content
stringlengths
35
416k
sha1
stringlengths
40
40
id
int64
0
710k
def calculate_pct_poi_msgs(series): """calculates the percentage of a potential POI's total messages that are to or from a POI Args: series (pandas.core.series.Series): data series associated with a single POI Returns: [pandas.core.series.Series]: data series with the added POI message calculate """ total_msgs = series["from_messages"] + series["to_messages"] series["pct_poi_messages"] = 0 if total_msgs > 0: series["pct_poi_messages"] = ( (series["from_poi_to_this_person"] + series["from_this_person_to_poi"]) / float(total_msgs) ) * 100 return series["pct_poi_messages"]
857e23204e6eab5db36f23d583613dd19bc7ffd4
703,543
import struct def _read_int(f, b): """ Read an integer of a specified number of bytes from the filestream f """ if b == 1: return struct.unpack('<B', f.read(b))[0] elif b == 2: return struct.unpack('<H', f.read(b))[0] elif b == 4: return struct.unpack('<I', f.read(b))[0] elif b == 8: return struct.unpack('<Q', f.read(b))[0]
36bcc2ccd4edd61fd9c6a438c3a069e699b7b17a
703,544
def compare_equality(col_1, col_2): """ This function compare the equality of two columns and output an accuracy percentage """ return float(col_1.eq(col_2.values).mean())
adf6e6bb26988c7ee0211669881b2cd8331838da
703,546
def saveForwardState(old_s_tree, new_s_tree, s): """Saving the s_current as well as all its successors in the old_s_tree into the new_s_tree. Parameters ---------- old_s_tree : dict The old tree. new_s_tree : dict The new tree. s_current : :py:class:`ast_toolbox.mcts.AdaptiveStressTesting.ASTState` The current state. Returns ---------- new_s_tree : dict The new tree. """ if not (s in old_s_tree): return new_s_tree new_s_tree[s] = old_s_tree[s] for sa in old_s_tree[s].a.values(): for s1 in sa.s.keys(): saveForwardState(old_s_tree, new_s_tree, s1) return new_s_tree
1cf8aeac314c2f224a76d9c91c3bf1a8d54fd9df
703,547
import json import os import logging def load_and_save_params(default_params, exp_dir, ignore_existing=False): """Update default_params with params.json from exp_dir and overwrite params.json with updated version.""" default_params = json.loads(json.dumps(default_params)) param_path = os.path.join(exp_dir, 'params.json') logging.info("Searching for '%s'" % param_path) if os.path.exists(param_path) and not ignore_existing: logging.info("Loading existing params.") with open(param_path, 'r') as fd: params = json.load(fd) default_params.update(params) if not os.path.exists(exp_dir): os.makedirs(exp_dir) with open(param_path, 'w') as fd: json.dump(default_params, fd, indent=4) return default_params
4a0e9c1e24ec914abe1540ad9dd7d655b96c0e39
703,549
def generate_input_with_unknown_words(file_path): """Reads the file with the given file_path. Replaces every first occurance of a (word, tag) pair with ("<UNK>", tag). Creates dictionary of all words encountered in following format: {(word, tag) : count}""" seen_tuples = [] label_matches = dict() file_lines = [] with open(file_path) as f: for line in f: file_lines = file_lines + [line.lower().split()] word_tuples = zip(file_lines[0::3], file_lines[1::3], file_lines[2::3]) for (words, part_of_speech, word_type) in word_tuples: type_tuple = zip(words, word_type) for word_and_tag in type_tuple: if word_and_tag in seen_tuples: label_matches.update({word_and_tag : (label_matches.get(word_and_tag, 0) + 1)}) else: tag = word_and_tag[1] unknown_entry = ("<UNK>", tag) label_matches.update({unknown_entry : (label_matches.get(unknown_entry, 0) + 1)}) seen_tuples.append(word_and_tag) return label_matches
21479c1953dc1779a28bc49a38de55c383513fbf
703,550
def terminal_values(rets): """ Computes the terminal values from a set of returns supplied as a T x N DataFrame Return a Series of length N indexed by the columns of rets """ return (rets+1).prod()
bea1f2a668deac3e915f7531ab68aea207e57d91
703,551
def getColumnNames(hdu): """Get names of columns in HDU.""" return [d.name for d in hdu.get_coldefs()]
9ac8fefe6fcf0e7aed10699f19b849c14b022d47
703,553
import torch def embedding_to_probability(embedding: torch.Tensor, centroids: torch.Tensor, sigma: torch.Tensor) -> torch.Tensor: """ Vectorizing this is slower than the loop!!! # / (e_ix - C_kx)^2 (e_iy - C_ky)^2 (e_iz - C_kz)^2 \ # prob_k(e_i) = exp |-1 * ---------------- - ----------------- - ------------------ | # \ 2*sigma_kx ^2 2*sigma_ky ^2 2 * sigma_kz ^2 / :param embedding: [B, K=3, X, Y, Z] torch.Tensor where K is the likely centroid component: {X, Y, Z} :param centroids: [B, I, K_true=3] torch.Tensor where I is the number of instances in the image and K_true is centroid {x, y, z} :param sigma: torch.Tensor of shape = (1) or (embedding.shape) :return: [B, I, X, Y, Z] of probabilities for instance I """ num = 512 sigma = sigma + 1e-10 # when sigma goes to zero, things tend to break centroids = centroids / num # Half the size of the image so vectors can be +- 1 # Calculates the euclidean distance between the centroid and the embedding # embedding [B, 3, X, Y, Z] -> euclidean_norm[B, 1, X, Y, Z] # euclidean_norm = sqrt(Δx^2 + Δy^2 + Δz^2) where Δx = (x_embed - x_centroid_i) prob = torch.zeros((embedding.shape[0], centroids.shape[1], embedding.shape[2], embedding.shape[3], embedding.shape[4]), device=embedding.device) sigma = sigma.pow(2).mul(2) for i in range(centroids.shape[1]): # Calculate euclidean distance between centroid and embedding for each pixel euclidean_norm = (embedding - centroids[:, i, :].view(centroids.shape[0], 3, 1, 1, 1)).pow(2) # Turn distance to probability and put it in preallocated matrix if sigma.shape[0] == 3: prob[:, i, :, :, :] = torch.exp( (euclidean_norm / sigma.view(centroids.shape[0], 3, 1, 1, 1)).mul(-1).sum(dim=1)).squeeze(1) else: prob[:, i, :, :, :] = torch.exp((euclidean_norm / sigma).mul(-1).sum(dim=1)).squeeze(1) return prob
133b7b81bb00db2110b6ec9709ab89924dee2dc4
703,554
def get_url(server_name, listen_port): """ Generating URL to get the information from namenode/namenode :param server_name: :param listen_port: :return: """ if listen_port < 0: print ("Invalid Port") exit() if not server_name: print("Pass valid Hostname") exit() URL = "http://"+server_name+":"+str(listen_port)+"/jmx" return URL
097e347a75eb581ae97734552fa6f9e7d3b11ce6
703,555
def euler97(): """Solution for problem 97.""" mod = 10 ** 10 return (1 + 28433 * pow(2, 7830457, mod)) % mod
ab04cf67431a434f147f3615bee5a211b58ccbde
703,556
def latex_code(size): """ Get LaTeX code for size """ return "\\" + size + " "
03478f8f62bb2b70ab5ca6ece66d4cdca3595dd6
703,557
def has_cycle_visit(visiting, parents, adjacency_list, s): """ Check if there is a cycle in a graph starting at the node s """ visiting[s] = True for u in adjacency_list[s]: if u in visiting: return True if u in parents: continue parents[u] = s if has_cycle_visit(visiting, parents, adjacency_list, u): return True del visiting[s] return False
5f87f6f39d88cbae93e7e461590002ca6a94aa20
703,558
def remove_trailing_whitespace(line): """Removes trailing whitespace, but preserves the newline if present. """ if line.endswith("\n"): return "{}\n".format(remove_trailing_whitespace(line[:-1])) return line.rstrip()
2c5f7b3a35152b89cda6645911569c9d2815f47e
703,559
def process_settings(pelicanobj): """Sets user specified Katex settings""" katex_settings = {} katex_settings['auto_insert'] = True katex_settings['process_summary'] = True return katex_settings
9799d9ea6bf17fabd1640c4e69ca3b1da5406829
703,560
import networkx def make_cross(length=20, width=2) -> networkx.Graph: """Builds graph which looks like a cross. Result graph has (2*length-width)*width vertices. For example, this is a cross of width 3: ... +++ +++ ...+++++++++++... ...+++++++++++... ...+++++++++++... +++ +++ ... :param length: Length of a cross. :param width: Width of a cross. """ assert width < length * 2 nodes = set() for i in range(length // 2, length // 2 + width): for j in range(0, length): nodes.add((i, j)) nodes.add((j, i)) nodes = list(nodes) node_index = {nodes[i]: i for i in range(len(nodes))} graph = networkx.Graph() graph.add_nodes_from(range(len(nodes))) for x, y in nodes: for dx, dy in [(1, 0), (-1, 0), (0, 1), (0, -1)]: if (x + dx, y + dy) in node_index: graph.add_edge(node_index[(x, y)], node_index[(x + dx, y + dy)]) return graph
f0be683fd8971ea8b3cc0b40977a939c117e9906
703,561
def print_table(input_dict, title='', header=('Key', 'Value'), style=('', '-')): """Print the dict in a table form""" assert input_dict.__class__ is dict, "Only accept class='dict'" if input_dict is None: return None max_string = 110 key_list = list(input_dict.keys()) val_list = list(map(str, input_dict.values())) key_list.append(header[0]) val_list.append(header[1]) # find the longest key value width_left = min(len(max(key_list, key=len)), max_string) width_right = min(len(max(val_list, key=len)), max_string) width_full = width_left + width_right + 2 + 2 + 1 # structure table_struct = f"{{:>{width_left}}} | {{:>{width_right}}}" # top border print(style[0] * width_full) # title print(f"{{:^{width_full}}}".format(f"~{title}~")) print(style[1] * width_full) # contents print(table_struct.format(header[0], header[1])) print(style[1] * width_full) for key, val in input_dict.items(): # format empty value if val == '': val = '-' # trim long string if len(str(val)) > max_string: print(table_struct.format(key, str(val)[0:max_string])) else: print(table_struct.format(key, str(val))) # bot boader print(style[0] * width_full) print("\n")
47844b6526723fbf63bc347ed1487442fc497904
703,562
def must_be_known(in_limit, out_limit): """ Logical combinatino of limits enforcing a known state The logic determines that we know that the device is fully inserted or removed, alerting the MPS if the device is stuck in an unknown state or broken Parameters ---------- in_limit : ``bool`` Whether the in limit is active out_limit: ``bool`` Whether the out limit is active Returns ------- is_known Whether the logical combination of the limit switch ensure that the device position is known """ return in_limit != out_limit
241b66b359643d069aa4066965879bb6ac76f2ae
703,564
def scale(x): """Scales values to [-1, 1]. **Parameters** :x: array-like, shape = arbitrary; unscaled data **Returns** :x_scaled: array-like, shape = x.shape; scaled data """ minimum = x.min() return 2.0 * (x - minimum) / (x.max() - minimum) - 1.0
e5c40a4a840a1fa178a2902378a51bfefc83b368
703,565
def group_data_by_columns(datasets, columns): """ :param datasets: [CxNxSxF] :param columns: F :return: CxNxFxS """ new_dataset = [] for i in range(len(datasets)): datalist = [] for row in range(len(datasets[i][0][0])): row_data = [] for column_idx in range(len(columns)): col_data = [] for series in range(len(datasets[i][0][0][row])): col_data.append(datasets[i][0][0][row][series][column_idx]) row_data.append(col_data) datalist.append(row_data) new_dataset.append((datalist, datasets[i][0][1])) return new_dataset
8a73c959501f422c26fe358c05ddc6a574123009
703,566
def GetStaticPipelineOptions(options_list): """ Takes the dictionary loaded from the yaml configuration file and returns it in a form consistent with the others in GenerateAllPipelineOptions: a list of (pipeline_option_name, pipeline_option_value) tuples. The options in the options_list are a dict: Key is the name of the pipeline option to pass to beam Value is the value of the pipeline option to pass to beam """ options = [] for option in options_list: if len(list(option.keys())) != 1: raise Exception('Each item in static_pipeline_options should only have' ' 1 key/value') option_kv = list(option.items())[0] options.append((option_kv[0], option_kv[1])) return options
d49effbdeb687ec62a2e2296330f66521023944c
703,567
def _field_object_metadata(field_object): """Return mapping of field metadata key to value. Args: field_object (arcpy.Field): ArcPy field object. Returns: dict. """ meta = {"object": field_object} key_attribute_name = { "alias_name": "aliasName", "base_name": "baseName", "default_value": "defaultValue", "is_editable": "editable", "is_nullable": "isNullable", "is_required": "required", } key_attribute_same = ["name", "type", "length", "precision", "scale"] for key in key_attribute_same: key_attribute_name[key] = key for key, attribute_name in key_attribute_name.items(): meta[key] = getattr(field_object, attribute_name) return meta
1e653737f1dee41c7ce786735368e55f4908b116
703,569
def mean_of_cluster(list_of_points): """Calculates the center of the list of points """ number_of_points = float(len(list_of_points)) vector_total = [float(0), float(0)] for point in list_of_points: for index, component in enumerate(point): vector_total[index] += component return vector_total[0] / number_of_points, vector_total[1] / number_of_points
b94b5ea40fb08253bcade35282692bbb58b85e98
703,570
def range_overlap(a_min, a_max, b_min, b_max): """ Neither range is completely greater than the other """ return (a_min <= b_max) and (b_min <= a_max)
c05d8b0799f62300760ad69704a5091c3830ad26
703,571
import json def read_json(json_file_path: str) -> dict: """Takes a JSON file and returns a dictionary""" with open(json_file_path, "r") as fp: data = json.load(fp) return data
07cb6c606de83b2b51ddcbf64f7eb45d6907f973
703,572
import os def _get_user_guide_directory(): """Returns absolute path to docs/ directory""" docsdir = os.path.join("docs", "user_guide") return os.path.abspath(docsdir)
147294fe005f7d6756aeb4c3579bddf795668087
703,573
import uuid def unique_variable_name(): """Creates a unique variable name. Useful when attempting to introduce a new token to see if it can fix specific cases of SyntaxError.""" name = uuid.uuid4() return "_%s" % name.hex
d4b54a8ab76fa8bddd6fe62a735f1dd886e9e62a
703,574
def cleaner_unicode(string): """ Objective : This method is used to clean the special characters from the report string and place ascii characters in place of them """ if string is not None: return string.encode('ascii', errors='backslashreplace') else: return string
f4e2c4b9fa7f4a644e409a5d429531a34bc1c6c2
703,575
import subprocess import sys def subprocess_call(args, cwd, capture_output=False, **kwargs): """Calls a subprocess, possibly capturing output.""" try: if capture_output: return subprocess.check_output(args, cwd=cwd, **kwargs) else: return subprocess.check_call(args, cwd=cwd, **kwargs) except subprocess.CalledProcessError: print("ERROR executing subprocess (from {}):\n {}".format( cwd, " ".join(args)), file=sys.stderr) sys.exit(1)
956837dae6e7b74f1e51cd87e4c920bfe08eb2d0
703,576
def enthalpy_Shomate(T, hCP): """ enthalpy_Shomate(T, hCP) NIST vapor, liquid, and solid phases heat capacity correlation H - H_ref (kJ/mol) = A*t + 1/2*B*t^2 + 1/3*C*t^3 + 1/4*D*t^4 - E*1/t + F - H t (K) = T/1000.0 H_ref is enthalpy in kJ/mol at 298.15 K Parameters T, temperature in Kelvin hCP, A=hCP[0], B=hCP[1], C=hCP[2], D=hCP[3], E=hCP[4], F=hCP[5], H=hCP[7] A, B, C, D, E, F, and H are regression coefficients Returns enthalpy in kJ/mol at T relative to enthalpy at 298.15 K """ t = T/1000.0 return hCP[0]*t + hCP[1]/2*t**2 + hCP[2]/3*t**3 + hCP[3]/4*t**4 - hCP[4]/t + hCP[5] - hCP[7]
05e3f3a35a87f767a44e2e1f4e35e768e12662f7
703,577
def get_acres(grid, coordinates): """Get acres from coordinates on grid.""" acres = [] for row, column in coordinates: if 0 <= row < len(grid) and 0 <= column < len(grid[0]): acres.append(grid[row][column]) return acres
e4ba6aabe07d8859481aefaba4d4559f1ec25e96
703,578
def highest_mag(slide): """Returns the highest magnification for the slide """ return int(slide.properties['aperio.AppMag'])
d42361c979a5addf0ebf4c7081a284c9bc0477ec
703,579
import re def enumerate_destination_file_name(destination_file_name): """ Append a * to the end of the provided destination file name. Only used when query output is too big and Google returns an error requesting multiple file names. """ if re.search(r'\.', destination_file_name): destination_file_name = re.sub( r'\.', f'_*.', destination_file_name, 1) else: destination_file_name = f'{destination_file_name}_*' return destination_file_name
6b398597db26a175e305446ac39c363a5077ba96
703,581
def demistoVersion(): """Retrieves server version and build number Returns: dict: Objects contains server version and build number """ return { 'version': '5.5.0', 'buildNumber': '12345' }
39ef34f88f44ecfad9d30a80bcdb74ad1833c3ae
703,582
import os def create_work_name(name): """ Remove ".nzb" and ".par(2)" """ strip_ext = ['.nzb', '.par', '.par2'] name = name.strip() if name.find('://') < 0: name_base, ext = os.path.splitext(name) # In case it was one of these, there might be more while ext.lower() in strip_ext: name = name_base name_base, ext = os.path.splitext(name) return name.strip() else: return name.strip()
5e5405505a7c342ebb372ea53ad8330919b0979a
703,583
def bias_act(x, b=None, dim=1, gain=None, clamp=None): """Slow reference implementation of `bias_act()` """ # spec = activation_funcs[act] # alpha = float(alpha if alpha is not None else 0) gain = float(gain if gain is not None else 1) clamp = float(clamp if clamp is not None else -1) # Add bias. if b is not None: x = x + b.reshape([-1 if i == dim else 1 for i in range(x.ndim)]) # Evaluate activation function. # alpha = float(alpha) # x = spec.func(x, alpha=alpha) # Scale by gain. gain = float(gain) if gain != 1: x = x * gain # Clamp. if clamp >= 0: x = x.clip(-clamp, clamp) # pylint: disable=invalid-unary-operand-type return x
3e98d5941d29c78ecd5c46c9ec960f14cedc36e9
703,584
def combine_envs(*envs): """Combine zero or more dictionaries containing environment variables. Environment variables later from dictionaries later in the list take priority over those earlier in the list. For variables ending with ``PATH``, we prepend (and add a colon) rather than overwriting. If you pass in ``None`` in place of a dictionary, it will be ignored. """ result = {} for env in envs: if env: for key, value in env.iteritems(): if key.endswith('PATH') and result.get(key): result[key] = '%s:%s' % (value, result[key]) else: result[key] = value return result
feb6e00b9c0b1262220339feac6c5ac2ae6b6b17
703,585
import torch def generate_square_subsequent_mask(sz): """ Generate attention mask using triu (triangle) attention """ mask = (torch.triu(torch.ones(sz, sz)) == 1).transpose(0, 1) mask = ( mask.float() .masked_fill(mask == 0, float("-inf")) .masked_fill(mask == 1, float(0.0)) ) return mask
5631e89a275eee13c4b01a7b856421f6b45c2588
703,586
def len_column(table): """ Add length column containing the length of the original entry in the seq column. Insert a number column with numbered entries for each row. """ for pos, i in enumerate(table): i.insert(0, pos) i.append(len(i[1])) return table
5a9215bc2feade70873de6adccd2b4c4b6acfed9
703,587
def read_maze(file_name): """ Reads a maze stored in a text file and returns a 2d list containing the maze representation. """ try: with open(file_name) as fh: maze = [[char for char in line.strip("\n")] for line in fh] num_cols_top_row = len(maze[0]) for row in maze: if len(row) != num_cols_top_row: print("The maze is not rectangular.") raise SystemExit return maze except OSError: print("There is a problem with the file you have selected.") raise SystemExit
373e121a9dc827307fc6b56350f8b19247115651
703,588
def sns_certificate(*args): """ Mock requests to retrieve the SNS signing certificate """ with open('tests/files/certificate.pem') as cert_file: cert = cert_file.read() return cert
6d1198c7ea3c29be28dbecf6affe5c31ab51267a
703,589
def translate_delta(mat, dx, dy): """ Return matrix with elements translated by dx and dy, filling the would-be empty spaces with 0. I feel this method may not be the most efficient. """ rows, cols = len(mat), len(mat[0]) # Filter out simple deltas if (dx == 0 and dy == 0): return mat elif (abs(dx) >= rows or abs(dy) >= cols): return [[0 for col in mat[0]] for row in mat] dmat = [] # Create new matrix translated by dx and dy for r in range(rows): drow = [] for c in range(cols): if (r + dy in range(rows) and c - dx in range(cols)): drow.append(mat[r + dy][c - dx]) else: drow.append(0) dmat.append(drow) return dmat
38492c874bc7bbd59787f4b2d94c2ea0150e69f8
703,590
def u2(vector): """ This function calculates the utility for agent 2. :param vector: The reward vector. :return: The utility for agent 2. """ utility = vector[0] * vector[1] return utility
93b9210db00ee9a3ddca4cd9b447a7348f63a659
703,591
def counting_sort_integers(values, max_val=None, min_val=None, inplace=False): """ Sorts an array of integers using counting_sort. Let n = len(values), k = max_val+1 """ if len(values) == 0: return values if inplace else [] #Runs in O(n) time if max_val is None or min_val is None if max_val is None: #If both are None, find max and min simultaneously. if min_val is None: max_val = min_val = values[0] for value in values[1:]: if value > max_val: max_val = value elif value < min_val: min_val = value else: max_val = max(values) elif min_val is None: min_val = min(values) #Assume values are integers in the range 0,1,2,...,max_val #Runs in O(k) time counts = [0 for _ in range(min_val,max_val+1)] #Runs in O(n) time for value in values: counts[value-min_val] += 1 #Overwrite values if inplace==True, otherwise create a new array for output. #Requires O(n) time if inplace is False. output = values if inplace else [0 for _ in range(len(values))] #Simultaneously iterate through output and counts arrays. #value will be the index of counts array - this is the value #we will be storing in the output array. value = min_val #Iterate through output array, storing one value at a time. #The for loop has n iterations. #The inner while loop will have a total of k iterations. #So the runtime for this loop is O(n+k) for i in range(len(output)): #Find the next value with a nonzero count. while counts[value-min_val] == 0: value += 1 #Store the value in the output array and decrease its count. output[i] = value counts[value-min_val] -= 1 #Total runtime, in iterations, is 2k+2n if max_key is passed and inplace==True. #Another n is added if max_key is None or inplace is False, for a maximum #runtime of 2k+4n. return output
d53b00b8753d8adc1782e5941b4b6dcce7c80ca3
703,592
def xfun(p,B,pv0,f): """ Steady state solution for x without CRISPR """ return f/(B*p-p/pv0)
874d7d5a1d0d485aafa6f7298e1d214ca86ea90e
703,593
def pattern_matching(pattern, genome): """Find all occurrences of a pattern in a string. Args: pattern (str): pattern string to search in the genome string. genome (str): search space for pattern. Returns: List, list of int, i.e. all starting positions in genome where pattern appears as a substring. Examples: Find all the starting positions for a pattern string in the genome string. 1. >>> pattern = 'ATAT' >>> genome = 'GATATATGCATATACTT' >>> positions = pattern_matching(pattern, genome) >>> positions [1, 3, 9] 2. >>> pattern = 'CTTGATCAT' >>> genome = 'CTTGATCATCTTGATCATCTTGATCAT' >>> positions = pattern_matching(pattern, genome) >>> positions [0, 9, 18] """ positions = [] # output variable for i in range(len(genome)-len(pattern)+1): if genome[i:i+len(pattern)] == pattern: positions.append(i) return positions
86ae704586fbac937e044f41a8831f2669c4e7dc
703,594
import glob def findLblWithoutImg(pathI, pathII): """ :param pathI: a glob path. example: "D:/大块煤数据/大块煤第三次标注数据/images/*.jpg" :param pathII: a glob path. example: "D:/大块煤数据/大块煤第三次标注数据/labels/*.txt" :return: num of image which not has label """ num = 0 pathI = glob.glob(pathI) pathII = glob.glob(pathII) imgNames = [i.split("\\")[-1].split(".")[0] for i in pathI] lblNames = [i.split("\\")[-1].split(".")[0] for i in pathII] for lbl in lblNames: if lbl not in imgNames: print(lbl) num += 1 return num
30edbff244acb0014b54cf3c85d86a47d779d226
703,595
import math def lcf_float(val1, val2, tolerance): """Finds lowest common floating point factor between two floating point numbers""" i = 1.0 while True: test = float(val1) / i check = float(val2) / test floor_check = math.floor(check) compare = floor_check * test if val2 - compare < (tolerance / 2.0): return test i += 1.0
b4bef1a63984440f43a1b0aa9bf9805cb4bfd466
703,596
def check_num_row(data): """ @param df: dataframe @return: return 1 if checking condition is true """ return data.shape[0] > 10
0761c4d31bc3a14132d6c1547d03149bd10013c5
703,597
def _convert_text_to_logs_format(text: str) -> str: """Convert text into format that is suitable for logs. Arguments: text: text that should be formatted. Returns: Shape for logging in loguru. """ max_log_text_length = 50 start_text_index = 15 end_text_index = 5 return ( "...".join((text[:start_text_index], text[-end_text_index:])) if len(text) > max_log_text_length else text )
4f7ff95a5cd74bdccd41559f58292cc9b1003ba2
703,598
import random def generate_random_slug(length=40, prefix=None): """ This function is used, for example, to create Coupon code mechanically when a customer pays for the subscriptions of an organization which does not yet exist in the database. """ if prefix: length = length - len(prefix) # make sure the slug starts with a letter in case it is used as a resource # name (variable or database). suffix = random.choice("abcdef") suffix += "".join( [random.choice("abcdef0123456789") for val in range(length - 1)] ) # Generated coupon codes # are stored as ``Transaction.event_id`` with # a 'cpn_' prefix. The total event_id must be less # than 50 chars. if prefix: return str(prefix) + suffix return suffix
add5e68d0ed6d3831993410afc5ec7900eb212c4
703,599
def digits_to_num(L, reverse=False): """Returns a number from a list of digits, given by the lowest power of 10 to the highest, or the other way around if `reverse` is True""" digits = reversed(L) if reverse else L n = 0 for i, d in enumerate(digits): n += d * (10 ** i) return n
1648073d46411fd430afea4f40f7fa9f4567793c
703,600
import sys import os def executable(name): """Return the full path to an executable""" suffix = "" folder = "bin" if sys.platform == "win32": suffix = ".exe" folder = os.path.join(folder, "Release") return os.path.join("..", folder, name + suffix)
8fbc4aa30e5ad3aeb126f7c5adbbdd62e68091c2
703,601
def clean_zeros(a, b, M): """ Remove all components with zeros weights in a and b """ M2 = M[a > 0, :][:, b > 0].copy() # copy force c style matrix (froemd) a2 = a[a > 0] b2 = b[b > 0] return a2, b2, M2
3e2def6e88a7ac5a67b9849a9dcd2f5f5156fb00
703,602
import re def get_cheque_code(cheque: str): """Get code""" if ( re.search(r'BTC_CHANGE_BOT\?start=', cheque) or not re.search(r'BTC_CHANGE_BOT\?start=', cheque) and re.search(r'Chatex_bot\?start=', cheque) ): return re.findall(r'c_\S+', cheque)[0] elif re.search(r'Getwallet_bot\?start=', cheque): return re.findall(r'g_\S+', cheque)[0] return cheque
97d0b3cadfb6010b48ed6fb148083060c50720ff
703,603
def parse_problems(lines): """ Given a list of lines, parses them and returns a list of problems. """ return [len(p) for p in lines]
83747e57bddf24484633e38ce27c51c7c8fce971
703,605
import urllib3 import certifi def load_content(site, host, links): """Tests a site.""" # Security: Verified HTTPS with SSL/TLS http = urllib3.PoolManager( cert_reqs='CERT_REQUIRED', # Force certificate check. ca_certs=certifi.where(), # Path to the Certifi bundle. ) start_page_search = """https://startpage.com/do/search ?cmd=process_search&language=english&enginecount=1&pl=&abp= 1&cdm=&tss=1&ff=&theme=&prf=464341bcfbcf47b736ff43307aef287a &suggestOn=1&flag_ac=0&lui=english&cat=web&query=""" start_page_search = start_page_search.replace('\n', '') start_page_search = start_page_search.replace(' ', '') if host: start_page_search = start_page_search + "host%3A"+host+"+" start_page_search = start_page_search+"link%3A"+site if not links: start_page_search = start_page_search.replace("link%3A", "") response = http.request('GET', start_page_search) return response
5a599579133297c2e6ab3231b466f1b6184d22cc
703,606
def get_types_dict(): """ :return: type name read in as string to type method mapping """ return {"str": str, "float": float, "int": int}
7a386fa63cba73e35672b15c31bc8b2c59361f24
703,607
def create_class_hierarchy_dict(cls): """Returns the dictionary with all members of the class ``cls`` and its superclasses.""" dict_extension_order = cls.__mro__[-2::-1] # Reversed __mro__ without the 'object' class attrs_dict = {} for base_class in dict_extension_order: attrs_dict.update(vars(base_class)) return attrs_dict
0378fb3243a48964fcec42fddb38c0664a338ee4
703,608
from datetime import datetime def month_to_date(month): """ Convert month to date format. Keyword arguments: month -- the month to convert to date format """ month = datetime.strptime(month, '%Y-%m') date = month.strftime('%Y-%m-%d') # eg 2018-02-01 date = datetime.strptime(date, '%Y-%m-%d') # return datetime object return date
e417eefa63430e422a53bd194fbb1e0d5e453c7b
703,609
def encode(string): """Encode some critical characters to html entities.""" return string.replace('&', '&amp;') \ .replace('<', '&lt;') \ .replace('>', '&gt;') \ .replace(' ', '&nbsp;&nbsp;') \ .replace('\n', '<br>') if string else ''
faea4b2f2e032b5e05e2c99bc56a1cf35e60b85d
703,610
def rem(x, a): """ x: a non-negative integer argument a: a positive integer argument returns: integer, the remainder when x is divided by a. """ if x == a: return 0 elif x < a: return x else: return rem(x-a, a)
22b421c090970810f9aa4d55ff5a700e1301c0b8
703,611
import platform import subprocess import re import os def get_env_prefix(): """ Automatically identify os_type information which use for install path of bash_completion.d """ TARGET_BIN_PATH = '/usr/local/bin/' os_type = platform.system() cygwin = r'CYGWIN|cygwin' if os_type == "Linux": TARGET_COMPLETION_PATH = "/etc/bash_completion.d/" # Darwin is indicate Mac OS elif os_type == "Darwin": proc = subprocess.Popen( 'brew --prefix', shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE) stdout, stderr = proc.communicate() brew_prefix = "{0}/etc/bash_completion.d/".format( stdout.rstrip().decode("utf-8")) TARGET_COMPLETION_PATH = brew_prefix # Return true if CYGWIN or cygwin there in os type string elif re.search(cygwin, os_type): TARGET_COMPLETION_PATH = '/etc/bash_completion.d/' TARGET_BIN_PATH = '/usr/bin/' if not os.path.exists(TARGET_COMPLETION_PATH): os.makedirs(TARGET_COMPLETION_PATH) else: raise ValueError( 'Unknown OS type found. This Operating System is not supported.') return TARGET_COMPLETION_PATH, TARGET_BIN_PATH
fd290446484ae0f0392aaf4c34dc2feef0aa3553
703,612
import subprocess def check_output(args): """ Delegates to subprocess.check_output() if it is available, otherwise provides a reasonable facsimile. """ if 'check_output' in dir(subprocess): out = subprocess.check_output(args) else: proc = subprocess.Popen(args, stdout=subprocess.PIPE) out, err = proc.communicate() ret = proc.poll() if ret: raise subprocess.CalledProcessError(ret, args[0], output=out) if type(out) is bytes: """ git isn't guaranteed to always return UTF-8, but for our purposes this should be fine as tags and hashes should be ASCII only. """ out = out.decode('utf-8') return out
bbe456c8b3d2e8f1acd0f32478828ce44af7842f
703,613
def demo7(response): """在每次请求后运行""" # eg:修改响应头 print(response) print('=========== after func run =============') # response.headers['Content-Type'] = 'application/json;charset=utf-8;' return response
86991057bb48f1da33b3417387009d98744d2d94
703,614
def identity(value): """ Node returning the input value. """ return value
e1af1346b11bc36a4426ad3c557dc01045657de8
703,616
import re def parse_members_for_workspace(toml_path): """Parse members from Cargo.toml of the worksapce""" with open(toml_path, mode='rb') as f: data = f.read() manifest = data.decode('utf8') regex = re.compile(r"^members\s*=\s*\[(.*?)\]", re.S | re.M) members_block = regex.findall(manifest)[0] out = [] members = members_block.split('\n') regex2 = re.compile(r'\s*"(.*?)".*') for mem in members: if (len(mem.strip()) == 0) or re.match(r".*#\signore", mem): continue out.append(regex2.findall(mem)[0]) return out
63926ac1eaadc360e2407f2fff5f41b7667e52b4
703,618
import torch def steering(taus, n_fft): """ This function computes a steering vector by using the time differences of arrival for each channel (in samples) and the number of bins (n_fft). The result has the following format: (batch, time_step, n_fft/2 + 1, 2, n_mics). Arguments: ---------- taus : tensor The time differences of arrival for each channel. The tensor must have the following format: (batch, time_steps, n_mics). n_fft : int The number of bins resulting of the STFT. It is assumed that the argument "onesided" was set to True for the STFT. Example: --------f >>> import torch >>> from speechbrain.dataio.dataio import read_audio >>> from speechbrain.processing.features import STFT >>> from speechbrain.processing.multi_mic import Covariance >>> from speechbrain.processing.multi_mic import GccPhat, tdoas2taus, steering >>> >>> xs_speech = read_audio( ... 'samples/audio_samples/multi_mic/speech_-0.82918_0.55279_-0.082918.flac' ... ) >>> xs_noise = read_audio('samples/audio_samples/multi_mic/noise_diffuse.flac') >>> xs = xs_speech + 0.05 * xs_noise >>> xs = xs.unsqueeze(0) # [batch, time, channels] >>> fs = 16000 >>> stft = STFT(sample_rate=fs) >>> cov = Covariance() >>> gccphat = GccPhat() >>> >>> Xs = stft(xs) >>> n_fft = Xs.shape[2] >>> XXs = cov(Xs) >>> tdoas = gccphat(XXs) >>> taus = tdoas2taus(tdoas) >>> As = steering(taus, n_fft) """ # Collecting useful numbers pi = 3.141592653589793 frame_size = int((n_fft - 1) * 2) # Computing the different parts of the steering vector omegas = 2 * pi * torch.arange(0, n_fft, device=taus.device) / frame_size omegas = omegas.repeat(taus.shape + (1,)) taus = taus.unsqueeze(len(taus.shape)).repeat( (1,) * len(taus.shape) + (n_fft,) ) # Assembling the steering vector a_re = torch.cos(-omegas * taus) a_im = torch.sin(-omegas * taus) a = torch.stack((a_re, a_im), len(a_re.shape)) a = a.transpose(len(a.shape) - 3, len(a.shape) - 1).transpose( len(a.shape) - 3, len(a.shape) - 2 ) return a
c33264516e6903d22533c9f23585739438aa5d75
703,619
def decodeXMLName(name): """ Decodes an XML (namespace, localname) pair from an ASCII string as encoded by encodeXMLName(). """ if name[0] is not "{": return (None, name.decode("utf-8")) index = name.find("}") if (index is -1 or not len(name) > index): raise ValueError("Invalid encoded name: %r" % (name,)) return (name[1:index].decode("utf-8"), name[index+1:].decode("utf-8"))
28a81aed2477b444ac061b21ca838912ee2bf24b
703,620
import argparse def parse_args() -> argparse.Namespace: """Parse user command line arguments.""" parser = argparse.ArgumentParser( prog="ssacc", description="Map SSA County Codes to ZIP Codes.", formatter_class=argparse.ArgumentDefaultsHelpFormatter, ) parser.add_argument( "-r", type=int, required=False, default=0, help="Regenerate the ZIP to FIPS county code CSV, if -r 1.", ) return parser.parse_args()
0ea9ec39d22c2908e9b72452b5553ca62ab02aa7
703,622
from typing import Dict from typing import Any from typing import List import copy def move_to_location( object_instance: Dict[str, Any], location: Dict[str, Any], object_bounds: List[Dict[str, float]], previous_object: Dict[str, Any] ) -> Dict[str, Any]: """Move the given object to a new location and return the object.""" new_location = copy.deepcopy(location) if previous_object and 'offset' in previous_object: new_location['position']['x'] += previous_object['offset']['x'] new_location['position']['z'] += previous_object['offset']['z'] if 'offset' in object_instance: new_location['position']['x'] -= object_instance['offset']['x'] new_location['position']['z'] -= object_instance['offset']['z'] object_instance['shows'][0]['position'] = new_location['position'] object_instance['shows'][0]['rotation'] = new_location['rotation'] object_instance['shows'][0]['boundingBox'] = object_bounds return object_instance
079f7367d04d732a93aa2ac18a1255a061e00243
703,623
import optparse def parse_args(): """ Parse command line options into variables """ parser = optparse.OptionParser(usage="Usage: %prog [options]") parser.add_option("--film-urls", type="string", dest="urls", help=("Film URLs to pick from, separated by commas") ) parser.add_option("--film-urls-file-path", type="string", dest="filepath", help=("File that contains film URLs to pick from") ) parser.add_option("--optimize-for", type="choice", dest="optimize_for", choices=["day", "evening"], default="evening", help=("Option for optimizing for day or evening times") ) (options, args) = parser.parse_args() return options
e618915c8c6a6211e208b3bca662ad951c46a507
703,626
def plural(items_or_count, singular: str, count_format='', these: bool = False, number: bool = True, are: bool = False) -> str: """Returns the singular or plural form of a word based on a count.""" try: count = len(items_or_count) except TypeError: count = items_or_count prefix = ('this ' if count == 1 else 'these ') if these else '' num = f'{count:{count_format}} ' if number else '' suffix = (' is' if count == 1 else ' are') if are else '' if singular.endswith('y'): result = f'{singular[:-1]}{"y" if count == 1 else "ies"}' elif singular.endswith('s'): result = f'{singular}{"" if count == 1 else "es"}' else: result = f'{singular}{"" if count == 1 else "s"}' return f'{prefix}{num}{result}{suffix}'
01f397579b60538f25710566507973bdc6422874
703,627
import sqlite3 def db_setup(db_name): """Database setup.""" cxn = sqlite3.connect(db_name, timeout=30.0) cxn.execute('PRAGMA page_size = {}'.format(2 ** 16)) cxn.execute("PRAGMA journal_mode = WAL") return cxn
55092a98aed1e0a42ebf004a116913cfbecfb5f9
703,628
def role_object_factory(role_name='role.test_role'): """Cook up a fake role.""" role = { 'nameI18n': role_name[:32], 'active': 1 } return role
e79e7b22a83d9da721b074d32878eabeca4054cd
703,629
import itertools def create_possible_expected_messages(message_template, expected_types): """ Some error messages contain dictionaries with error types. Dictionaries in Python are unordered so it makes testing unpredictable. This function takes in a message template and a list of types and returns a list that contains error messages for every permutation of the types. Args: message_template (str): A string with a single format argument ({}). expected_types (list): A list of types. Ex: [str, int] Returns: list: A list of the given error message formatted with all permutations of the given type list. """ # Create an iterable of all the permutations of the types. # Can roughly be thought of as a list of tuples type_premutations = itertools.permutations(expected_types) # For each permutation, map each type in the permutation to a string # and remove '<' and '>' since this is how our exceptions format them. formatted_string_types = [ map(lambda s: str(s).replace('<', '').replace('>', ''), t) for t in type_premutations ] # Finally, create an error message with each permutation. return [ message_template.format(', '.join(f)) for f in formatted_string_types ]
674dec990e0786d3e313a9b8deec72e37588d8eb
703,630
def load_saved_recipes(filename): """ Internal method for reading contens of given file. """ contents = [] try: # Read file line by line, recipe by recipe with open(filename, 'r') as recipes_file: contents = recipes_file.readlines() return contents except Exception: print('Problem reading recipes from file.')
60cf9ace8cd3cbcc40aae6fa5c1d2def50bf95b9
703,631
def GetNetworkConfig(has_external_ip, network): """Helper method to create a network config.""" network_interfaces = { 'network': network } if has_external_ip: network_interfaces['accessConfigs'] = [{ 'name': 'external-nat', 'type': 'ONE_TO_ONE_NAT' }] return network_interfaces
c0ee213c5c289fb2f6eb4b34fc18028233a1d162
703,633
from operator import inv def zeros(a): """ Return the number of cleared bits in the sequence. >>> assert zeros([0, 0]) == 2 >>> assert zeros([0, 1]) == 1 >>> assert zeros([1, 0]) == 1 >>> assert zeros([1, 1]) == 0 >>> assert zeros([1, 1, 1, 0, 1]) == 1 >>> assert zeros([0, 1, 0, 0, 0]) == 4 """ return sum(inv(a))
76f041390dfe43bcc583e39fc7a3e3d761f87c25
703,634
def escape_special_char(string): """ Is called on all paths to remove all special characters but it's not good. Should be moved in core Should be called only in get_wrapper_path and unescape_special_char in get_entry and in script += 'menu_click... in menu_click as it's already done should replace -> by _> """ for r in (("\\", "\\\\"), ("\t", "\\t"), ("\n", "\\n"), ("\r", "\\r"), ("\v", "\\v"), ("\f", "\\f"), ('"', '\\"')): string = string.replace(*r) return string
cb3d4bd0d7370ec9c3d76543db8e3aafaf1bd8e8
703,635
from pathlib import Path def fp_search_rglob(spt_root="../", st_rglob='*.py', ls_srt_subfolders=None, verbose=False, ): """Searches for files with search string in a list of folders Parameters ---------- spt_root : string root folder to search in st_rglob : string search for files with this rglob string ls_srt_subfolders : :obj:`list` of :obj:`str` a list of subfolders of the spt_root to search in verbose: bool print details Returns ------- :obj:`list` of :obj:`str` A list of file names Examples -------- >>> ls_spn = fp_search_rglob(spt_root="../", >>> ls_srt_subfolders=['rmd', 'pdf'], >>> st_rglob = '*d*.py') [WindowsPath('../rmd/bookdownparse.py'), WindowsPath('../rmd/mattexmd.py'), WindowsPath('../rmd/rmdparse.py'), WindowsPath('../pdf/pdfgen.py')] """ # Directories to search in if ls_srt_subfolders is None: # ls_srt_subfolders = ['calconevar/', 'derivative/', 'derivative_application/', # 'matrix_basics/', # 'opti_firm_constrained/', 'opti_hh_constrained_brsv/', # 'opti_hh_constrained_brsv_inequality/'] # ls_srt_subfolders = ['matrix_basics/'] ls_spt = [spt_root] else: ls_spt = [spt_root + srt_subf for srt_subf in ls_srt_subfolders] if verbose: print(ls_spt) # get file names ls_spn_found_tex = [spn_file for spt_srh in ls_spt for spn_file in Path(spt_srh).rglob(st_rglob)] if verbose: print(ls_spn_found_tex) return ls_spn_found_tex
e8fe03f9549ae77147ec96263411db9273d2c4cb
703,636
def get_minimum(feature): """Get minimum of either a single Feature or Feature group.""" if hasattr(feature, "location"): return feature.location.min() return min(f.location.min() for f in feature)
aec98f5bc065c6a97d32bc9106d67579f76f7751
703,637
def isUniqueSFW(str): """ Given a string, checks if the string has unique charachters Note that this solution is inefficient as it takes O(n^2) """ l = len(str) for i in range(l): for j in range(l): if i != j and not ord(str[i]) ^ ord(str[j]): return False return True
369eddfc360a2661e063183a30c9d511a5deb3de
703,638
def get_3x3_homothety(x,y,z): """return a homothety 3x3 matrix""" a= [x,0,0] b= [0,y,0] c= [0,0,z] return [a,b,c]
5c6c2d8931334cc13297e787a079499753c1976c
703,639
def scrape_to_list_value(scraped_rows, i, list_name): """insert row of rows of scraped data input i for skipping rows return value in dollars""" to_scrape = scraped_rows[i::7] list_name = [] for i in range(len(to_scrape)): num = float(to_scrape[i][0].replace(',', '.')) num_dollar = round((num * 1.14), 2) list_name.append(num_dollar) return list_name
62117d0d78a4fd691baa4163a19962c2fb1443d3
703,640
def get_nodes_from_vpc_id(vpc_id): """ calculate node-ids from vpc_id. If not a vpc_id, then single node returned """ try: vpc_id = int(vpc_id) except ValueError as e: return ["%s" % vpc_id ] if vpc_id > 0xffff: n1 = (0xffff0000 & vpc_id) >> 16 n2 = (0x0000ffff & vpc_id) return ["%s" % n1, "%s" % n2] return ["%s" % vpc_id]
5c3a6506a721f9d518579df39a91ec38118d5e75
703,641
def ex_verb_voice(sent, ex_set, be_outside_ex=True): """ Finds verb voice feature. 1. One of the tokens in the set must be partisip - VBG 2. One of the tokens in the set must be lemma 'be' 3. VBN's head has lemma 'be' If none of the tokens is verb, returns string 'None' @param sent List of tokens in sentence. @param ex_set set of nums in expression @return string Active, Passive or None """ criteria_1 = False criteria_2 = False criteria_3 = False verb_exists = False _slice = [] for num in ex_set: _slice.append(num-1) if sent[num-1]['pos'] == 'VBN': criteria_1 = True if sent[int(sent[num-1]['head'])-1]['lemma'] == 'be': criteria_3 = True if sent[num-1]['lemma'] == 'be': criteria_2 = True if sent[num-1]['pos'][0] == 'V': verb_exists = True if criteria_1 and criteria_2 and criteria_3: return 'Passive' elif criteria_1 and criteria_3 and be_outside_ex: _slice.sort() return 'Passive' elif verb_exists: return 'Active' else: return 'None'
8891a792528af0c44865e4bbc63f269a85df4da9
703,642
def get_player_actions(game, player): """ Returns player's actions for a game. :param game: game.models.Game :param player: string :rtype: set """ qs = game.action_set.filter(player=player) return set(list(qs.values_list('box', flat=True)))
9b961afbee7c3a0e8f44e78c269f37a9b6613488
703,643
def create_lkas_ui(packer, main_on, enabled, steer_alert): """Creates a CAN message for the Ford Steer Ui.""" if not main_on: lines = 0xf elif enabled: lines = 0x3 else: lines = 0x6 values = { "Set_Me_X80": 0x80, "Set_Me_X45": 0x45, "Set_Me_X30": 0x30, "Lines_Hud": lines, "Hands_Warning_W_Chime": steer_alert, } return packer.make_can_msg("Lane_Keep_Assist_Ui", 0, values)
16c226698160b14194daf63baf61bb3952e1cd59
703,644
import torch def get_pytorch_device() -> torch.device: """Checks if a CUDA enabled GPU is available, and returns the approriate device, either CPU or GPU. Returns ------- device : torch.device """ device = torch.device("cpu") if torch.cuda.is_available(): device = torch.device("cuda:0") return device
0109f3146c96bec08bbe6fa62e5a8bc5638e461c
703,645
import time import random def creat_order_num(user_id): """ 生成订单号 :param user_id: 用户id :return: 订单号 """ time_stamp = int(round(time.time() * 1000)) randomnum = '%04d' % random.randint(0, 100000) order_num = str(time_stamp) + str(randomnum) + str(user_id) return order_num
339764f7dc943c46d959a9bfdc6c48dc9ecd6bef
703,646
def get_rst_title_char(level): """Return character used for the given title level in rst files. :param level: Level of the title. :type: int :returns: Character used for the given title level in rst files. :rtype: str """ chars = (u'=', u'-', u'`', u"'", u'.', u'~', u'*', u'+', u'^') if level < len(chars): return chars[level] return chars[-1]
b646b9e0010d87ece7f5c8c53c8abf89ca557a21
703,647
import os def toPath(prefix, metric): """Translate the metric key name in metric to its OS path location rooted under prefix.""" m = metric.replace(".", "/") + ".wsp" return os.path.join(prefix, m)
161ea82432c9e6a5e23ab9305133156ba35755f3
703,648
def get_sample_ids(fams): """ create a ditionary mapping family ID to sample, to subID Returns: e.g {'10000': {'p': 'p1', 's': 's1'}, ...} """ sample_ids = {} for i, row in fams.iterrows(): ids = set() for col in ['CSHL', 'UW', 'YALE']: col = 'SequencedAt' + col if type(row[col]) == float: continue ids |= set(row[col].split(',')) # we want to refer to the individuals by 'p' or 's' for proband or # sibling, since that is how they are represented in the de novo table sample_ids[str(row.familyId)] = dict( (x[0], x) for x in ids ) return sample_ids
443e63b486a1bdb8a64595beda30f75468af7560
703,649
def calcbw(K, N, srate): """Calculate the bandwidth given K.""" return float(K + 1) * srate / N
13e99bcb729352feb66a34aac66e12b1c5e158ef
703,651
def format_sqlexec(result_rows, maxlen): """ Format rows of a SQL query as a discord message, adhering to a maximum length. If the message needs to be truncated, a (truncated) note will be added. """ codeblock = "\n".join(str(row) for row in result_rows) message = f"```\n{codeblock}```" if len(message) < maxlen: return message else: note = "(truncated)" return f"```\n{codeblock[:maxlen - len(note)]}```{note}"
3b98590c72245241ba488e07fdfdd20acae441cf
703,652
import re def regex_sub_groups_global(pattern, repl, string): """ Globally replace all groups inside pattern with `repl`. If `pattern` doesn't have groups the whole match is replaced. """ for search in reversed(list(re.finditer(pattern, string))): for i in range(len(search.groups()), 0 if search.groups() else -1, -1): start, end = search.span(i) string = string[:start] + repl + string[end:] return string
67e909778d9565d498fc3e7b3c9522378e971846
703,653
def _parse( filepath : str ) -> list: """ [summary] Arguments: filepath {str} -- [description] Returns: list -- [description] """ with open( filepath, 'r' ) as f: raw_data = f.read( ) # not readlines( ), as this needs to be one long string data = list( map( int, raw_data.split( ) ) ) return data
6814c4f45aee453f6387761ee7c4f3e64c669b1c
703,654
def stations_level_over_threshold(stations, tol): """Returns a list of the tuples, each containing the name of a station at which the relative water level is above tol and the relative water level at that station""" output = [] for station in stations: relative_level = station.relative_water_level() # the following raises an exception if relative_level is None try: if relative_level > tol: output.append((station, relative_level)) except: pass # sort list by second value in descending order output.sort(key=lambda x: x[1], reverse=True) return output
87be1329ea8b7e58796ebfe33a6f9e9503777227
703,655
def deregister_device(device): """ Task that deregisters a device. :param device: device to be deregistered. :return: response from SNS """ return device.deregister()
44bec0e3ac356f150a0c4a6a0632939a20caafb0
703,656