj","6":"knbz","7":"k253ab","8":"kgim - fm","9":"kmom","10":"kbfo","11":"k296fw"},"name":{"0":"effect radio","1":"south dakota public broadcasting","2":"south dakota public broadcasting","3":"94.1 the rock","4":"life 97.9","5":"k - love","6":"sunny 97.7","7":"praise fm","8":"pheasant country 103","9":"dakota 105.5","10":"point fm","11":"espn radio 1420 \/ 107.1"},"format":{"0":"christian rock","1":"public radio","2":"public radio","3":"mainstream rock","4":"christian","5":"christian","6":"adult contemporary","7":"christian","8":"country","9":"country","10":"top 40","11":"sports"},"owner":{"0":"the river christian fellowship","1":"south dakota public broadcasting","2":"south dakota public broadcasting","3":"armada media","4":"northwestern college","5":"educational media foundation","6":"armada media","7":"christian heritage broadcasting","8":"armada media","9":"dakota broadcasting","10":"armada media","11":"armada media"},"target city \/ market":{"0":"aberdeen","1":"aberdeen","2":"aberdeen","3":"aberdeen","4":"aberdeen","5":"aberdeen","6":"aberdeen","7":"aberdeen","8":"aberdeen","9":"aberdeen","10":"aberdeen","11":"aberdeen"},"city of license":{"0":"aberdeen","1":"pierpont","2":"aberdeen","3":"aberdeen","4":"aberdeen","5":"aberdeen","6":"redfield","7":"aberdeen","8":"redfield","9":"roscoe","10":"aberdeen","11":"aberdeen"}}
team outgoing manager manner of departure date of vacancy replaced by date of appointment 0 ankaraspor jürgen röber contract cancelled 07.12.2009 önder özen 09.07.2010 1 boluspor cüneyt karakuş contract ended 31.05.2010 levent eriş 02.06.2010 2 mersin idmanyurdu ergün penbe contract ended 31.05.2010 yüksel yeşilova 03.06.2010 3 kartalspor kadir özcan contract ended 31.05.2010 ergün penbe 08.06.2010 4 orduspor ahmet akcan contract ended 31.05.2010 uğur tütüneker 10.06.2010 5 altay güvenç kurtar contract ended 31.05.2010 ercan ertemçöz 12.06.2010 6 giresunspor levent eriş contract ended 31.05.2010 hüsnü özkara 18.06.2010 7 diyarbakırspor mehmet budakın contract ended 31.05.2010 suat kaya 06.07.2010
{"team":{"0":"ankaraspor","1":"boluspor","2":"mersin idmanyurdu","3":"kartalspor","4":"orduspor","5":"altay","6":"giresunspor","7":"diyarbakırspor"},"outgoing manager":{"0":"jürgen röber","1":"cüneyt karakuş","2":"ergün penbe","3":"kadir özcan","4":"ahmet akcan","5":"güvenç kurtar","6":"levent eriş","7":"mehmet budakın"},"manner of departure":{"0":"contract cancelled","1":"contract ended","2":"contract ended","3":"contract ended","4":"contract ended","5":"contract ended","6":"contract ended","7":"contract ended"},"date of vacancy":{"0":"07.12.2009","1":"31.05.2010","2":"31.05.2010","3":"31.05.2010","4":"31.05.2010","5":"31.05.2010","6":"31.05.2010","7":"31.05.2010"},"replaced by":{"0":"önder özen","1":"levent eriş","2":"yüksel yeşilova","3":"ergün penbe","4":"uğur tütüneker","5":"ercan ertemçöz","6":"hüsnü özkara","7":"suat kaya"},"date of appointment":{"0":"09.07.2010","1":"02.06.2010","2":"03.06.2010","3":"08.06.2010","4":"10.06.2010","5":"12.06.2010","6":"18.06.2010","7":"06.07.2010"}}
team home gms home total home avg top home crowd road gms road total road avg overall gms overall total overall avg 0 omaha nighthawks 4 91143 22785 23554 (10 / 28 vs lv ) 4 53026 13256 8 144169 18021 1 sacramento mountain lions 4 72500 18125 20000 (9 / 25 vs fla and 11 / 13 vs oma ) 4 61488 15372 8 133988 16749 2 hartford colonials 4 57462 14366 14554 (11 / 20 vs lv ) 4 54655 13664 8 112117 14015 3 las vegas locomotives 4 40943 10236 13622 (11 / 6 vs sac ) 4 66161 16540 8 107104 13388 4 florida tuskers 4 37689 9422 10066 (10 / 21 vs sac ) 4 64677 16169 8 102366 12796
{"team":{"0":"omaha nighthawks","1":"sacramento mountain lions","2":"hartford colonials","3":"las vegas locomotives","4":"florida tuskers"},"home gms":{"0":4,"1":4,"2":4,"3":4,"4":4},"home total":{"0":91143,"1":72500,"2":57462,"3":40943,"4":37689},"home avg":{"0":22785,"1":18125,"2":14366,"3":10236,"4":9422},"top home crowd":{"0":"23554 (10 \/ 28 vs lv )","1":"20000 (9 \/ 25 vs fla and 11 \/ 13 vs oma )","2":"14554 (11 \/ 20 vs lv )","3":"13622 (11 \/ 6 vs sac )","4":"10066 (10 \/ 21 vs sac )"},"road gms":{"0":4,"1":4,"2":4,"3":4,"4":4},"road total":{"0":53026,"1":61488,"2":54655,"3":66161,"4":64677},"road avg":{"0":13256,"1":15372,"2":13664,"3":16540,"4":16169},"overall gms":{"0":8,"1":8,"2":8,"3":8,"4":8},"overall total":{"0":144169,"1":133988,"2":112117,"3":107104,"4":102366},"overall avg":{"0":18021,"1":16749,"2":14015,"3":13388,"4":12796}}
stage stage winner general classification points classification mountains classification asian rider classification team classification 0 1 mohd shahrul mat amin mohd shahrul mat amin ahmad fallanie ali not available mohd shahrul mat amin malaysian armed forces 1 2 johann rabie david mccann malcolm lange matnur amir rusli letua cycling team 2 3 malcolm lange david mccann malcolm lange matnur amir rusli letua cycling team 3 4 suhardi hassan david mccann malcolm lange matnur amir rusli letua cycling team 4 5 mark o'brien david mccann malcolm lange matnur amir rusli letua cycling team
{"stage":{"0":1,"1":2,"2":3,"3":4,"4":5},"stage winner":{"0":"mohd shahrul mat amin","1":"johann rabie","2":"malcolm lange","3":"suhardi hassan","4":"mark o'brien"},"general classification":{"0":"mohd shahrul mat amin","1":"david mccann","2":"david mccann","3":"david mccann","4":"david mccann"},"points classification":{"0":"ahmad fallanie ali","1":"malcolm lange","2":"malcolm lange","3":"malcolm lange","4":"malcolm lange"},"mountains classification":{"0":"not available","1":"matnur","2":"matnur","3":"matnur","4":"matnur"},"asian rider classification":{"0":"mohd shahrul mat amin","1":"amir rusli","2":"amir rusli","3":"amir rusli","4":"amir rusli"},"team classification":{"0":"malaysian armed forces","1":"letua cycling team","2":"letua cycling team","3":"letua cycling team","4":"letua cycling team"}}
no in series no in season title directed by written by original air date production code us viewers (million) 0 14 1 chuck versus the first date jason ensler josh schwartz & chris fedak september 29 , 2008 3t7251 6.84 1 15 2 chuck versus the seduction allan kroeker matthew miller october 6 , 2008 3t7252 5.83 2 16 3 chuck versus the break - up robert duncan mcneill scott rosenbaum october 13 , 2008 3t7253 6.17 3 17 4 chuck versus the cougars patrick norris allison adler october 20 , 2008 3t7254 6.87 4 18 5 chuck versus tom sawyer norman buckley phil klemmer october 27 , 2008 3t7255 6.70 5 19 6 chuck versus the ex jay chandrasekhar zev borow november 10 , 2008 3t7256 6.34 6 20 7 chuck versus the fat lady jeffrey g hunt matthew lau november 17 , 2008 3t7257 6.89 7 21 8 chuck versus the gravitron allison liddi - brown chris fedak november 24 , 2008 3t7258 6.53 8 22 9 chuck versus the sensei jonas pate anne cofell saunders december 1 , 2008 3t7259 7.34 9 23 10 chuck versus the delorean ken whittingham matthew miller december 8 , 2008 3t7260 6.94 10 24 11 chuck versus santa claus robert duncan mcneill scott rosenbaum december 15 , 2008 3t7261 7.66 11 25 12 chuck versus the third dimension robert duncan mcneill chris fedak february 2 , 2009 3t7263 8.45 12 26 13 chuck versus the suburbs jay chandrasekhar phil klemmer february 16 , 2009 3t7264 6.84 13 27 14 chuck versus the best friend peter lauer allison adler february 23 , 2009 3t7262 6.59 14 28 15 chuck versus the beefcake patrick norris matthew miller & scott rosenbaum march 2 , 2009 3t7265 6.66 15 29 16 chuck versus the lethal weapon allan kroeker zev borow & matthew lau march 9 , 2009 3t7266 5.80 16 30 17 chuck versus the predator jeremiah chechik chris fedak march 23 , 2009 3t7267 6.16 17 31 18 chuck versus the broken heart kevin bray allison adler march 30 , 2009 3t7268 5.72 18 32 19 chuck versus the dream job robert duncan mcneill phil klemmer & cory nickerson april 6 , 2009 3t7269 6.10 19 33 20 chuck versus the first kill norman buckley scott rosenbaum april 13 , 2009 3t7270 6.21 20 34 21 chuck versus the colonel peter lauer matthew miller april 20 , 2009 3t7271 6.11
{"no in series":{"0":14,"1":15,"2":16,"3":17,"4":18,"5":19,"6":20,"7":21,"8":22,"9":23,"10":24,"11":25,"12":26,"13":27,"14":28,"15":29,"16":30,"17":31,"18":32,"19":33,"20":34},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21},"title":{"0":"chuck versus the first date","1":"chuck versus the seduction","2":"chuck versus the break - up","3":"chuck versus the cougars","4":"chuck versus tom sawyer","5":"chuck versus the ex","6":"chuck versus the fat lady","7":"chuck versus the gravitron","8":"chuck versus the sensei","9":"chuck versus the delorean","10":"chuck versus santa claus","11":"chuck versus the third dimension","12":"chuck versus the suburbs","13":"chuck versus the best friend","14":"chuck versus the beefcake","15":"chuck versus the lethal weapon","16":"chuck versus the predator","17":"chuck versus the broken heart","18":"chuck versus the dream job","19":"chuck versus the first kill","20":"chuck versus the colonel"},"directed by":{"0":"jason ensler","1":"allan kroeker","2":"robert duncan mcneill","3":"patrick norris","4":"norman buckley","5":"jay chandrasekhar","6":"jeffrey g hunt","7":"allison liddi - brown","8":"jonas pate","9":"ken whittingham","10":"robert duncan mcneill","11":"robert duncan mcneill","12":"jay chandrasekhar","13":"peter lauer","14":"patrick norris","15":"allan kroeker","16":"jeremiah chechik","17":"kevin bray","18":"robert duncan mcneill","19":"norman buckley","20":"peter lauer"},"written by":{"0":"josh schwartz & chris fedak","1":"matthew miller","2":"scott rosenbaum","3":"allison adler","4":"phil klemmer","5":"zev borow","6":"matthew lau","7":"chris fedak","8":"anne cofell saunders","9":"matthew miller","10":"scott rosenbaum","11":"chris fedak","12":"phil klemmer","13":"allison adler","14":"matthew miller & scott rosenbaum","15":"zev borow & matthew lau","16":"chris fedak","17":"allison adler","18":"phil klemmer & cory nickerson","19":"scott rosenbaum","20":"matthew miller"},"original air date":{"0":"september 29 , 2008","1":"october 6 , 2008","2":"october 13 , 2008","3":"october 20 , 2008","4":"october 27 , 2008","5":"november 10 , 2008","6":"november 17 , 2008","7":"november 24 , 2008","8":"december 1 , 2008","9":"december 8 , 2008","10":"december 15 , 2008","11":"february 2 , 2009","12":"february 16 , 2009","13":"february 23 , 2009","14":"march 2 , 2009","15":"march 9 , 2009","16":"march 23 , 2009","17":"march 30 , 2009","18":"april 6 , 2009","19":"april 13 , 2009","20":"april 20 , 2009"},"production code":{"0":"3t7251","1":"3t7252","2":"3t7253","3":"3t7254","4":"3t7255","5":"3t7256","6":"3t7257","7":"3t7258","8":"3t7259","9":"3t7260","10":"3t7261","11":"3t7263","12":"3t7264","13":"3t7262","14":"3t7265","15":"3t7266","16":"3t7267","17":"3t7268","18":"3t7269","19":"3t7270","20":"3t7271"},"us viewers (million)":{"0":6.84,"1":5.83,"2":6.17,"3":6.87,"4":6.7,"5":6.34,"6":6.89,"7":6.53,"8":7.34,"9":6.94,"10":7.66,"11":8.45,"12":6.84,"13":6.59,"14":6.66,"15":5.8,"16":6.16,"17":5.72,"18":6.1,"19":6.21,"20":6.11}}
no in series no in season title directed by written by original air date production code us viewers (million) 0 36 1 chuck versus the pink slip robert duncan mcneill chris fedak & matt miller january 10 , 2010 3x5801 7.70 1 37 2 chuck versus the three words peter lauer allison adler & scott rosenbaum january 10 , 2010 3x5802 7.20 2 38 3 chuck versus the angel de la muerte jeremiah chechik phil klemmer january 11 , 2010 ( citytv ) 3x5803 7.36 3 39 4 chuck versus operation awesome robert duncan mcneill zev borow january 17 , 2010 3x5804 6.65 4 40 5 chuck versus first class fred toye chris fedak january 24 , 2010 (citytv) 3x5805 6.98 5 41 6 chuck versus the nacho sampler allan kroeker matt miller & scott rosenbaum january 31 , 2010 (citytv) 3x5806 6.73 6 42 7 chuck versus the mask michael schultz phil klemmer february 8 , 2010 3x5807 6.60 7 43 8 chuck versus the fake name jeremiah chechik allison adler march 1 , 2010 3x5808 6.70 8 44 9 chuck versus the beard zachary levi scott rosenbaum march 8 , 2010 3x5809 6.37 9 45 10 chuck versus the tic tac patrick norris rafe judkins & lauren lefranc march 15 , 2010 3x5810 5.85 10 46 11 chuck versus the final exam robert duncan mcneill zev borow march 22 , 2010 3x5811 5.46 11 48 13 chuck versus the other guy peter lauer chris fedak april 5 , 2010 3x5813 5.79 12 50 15 chuck versus the role models fred toye phil klemmer may 3 , 2010 3x5815 5.35 13 51 16 chuck versus the tooth daisy von scherler mayer zev borow & max denby may 10 , 2010 3x5816 5.33 14 52 17 chuck versus the living dead jay chandrasekhar lauren lefranc & rafe judkins may 17 , 2010 3x5817 5.20
{"no in series":{"0":36,"1":37,"2":38,"3":39,"4":40,"5":41,"6":42,"7":43,"8":44,"9":45,"10":46,"11":48,"12":50,"13":51,"14":52},"no in season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":13,"12":15,"13":16,"14":17},"title":{"0":"chuck versus the pink slip","1":"chuck versus the three words","2":"chuck versus the angel de la muerte","3":"chuck versus operation awesome","4":"chuck versus first class","5":"chuck versus the nacho sampler","6":"chuck versus the mask","7":"chuck versus the fake name","8":"chuck versus the beard","9":"chuck versus the tic tac","10":"chuck versus the final exam","11":"chuck versus the other guy","12":"chuck versus the role models","13":"chuck versus the tooth","14":"chuck versus the living dead"},"directed by":{"0":"robert duncan mcneill","1":"peter lauer","2":"jeremiah chechik","3":"robert duncan mcneill","4":"fred toye","5":"allan kroeker","6":"michael schultz","7":"jeremiah chechik","8":"zachary levi","9":"patrick norris","10":"robert duncan mcneill","11":"peter lauer","12":"fred toye","13":"daisy von scherler mayer","14":"jay chandrasekhar"},"written by":{"0":"chris fedak & matt miller","1":"allison adler & scott rosenbaum","2":"phil klemmer","3":"zev borow","4":"chris fedak","5":"matt miller & scott rosenbaum","6":"phil klemmer","7":"allison adler","8":"scott rosenbaum","9":"rafe judkins & lauren lefranc","10":"zev borow","11":"chris fedak","12":"phil klemmer","13":"zev borow & max denby","14":"lauren lefranc & rafe judkins"},"original air date":{"0":"january 10 , 2010","1":"january 10 , 2010","2":"january 11 , 2010 ( citytv )","3":"january 17 , 2010","4":"january 24 , 2010 (citytv)","5":"january 31 , 2010 (citytv)","6":"february 8 , 2010","7":"march 1 , 2010","8":"march 8 , 2010","9":"march 15 , 2010","10":"march 22 , 2010","11":"april 5 , 2010","12":"may 3 , 2010","13":"may 10 , 2010","14":"may 17 , 2010"},"production code":{"0":"3x5801","1":"3x5802","2":"3x5803","3":"3x5804","4":"3x5805","5":"3x5806","6":"3x5807","7":"3x5808","8":"3x5809","9":"3x5810","10":"3x5811","11":"3x5813","12":"3x5815","13":"3x5816","14":"3x5817"},"us viewers (million)":{"0":7.7,"1":7.2,"2":7.36,"3":6.65,"4":6.98,"5":6.73,"6":6.6,"7":6.7,"8":6.37,"9":5.85,"10":5.46,"11":5.79,"12":5.35,"13":5.33,"14":5.2}}
pick nfl team player position pro team college 0 57 tampa bay buccaneers alex clark db new orleans breakers lsu 1 58 houston oilers lynn madsen dt new jersey generals washington 2 59 new york giants kirby warren rb los angeles express pacific 3 60 philadelphia eagles thomas carter lb oakland invaders san diego state 4 61 kansas city chiefs garcia lane cb philadelphia stars ohio state 5 62 san diego chargers clarence collins wr new jersey generals illinois state 6 63 atlanta falcons dennis woodberry db birmingham stallions southern arkansas 7 64 new york jets turner gill qb montreal concordes cfl nebraska 8 65 cincinnati bengals tom kilkenny lb chicago blitz temple 9 66 indianapolis colts byron smith dt saskatchewan roughriders cfl california 10 67 minnesota vikings david howard lb los angeles express long beach state 11 68 buffalo bills don corbin ot pittsburgh maulers kentucky 12 69 new orleans saints steve dearden lb memphis showboats vanderbilt 13 70 new england patriots walter lewis qb memphis showboats alabama 14 71 cleveland browns (from chicago bears) doug west lb jacksonville bulls ucla 15 72 green bay packers john sullivan db oakland invaders california 16 73 st louis cardinals tim riordan qb philadelphia stars temple 17 74 detroit lions doug hollie de pittsburgh maulers smu 18 75 los angeles rams jim byrne nt philadelphia stars wisconsin - lacrosse 19 76 seattle seahawks frank seurer qb los angeles express kansas 20 77 cleveland browns john bond qb saskatchewan roughriders cfl mississippi state 21 78 denver broncos reggie smith ot tampa bay bandits kansas 22 79 pittsburgh steelers phil boren ot birmingham stallions arkansas 23 80 san francisco 49ers mark schellen rb new orleans breakers nebraska 24 81 dallas cowboys jeff spek te new jersey generals san diego state 25 82 miami dolphins duan hanks wr philadelphia stars stephen f austin 26 83 washington redskins clarence verdin wr houston gamblers southwestern louisiana
{"pick":{"0":57,"1":58,"2":59,"3":60,"4":61,"5":62,"6":63,"7":64,"8":65,"9":66,"10":67,"11":68,"12":69,"13":70,"14":71,"15":72,"16":73,"17":74,"18":75,"19":76,"20":77,"21":78,"22":79,"23":80,"24":81,"25":82,"26":83},"nfl team":{"0":"tampa bay buccaneers","1":"houston oilers","2":"new york giants","3":"philadelphia eagles","4":"kansas city chiefs","5":"san diego chargers","6":"atlanta falcons","7":"new york jets","8":"cincinnati bengals","9":"indianapolis colts","10":"minnesota vikings","11":"buffalo bills","12":"new orleans saints","13":"new england patriots","14":"cleveland browns (from chicago bears)","15":"green bay packers","16":"st louis cardinals","17":"detroit lions","18":"los angeles rams","19":"seattle seahawks","20":"cleveland browns","21":"denver broncos","22":"pittsburgh steelers","23":"san francisco 49ers","24":"dallas cowboys","25":"miami dolphins","26":"washington redskins"},"player":{"0":"alex clark","1":"lynn madsen","2":"kirby warren","3":"thomas carter","4":"garcia lane","5":"clarence collins","6":"dennis woodberry","7":"turner gill","8":"tom kilkenny","9":"byron smith","10":"david howard","11":"don corbin","12":"steve dearden","13":"walter lewis","14":"doug west","15":"john sullivan","16":"tim riordan","17":"doug hollie","18":"jim byrne","19":"frank seurer","20":"john bond","21":"reggie smith","22":"phil boren","23":"mark schellen","24":"jeff spek","25":"duan hanks","26":"clarence verdin"},"position":{"0":"db","1":"dt","2":"rb","3":"lb","4":"cb","5":"wr","6":"db","7":"qb","8":"lb","9":"dt","10":"lb","11":"ot","12":"lb","13":"qb","14":"lb","15":"db","16":"qb","17":"de","18":"nt","19":"qb","20":"qb","21":"ot","22":"ot","23":"rb","24":"te","25":"wr","26":"wr"},"pro team":{"0":"new orleans breakers","1":"new jersey generals","2":"los angeles express","3":"oakland invaders","4":"philadelphia stars","5":"new jersey generals","6":"birmingham stallions","7":"montreal concordes cfl","8":"chicago blitz","9":"saskatchewan roughriders cfl","10":"los angeles express","11":"pittsburgh maulers","12":"memphis showboats","13":"memphis showboats","14":"jacksonville bulls","15":"oakland invaders","16":"philadelphia stars","17":"pittsburgh maulers","18":"philadelphia stars","19":"los angeles express","20":"saskatchewan roughriders cfl","21":"tampa bay bandits","22":"birmingham stallions","23":"new orleans breakers","24":"new jersey generals","25":"philadelphia stars","26":"houston gamblers"},"college":{"0":"lsu","1":"washington","2":"pacific","3":"san diego state","4":"ohio state","5":"illinois state","6":"southern arkansas","7":"nebraska","8":"temple","9":"california","10":"long beach state","11":"kentucky","12":"vanderbilt","13":"alabama","14":"ucla","15":"california","16":"temple","17":"smu","18":"wisconsin - lacrosse","19":"kansas","20":"mississippi state","21":"kansas","22":"arkansas","23":"nebraska","24":"san diego state","25":"stephen f austin","26":"southwestern louisiana"}}
team outgoing head coach manner of departure date of vacancy position in table incoming head coach date of appointment 0 união de leiria lito vidigal sacked 7 july 2010 off - season pedro caixinha 10 july 2010 1 marítimo mitchell van der gaag sacked 14 september 2010 15th pedro martins 14 september 2010 2 naval 1 de maio victor zvunka sacked 27 september 2010 14th rogério gonçalves 6 october 2010 3 académica jorge costa resigned 21 december 2010 9th josé guilherme 27 december 2010 4 naval 1 de maio rogério gonçalves sacked 19 december 2010 16th carlos mozer 30 december 2010 5 portimonense litos sacked 28 december 2011 16th carlos azenha 29 december 2010 6 académica josé guilherme resigned 20 february 2011 13th ulisses morais 22 february 2011 7 sporting paulo sérgio resigned 26 february 2011 3rd josé couceiro 26 february 2011 8 beira - mar leonardo jardim resigned 28 february 2011 10th rui bento 1 march 2011 9 vitória de setúbal manuel fernandes sacked 1 march 2011 14th bruno ribeiro 1 march 2011
{"team":{"0":"união de leiria","1":"marítimo","2":"naval 1 de maio","3":"académica","4":"naval 1 de maio","5":"portimonense","6":"académica","7":"sporting","8":"beira - mar","9":"vitória de setúbal"},"outgoing head coach":{"0":"lito vidigal","1":"mitchell van der gaag","2":"victor zvunka","3":"jorge costa","4":"rogério gonçalves","5":"litos","6":"josé guilherme","7":"paulo sérgio","8":"leonardo jardim","9":"manuel fernandes"},"manner of departure":{"0":"sacked","1":"sacked","2":"sacked","3":"resigned","4":"sacked","5":"sacked","6":"resigned","7":"resigned","8":"resigned","9":"sacked"},"date of vacancy":{"0":"7 july 2010","1":"14 september 2010","2":"27 september 2010","3":"21 december 2010","4":"19 december 2010","5":"28 december 2011","6":"20 february 2011","7":"26 february 2011","8":"28 february 2011","9":"1 march 2011"},"position in table":{"0":"off - season","1":"15th","2":"14th","3":"9th","4":"16th","5":"16th","6":"13th","7":"3rd","8":"10th","9":"14th"},"incoming head coach":{"0":"pedro caixinha","1":"pedro martins","2":"rogério gonçalves","3":"josé guilherme","4":"carlos mozer","5":"carlos azenha","6":"ulisses morais","7":"josé couceiro","8":"rui bento","9":"bruno ribeiro"},"date of appointment":{"0":"10 july 2010","1":"14 september 2010","2":"6 october 2010","3":"27 december 2010","4":"30 december 2010","5":"29 december 2010","6":"22 february 2011","7":"26 february 2011","8":"1 march 2011","9":"1 march 2011"}}
greek national account 1970 1980 1990 1995 1996 1997 1998 1999 2000 2001 1 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2 2014 2 2015 3 0 public revenue (% of gdp) n / a n / a 31.0 37.0 37.8 39.3 40.9 41.8 43.4 41.3 40.6 39.4 38.4 39.0 39.2 40.7 40.7 38.3 40.6 42.4 44.7 43.5 43.9 n / a 1 public expenditure 4 (% of gdp) n / a n / a 45.2 46.2 44.5 45.3 44.7 44.8 47.1 45.8 45.4 45.1 46.0 44.4 45.0 47.2 50.5 54.0 51.3 51.9 54.7 47.3 46.5 n / a 2 budget deficit 4 (% of gdp) n / a n / a 14.2 9.1 6.7 5.9 3.9 3.1 3.7 4.5 4.8 5.7 7.6 5.5 5.7 6.5 9.8 15.6 10.7 9.5 10.0 3.8 2.6 tba 3 structural deficit 5 (% of gdp) n / a n / a 14.8 9.1 6.6 6.1 4.1 3.3 4.0 4.6 4.3 5.6 7.8 5.3 6.8 7.9 9.6 14.8 8.8 5.4 1.0 - 2.0 - 2.0 n / a 4 hicp inflation (annual %) n / a n / a n / a 8.9 7.9 5.4 4.5 2.1 2.9 3.7 3.9 3.4 3.0 3.5 3.3 3.0 4.2 1.3 4.7 3.1 1.0 - 0.8 - 0.4 n / a 5 gdp deflator 6 (annual %) 3.8 19.3 20.7 9.8 7.3 6.8 5.2 3.0 3.4 3.1 3.4 3.9 2.9 2.8 2.4 3.3 4.7 2.3 1.1 1.0 - 0.8 - 1.1 - 0.4 tba 6 real gdp growth 7 (%) 8.9 0.7 0.0 2.1 2.4 3.6 3.4 3.4 4.5 4.2 3.4 5.9 4.4 2.3 5.5 3.5 0.2 3.1 4.9 7.1 6.4 - 4.2 0.6 tba 7 public debt 8 (billion ) 0.2 1.5 31.1 86.9 97.8 105.2 111.9 118.6 141.0 151.9 159.2 168.0 183.2 195.4 224.2 239.3 263.3 299.7 329.5 355.2 303.9 321.5 322.2 tba
{"greek national account":{"0":"public revenue (% of gdp)","1":"public expenditure 4 (% of gdp)","2":"budget deficit 4 (% of gdp)","3":"structural deficit 5 (% of gdp)","4":"hicp inflation (annual %)","5":"gdp deflator 6 (annual %)","6":"real gdp growth 7 (%)","7":"public debt 8 (billion )"},"1970":{"0":"n \/ a","1":"n \/ a","2":"n \/ a","3":"n \/ a","4":"n \/ a","5":"3.8","6":"8.9","7":"0.2"},"1980":{"0":"n \/ a","1":"n \/ a","2":"n \/ a","3":"n \/ a","4":"n \/ a","5":"19.3","6":"0.7","7":"1.5"},"1990":{"0":"31.0","1":"45.2","2":"14.2","3":"14.8","4":"n \/ a","5":"20.7","6":"0.0","7":"31.1"},"1995":{"0":37.0,"1":46.2,"2":9.1,"3":9.1,"4":8.9,"5":9.8,"6":2.1,"7":86.9},"1996":{"0":37.8,"1":44.5,"2":6.7,"3":6.6,"4":7.9,"5":7.3,"6":2.4,"7":97.8},"1997":{"0":39.3,"1":45.3,"2":5.9,"3":6.1,"4":5.4,"5":6.8,"6":3.6,"7":105.2},"1998":{"0":40.9,"1":44.7,"2":3.9,"3":4.1,"4":4.5,"5":5.2,"6":3.4,"7":111.9},"1999":{"0":41.8,"1":44.8,"2":3.1,"3":3.3,"4":2.1,"5":3.0,"6":3.4,"7":118.6},"2000":{"0":43.4,"1":47.1,"2":3.7,"3":4.0,"4":2.9,"5":3.4,"6":4.5,"7":141.0},"2001 1":{"0":41.3,"1":45.8,"2":4.5,"3":4.6,"4":3.7,"5":3.1,"6":4.2,"7":151.9},"2002":{"0":40.6,"1":45.4,"2":4.8,"3":4.3,"4":3.9,"5":3.4,"6":3.4,"7":159.2},"2003":{"0":39.4,"1":45.1,"2":5.7,"3":5.6,"4":3.4,"5":3.9,"6":5.9,"7":168.0},"2004":{"0":38.4,"1":46.0,"2":7.6,"3":7.8,"4":3.0,"5":2.9,"6":4.4,"7":183.2},"2005":{"0":39.0,"1":44.4,"2":5.5,"3":5.3,"4":3.5,"5":2.8,"6":2.3,"7":195.4},"2006":{"0":39.2,"1":45.0,"2":5.7,"3":6.8,"4":3.3,"5":2.4,"6":5.5,"7":224.2},"2007":{"0":40.7,"1":47.2,"2":6.5,"3":7.9,"4":3.0,"5":3.3,"6":3.5,"7":239.3},"2008":{"0":40.7,"1":50.5,"2":9.8,"3":9.6,"4":4.2,"5":4.7,"6":0.2,"7":263.3},"2009":{"0":38.3,"1":54.0,"2":15.6,"3":14.8,"4":1.3,"5":2.3,"6":3.1,"7":299.7},"2010":{"0":40.6,"1":51.3,"2":10.7,"3":8.8,"4":4.7,"5":1.1,"6":4.9,"7":329.5},"2011":{"0":42.4,"1":51.9,"2":9.5,"3":5.4,"4":3.1,"5":1.0,"6":7.1,"7":355.2},"2012":{"0":"44.7","1":"54.7","2":"10.0","3":"1.0","4":"1.0","5":"- 0.8","6":"6.4","7":"303.9"},"2013 2":{"0":"43.5","1":"47.3","2":"3.8","3":"- 2.0","4":"- 0.8","5":"- 1.1","6":"- 4.2","7":"321.5"},"2014 2":{"0":"43.9","1":"46.5","2":"2.6","3":"- 2.0","4":"- 0.4","5":"- 0.4","6":"0.6","7":"322.2"},"2015 3":{"0":"n \/ a","1":"n \/ a","2":"tba","3":"n \/ a","4":"n \/ a","5":"tba","6":"tba","7":"tba"}}
team contest and round opponent 1st leg score 2nd leg score aggregate score 0 the new saints champions league 2nd qualifying round bohemians 0 - 1 (a) 4 - 0 (h) w 4 - 1 1 the new saints champions league 3rd qualifying round rsc anderlecht 1 - 3 (h) 0 - 3 (a) l 1 - 6 2 the new saints europa league playoff round cska sofia 0 - 3 (a) 2 - 2 (h) l 2 - 5 3 bangor city europa league 2nd qualifying round fc honka 1 - 1 (a) 2 - 1 (h) w 3 - 2 4 bangor city europa league 3rd qualifying round cs marítimo 2 - 8 (a) 1 - 2 (h) l 3 - 10 5 port talbot town europa league 1st qualifying round turun palloseura 1 - 3 (a) 0 - 4 (h) l 1 - 7
{"team":{"0":"the new saints","1":"the new saints","2":"the new saints","3":"bangor city","4":"bangor city","5":"port talbot town"},"contest and round":{"0":"champions league 2nd qualifying round","1":"champions league 3rd qualifying round","2":"europa league playoff round","3":"europa league 2nd qualifying round","4":"europa league 3rd qualifying round","5":"europa league 1st qualifying round"},"opponent":{"0":"bohemians","1":"rsc anderlecht","2":"cska sofia","3":"fc honka","4":"cs marítimo","5":"turun palloseura"},"1st leg score":{"0":"0 - 1 (a)","1":"1 - 3 (h)","2":"0 - 3 (a)","3":"1 - 1 (a)","4":"2 - 8 (a)","5":"1 - 3 (a)"},"2nd leg score":{"0":"4 - 0 (h)","1":"0 - 3 (a)","2":"2 - 2 (h)","3":"2 - 1 (h)","4":"1 - 2 (h)","5":"0 - 4 (h)"},"aggregate score":{"0":"w 4 - 1","1":"l 1 - 6","2":"l 2 - 5","3":"w 3 - 2","4":"l 3 - 10","5":"l 1 - 7"}}
year winner location entrants winners prize total prize pool 0 2013 nigel richards (5) las vegas 521 usd 10000 usd 43725 1 2012 nigel richards (4) orlando 339 usd 10000 usd 36150 2 2011 nigel richards (3) dallas 329 usd 10000 usd 42075 3 2010 nigel richards (2) dallas 408 usd 10000 usd 42075 4 2009 dave wiegand (2) dayton 486 usd 10000 usd 43175 5 2008 nigel richards (1) orlando 662 usd 25000 usd 85385 6 2006 jim kramer phoenix 625 usd 25000 usd 85385 7 2005 dave wiegand (1) reno 682 usd 25000 usd 85415 8 2004 trey wright new orleans 837 usd 25000 usd 92805 9 2002 joel sherman san diego 696 usd 25000 usd 89290 10 2000 joe edley (3) providence 598 usd 25000 usd 89290 11 1998 brian cappelletto chicago 535 usd 25000 usd 82200 12 1996 adam logan dallas 412 usd 25000 usd 75485 13 1994 david gibson los angeles 294 usd 15000 usd 50585 14 1992 joe edley (2) atlanta 315 usd 10000 usd 35910 15 1990 robert felt washington 282 usd 10000 usd 37400 16 1989 peter morris new york 221 usd 5000 usd 24425 17 1988 robert watson reno 315 usd 5000 usd 23100 18 1987 rita norr las vegas 327 usd 5000 usd 16850 19 1985 ron tiekert boston 302 usd 10000 usd 52370 20 1983 joel wapnick chicago 32 usd 5000 usd 13600 21 1980 joe edley (1) santa monica 32 usd 5000 usd 10100
{"year":{"0":2013,"1":2012,"2":2011,"3":2010,"4":2009,"5":2008,"6":2006,"7":2005,"8":2004,"9":2002,"10":2000,"11":1998,"12":1996,"13":1994,"14":1992,"15":1990,"16":1989,"17":1988,"18":1987,"19":1985,"20":1983,"21":1980},"winner":{"0":"nigel richards (5)","1":"nigel richards (4)","2":"nigel richards (3)","3":"nigel richards (2)","4":"dave wiegand (2)","5":"nigel richards (1)","6":"jim kramer","7":"dave wiegand (1)","8":"trey wright","9":"joel sherman","10":"joe edley (3)","11":"brian cappelletto","12":"adam logan","13":"david gibson","14":"joe edley (2)","15":"robert felt","16":"peter morris","17":"robert watson","18":"rita norr","19":"ron tiekert","20":"joel wapnick","21":"joe edley (1)"},"location":{"0":"las vegas","1":"orlando","2":"dallas","3":"dallas","4":"dayton","5":"orlando","6":"phoenix","7":"reno","8":"new orleans","9":"san diego","10":"providence","11":"chicago","12":"dallas","13":"los angeles","14":"atlanta","15":"washington","16":"new york","17":"reno","18":"las vegas","19":"boston","20":"chicago","21":"santa monica"},"entrants":{"0":521,"1":339,"2":329,"3":408,"4":486,"5":662,"6":625,"7":682,"8":837,"9":696,"10":598,"11":535,"12":412,"13":294,"14":315,"15":282,"16":221,"17":315,"18":327,"19":302,"20":32,"21":32},"winners prize":{"0":"usd 10000","1":"usd 10000","2":"usd 10000","3":"usd 10000","4":"usd 10000","5":"usd 25000","6":"usd 25000","7":"usd 25000","8":"usd 25000","9":"usd 25000","10":"usd 25000","11":"usd 25000","12":"usd 25000","13":"usd 15000","14":"usd 10000","15":"usd 10000","16":"usd 5000","17":"usd 5000","18":"usd 5000","19":"usd 10000","20":"usd 5000","21":"usd 5000"},"total prize pool":{"0":"usd 43725","1":"usd 36150","2":"usd 42075","3":"usd 42075","4":"usd 43175","5":"usd 85385","6":"usd 85385","7":"usd 85415","8":"usd 92805","9":"usd 89290","10":"usd 89290","11":"usd 82200","12":"usd 75485","13":"usd 50585","14":"usd 35910","15":"usd 37400","16":"usd 24425","17":"usd 23100","18":"usd 16850","19":"usd 52370","20":"usd 13600","21":"usd 10100"}}
genus / species gene name accession number sequence length sequence similarity 0 bartonella henselae hypothetical protein bx897699.1 2805nt / 934aa 100 1 bartonella quintana hypothetical protein bx897700.1 2805nt / 934aa 91 2 bartonella grahamii transcription regulator cp001562.1 2799nt / 932aa 87 3 bartonella tribocorum alanyl - trna synthetase am260525.1 2799nt / 932aa 87 4 methylobacterium nodulans hypothetical protein yp_002500318.1 2820nt / 939aa 53 5 nitrobacter hamburgensis double transmembrane region like yp_578448.1 2817nt / 938aa 53 6 hyphomicrobium denitrificans conserved hypothetical protein zp_05374729.1 2973nt / 990aa 53 7 rhodopseudomonas palustris double transmembrane region like yp_568432.1 2826nt / 941aa 54 8 hoeflea phototrophica double transmembrane region like yp_002289983.1 1832nt / 943aa 55
{"genus \/ species":{"0":"bartonella henselae","1":"bartonella quintana","2":"bartonella grahamii","3":"bartonella tribocorum","4":"methylobacterium nodulans","5":"nitrobacter hamburgensis","6":"hyphomicrobium denitrificans","7":"rhodopseudomonas palustris","8":"hoeflea phototrophica"},"gene name":{"0":"hypothetical protein","1":"hypothetical protein","2":"transcription regulator","3":"alanyl - trna synthetase","4":"hypothetical protein","5":"double transmembrane region like","6":"conserved hypothetical protein","7":"double transmembrane region like","8":"double transmembrane region like"},"accession number":{"0":"bx897699.1","1":"bx897700.1","2":"cp001562.1","3":"am260525.1","4":"yp_002500318.1","5":"yp_578448.1","6":"zp_05374729.1","7":"yp_568432.1","8":"yp_002289983.1"},"sequence length":{"0":"2805nt \/ 934aa","1":"2805nt \/ 934aa","2":"2799nt \/ 932aa","3":"2799nt \/ 932aa","4":"2820nt \/ 939aa","5":"2817nt \/ 938aa","6":"2973nt \/ 990aa","7":"2826nt \/ 941aa","8":"1832nt \/ 943aa"},"sequence similarity":{"0":100,"1":91,"2":87,"3":87,"4":53,"5":53,"6":53,"7":54,"8":55}}
rank total usd project name creator category % funded backers closing date 0 1 10266845 pebble : e - paper watch for iphone and android pebble technology design 10266 68928 2012 - 05 - 18 1 2 8596474 ouya : a new kind of video game console ouya inc video games 905 63416 2012 - 08 - 09 2 3 5702153 veronica mars movie rob thomas film & video 285 91585 2013 - 04 - 12 3 4 4188927 torment : tides of numenera inxile entertainment video games 465 74405 2013 - 04 - 05 4 5 3986929 project eternity obsidian entertainment video games 362 73986 2012 - 10 - 16 5 6 3845170 mighty no 9 comcept and inti creates video games 450 67226 2013 - 10 - 01 6 8 3336371 double fine adventure double fine and 2 player productions video games 834 87142 2012 - 03 - 13
{"rank":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":8},"total usd":{"0":10266845,"1":8596474,"2":5702153,"3":4188927,"4":3986929,"5":3845170,"6":3336371},"project name":{"0":"pebble : e - paper watch for iphone and android","1":"ouya : a new kind of video game console","2":"veronica mars movie","3":"torment : tides of numenera","4":"project eternity","5":"mighty no 9","6":"double fine adventure"},"creator":{"0":"pebble technology","1":"ouya inc","2":"rob thomas","3":"inxile entertainment","4":"obsidian entertainment","5":"comcept and inti creates","6":"double fine and 2 player productions"},"category":{"0":"design","1":"video games","2":"film & video","3":"video games","4":"video games","5":"video games","6":"video games"},"% funded":{"0":10266,"1":905,"2":285,"3":465,"4":362,"5":450,"6":834},"backers":{"0":68928,"1":63416,"2":91585,"3":74405,"4":73986,"5":67226,"6":87142},"closing date":{"0":"2012 - 05 - 18","1":"2012 - 08 - 09","2":"2013 - 04 - 12","3":"2013 - 04 - 05","4":"2012 - 10 - 16","5":"2013 - 10 - 01","6":"2012 - 03 - 13"}}
series season title directed by written by original air date us viewers (millions) 0 135 1 remember paul david grossman marc cherry september 26 , 2010 13.06 1 136 2 you must meet my wife larry shaw dave flebotte october 3 , 2010 13.23 2 137 3 truly content tara nicole weyr matt berry october 10 , 2010 12.38 3 138 4 the thing that counts is what 's inside david grossman jason ganzel october 17 , 2010 12.67 4 139 5 let me entertain you lonny price sara parriott & josann mcgibbon october 24 , 2010 12.16 5 140 6 excited and scared jeff greenstein jeff greenstein october 31 , 2010 11.10 6 141 7 a humiliating business larry shaw marco pennette november 7 , 2010 12.72 7 142 8 sorry grateful david grossman annie weisman november 14 , 2010 11.92 8 143 9 pleasant little kingdom arlene sanford dave flebotte december 5 , 2010 11.36 9 144 10 down the block there 's a riot larry shaw bob daily december 12 , 2010 11.60 10 145 11 assassins david warren john paul bullock iii january 2 , 2011 12.19 11 146 12 where do i belong david grossman david schladweiler january 9 , 2011 12.83 12 147 13 i'm still here lonny price josann mcgibbon & sara parriott january 16 , 2011 10.25 13 148 14 flashback andrew doerfer matt berry february 13 , 2011 9.20 14 149 15 farewell letter david grossman marco pennette february 20 , 2011 10.58 15 150 16 searching larry shaw jeff greenstein march 6 , 2011 11.35 16 151 17 everything 's different , nothing 's changed david warren annie weisman april 3 , 2011 9.05 17 152 18 moments in the woods david grossman john paul bullock iii april 17 , 2011 9.11 18 153 19 the lies ill - concealed larry shaw david schladweiler april 24 , 2011 10.15 19 154 20 i'll swallow poison on sunday david warren jason ganzel may 1 , 2011 9.44 20 155 21 then i really got scared larry shaw valerie a brotski may 8 , 2011 10.00 21 156 22 and lots of security david grossman joe keenan may 15 , 2011 10.25
{"series":{"0":135,"1":136,"2":137,"3":138,"4":139,"5":140,"6":141,"7":142,"8":143,"9":144,"10":145,"11":146,"12":147,"13":148,"14":149,"15":150,"16":151,"17":152,"18":153,"19":154,"20":155,"21":156},"season":{"0":1,"1":2,"2":3,"3":4,"4":5,"5":6,"6":7,"7":8,"8":9,"9":10,"10":11,"11":12,"12":13,"13":14,"14":15,"15":16,"16":17,"17":18,"18":19,"19":20,"20":21,"21":22},"title":{"0":"remember paul","1":"you must meet my wife","2":"truly content","3":"the thing that counts is what 's inside","4":"let me entertain you","5":"excited and scared","6":"a humiliating business","7":"sorry grateful","8":"pleasant little kingdom","9":"down the block there 's a riot","10":"assassins","11":"where do i belong","12":"i'm still here","13":"flashback","14":"farewell letter","15":"searching","16":"everything 's different , nothing 's changed","17":"moments in the woods","18":"the lies ill - concealed","19":"i'll swallow poison on sunday","20":"then i really got scared","21":"and lots of security"},"directed by":{"0":"david grossman","1":"larry shaw","2":"tara nicole weyr","3":"david grossman","4":"lonny price","5":"jeff greenstein","6":"larry shaw","7":"david grossman","8":"arlene sanford","9":"larry shaw","10":"david warren","11":"david grossman","12":"lonny price","13":"andrew doerfer","14":"david grossman","15":"larry shaw","16":"david warren","17":"david grossman","18":"larry shaw","19":"david warren","20":"larry shaw","21":"david grossman"},"written by":{"0":"marc cherry","1":"dave flebotte","2":"matt berry","3":"jason ganzel","4":"sara parriott & josann mcgibbon","5":"jeff greenstein","6":"marco pennette","7":"annie weisman","8":"dave flebotte","9":"bob daily","10":"john paul bullock iii","11":"david schladweiler","12":"josann mcgibbon & sara parriott","13":"matt berry","14":"marco pennette","15":"jeff greenstein","16":"annie weisman","17":"john paul bullock iii","18":"david schladweiler","19":"jason ganzel","20":"valerie a brotski","21":"joe keenan"},"original air date":{"0":"september 26 , 2010","1":"october 3 , 2010","2":"october 10 , 2010","3":"october 17 , 2010","4":"october 24 , 2010","5":"october 31 , 2010","6":"november 7 , 2010","7":"november 14 , 2010","8":"december 5 , 2010","9":"december 12 , 2010","10":"january 2 , 2011","11":"january 9 , 2011","12":"january 16 , 2011","13":"february 13 , 2011","14":"february 20 , 2011","15":"march 6 , 2011","16":"april 3 , 2011","17":"april 17 , 2011","18":"april 24 , 2011","19":"may 1 , 2011","20":"may 8 , 2011","21":"may 15 , 2011"},"us viewers (millions)":{"0":13.06,"1":13.23,"2":12.38,"3":12.67,"4":12.16,"5":11.1,"6":12.72,"7":11.92,"8":11.36,"9":11.6,"10":12.19,"11":12.83,"12":10.25,"13":9.2,"14":10.58,"15":11.35,"16":9.05,"17":9.11,"18":10.15,"19":9.44,"20":10.0,"21":10.25}}
position nationality name league apps league goals fa cup apps fa cup goals total apps total goals 0 fw scotland jack angus 3 1 1 0 4 1 1 fb england charles baker 18 5 5 0 23 12 2 gk england jack barrett 3 0 0 0 3 0 3 gk england tom cain 10 0 0 0 10 0 4 gk england walter cox 3 0 5 0 8 0 5 hb scotland jimmy dale 3 0 2 0 5 0 6 fw england jack farrell 17 10 5 4 22 14 7 fb wales david hamer 4 0 1 0 5 0 8 hb england john hodgkinson 7 2 1 0 8 2 9 hb scotland sergt inglis 1 0 0 0 1 0 10 fw scotland watty keay 15 6 5 3 20 9 11 fw england bob kiddle 1 0 0 0 1 0 12 hb england alf littlehales 17 4 5 1 22 5 13 hb scotland john mcmillan 4 0 0 0 4 0 14 fb england george marshall 8 0 3 0 11 0 15 fb scotland samuel meston 18 0 5 1 23 1 16 fw scotland willie naughton 17 8 4 3 21 11 17 fb england gunner phillips 1 0 0 0 1 0 18 gk ireland matt reilly 2 0 0 0 2 0 19 fb england joe rogers 8 1 1 0 9 1 20 hb england victor smith 1 0 0 0 1 0 21 hb england ernie taylor 8 1 2 1 10 2 22 hb england lachie thomson 12 0 5 0 17 0
{"position":{"0":"fw","1":"fb","2":"gk","3":"gk","4":"gk","5":"hb","6":"fw","7":"fb","8":"hb","9":"hb","10":"fw","11":"fw","12":"hb","13":"hb","14":"fb","15":"fb","16":"fw","17":"fb","18":"gk","19":"fb","20":"hb","21":"hb","22":"hb"},"nationality":{"0":"scotland","1":"england","2":"england","3":"england","4":"england","5":"scotland","6":"england","7":"wales","8":"england","9":"scotland","10":"scotland","11":"england","12":"england","13":"scotland","14":"england","15":"scotland","16":"scotland","17":"england","18":"ireland","19":"england","20":"england","21":"england","22":"england"},"name":{"0":"jack angus","1":"charles baker","2":"jack barrett","3":"tom cain","4":"walter cox","5":"jimmy dale","6":"jack farrell","7":"david hamer","8":"john hodgkinson","9":"sergt inglis","10":"watty keay","11":"bob kiddle","12":"alf littlehales","13":"john mcmillan","14":"george marshall","15":"samuel meston","16":"willie naughton","17":"gunner phillips","18":"matt reilly","19":"joe rogers","20":"victor smith","21":"ernie taylor","22":"lachie thomson"},"league apps":{"0":3,"1":18,"2":3,"3":10,"4":3,"5":3,"6":17,"7":4,"8":7,"9":1,"10":15,"11":1,"12":17,"13":4,"14":8,"15":18,"16":17,"17":1,"18":2,"19":8,"20":1,"21":8,"22":12},"league goals":{"0":1,"1":5,"2":0,"3":0,"4":0,"5":0,"6":10,"7":0,"8":2,"9":0,"10":6,"11":0,"12":4,"13":0,"14":0,"15":0,"16":8,"17":0,"18":0,"19":1,"20":0,"21":1,"22":0},"fa cup apps":{"0":1,"1":5,"2":0,"3":0,"4":5,"5":2,"6":5,"7":1,"8":1,"9":0,"10":5,"11":0,"12":5,"13":0,"14":3,"15":5,"16":4,"17":0,"18":0,"19":1,"20":0,"21":2,"22":5},"fa cup goals":{"0":0,"1":0,"2":0,"3":0,"4":0,"5":0,"6":4,"7":0,"8":0,"9":0,"10":3,"11":0,"12":1,"13":0,"14":0,"15":1,"16":3,"17":0,"18":0,"19":0,"20":0,"21":1,"22":0},"total apps":{"0":4,"1":23,"2":3,"3":10,"4":8,"5":5,"6":22,"7":5,"8":8,"9":1,"10":20,"11":1,"12":22,"13":4,"14":11,"15":23,"16":21,"17":1,"18":2,"19":9,"20":1,"21":10,"22":17},"total goals":{"0":1,"1":12,"2":0,"3":0,"4":0,"5":0,"6":14,"7":0,"8":2,"9":0,"10":9,"11":0,"12":5,"13":0,"14":0,"15":1,"16":11,"17":0,"18":0,"19":1,"20":0,"21":2,"22":0}}