content
stringlengths 7
1.05M
| fixed_cases
stringlengths 1
1.28M
|
|---|---|
#Fibonacci
Fibonacci.py
# Fibonacci numbers module
#n = int(input('Please enter a number: '))
def fib(n):
a, b = 0, 1
while a < n:
print(a, end=' ')
a, b = b, a+b
print()
# Go to fibonacci Powerpoint
def fib2(n): # return Fibonacci series
result = []
a, b = 0, 1
while a < n:
result.append(a)
a, b = b, a+b
return result
#>>> fib #import
|
Fibonacci.py
def fib(n):
(a, b) = (0, 1)
while a < n:
print(a, end=' ')
(a, b) = (b, a + b)
print()
def fib2(n):
result = []
(a, b) = (0, 1)
while a < n:
result.append(a)
(a, b) = (b, a + b)
return result
|
#Parameters given at the beginning of the APP
zid_min = 1E06 #1Mohm
zic_min = 10E06 #10Mohm
GM_min = 10 #dB
PM_min = 30 #deg
CL_min = 0 #0uF
CL_max = 1E-06 #1uF
Rl = 10 #10ohm
Fc_low = 0 #DC
Fc_high = 100E03 #100kHz
CMRR_min = 100 #dB
AvCL = 10 #V/V
THD = 0.01 #env. 1% 10kHz & Vout = 10Vcrete
Dyn_range = 10 # V crete
CM_min = -2 # V
CM_max = 2 # V
|
zid_min = 1000000.0
zic_min = 10000000.0
gm_min = 10
pm_min = 30
cl_min = 0
cl_max = 1e-06
rl = 10
fc_low = 0
fc_high = 100000.0
cmrr_min = 100
av_cl = 10
thd = 0.01
dyn_range = 10
cm_min = -2
cm_max = 2
|
#
# PySNMP MIB module IPFIX-SELECTOR-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/IPFIX-SELECTOR-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 19:44:48 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
OctetString, Integer, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "OctetString", "Integer", "ObjectIdentifier")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, SingleValueConstraint, ValueRangeConstraint, ConstraintsUnion, ConstraintsIntersection = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "SingleValueConstraint", "ValueRangeConstraint", "ConstraintsUnion", "ConstraintsIntersection")
ModuleCompliance, NotificationGroup, ObjectGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup", "ObjectGroup")
ObjectIdentity, TimeTicks, MibScalar, MibTable, MibTableRow, MibTableColumn, Unsigned32, Bits, ModuleIdentity, Counter64, Gauge32, MibIdentifier, Integer32, IpAddress, mib_2, Counter32, iso, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "ObjectIdentity", "TimeTicks", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Unsigned32", "Bits", "ModuleIdentity", "Counter64", "Gauge32", "MibIdentifier", "Integer32", "IpAddress", "mib-2", "Counter32", "iso", "NotificationType")
TextualConvention, TruthValue, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "TruthValue", "DisplayString")
ipfixSelectorMIB = ModuleIdentity((1, 3, 6, 1, 2, 1, 194))
ipfixSelectorMIB.setRevisions(('2012-06-11 00:00', '2010-03-15 00:00',))
if mibBuilder.loadTexts: ipfixSelectorMIB.setLastUpdated('201206110000Z')
if mibBuilder.loadTexts: ipfixSelectorMIB.setOrganization('IETF IPFIX Working Group')
ipfixSelectorObjects = MibIdentifier((1, 3, 6, 1, 2, 1, 194, 1))
ipfixSelectorConformance = MibIdentifier((1, 3, 6, 1, 2, 1, 194, 2))
ipfixSelectorFunctions = MibIdentifier((1, 3, 6, 1, 2, 1, 194, 1, 1))
ipfixFuncSelectAll = MibIdentifier((1, 3, 6, 1, 2, 1, 194, 1, 1, 1))
ipfixFuncSelectAllAvail = MibScalar((1, 3, 6, 1, 2, 1, 194, 1, 1, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ipfixFuncSelectAllAvail.setStatus('current')
ipfixSelectorCompliances = MibIdentifier((1, 3, 6, 1, 2, 1, 194, 2, 1))
ipfixSelectorGroups = MibIdentifier((1, 3, 6, 1, 2, 1, 194, 2, 2))
ipfixSelectorBasicCompliance = ModuleCompliance((1, 3, 6, 1, 2, 1, 194, 2, 1, 1)).setObjects(("IPFIX-SELECTOR-MIB", "ipfixSelectorBasicGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ipfixSelectorBasicCompliance = ipfixSelectorBasicCompliance.setStatus('current')
ipfixSelectorBasicGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 194, 2, 2, 1)).setObjects(("IPFIX-SELECTOR-MIB", "ipfixFuncSelectAllAvail"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ipfixSelectorBasicGroup = ipfixSelectorBasicGroup.setStatus('current')
mibBuilder.exportSymbols("IPFIX-SELECTOR-MIB", ipfixFuncSelectAllAvail=ipfixFuncSelectAllAvail, ipfixSelectorBasicCompliance=ipfixSelectorBasicCompliance, ipfixSelectorGroups=ipfixSelectorGroups, ipfixSelectorConformance=ipfixSelectorConformance, PYSNMP_MODULE_ID=ipfixSelectorMIB, ipfixSelectorObjects=ipfixSelectorObjects, ipfixFuncSelectAll=ipfixFuncSelectAll, ipfixSelectorCompliances=ipfixSelectorCompliances, ipfixSelectorMIB=ipfixSelectorMIB, ipfixSelectorBasicGroup=ipfixSelectorBasicGroup, ipfixSelectorFunctions=ipfixSelectorFunctions)
|
(octet_string, integer, object_identifier) = mibBuilder.importSymbols('ASN1', 'OctetString', 'Integer', 'ObjectIdentifier')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, single_value_constraint, value_range_constraint, constraints_union, constraints_intersection) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'SingleValueConstraint', 'ValueRangeConstraint', 'ConstraintsUnion', 'ConstraintsIntersection')
(module_compliance, notification_group, object_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup', 'ObjectGroup')
(object_identity, time_ticks, mib_scalar, mib_table, mib_table_row, mib_table_column, unsigned32, bits, module_identity, counter64, gauge32, mib_identifier, integer32, ip_address, mib_2, counter32, iso, notification_type) = mibBuilder.importSymbols('SNMPv2-SMI', 'ObjectIdentity', 'TimeTicks', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Unsigned32', 'Bits', 'ModuleIdentity', 'Counter64', 'Gauge32', 'MibIdentifier', 'Integer32', 'IpAddress', 'mib-2', 'Counter32', 'iso', 'NotificationType')
(textual_convention, truth_value, display_string) = mibBuilder.importSymbols('SNMPv2-TC', 'TextualConvention', 'TruthValue', 'DisplayString')
ipfix_selector_mib = module_identity((1, 3, 6, 1, 2, 1, 194))
ipfixSelectorMIB.setRevisions(('2012-06-11 00:00', '2010-03-15 00:00'))
if mibBuilder.loadTexts:
ipfixSelectorMIB.setLastUpdated('201206110000Z')
if mibBuilder.loadTexts:
ipfixSelectorMIB.setOrganization('IETF IPFIX Working Group')
ipfix_selector_objects = mib_identifier((1, 3, 6, 1, 2, 1, 194, 1))
ipfix_selector_conformance = mib_identifier((1, 3, 6, 1, 2, 1, 194, 2))
ipfix_selector_functions = mib_identifier((1, 3, 6, 1, 2, 1, 194, 1, 1))
ipfix_func_select_all = mib_identifier((1, 3, 6, 1, 2, 1, 194, 1, 1, 1))
ipfix_func_select_all_avail = mib_scalar((1, 3, 6, 1, 2, 1, 194, 1, 1, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ipfixFuncSelectAllAvail.setStatus('current')
ipfix_selector_compliances = mib_identifier((1, 3, 6, 1, 2, 1, 194, 2, 1))
ipfix_selector_groups = mib_identifier((1, 3, 6, 1, 2, 1, 194, 2, 2))
ipfix_selector_basic_compliance = module_compliance((1, 3, 6, 1, 2, 1, 194, 2, 1, 1)).setObjects(('IPFIX-SELECTOR-MIB', 'ipfixSelectorBasicGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ipfix_selector_basic_compliance = ipfixSelectorBasicCompliance.setStatus('current')
ipfix_selector_basic_group = object_group((1, 3, 6, 1, 2, 1, 194, 2, 2, 1)).setObjects(('IPFIX-SELECTOR-MIB', 'ipfixFuncSelectAllAvail'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ipfix_selector_basic_group = ipfixSelectorBasicGroup.setStatus('current')
mibBuilder.exportSymbols('IPFIX-SELECTOR-MIB', ipfixFuncSelectAllAvail=ipfixFuncSelectAllAvail, ipfixSelectorBasicCompliance=ipfixSelectorBasicCompliance, ipfixSelectorGroups=ipfixSelectorGroups, ipfixSelectorConformance=ipfixSelectorConformance, PYSNMP_MODULE_ID=ipfixSelectorMIB, ipfixSelectorObjects=ipfixSelectorObjects, ipfixFuncSelectAll=ipfixFuncSelectAll, ipfixSelectorCompliances=ipfixSelectorCompliances, ipfixSelectorMIB=ipfixSelectorMIB, ipfixSelectorBasicGroup=ipfixSelectorBasicGroup, ipfixSelectorFunctions=ipfixSelectorFunctions)
|
grid_view_field_options_schema = {
'type': 'object',
'description': 'An object containing the field id as key and the '
'properties related to view as value.',
'properties': {
'1': {
'type': 'object',
'description': 'Properties of field with id 1 of the related view.',
'properties': {
'width': {
'type': 'integer',
'example': 200,
'description': 'The width of the table field in the related view.'
},
'hidden': {
'type': 'boolean',
'example': True,
'description': 'Whether or not the field should be hidden in the '
'current view.'
}
}
},
}
}
|
grid_view_field_options_schema = {'type': 'object', 'description': 'An object containing the field id as key and the properties related to view as value.', 'properties': {'1': {'type': 'object', 'description': 'Properties of field with id 1 of the related view.', 'properties': {'width': {'type': 'integer', 'example': 200, 'description': 'The width of the table field in the related view.'}, 'hidden': {'type': 'boolean', 'example': True, 'description': 'Whether or not the field should be hidden in the current view.'}}}}}
|
#!/usr/bin/env python3
# vim: set ai et ts=4 sw=4:
def gen(arg, begin, pixels, arr):
for i in range(0, int(2**len(arr))):
if i > 0:
print("else");
if i != int(2**len(arr)) - 1:
print("if({} < ({} + ({}/{})*{}))".format(
arg, begin, pixels, int(2**len(arr)), i+1))
print("begin")
for j in range(0, len(arr)):
print((" " * 4) + "{} <= {};".format(
arr[j], "1" if i & (1 << j) else "0"))
print("end")
gen("hctr", "horiz_vis_begin", "horiz_active_pixels",
["r[0]", "r[1]", "r[2]", "g[0]"])
gen("vctr", "vert_vis_begin", "vert_active_pixels",
["g[1]", "g[2]", "b[0]", "b[1]"])
|
def gen(arg, begin, pixels, arr):
for i in range(0, int(2 ** len(arr))):
if i > 0:
print('else')
if i != int(2 ** len(arr)) - 1:
print('if({} < ({} + ({}/{})*{}))'.format(arg, begin, pixels, int(2 ** len(arr)), i + 1))
print('begin')
for j in range(0, len(arr)):
print(' ' * 4 + '{} <= {};'.format(arr[j], '1' if i & 1 << j else '0'))
print('end')
gen('hctr', 'horiz_vis_begin', 'horiz_active_pixels', ['r[0]', 'r[1]', 'r[2]', 'g[0]'])
gen('vctr', 'vert_vis_begin', 'vert_active_pixels', ['g[1]', 'g[2]', 'b[0]', 'b[1]'])
|
# Time: O(m * nlogn)
# Space: O(n)
class Solution(object):
def longestCommonSubpath(self, n, paths):
"""
:type n: int
:type paths: List[List[int]]
:rtype: int
"""
def RabinKarp(arr, x): # double hashing
hashes = tuple([reduce(lambda h,x: (h*p+x)%MOD, (arr[i] for i in xrange(x)), 0) for p in P])
powers = [pow(p, x, MOD) for p in P]
lookup = {hashes}
for i in xrange(x, len(arr)):
hashes = tuple([(hashes[j]*P[j] - arr[i-x]*powers[j] + arr[i])%MOD for j in xrange(len(P))]) # in smaller datasets, tuple from list is much faster than tuple from generator, see https://stackoverflow.com/questions/16940293/why-is-there-no-tuple-comprehension-in-python
lookup.add(hashes)
return lookup
def check(paths, x):
intersect = RabinKarp(paths[0], x)
for i in xrange(1, len(paths)):
intersect = set.intersection(intersect, RabinKarp(paths[i], x))
if not intersect:
return False
return True
MOD, P = 10**9+7, (113, 109) # MOD could be the min prime of 7-digit number (10**6+3), P could be (2, 3)
left, right = 1, min(len(p) for p in paths)
while left <= right:
mid = left + (right-left)//2
if not check(paths, mid):
right = mid-1
else:
left = mid+1
return right
# Time: O(m * nlogn)
# Space: O(n)
class Solution2(object):
def longestCommonSubpath(self, n, paths):
"""
:type n: int
:type paths: List[List[int]]
:rtype: int
"""
def RabinKarp(arr, x):
h = reduce(lambda h,x: (h*P+x)%MOD, (arr[i] for i in xrange(x)), 0)
power = pow(P, x, MOD)
lookup = {h}
for i in xrange(x, len(arr)):
h = (h*P - arr[i-x]*power + arr[i])%MOD
lookup.add(h)
return lookup
def check(paths, x):
intersect = RabinKarp(paths[0], x)
for i in xrange(1, len(paths)):
intersect = set.intersection(intersect, RabinKarp(paths[i], x))
if not intersect:
return False
return True
MOD, P = 10**11+19, max(x for p in paths for x in p)+1 # MOD is the min prime of 12-digit number
left, right = 1, min(len(p) for p in paths)
while left <= right:
mid = left + (right-left)//2
if not check(paths, mid):
right = mid-1
else:
left = mid+1
return right
|
class Solution(object):
def longest_common_subpath(self, n, paths):
"""
:type n: int
:type paths: List[List[int]]
:rtype: int
"""
def rabin_karp(arr, x):
hashes = tuple([reduce(lambda h, x: (h * p + x) % MOD, (arr[i] for i in xrange(x)), 0) for p in P])
powers = [pow(p, x, MOD) for p in P]
lookup = {hashes}
for i in xrange(x, len(arr)):
hashes = tuple([(hashes[j] * P[j] - arr[i - x] * powers[j] + arr[i]) % MOD for j in xrange(len(P))])
lookup.add(hashes)
return lookup
def check(paths, x):
intersect = rabin_karp(paths[0], x)
for i in xrange(1, len(paths)):
intersect = set.intersection(intersect, rabin_karp(paths[i], x))
if not intersect:
return False
return True
(mod, p) = (10 ** 9 + 7, (113, 109))
(left, right) = (1, min((len(p) for p in paths)))
while left <= right:
mid = left + (right - left) // 2
if not check(paths, mid):
right = mid - 1
else:
left = mid + 1
return right
class Solution2(object):
def longest_common_subpath(self, n, paths):
"""
:type n: int
:type paths: List[List[int]]
:rtype: int
"""
def rabin_karp(arr, x):
h = reduce(lambda h, x: (h * P + x) % MOD, (arr[i] for i in xrange(x)), 0)
power = pow(P, x, MOD)
lookup = {h}
for i in xrange(x, len(arr)):
h = (h * P - arr[i - x] * power + arr[i]) % MOD
lookup.add(h)
return lookup
def check(paths, x):
intersect = rabin_karp(paths[0], x)
for i in xrange(1, len(paths)):
intersect = set.intersection(intersect, rabin_karp(paths[i], x))
if not intersect:
return False
return True
(mod, p) = (10 ** 11 + 19, max((x for p in paths for x in p)) + 1)
(left, right) = (1, min((len(p) for p in paths)))
while left <= right:
mid = left + (right - left) // 2
if not check(paths, mid):
right = mid - 1
else:
left = mid + 1
return right
|
class Song:
def __init__(self, json):
# playlist tracks not queryable over API
if not json:
raise LookupError
self.name = json['name']
self.artists = list(map(lambda artist: artist['name'], json['artists']))
self.album = json['album']['name']
def __str__(self) -> str:
return self.name + ' - ' + ', '.join(self.artists) + ' (' + self.album + ')'
|
class Song:
def __init__(self, json):
if not json:
raise LookupError
self.name = json['name']
self.artists = list(map(lambda artist: artist['name'], json['artists']))
self.album = json['album']['name']
def __str__(self) -> str:
return self.name + ' - ' + ', '.join(self.artists) + ' (' + self.album + ')'
|
# test with
with open("test.txt") as f:
f.write("hello worlds")
f.read()
|
with open('test.txt') as f:
f.write('hello worlds')
f.read()
|
class Solution:
"""
@param numbers : An array of Integer
@param target : target = numbers[index1] + numbers[index2]
@return : [index1 + 1, index2 + 1] (index1 < index2)
"""
def twoSum(self, numbers, target):
# Hash map
# map = {}
# for i, n in enumerate(numbers):
# map[n] = i + 1
# for i, n in enumerate(numbers):
# rest = target - n
# if(rest in map and map[rest] > i):
# return [i + 1, map[rest]]
# Two pointer
sorted_numbers = sorted(numbers)
l = 0
r = len(numbers) - 1
while (l < r):
res = sorted_numbers[l] + sorted_numbers[r]
if (res == target):
i = 0
l_index = None
r_index = None
while (i < len(numbers)):
if (numbers[i] == sorted_numbers[l]):
l_index = i + 1
break
elif (numbers[i] == sorted_numbers[r]):
r_index = i + 1
break
else:
i += 1
i += 1
while (i < len(numbers)):
if (l_index and numbers[i] == sorted_numbers[r]):
r_index = i + 1
break
elif (r_index and numbers[i] == sorted_numbers[l]):
l_index = i + 1
break
else:
i += 1
return [l_index, r_index] if l_index < r_index else [r_index, l_index]
elif (res < target):
l += 1
else:
r -= 1
|
class Solution:
"""
@param numbers : An array of Integer
@param target : target = numbers[index1] + numbers[index2]
@return : [index1 + 1, index2 + 1] (index1 < index2)
"""
def two_sum(self, numbers, target):
sorted_numbers = sorted(numbers)
l = 0
r = len(numbers) - 1
while l < r:
res = sorted_numbers[l] + sorted_numbers[r]
if res == target:
i = 0
l_index = None
r_index = None
while i < len(numbers):
if numbers[i] == sorted_numbers[l]:
l_index = i + 1
break
elif numbers[i] == sorted_numbers[r]:
r_index = i + 1
break
else:
i += 1
i += 1
while i < len(numbers):
if l_index and numbers[i] == sorted_numbers[r]:
r_index = i + 1
break
elif r_index and numbers[i] == sorted_numbers[l]:
l_index = i + 1
break
else:
i += 1
return [l_index, r_index] if l_index < r_index else [r_index, l_index]
elif res < target:
l += 1
else:
r -= 1
|
class File(object):
def __init__(self):
self.filename = ''
self.server_filename = ''
self.rotate = 0
self.password = None
# file_encryption_key TBD
self.file_encryption_key = None
self.metas = {}
@property
def metas_values(self):
return "Title", "Author", "Subject", "Keywords", "Creator", "Producer", "CreationDate", "ModDate", "Trapped"
def get_file_options(self):
pass
def set_metas(self, key, value):
if key in self.metas_values:
self.metas[key] = value
else:
raise ValueError("'%s' is not a meta tag: %s" % (key, self.metas))
def as_dict(self):
for k in dir(self):
if getattr(self, k) and \
'set_metas' not in k and 'get_file_options' not in k and 'as_dict' not in k \
and '__' not in k and '_values' not in k:
yield(k, getattr(self, k))
|
class File(object):
def __init__(self):
self.filename = ''
self.server_filename = ''
self.rotate = 0
self.password = None
self.file_encryption_key = None
self.metas = {}
@property
def metas_values(self):
return ('Title', 'Author', 'Subject', 'Keywords', 'Creator', 'Producer', 'CreationDate', 'ModDate', 'Trapped')
def get_file_options(self):
pass
def set_metas(self, key, value):
if key in self.metas_values:
self.metas[key] = value
else:
raise value_error("'%s' is not a meta tag: %s" % (key, self.metas))
def as_dict(self):
for k in dir(self):
if getattr(self, k) and 'set_metas' not in k and ('get_file_options' not in k) and ('as_dict' not in k) and ('__' not in k) and ('_values' not in k):
yield (k, getattr(self, k))
|
windowWidth = 500
windowHeight = 500
ellipseSize = 200
def setup():
size(windowWidth , windowHeight)
smooth()
background(255)
fill(50, 80)
stroke(100)
strokeWeight(3)
noLoop()
def draw():
ellipse(windowWidth/2, windowHeight/2 - ellipseSize/2,
ellipseSize , ellipseSize);
ellipse(windowWidth/2 - ellipseSize/2, windowHeight/2,
ellipseSize , ellipseSize);
ellipse(windowWidth/2 + ellipseSize/2, windowHeight/2,
ellipseSize , ellipseSize);
ellipse(windowWidth/2, windowHeight/2 + ellipseSize/2,
ellipseSize , ellipseSize);
|
window_width = 500
window_height = 500
ellipse_size = 200
def setup():
size(windowWidth, windowHeight)
smooth()
background(255)
fill(50, 80)
stroke(100)
stroke_weight(3)
no_loop()
def draw():
ellipse(windowWidth / 2, windowHeight / 2 - ellipseSize / 2, ellipseSize, ellipseSize)
ellipse(windowWidth / 2 - ellipseSize / 2, windowHeight / 2, ellipseSize, ellipseSize)
ellipse(windowWidth / 2 + ellipseSize / 2, windowHeight / 2, ellipseSize, ellipseSize)
ellipse(windowWidth / 2, windowHeight / 2 + ellipseSize / 2, ellipseSize, ellipseSize)
|
# Given an integer n, return the number of structurally unique BST's (binary search trees) which has exactly n nodes of unique values from 1 to n.
# Example 1:
# Input: n = 3
# Output: 5
#FORMULA is 2nCn/ n+1 catelon number
class Solution:
def numTrees(self, n: int) -> int:
res = 1
x = 2*n
for i in range(n):
res = res * (x-1)
res = res // (i+1)
return res // (n+1)
if __name__ == '__main__':
n = 3
print(Solution().numTrees(n))
|
class Solution:
def num_trees(self, n: int) -> int:
res = 1
x = 2 * n
for i in range(n):
res = res * (x - 1)
res = res // (i + 1)
return res // (n + 1)
if __name__ == '__main__':
n = 3
print(solution().numTrees(n))
|
'''Constants used by TRender.
:copyright: 2015, Jeroen van der Heijden (Cesbit)
'''
LINE_IF = 1
LINE_ELSE = 2
LINE_ELIF = 4
LINE_END = 8
LINE_MACRO = 16
LINE_COMMENT = 32
LINE_BLOCK = 64
LINE_FOR = 128
LINE_PASTE = 256
LINE_TEXT = 512
LINE_INCLUDE = 1024
LINE_EXTEND = 2048
LINE_EMPTY = 4096
EOF_TEXT = 8192
ALWAYS_ALLOWED = (
LINE_IF |
LINE_MACRO |
LINE_PASTE |
LINE_TEXT |
LINE_COMMENT |
LINE_FOR |
LINE_BLOCK |
LINE_INCLUDE |
LINE_EXTEND |
LINE_EMPTY)
MAP_LINE_TYPE = {
True: LINE_TEXT,
None: LINE_EMPTY,
'if': LINE_IF,
'else': LINE_ELSE,
'elif': LINE_ELIF,
'end': LINE_END,
'for': LINE_FOR,
'macro': LINE_MACRO,
'block': LINE_BLOCK,
'include': LINE_INCLUDE,
'extend': LINE_EXTEND,
'': LINE_COMMENT
}
VAR = 'a-zA-Z0-9_'
VAR_DOTS = VAR + r'\.'
FILENAME = r'a-zA-Z0-9_\-\./'
|
"""Constants used by TRender.
:copyright: 2015, Jeroen van der Heijden (Cesbit)
"""
line_if = 1
line_else = 2
line_elif = 4
line_end = 8
line_macro = 16
line_comment = 32
line_block = 64
line_for = 128
line_paste = 256
line_text = 512
line_include = 1024
line_extend = 2048
line_empty = 4096
eof_text = 8192
always_allowed = LINE_IF | LINE_MACRO | LINE_PASTE | LINE_TEXT | LINE_COMMENT | LINE_FOR | LINE_BLOCK | LINE_INCLUDE | LINE_EXTEND | LINE_EMPTY
map_line_type = {True: LINE_TEXT, None: LINE_EMPTY, 'if': LINE_IF, 'else': LINE_ELSE, 'elif': LINE_ELIF, 'end': LINE_END, 'for': LINE_FOR, 'macro': LINE_MACRO, 'block': LINE_BLOCK, 'include': LINE_INCLUDE, 'extend': LINE_EXTEND, '': LINE_COMMENT}
var = 'a-zA-Z0-9_'
var_dots = VAR + '\\.'
filename = 'a-zA-Z0-9_\\-\\./'
|
test_cases = int(input())
sol = []
for test in range(test_cases):
budget = int(input())
useless = input()
prices = list(map(int,input().split()))
for i in range(len(prices)):
for j in range(i+1,len(prices)):
if prices[i]+prices[j] == budget:
sol.append(str(i+1)+' '+str(j+1))
for ans in sol:
print(ans)
|
test_cases = int(input())
sol = []
for test in range(test_cases):
budget = int(input())
useless = input()
prices = list(map(int, input().split()))
for i in range(len(prices)):
for j in range(i + 1, len(prices)):
if prices[i] + prices[j] == budget:
sol.append(str(i + 1) + ' ' + str(j + 1))
for ans in sol:
print(ans)
|
def pytest_assertrepr_compare(config, op, left, right):
"""Hook for PyCharm full diff
References:
https://stackoverflow.com/a/50625086/4249707"""
if op in ("==", "!="):
return ["{0} {1} {2}".format(left, op, right)]
|
def pytest_assertrepr_compare(config, op, left, right):
"""Hook for PyCharm full diff
References:
https://stackoverflow.com/a/50625086/4249707"""
if op in ('==', '!='):
return ['{0} {1} {2}'.format(left, op, right)]
|
n = int(input())
t = 0
a = 0
for _ in range(n):
s = input()
t += s.count('R')
a += s.count('B')
if t > a:
print('TAKAHASHI')
elif a > t:
print('AOKI')
else:
print('DRAW')
|
n = int(input())
t = 0
a = 0
for _ in range(n):
s = input()
t += s.count('R')
a += s.count('B')
if t > a:
print('TAKAHASHI')
elif a > t:
print('AOKI')
else:
print('DRAW')
|
#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Created on Fri Oct 20 14:55:39 2017
@author: ishxiao
~Email~: [email protected]
"""
|
"""
Created on Fri Oct 20 14:55:39 2017
@author: ishxiao
~Email~: [email protected]
"""
|
ledger = {n: idx + 1 for idx, n in enumerate([1, 17, 0, 10, 18, 11, 6])}
spoken_number = list(ledger)[-1]
for turn in range(len(ledger), 30000000):
ledger[spoken_number], spoken_number = turn, turn - ledger.get(spoken_number, turn)
if turn == 2020 - 1:
print(f"Part 1: {spoken_number}") # 595
print(f"Part 2: {spoken_number}") # 1708310
|
ledger = {n: idx + 1 for (idx, n) in enumerate([1, 17, 0, 10, 18, 11, 6])}
spoken_number = list(ledger)[-1]
for turn in range(len(ledger), 30000000):
(ledger[spoken_number], spoken_number) = (turn, turn - ledger.get(spoken_number, turn))
if turn == 2020 - 1:
print(f'Part 1: {spoken_number}')
print(f'Part 2: {spoken_number}')
|
n = int(input())
arr = map(int, input().split())
list1 = list(arr)
print(list1)
new_list = set(list1)
print(new_list)
new_list.remove(max(new_list))
print(max(new_list))
|
n = int(input())
arr = map(int, input().split())
list1 = list(arr)
print(list1)
new_list = set(list1)
print(new_list)
new_list.remove(max(new_list))
print(max(new_list))
|
MODEL_FOLDER_NAME = 'models'
FASTTEXT_MODEL_NAME = 'fasttext.magnitude'
GLOVE_MODEL_NAME = 'glove.magnitude'
WORD2VEC_MODEL_NAME = 'word2vec.magnitude'
ELMO_MODEL_NAME = 'elmo.magnitude'
BERT_MODEL_NAME = ''
FLAIR_MODEL_NAME = 'news-forward'
COVE_MODEL_NAME = ''
UNIVERSAL_SENTENCE_ENCODER_MODEL_NAME = 'https://tfhub.dev/google/universal-sentence-encoder/1'
CLASSIFIER_ALIAS_DICT = dict({'Random Forest': 'randomforest',
'Logistic Regression': 'logitreg',
'AdaBoost':'adaboost',
'GradientBoost':'gradboost',
'Support Vector Machine (Linear Kernel)':'svm',
'Stochastic Gradient Descent': 'svm',
'SGD Classifier': 'svm'})
|
model_folder_name = 'models'
fasttext_model_name = 'fasttext.magnitude'
glove_model_name = 'glove.magnitude'
word2_vec_model_name = 'word2vec.magnitude'
elmo_model_name = 'elmo.magnitude'
bert_model_name = ''
flair_model_name = 'news-forward'
cove_model_name = ''
universal_sentence_encoder_model_name = 'https://tfhub.dev/google/universal-sentence-encoder/1'
classifier_alias_dict = dict({'Random Forest': 'randomforest', 'Logistic Regression': 'logitreg', 'AdaBoost': 'adaboost', 'GradientBoost': 'gradboost', 'Support Vector Machine (Linear Kernel)': 'svm', 'Stochastic Gradient Descent': 'svm', 'SGD Classifier': 'svm'})
|
# coding=utf-8
class App:
TESTING = True
HOST_URL = "http://pay.lvye.com"
PAYEE = '169658002'
class PayClientConfig:
CHANNEL_NAME = 'lvye_pay_test'
ROOT_URL = "http://pay.lvye.com/api/__"
CHECKOUT_URL = 'http://pay.lvye.com/__/checkout/{sn}'
|
class App:
testing = True
host_url = 'http://pay.lvye.com'
payee = '169658002'
class Payclientconfig:
channel_name = 'lvye_pay_test'
root_url = 'http://pay.lvye.com/api/__'
checkout_url = 'http://pay.lvye.com/__/checkout/{sn}'
|
def calc_gc(sequence):
sequence = sequence.upper() # make all chars uppercase
n = sequence.count('T') + sequence.count('A') # count only A, T,
m = sequence.count('G') + sequence.count('C') # C, and G -- nothing else (no Ns, Rs, Ws, etc.)
return float(m) / float(n + m) if n+m else 0
def test_1(): # test handling N
result = round(calc_gc('NATGC'), 2)
assert result == 0.5, result
def test_2(): # test handling lowercase
result = round(calc_gc('natgc'), 2)
assert result == 0.5, result
|
def calc_gc(sequence):
sequence = sequence.upper()
n = sequence.count('T') + sequence.count('A')
m = sequence.count('G') + sequence.count('C')
return float(m) / float(n + m) if n + m else 0
def test_1():
result = round(calc_gc('NATGC'), 2)
assert result == 0.5, result
def test_2():
result = round(calc_gc('natgc'), 2)
assert result == 0.5, result
|
# Use this to take notes on the Edpuzzle video. Try each example rather than just watching it - you will get much more out of it!
#
student = {'name': 'John', 'age': 25, 'courses': ['math', 'CompSci']}
for key, value in student.items():
print(key, value)
|
student = {'name': 'John', 'age': 25, 'courses': ['math', 'CompSci']}
for (key, value) in student.items():
print(key, value)
|
PARSING_SCHEME = {
'name': 'a',
'games_played': 'td[data-stat="g"]:first',
'minutes_played': 'td[data-stat="mp"]:first',
'field_goals': 'td[data-stat="fg"]:first',
'field_goal_attempts': 'td[data-stat="fga"]:first',
'field_goal_percentage': 'td[data-stat="fg_pct"]:first',
'three_point_field_goals': 'td[data-stat="fg3"]:first',
'three_point_field_goal_attempts': 'td[data-stat="fg3a"]:first',
'three_point_field_goal_percentage': 'td[data-stat="fg3_pct"]:first',
'two_point_field_goals': 'td[data-stat="fg2"]:first',
'two_point_field_goal_attempts': 'td[data-stat="fg2a"]:first',
'two_point_field_goal_percentage': 'td[data-stat="fg2_pct"]:first',
'free_throws': 'td[data-stat="ft"]:first',
'free_throw_attempts': 'td[data-stat="fta"]:first',
'free_throw_percentage': 'td[data-stat="ft_pct"]:first',
'offensive_rebounds': 'td[data-stat="orb"]:first',
'defensive_rebounds': 'td[data-stat="drb"]:first',
'total_rebounds': 'td[data-stat="trb"]:first',
'assists': 'td[data-stat="ast"]:first',
'steals': 'td[data-stat="stl"]:first',
'blocks': 'td[data-stat="blk"]:first',
'turnovers': 'td[data-stat="tov"]:first',
'personal_fouls': 'td[data-stat="pf"]:first',
'points': 'td[data-stat="pts"]:first',
'opp_minutes_played': 'td[data-stat="mp"]:first',
'opp_field_goals': 'td[data-stat="opp_fg"]:first',
'opp_field_goal_attempts': 'td[data-stat="opp_fga"]:first',
'opp_field_goal_percentage': 'td[data-stat="opp_fg_pct"]:first',
'opp_three_point_field_goals': 'td[data-stat="opp_fg3"]:first',
'opp_three_point_field_goal_attempts': 'td[data-stat="opp_fg3a"]:first',
'opp_three_point_field_goal_percentage':
'td[data-stat="opp_fg3_pct"]:first',
'opp_two_point_field_goals': 'td[data-stat="opp_fg2"]:first',
'opp_two_point_field_goal_attempts': 'td[data-stat="opp_fg2a"]:first',
'opp_two_point_field_goal_percentage': 'td[data-stat="opp_fg2_pct"]:first',
'opp_free_throws': 'td[data-stat="opp_ft"]:first',
'opp_free_throw_attempts': 'td[data-stat="opp_fta"]:first',
'opp_free_throw_percentage': 'td[data-stat="opp_ft_pct"]:first',
'opp_offensive_rebounds': 'td[data-stat="opp_orb"]:first',
'opp_defensive_rebounds': 'td[data-stat="opp_drb"]:first',
'opp_total_rebounds': 'td[data-stat="opp_trb"]:first',
'opp_assists': 'td[data-stat="opp_ast"]:first',
'opp_steals': 'td[data-stat="opp_stl"]:first',
'opp_blocks': 'td[data-stat="opp_blk"]:first',
'opp_turnovers': 'td[data-stat="opp_tov"]:first',
'opp_personal_fouls': 'td[data-stat="opp_pf"]:first',
'opp_points': 'td[data-stat="opp_pts"]:first'
}
SCHEDULE_SCHEME = {
'game': 'th[data-stat="g"]:first',
'date': 'td[data-stat="date_game"]:first',
'time': 'td[data-stat="game_start_time"]:first',
'boxscore': 'td[data-stat="box_score_text"]:first',
'location': 'td[data-stat="game_location"]:first',
'opponent_abbr': 'td[data-stat="opp_id"]:first',
'opponent_name': 'td[data-stat="opp_name"]:first',
'result': 'td[data-stat="game_result"]:first',
'points_scored': 'td[data-stat="pts"]:first',
'points_allowed': 'td[data-stat="opp_pts"]:first',
'wins': 'td[data-stat="wins"]:first',
'losses': 'td[data-stat="losses"]:first',
'streak': 'td[data-stat="game_streak"]:first'
}
BOXSCORE_SCHEME = {
'date': 'div[class="scorebox_meta"]',
'location': 'div[class="scorebox_meta"]',
'away_name': 'a[itemprop="name"]:first',
'home_name': 'a[itemprop="name"]:last',
'winning_name': '',
'winning_abbr': '',
'losing_name': '',
'losing_abbr': '',
'summary': 'table#line_score',
'pace': 'td[data-stat="pace"]:first',
'away_record': 'div[class="table_wrapper"] h2',
'away_minutes_played': 'tfoot td[data-stat="mp"]',
'away_field_goals': 'tfoot td[data-stat="fg"]',
'away_field_goal_attempts': 'tfoot td[data-stat="fga"]',
'away_field_goal_percentage': 'tfoot td[data-stat="fg_pct"]',
'away_two_point_field_goals': 'tfoot td[data-stat="fg2"]',
'away_two_point_field_goal_attempts': 'tfoot td[data-stat="fg2a"]',
'away_two_point_field_goal_percentage': 'tfoot td[data-stat="fg2_pct"]',
'away_three_point_field_goals': 'tfoot td[data-stat="fg3"]',
'away_three_point_field_goal_attempts': 'tfoot td[data-stat="fg3a"]',
'away_three_point_field_goal_percentage': 'tfoot td[data-stat="fg3_pct"]',
'away_free_throws': 'tfoot td[data-stat="ft"]',
'away_free_throw_attempts': 'tfoot td[data-stat="fta"]',
'away_free_throw_percentage': 'tfoot td[data-stat="ft_pct"]',
'away_offensive_rebounds': 'tfoot td[data-stat="orb"]',
'away_defensive_rebounds': 'tfoot td[data-stat="drb"]',
'away_total_rebounds': 'tfoot td[data-stat="trb"]',
'away_assists': 'tfoot td[data-stat="ast"]',
'away_steals': 'tfoot td[data-stat="stl"]',
'away_blocks': 'tfoot td[data-stat="blk"]',
'away_turnovers': 'tfoot td[data-stat="tov"]',
'away_personal_fouls': 'tfoot td[data-stat="pf"]',
'away_points': 'tfoot td[data-stat="pts"]',
'away_true_shooting_percentage': 'tfoot td[data-stat="ts_pct"]',
'away_effective_field_goal_percentage': 'tfoot td[data-stat="efg_pct"]',
'away_three_point_attempt_rate': 'tfoot td[data-stat="fg3a_per_fga_pct"]',
'away_free_throw_attempt_rate': 'tfoot td[data-stat="fta_per_fga_pct"]',
'away_offensive_rebound_percentage': 'tfoot td[data-stat="orb_pct"]',
'away_defensive_rebound_percentage': 'tfoot td[data-stat="drb_pct"]',
'away_total_rebound_percentage': 'tfoot td[data-stat="trb_pct"]',
'away_assist_percentage': 'tfoot td[data-stat="ast_pct"]',
'away_steal_percentage': 'tfoot td[data-stat="stl_pct"]',
'away_block_percentage': 'tfoot td[data-stat="blk_pct"]',
'away_turnover_percentage': 'tfoot td[data-stat="tov_pct"]',
'away_offensive_rating': 'tfoot td[data-stat="off_rtg"]',
'away_defensive_rating': 'tfoot td[data-stat="def_rtg"]',
'home_record': 'div[class="table_wrapper"] h2',
'home_minutes_played': 'tfoot td[data-stat="mp"]',
'home_field_goals': 'tfoot td[data-stat="fg"]',
'home_field_goal_attempts': 'tfoot td[data-stat="fga"]',
'home_field_goal_percentage': 'tfoot td[data-stat="fg_pct"]',
'home_two_point_field_goals': 'tfoot td[data-stat="fg2"]',
'home_two_point_field_goal_attempts': 'tfoot td[data-stat="fg2a"]',
'home_two_point_field_goal_percentage': 'tfoot td[data-stat="fg2_pct"]',
'home_three_point_field_goals': 'tfoot td[data-stat="fg3"]',
'home_three_point_field_goal_attempts': 'tfoot td[data-stat="fg3a"]',
'home_three_point_field_goal_percentage': 'tfoot td[data-stat="fg3_pct"]',
'home_free_throws': 'tfoot td[data-stat="ft"]',
'home_free_throw_attempts': 'tfoot td[data-stat="fta"]',
'home_free_throw_percentage': 'tfoot td[data-stat="ft_pct"]',
'home_offensive_rebounds': 'tfoot td[data-stat="orb"]',
'home_defensive_rebounds': 'tfoot td[data-stat="drb"]',
'home_total_rebounds': 'tfoot td[data-stat="trb"]',
'home_assists': 'tfoot td[data-stat="ast"]',
'home_steals': 'tfoot td[data-stat="stl"]',
'home_blocks': 'tfoot td[data-stat="blk"]',
'home_turnovers': 'tfoot td[data-stat="tov"]',
'home_personal_fouls': 'tfoot td[data-stat="pf"]',
'home_points': 'div[class="score"]',
'home_true_shooting_percentage': 'tfoot td[data-stat="ts_pct"]',
'home_effective_field_goal_percentage': 'tfoot td[data-stat="efg_pct"]',
'home_three_point_attempt_rate': 'tfoot td[data-stat="fg3a_per_fga_pct"]',
'home_free_throw_attempt_rate': 'tfoot td[data-stat="fta_per_fga_pct"]',
'home_offensive_rebound_percentage': 'tfoot td[data-stat="orb_pct"]',
'home_defensive_rebound_percentage': 'tfoot td[data-stat="drb_pct"]',
'home_total_rebound_percentage': 'tfoot td[data-stat="trb_pct"]',
'home_assist_percentage': 'tfoot td[data-stat="ast_pct"]',
'home_steal_percentage': 'tfoot td[data-stat="stl_pct"]',
'home_block_percentage': 'tfoot td[data-stat="blk_pct"]',
'home_turnover_percentage': 'tfoot td[data-stat="tov_pct"]',
'home_offensive_rating': 'tfoot td[data-stat="off_rtg"]',
'home_defensive_rating': 'tfoot td[data-stat="def_rtg"]'
}
BOXSCORE_ELEMENT_INDEX = {
'date': 0,
'location': 1,
'home_record': -1,
'home_minutes_played': 7,
'home_field_goals': 7,
'home_field_goal_attempts': 7,
'home_field_goal_percentage': 7,
'home_two_point_field_goals': 7,
'home_two_point_field_goal_attempts': 7,
'home_two_point_field_goal_percentage': 7,
'home_three_point_field_goals': 7,
'home_three_point_field_goal_attempts': 7,
'home_three_point_field_goal_percentage': 7,
'home_free_throws': 7,
'home_free_throw_attempts': 7,
'home_free_throw_percentage': 7,
'home_offensive_rebounds': 7,
'home_defensive_rebounds': 7,
'home_total_rebounds': 7,
'home_assists': 7,
'home_steals': 7,
'home_blocks': 7,
'home_turnovers': 7,
'home_personal_fouls': 7,
'home_points': -1,
'home_true_shooting_percentage': 7,
'home_effective_field_goal_percentage': 7,
'home_three_point_attempt_rate': 7,
'home_free_throw_attempt_rate': 7,
'home_offensive_rebound_percentage': 7,
'home_defensive_rebound_percentage': 7,
'home_total_rebound_percentage': 7,
'home_assist_percentage': 7,
'home_steal_percentage': 7,
'home_block_percentage': 7,
'home_turnover_percentage': 7,
'home_offensive_rating': 7,
'home_defensive_rating': 7
}
PLAYER_SCHEME = {
'summary': '[data-template="Partials/Teams/Summary"]',
'season': 'th[data-stat="season"]:first',
'name': 'h1',
'team_abbreviation': 'td[data-stat="team_id"]',
'position': 'td[data-stat="pos"]',
'height': 'span[itemprop="height"]',
'weight': 'span[itemprop="weight"]',
'birth_date': 'td[data-stat=""]',
'nationality': 'td[data-stat=""]',
'age': 'nobr',
'games_played': 'td[data-stat="g"]',
'games_started': 'td[data-stat="gs"]',
'minutes_played': 'td[data-stat="mp"]',
'field_goals': 'td[data-stat="fg"]',
'field_goal_attempts': 'td[data-stat="fga"]',
'field_goal_percentage': 'td[data-stat="fg_pct"]',
'three_pointers': 'td[data-stat="fg3"]',
'three_point_attempts': 'td[data-stat="fg3a"]',
'three_point_percentage': 'td[data-stat="fg3_pct"]',
'two_pointers': 'td[data-stat="fg2"]',
'two_point_attempts': 'td[data-stat="fg2a"]',
'two_point_percentage': 'td[data-stat="fg2_pct"]',
'effective_field_goal_percentage': 'td[data-stat="efg_pct"]',
'free_throws': 'td[data-stat="ft"]',
'free_throw_attempts': 'td[data-stat="fta"]',
'free_throw_percentage': 'td[data-stat="ft_pct"]',
'offensive_rebounds': 'td[data-stat="orb"]',
'defensive_rebounds': 'td[data-stat="drb"]',
'total_rebounds': 'td[data-stat="trb"]',
'assists': 'td[data-stat="ast"]',
'steals': 'td[data-stat="stl"]',
'blocks': 'td[data-stat="blk"]',
'turnovers': 'td[data-stat="tov"]',
'personal_fouls': 'td[data-stat="pf"]',
'points': 'td[data-stat="pts"]',
'player_efficiency_rating': 'td[data-stat="per"]',
'true_shooting_percentage': 'td[data-stat="ts_pct"]',
'three_point_attempt_rate': 'td[data-stat="fg3a_per_fga_pct"]',
'free_throw_attempt_rate': 'td[data-stat="fta_per_fga_pct"]',
'offensive_rebound_percentage': 'td[data-stat="orb_pct"]',
'defensive_rebound_percentage': 'td[data-stat="drb_pct"]',
'total_rebound_percentage': 'td[data-stat="trb_pct"]',
'assist_percentage': 'td[data-stat="ast_pct"]',
'steal_percentage': 'td[data-stat="stl_pct"]',
'block_percentage': 'td[data-stat="blk_pct"]',
'turnover_percentage': 'td[data-stat="tov_pct"]',
'usage_percentage': 'td[data-stat="usg_pct"]',
'offensive_win_shares': 'td[data-stat="ows"]',
'defensive_win_shares': 'td[data-stat="dws"]',
'win_shares': 'td[data-stat="ws"]',
'win_shares_per_48_minutes': 'td[data-stat="ws_per_48"]',
'offensive_box_plus_minus': 'td[data-stat="obpm"]',
'defensive_box_plus_minus': 'td[data-stat="dbpm"]',
'box_plus_minus': 'td[data-stat="bpm"]',
'defensive_rating': 'td[data-stat="def_rtg"]',
'offensive_rating': 'td[data-stat="off_rtg"]',
'boxscore_box_plus_minus': 'td[data-stat="plus_minus"]',
'value_over_replacement_player': 'td[data-stat="vorp"]',
'shooting_distance': 'td[data-stat="avg_dist"]',
'percentage_shots_two_pointers': 'td[data-stat="fg2a_pct_fga"]',
'percentage_zero_to_three_footers': 'td[data-stat="pct_fga_00_03"]',
'percentage_three_to_ten_footers': 'td[data-stat="pct_fga_03_10"]',
'percentage_ten_to_sixteen_footers': 'td[data-stat="pct_fga_10_16"]',
'percentage_sixteen_foot_plus_two_pointers':
'td[data-stat="pct_fga_16_xx"]',
'percentage_shots_three_pointers': 'td[data-stat="fg3a_pct_fga"]',
'field_goal_perc_zero_to_three_feet': 'td[data-stat="fg_pct_00_03"]',
'field_goal_perc_three_to_ten_feet': 'td[data-stat="fg_pct_03_10"]',
'field_goal_perc_ten_to_sixteen_feet': 'td[data-stat="fg_pct_10_16"]',
'field_goal_perc_sixteen_foot_plus_two_pointers':
'td[data-stat="fg_pct_16_xx"]',
'two_pointers_assisted_percentage': 'td[data-stat="fg2_pct_ast"]',
'percentage_field_goals_as_dunks': 'td[data-stat="pct_fg2_dunk"]',
'dunks': 'td[data-stat="fg2_dunk"]',
'three_pointers_assisted_percentage': 'td[data-stat="fg3_pct_ast"]',
'percentage_of_three_pointers_from_corner':
'td[data-stat="pct_fg3a_corner"]',
'three_point_shot_percentage_from_corner':
'td[data-stat="fg3_pct_corner"]',
'half_court_heaves': 'td[data-stat="fg3a_heave"]',
'half_court_heaves_made': 'td[data-stat="fg3_heave"]',
'point_guard_percentage': 'td[data-stat="pct_1"]',
'shooting_guard_percentage': 'td[data-stat="pct_2"]',
'small_forward_percentage': 'td[data-stat="pct_3"]',
'power_forward_percentage': 'td[data-stat="pct_4"]',
'center_percentage': 'td[data-stat="pct_5"]',
'on_court_plus_minus': 'td[data-stat="plus_minus_on"]',
'net_plus_minus': 'td[data-stat="plus_minus_net"]',
'passing_turnovers': 'td[data-stat="tov_bad_pass"]',
'lost_ball_turnovers': 'td[data-stat="tov_lost_ball"]',
'other_turnovers': 'td[data-stat="tov_other"]',
'shooting_fouls': 'td[data-stat="fouls_shooting"]',
'blocking_fouls': 'td[data-stat="fouls_blocking"]',
'offensive_fouls': 'td[data-stat="fouls_offensive"]',
'take_fouls': 'td[data-stat="fouls_take"]',
'points_generated_by_assists': 'td[data-stat="astd_pts"]',
'shooting_fouls_drawn': 'td[data-stat="drawn_shooting"]',
'and_ones': 'td[data-stat="and1s"]',
'shots_blocked': 'td[data-stat="fga_blkd"]',
'salary': 'td[data-stat="salary"]',
'field_goals_per_poss': 'td[data-stat="fg_per_poss"]',
'field_goal_attempts_per_poss': 'td[data-stat="fga_per_poss"]',
'three_pointers_per_poss': 'td[data-stat="fg3_per_poss"]',
'three_point_attempts_per_poss': 'td[data-stat="fg3a_per_poss"]',
'two_pointers_per_poss': 'td[data-stat="fg2_per_poss"]',
'two_point_attempts_per_poss': 'td[data-stat="fg2a_per_poss"]',
'free_throws_per_poss': 'td[data-stat="ft_per_poss"]',
'free_throw_attempts_per_poss': 'td[data-stat="fta_per_poss"]',
'offensive_rebounds_per_poss': 'td[data-stat="orb_per_poss"]',
'defensive_rebounds_per_poss': 'td[data-stat="drb_per_poss"]',
'total_rebounds_per_poss': 'td[data-stat="trb_per_poss"]',
'assists_per_poss': 'td[data-stat="ast_per_poss"]',
'steals_per_poss': 'td[data-stat="stl_per_poss"]',
'blocks_per_poss': 'td[data-stat="blk_per_poss"]',
'turnovers_per_poss': 'td[data-stat="tov_per_poss"]',
'personal_fouls_per_poss': 'td[data-stat="pf_per_poss"]',
'points_per_poss': 'td[data-stat="pts_per_poss"]'
}
NATIONALITY = {
'ao': 'Angola',
'ag': 'Antigua and Barbuda',
'ar': 'Argentina',
'au': 'Australia',
'at': 'Austria',
'bs': 'Bahamas',
'be': 'Belgium',
'ba': 'Bosnia and Herzegovina',
'br': 'Brazil',
'bg': 'Bulgaria',
'cm': 'Cameroon',
'ca': 'Canada',
'td': 'Chad',
'co': 'Colombia',
'cv': 'Cape Verde',
'cn': 'China',
'hr': 'Croatia',
'cu': 'Cuba',
'cz': 'Czech Republic',
'cd': 'Democratic Replubic of Congo',
'dk': 'Denmark',
'dm': 'Dominica',
'do': 'Dominican Replubic',
'eg': 'Egypt',
'ee': 'Estonia',
'fi': 'Finland',
'fr': 'France',
'gf': 'French Guiana',
'ga': 'Gabon',
'ge': 'Georgia',
'de': 'Germany',
'gh': 'Ghana',
'gr': 'Greece',
'gp': 'Guadeloupe',
'gn': 'Guinea',
'gy': 'Guyana',
'ht': 'Haiti',
'hu': 'Hungary',
'is': 'Iceland',
'ie': 'Ireland',
'ir': 'Islamic Replubic of Iran',
'il': 'Israel',
'it': 'Italy',
'jm': 'Jamaica',
'jp': 'Japan',
'lv': 'Latvia',
'lb': 'Lebanon',
'lt': 'Lithuania',
'lu': 'Luxembourg',
'ml': 'Mali',
'mq': 'Martinique',
'mx': 'Mexico',
'me': 'Montenegro',
'ma': 'Morocco',
'nl': 'Netherlands',
'nz': 'New Zealand',
'ng': 'Nigeria',
'no': 'Norway',
'pa': 'Panama',
'pl': 'Poland',
'pr': 'Puerto Rico',
'ke': 'Kenya',
'kr': 'Republic of Korea',
'mk': 'Republic of Macedonia',
'cg': 'Republic of Congo',
'ro': 'Romania',
'ru': 'Russian Federation',
'lc': 'Saint Lucia',
'vc': 'Saint Vincent and the Grenadines',
'sd': 'Sudan',
'sn': 'Senegal',
'rs': 'Serbia',
'sk': 'Slovakia',
'si': 'Slovenia',
'za': 'South Africa',
'ss': 'South Sudan',
'es': 'Spain',
'se': 'Sweden',
'ch': 'Switzerland',
'tw': 'Taiwan',
'tt': 'Trinidad and Tobago',
'tn': 'Tunisia',
'tr': 'Turkey',
'us': 'United States of America',
'vi': 'U.S. Virgin Islands',
'ua': 'Ukraine',
'gb': 'United Kingdom',
'tz': 'United Republic of Tanzania',
'uy': 'Uruguay',
've': 'Venezuela'
}
SEASON_PAGE_URL = 'http://www.basketball-reference.com/leagues/NBA_%s.html'
SCHEDULE_URL = 'http://www.basketball-reference.com/teams/%s/%s_games.html'
BOXSCORE_URL = 'https://www.basketball-reference.com/boxscores/%s.html'
BOXSCORES_URL = ('https://www.basketball-reference.com/boxscores/'
'?month=%s&day=%s&year=%s')
PLAYER_URL = 'https://www.basketball-reference.com/players/%s/%s.html'
ROSTER_URL = 'https://www.basketball-reference.com/teams/%s/%s.html'
|
parsing_scheme = {'name': 'a', 'games_played': 'td[data-stat="g"]:first', 'minutes_played': 'td[data-stat="mp"]:first', 'field_goals': 'td[data-stat="fg"]:first', 'field_goal_attempts': 'td[data-stat="fga"]:first', 'field_goal_percentage': 'td[data-stat="fg_pct"]:first', 'three_point_field_goals': 'td[data-stat="fg3"]:first', 'three_point_field_goal_attempts': 'td[data-stat="fg3a"]:first', 'three_point_field_goal_percentage': 'td[data-stat="fg3_pct"]:first', 'two_point_field_goals': 'td[data-stat="fg2"]:first', 'two_point_field_goal_attempts': 'td[data-stat="fg2a"]:first', 'two_point_field_goal_percentage': 'td[data-stat="fg2_pct"]:first', 'free_throws': 'td[data-stat="ft"]:first', 'free_throw_attempts': 'td[data-stat="fta"]:first', 'free_throw_percentage': 'td[data-stat="ft_pct"]:first', 'offensive_rebounds': 'td[data-stat="orb"]:first', 'defensive_rebounds': 'td[data-stat="drb"]:first', 'total_rebounds': 'td[data-stat="trb"]:first', 'assists': 'td[data-stat="ast"]:first', 'steals': 'td[data-stat="stl"]:first', 'blocks': 'td[data-stat="blk"]:first', 'turnovers': 'td[data-stat="tov"]:first', 'personal_fouls': 'td[data-stat="pf"]:first', 'points': 'td[data-stat="pts"]:first', 'opp_minutes_played': 'td[data-stat="mp"]:first', 'opp_field_goals': 'td[data-stat="opp_fg"]:first', 'opp_field_goal_attempts': 'td[data-stat="opp_fga"]:first', 'opp_field_goal_percentage': 'td[data-stat="opp_fg_pct"]:first', 'opp_three_point_field_goals': 'td[data-stat="opp_fg3"]:first', 'opp_three_point_field_goal_attempts': 'td[data-stat="opp_fg3a"]:first', 'opp_three_point_field_goal_percentage': 'td[data-stat="opp_fg3_pct"]:first', 'opp_two_point_field_goals': 'td[data-stat="opp_fg2"]:first', 'opp_two_point_field_goal_attempts': 'td[data-stat="opp_fg2a"]:first', 'opp_two_point_field_goal_percentage': 'td[data-stat="opp_fg2_pct"]:first', 'opp_free_throws': 'td[data-stat="opp_ft"]:first', 'opp_free_throw_attempts': 'td[data-stat="opp_fta"]:first', 'opp_free_throw_percentage': 'td[data-stat="opp_ft_pct"]:first', 'opp_offensive_rebounds': 'td[data-stat="opp_orb"]:first', 'opp_defensive_rebounds': 'td[data-stat="opp_drb"]:first', 'opp_total_rebounds': 'td[data-stat="opp_trb"]:first', 'opp_assists': 'td[data-stat="opp_ast"]:first', 'opp_steals': 'td[data-stat="opp_stl"]:first', 'opp_blocks': 'td[data-stat="opp_blk"]:first', 'opp_turnovers': 'td[data-stat="opp_tov"]:first', 'opp_personal_fouls': 'td[data-stat="opp_pf"]:first', 'opp_points': 'td[data-stat="opp_pts"]:first'}
schedule_scheme = {'game': 'th[data-stat="g"]:first', 'date': 'td[data-stat="date_game"]:first', 'time': 'td[data-stat="game_start_time"]:first', 'boxscore': 'td[data-stat="box_score_text"]:first', 'location': 'td[data-stat="game_location"]:first', 'opponent_abbr': 'td[data-stat="opp_id"]:first', 'opponent_name': 'td[data-stat="opp_name"]:first', 'result': 'td[data-stat="game_result"]:first', 'points_scored': 'td[data-stat="pts"]:first', 'points_allowed': 'td[data-stat="opp_pts"]:first', 'wins': 'td[data-stat="wins"]:first', 'losses': 'td[data-stat="losses"]:first', 'streak': 'td[data-stat="game_streak"]:first'}
boxscore_scheme = {'date': 'div[class="scorebox_meta"]', 'location': 'div[class="scorebox_meta"]', 'away_name': 'a[itemprop="name"]:first', 'home_name': 'a[itemprop="name"]:last', 'winning_name': '', 'winning_abbr': '', 'losing_name': '', 'losing_abbr': '', 'summary': 'table#line_score', 'pace': 'td[data-stat="pace"]:first', 'away_record': 'div[class="table_wrapper"] h2', 'away_minutes_played': 'tfoot td[data-stat="mp"]', 'away_field_goals': 'tfoot td[data-stat="fg"]', 'away_field_goal_attempts': 'tfoot td[data-stat="fga"]', 'away_field_goal_percentage': 'tfoot td[data-stat="fg_pct"]', 'away_two_point_field_goals': 'tfoot td[data-stat="fg2"]', 'away_two_point_field_goal_attempts': 'tfoot td[data-stat="fg2a"]', 'away_two_point_field_goal_percentage': 'tfoot td[data-stat="fg2_pct"]', 'away_three_point_field_goals': 'tfoot td[data-stat="fg3"]', 'away_three_point_field_goal_attempts': 'tfoot td[data-stat="fg3a"]', 'away_three_point_field_goal_percentage': 'tfoot td[data-stat="fg3_pct"]', 'away_free_throws': 'tfoot td[data-stat="ft"]', 'away_free_throw_attempts': 'tfoot td[data-stat="fta"]', 'away_free_throw_percentage': 'tfoot td[data-stat="ft_pct"]', 'away_offensive_rebounds': 'tfoot td[data-stat="orb"]', 'away_defensive_rebounds': 'tfoot td[data-stat="drb"]', 'away_total_rebounds': 'tfoot td[data-stat="trb"]', 'away_assists': 'tfoot td[data-stat="ast"]', 'away_steals': 'tfoot td[data-stat="stl"]', 'away_blocks': 'tfoot td[data-stat="blk"]', 'away_turnovers': 'tfoot td[data-stat="tov"]', 'away_personal_fouls': 'tfoot td[data-stat="pf"]', 'away_points': 'tfoot td[data-stat="pts"]', 'away_true_shooting_percentage': 'tfoot td[data-stat="ts_pct"]', 'away_effective_field_goal_percentage': 'tfoot td[data-stat="efg_pct"]', 'away_three_point_attempt_rate': 'tfoot td[data-stat="fg3a_per_fga_pct"]', 'away_free_throw_attempt_rate': 'tfoot td[data-stat="fta_per_fga_pct"]', 'away_offensive_rebound_percentage': 'tfoot td[data-stat="orb_pct"]', 'away_defensive_rebound_percentage': 'tfoot td[data-stat="drb_pct"]', 'away_total_rebound_percentage': 'tfoot td[data-stat="trb_pct"]', 'away_assist_percentage': 'tfoot td[data-stat="ast_pct"]', 'away_steal_percentage': 'tfoot td[data-stat="stl_pct"]', 'away_block_percentage': 'tfoot td[data-stat="blk_pct"]', 'away_turnover_percentage': 'tfoot td[data-stat="tov_pct"]', 'away_offensive_rating': 'tfoot td[data-stat="off_rtg"]', 'away_defensive_rating': 'tfoot td[data-stat="def_rtg"]', 'home_record': 'div[class="table_wrapper"] h2', 'home_minutes_played': 'tfoot td[data-stat="mp"]', 'home_field_goals': 'tfoot td[data-stat="fg"]', 'home_field_goal_attempts': 'tfoot td[data-stat="fga"]', 'home_field_goal_percentage': 'tfoot td[data-stat="fg_pct"]', 'home_two_point_field_goals': 'tfoot td[data-stat="fg2"]', 'home_two_point_field_goal_attempts': 'tfoot td[data-stat="fg2a"]', 'home_two_point_field_goal_percentage': 'tfoot td[data-stat="fg2_pct"]', 'home_three_point_field_goals': 'tfoot td[data-stat="fg3"]', 'home_three_point_field_goal_attempts': 'tfoot td[data-stat="fg3a"]', 'home_three_point_field_goal_percentage': 'tfoot td[data-stat="fg3_pct"]', 'home_free_throws': 'tfoot td[data-stat="ft"]', 'home_free_throw_attempts': 'tfoot td[data-stat="fta"]', 'home_free_throw_percentage': 'tfoot td[data-stat="ft_pct"]', 'home_offensive_rebounds': 'tfoot td[data-stat="orb"]', 'home_defensive_rebounds': 'tfoot td[data-stat="drb"]', 'home_total_rebounds': 'tfoot td[data-stat="trb"]', 'home_assists': 'tfoot td[data-stat="ast"]', 'home_steals': 'tfoot td[data-stat="stl"]', 'home_blocks': 'tfoot td[data-stat="blk"]', 'home_turnovers': 'tfoot td[data-stat="tov"]', 'home_personal_fouls': 'tfoot td[data-stat="pf"]', 'home_points': 'div[class="score"]', 'home_true_shooting_percentage': 'tfoot td[data-stat="ts_pct"]', 'home_effective_field_goal_percentage': 'tfoot td[data-stat="efg_pct"]', 'home_three_point_attempt_rate': 'tfoot td[data-stat="fg3a_per_fga_pct"]', 'home_free_throw_attempt_rate': 'tfoot td[data-stat="fta_per_fga_pct"]', 'home_offensive_rebound_percentage': 'tfoot td[data-stat="orb_pct"]', 'home_defensive_rebound_percentage': 'tfoot td[data-stat="drb_pct"]', 'home_total_rebound_percentage': 'tfoot td[data-stat="trb_pct"]', 'home_assist_percentage': 'tfoot td[data-stat="ast_pct"]', 'home_steal_percentage': 'tfoot td[data-stat="stl_pct"]', 'home_block_percentage': 'tfoot td[data-stat="blk_pct"]', 'home_turnover_percentage': 'tfoot td[data-stat="tov_pct"]', 'home_offensive_rating': 'tfoot td[data-stat="off_rtg"]', 'home_defensive_rating': 'tfoot td[data-stat="def_rtg"]'}
boxscore_element_index = {'date': 0, 'location': 1, 'home_record': -1, 'home_minutes_played': 7, 'home_field_goals': 7, 'home_field_goal_attempts': 7, 'home_field_goal_percentage': 7, 'home_two_point_field_goals': 7, 'home_two_point_field_goal_attempts': 7, 'home_two_point_field_goal_percentage': 7, 'home_three_point_field_goals': 7, 'home_three_point_field_goal_attempts': 7, 'home_three_point_field_goal_percentage': 7, 'home_free_throws': 7, 'home_free_throw_attempts': 7, 'home_free_throw_percentage': 7, 'home_offensive_rebounds': 7, 'home_defensive_rebounds': 7, 'home_total_rebounds': 7, 'home_assists': 7, 'home_steals': 7, 'home_blocks': 7, 'home_turnovers': 7, 'home_personal_fouls': 7, 'home_points': -1, 'home_true_shooting_percentage': 7, 'home_effective_field_goal_percentage': 7, 'home_three_point_attempt_rate': 7, 'home_free_throw_attempt_rate': 7, 'home_offensive_rebound_percentage': 7, 'home_defensive_rebound_percentage': 7, 'home_total_rebound_percentage': 7, 'home_assist_percentage': 7, 'home_steal_percentage': 7, 'home_block_percentage': 7, 'home_turnover_percentage': 7, 'home_offensive_rating': 7, 'home_defensive_rating': 7}
player_scheme = {'summary': '[data-template="Partials/Teams/Summary"]', 'season': 'th[data-stat="season"]:first', 'name': 'h1', 'team_abbreviation': 'td[data-stat="team_id"]', 'position': 'td[data-stat="pos"]', 'height': 'span[itemprop="height"]', 'weight': 'span[itemprop="weight"]', 'birth_date': 'td[data-stat=""]', 'nationality': 'td[data-stat=""]', 'age': 'nobr', 'games_played': 'td[data-stat="g"]', 'games_started': 'td[data-stat="gs"]', 'minutes_played': 'td[data-stat="mp"]', 'field_goals': 'td[data-stat="fg"]', 'field_goal_attempts': 'td[data-stat="fga"]', 'field_goal_percentage': 'td[data-stat="fg_pct"]', 'three_pointers': 'td[data-stat="fg3"]', 'three_point_attempts': 'td[data-stat="fg3a"]', 'three_point_percentage': 'td[data-stat="fg3_pct"]', 'two_pointers': 'td[data-stat="fg2"]', 'two_point_attempts': 'td[data-stat="fg2a"]', 'two_point_percentage': 'td[data-stat="fg2_pct"]', 'effective_field_goal_percentage': 'td[data-stat="efg_pct"]', 'free_throws': 'td[data-stat="ft"]', 'free_throw_attempts': 'td[data-stat="fta"]', 'free_throw_percentage': 'td[data-stat="ft_pct"]', 'offensive_rebounds': 'td[data-stat="orb"]', 'defensive_rebounds': 'td[data-stat="drb"]', 'total_rebounds': 'td[data-stat="trb"]', 'assists': 'td[data-stat="ast"]', 'steals': 'td[data-stat="stl"]', 'blocks': 'td[data-stat="blk"]', 'turnovers': 'td[data-stat="tov"]', 'personal_fouls': 'td[data-stat="pf"]', 'points': 'td[data-stat="pts"]', 'player_efficiency_rating': 'td[data-stat="per"]', 'true_shooting_percentage': 'td[data-stat="ts_pct"]', 'three_point_attempt_rate': 'td[data-stat="fg3a_per_fga_pct"]', 'free_throw_attempt_rate': 'td[data-stat="fta_per_fga_pct"]', 'offensive_rebound_percentage': 'td[data-stat="orb_pct"]', 'defensive_rebound_percentage': 'td[data-stat="drb_pct"]', 'total_rebound_percentage': 'td[data-stat="trb_pct"]', 'assist_percentage': 'td[data-stat="ast_pct"]', 'steal_percentage': 'td[data-stat="stl_pct"]', 'block_percentage': 'td[data-stat="blk_pct"]', 'turnover_percentage': 'td[data-stat="tov_pct"]', 'usage_percentage': 'td[data-stat="usg_pct"]', 'offensive_win_shares': 'td[data-stat="ows"]', 'defensive_win_shares': 'td[data-stat="dws"]', 'win_shares': 'td[data-stat="ws"]', 'win_shares_per_48_minutes': 'td[data-stat="ws_per_48"]', 'offensive_box_plus_minus': 'td[data-stat="obpm"]', 'defensive_box_plus_minus': 'td[data-stat="dbpm"]', 'box_plus_minus': 'td[data-stat="bpm"]', 'defensive_rating': 'td[data-stat="def_rtg"]', 'offensive_rating': 'td[data-stat="off_rtg"]', 'boxscore_box_plus_minus': 'td[data-stat="plus_minus"]', 'value_over_replacement_player': 'td[data-stat="vorp"]', 'shooting_distance': 'td[data-stat="avg_dist"]', 'percentage_shots_two_pointers': 'td[data-stat="fg2a_pct_fga"]', 'percentage_zero_to_three_footers': 'td[data-stat="pct_fga_00_03"]', 'percentage_three_to_ten_footers': 'td[data-stat="pct_fga_03_10"]', 'percentage_ten_to_sixteen_footers': 'td[data-stat="pct_fga_10_16"]', 'percentage_sixteen_foot_plus_two_pointers': 'td[data-stat="pct_fga_16_xx"]', 'percentage_shots_three_pointers': 'td[data-stat="fg3a_pct_fga"]', 'field_goal_perc_zero_to_three_feet': 'td[data-stat="fg_pct_00_03"]', 'field_goal_perc_three_to_ten_feet': 'td[data-stat="fg_pct_03_10"]', 'field_goal_perc_ten_to_sixteen_feet': 'td[data-stat="fg_pct_10_16"]', 'field_goal_perc_sixteen_foot_plus_two_pointers': 'td[data-stat="fg_pct_16_xx"]', 'two_pointers_assisted_percentage': 'td[data-stat="fg2_pct_ast"]', 'percentage_field_goals_as_dunks': 'td[data-stat="pct_fg2_dunk"]', 'dunks': 'td[data-stat="fg2_dunk"]', 'three_pointers_assisted_percentage': 'td[data-stat="fg3_pct_ast"]', 'percentage_of_three_pointers_from_corner': 'td[data-stat="pct_fg3a_corner"]', 'three_point_shot_percentage_from_corner': 'td[data-stat="fg3_pct_corner"]', 'half_court_heaves': 'td[data-stat="fg3a_heave"]', 'half_court_heaves_made': 'td[data-stat="fg3_heave"]', 'point_guard_percentage': 'td[data-stat="pct_1"]', 'shooting_guard_percentage': 'td[data-stat="pct_2"]', 'small_forward_percentage': 'td[data-stat="pct_3"]', 'power_forward_percentage': 'td[data-stat="pct_4"]', 'center_percentage': 'td[data-stat="pct_5"]', 'on_court_plus_minus': 'td[data-stat="plus_minus_on"]', 'net_plus_minus': 'td[data-stat="plus_minus_net"]', 'passing_turnovers': 'td[data-stat="tov_bad_pass"]', 'lost_ball_turnovers': 'td[data-stat="tov_lost_ball"]', 'other_turnovers': 'td[data-stat="tov_other"]', 'shooting_fouls': 'td[data-stat="fouls_shooting"]', 'blocking_fouls': 'td[data-stat="fouls_blocking"]', 'offensive_fouls': 'td[data-stat="fouls_offensive"]', 'take_fouls': 'td[data-stat="fouls_take"]', 'points_generated_by_assists': 'td[data-stat="astd_pts"]', 'shooting_fouls_drawn': 'td[data-stat="drawn_shooting"]', 'and_ones': 'td[data-stat="and1s"]', 'shots_blocked': 'td[data-stat="fga_blkd"]', 'salary': 'td[data-stat="salary"]', 'field_goals_per_poss': 'td[data-stat="fg_per_poss"]', 'field_goal_attempts_per_poss': 'td[data-stat="fga_per_poss"]', 'three_pointers_per_poss': 'td[data-stat="fg3_per_poss"]', 'three_point_attempts_per_poss': 'td[data-stat="fg3a_per_poss"]', 'two_pointers_per_poss': 'td[data-stat="fg2_per_poss"]', 'two_point_attempts_per_poss': 'td[data-stat="fg2a_per_poss"]', 'free_throws_per_poss': 'td[data-stat="ft_per_poss"]', 'free_throw_attempts_per_poss': 'td[data-stat="fta_per_poss"]', 'offensive_rebounds_per_poss': 'td[data-stat="orb_per_poss"]', 'defensive_rebounds_per_poss': 'td[data-stat="drb_per_poss"]', 'total_rebounds_per_poss': 'td[data-stat="trb_per_poss"]', 'assists_per_poss': 'td[data-stat="ast_per_poss"]', 'steals_per_poss': 'td[data-stat="stl_per_poss"]', 'blocks_per_poss': 'td[data-stat="blk_per_poss"]', 'turnovers_per_poss': 'td[data-stat="tov_per_poss"]', 'personal_fouls_per_poss': 'td[data-stat="pf_per_poss"]', 'points_per_poss': 'td[data-stat="pts_per_poss"]'}
nationality = {'ao': 'Angola', 'ag': 'Antigua and Barbuda', 'ar': 'Argentina', 'au': 'Australia', 'at': 'Austria', 'bs': 'Bahamas', 'be': 'Belgium', 'ba': 'Bosnia and Herzegovina', 'br': 'Brazil', 'bg': 'Bulgaria', 'cm': 'Cameroon', 'ca': 'Canada', 'td': 'Chad', 'co': 'Colombia', 'cv': 'Cape Verde', 'cn': 'China', 'hr': 'Croatia', 'cu': 'Cuba', 'cz': 'Czech Republic', 'cd': 'Democratic Replubic of Congo', 'dk': 'Denmark', 'dm': 'Dominica', 'do': 'Dominican Replubic', 'eg': 'Egypt', 'ee': 'Estonia', 'fi': 'Finland', 'fr': 'France', 'gf': 'French Guiana', 'ga': 'Gabon', 'ge': 'Georgia', 'de': 'Germany', 'gh': 'Ghana', 'gr': 'Greece', 'gp': 'Guadeloupe', 'gn': 'Guinea', 'gy': 'Guyana', 'ht': 'Haiti', 'hu': 'Hungary', 'is': 'Iceland', 'ie': 'Ireland', 'ir': 'Islamic Replubic of Iran', 'il': 'Israel', 'it': 'Italy', 'jm': 'Jamaica', 'jp': 'Japan', 'lv': 'Latvia', 'lb': 'Lebanon', 'lt': 'Lithuania', 'lu': 'Luxembourg', 'ml': 'Mali', 'mq': 'Martinique', 'mx': 'Mexico', 'me': 'Montenegro', 'ma': 'Morocco', 'nl': 'Netherlands', 'nz': 'New Zealand', 'ng': 'Nigeria', 'no': 'Norway', 'pa': 'Panama', 'pl': 'Poland', 'pr': 'Puerto Rico', 'ke': 'Kenya', 'kr': 'Republic of Korea', 'mk': 'Republic of Macedonia', 'cg': 'Republic of Congo', 'ro': 'Romania', 'ru': 'Russian Federation', 'lc': 'Saint Lucia', 'vc': 'Saint Vincent and the Grenadines', 'sd': 'Sudan', 'sn': 'Senegal', 'rs': 'Serbia', 'sk': 'Slovakia', 'si': 'Slovenia', 'za': 'South Africa', 'ss': 'South Sudan', 'es': 'Spain', 'se': 'Sweden', 'ch': 'Switzerland', 'tw': 'Taiwan', 'tt': 'Trinidad and Tobago', 'tn': 'Tunisia', 'tr': 'Turkey', 'us': 'United States of America', 'vi': 'U.S. Virgin Islands', 'ua': 'Ukraine', 'gb': 'United Kingdom', 'tz': 'United Republic of Tanzania', 'uy': 'Uruguay', 've': 'Venezuela'}
season_page_url = 'http://www.basketball-reference.com/leagues/NBA_%s.html'
schedule_url = 'http://www.basketball-reference.com/teams/%s/%s_games.html'
boxscore_url = 'https://www.basketball-reference.com/boxscores/%s.html'
boxscores_url = 'https://www.basketball-reference.com/boxscores/?month=%s&day=%s&year=%s'
player_url = 'https://www.basketball-reference.com/players/%s/%s.html'
roster_url = 'https://www.basketball-reference.com/teams/%s/%s.html'
|
class NuGetPackage(GitHubTarballPackage):
def __init__(self):
GitHubTarballPackage.__init__(self,
'mono', 'nuget',
'2.8.5',
'ea1d244b066338c9408646afdcf8acae6299f7fb',
configure = '')
def build(self):
self.sh ('%{make} PREFIX=%{package_prefix}')
def install(self):
self.sh ('%{makeinstall} PREFIX=%{staged_prefix}')
NuGetPackage()
|
class Nugetpackage(GitHubTarballPackage):
def __init__(self):
GitHubTarballPackage.__init__(self, 'mono', 'nuget', '2.8.5', 'ea1d244b066338c9408646afdcf8acae6299f7fb', configure='')
def build(self):
self.sh('%{make} PREFIX=%{package_prefix}')
def install(self):
self.sh('%{makeinstall} PREFIX=%{staged_prefix}')
nu_get_package()
|
class Cat:
def __init__(self, name, age):
self.name = name
self.age = age
def info(self):
print(f"I am a cat. My name is {self.name}. I am {self.age} years old.")
def make_sound(self):
print("Meow")
class Dog:
def __init__(self, name, age):
self.name = name
self.age = age
def info(self):
print(f"I am a dog. My name is {self.name}. I am {self.age} years old.")
def make_sound(self):
print("Bark")
cat1 = Cat("Kitty", 2.5)
cat2 = Cat("Catty", 3.0)
dog1 = Dog("Fluffy", 4)
dog2 = Dog("Doggy", 4.5)
animals = [cat1, cat2, dog1, dog2]
for animal in animals:
animal.make_sound()
animal.info()
animal.make_sound()
|
class Cat:
def __init__(self, name, age):
self.name = name
self.age = age
def info(self):
print(f'I am a cat. My name is {self.name}. I am {self.age} years old.')
def make_sound(self):
print('Meow')
class Dog:
def __init__(self, name, age):
self.name = name
self.age = age
def info(self):
print(f'I am a dog. My name is {self.name}. I am {self.age} years old.')
def make_sound(self):
print('Bark')
cat1 = cat('Kitty', 2.5)
cat2 = cat('Catty', 3.0)
dog1 = dog('Fluffy', 4)
dog2 = dog('Doggy', 4.5)
animals = [cat1, cat2, dog1, dog2]
for animal in animals:
animal.make_sound()
animal.info()
animal.make_sound()
|
#!/usr/bin/python
# Copyright 2015 Neuhold Markus and Kleinsasser Mario
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
smsgatewayabspath = None
watchdogThread = None
watchdogThreadNotify = None
# For route-based watchdogs
watchdogRouteThread = {}
watchdogRouteThreadNotify = {}
watchdogRouteThreadQueue = {}
routerThread = None
rdb = None
cleanupseconds = None
wisid = None
wisport = None
wisipaddress = None
pissendtimeout = None
ldapenabled = None
ldapserver = None
ldapbasedn = None
ldapusers = None
sslenabled = None
sslcertificate = None
sslprivatekey = None
sslcertificatechain = None
validusernameregex = None
validusernamelength = None
version = None
|
smsgatewayabspath = None
watchdog_thread = None
watchdog_thread_notify = None
watchdog_route_thread = {}
watchdog_route_thread_notify = {}
watchdog_route_thread_queue = {}
router_thread = None
rdb = None
cleanupseconds = None
wisid = None
wisport = None
wisipaddress = None
pissendtimeout = None
ldapenabled = None
ldapserver = None
ldapbasedn = None
ldapusers = None
sslenabled = None
sslcertificate = None
sslprivatekey = None
sslcertificatechain = None
validusernameregex = None
validusernamelength = None
version = None
|
class DistributedRouter:
def allow_migrate(self, db, app_label, model_name=None, **hints):
if model_name in ['user', 'settings']:
return db == 'parser'
if model_name in ['search', 'betdata']:
return db == 'betdata'
return True
|
class Distributedrouter:
def allow_migrate(self, db, app_label, model_name=None, **hints):
if model_name in ['user', 'settings']:
return db == 'parser'
if model_name in ['search', 'betdata']:
return db == 'betdata'
return True
|
contador_externo = 0
contador_interno = 0
while contador_externo < 5:
while contador_interno < 6:
print(contador_externo, contador_interno)
contador_interno += 1
contador_externo += 1
contador_interno = 0
|
contador_externo = 0
contador_interno = 0
while contador_externo < 5:
while contador_interno < 6:
print(contador_externo, contador_interno)
contador_interno += 1
contador_externo += 1
contador_interno = 0
|
# Python: QuickSort
def quick_sort(arr):
start = 0
end = len(arr) - 1
__quick_sort(arr, start, end)
def __quick_sort(arr, start, end):
if start < end:
pertition_index = __pertition(arr, start, end)
__quick_sort(arr, start, pertition_index - 1)
__quick_sort(arr, pertition_index + 1, end)
def __pertition(arr, start, end):
pivot_elm = arr[end]
pertition_index = start
for i in range(start, end):
if arr[i] <= pivot_elm:
arr[i], arr[pertition_index] = arr[pertition_index], arr[i]
pertition_index += 1
arr[end], arr[pertition_index] = arr[pertition_index], arr[end]
return pertition_index
|
def quick_sort(arr):
start = 0
end = len(arr) - 1
__quick_sort(arr, start, end)
def __quick_sort(arr, start, end):
if start < end:
pertition_index = __pertition(arr, start, end)
__quick_sort(arr, start, pertition_index - 1)
__quick_sort(arr, pertition_index + 1, end)
def __pertition(arr, start, end):
pivot_elm = arr[end]
pertition_index = start
for i in range(start, end):
if arr[i] <= pivot_elm:
(arr[i], arr[pertition_index]) = (arr[pertition_index], arr[i])
pertition_index += 1
(arr[end], arr[pertition_index]) = (arr[pertition_index], arr[end])
return pertition_index
|
def heapify(array, size, index):
largest = index
left = 2 * index + 1
right = 2 * index + 2
if left < size and array[index] < array[left]:
largest = left
if right < size and array[largest] < array[right]:
largest = right
if largest != index:
array[index], array[largest] = array[largest], array[index]
heapify(array, size, largest)
def heap_sort(array):
size = len(array)
for index in range(size//2 - 1, -1, -1):
heapify(array, size, index)
for index in range(size - 1, 0, -1):
array[index], array[0] = array[0], array[index]
heapify(array, index, 0)
if __name__ == '__main__':
array = [19, 50, 27, 7, 2020, 14, 18, 1, 12, 23, 200, 2201]
heap_sort(array)
print(array)
|
def heapify(array, size, index):
largest = index
left = 2 * index + 1
right = 2 * index + 2
if left < size and array[index] < array[left]:
largest = left
if right < size and array[largest] < array[right]:
largest = right
if largest != index:
(array[index], array[largest]) = (array[largest], array[index])
heapify(array, size, largest)
def heap_sort(array):
size = len(array)
for index in range(size // 2 - 1, -1, -1):
heapify(array, size, index)
for index in range(size - 1, 0, -1):
(array[index], array[0]) = (array[0], array[index])
heapify(array, index, 0)
if __name__ == '__main__':
array = [19, 50, 27, 7, 2020, 14, 18, 1, 12, 23, 200, 2201]
heap_sort(array)
print(array)
|
'''
Description : Use Of Local Scope
Function Date : 05 Feb 2021
Function Author : Prasad Dangare
Input : Int
Output : Int
'''
x = 50
def func(x):
print ('x is', x)
x = 2
print ('Changed local x to', x)
func(x)
print ('x is still', x)
|
"""
Description : Use Of Local Scope
Function Date : 05 Feb 2021
Function Author : Prasad Dangare
Input : Int
Output : Int
"""
x = 50
def func(x):
print('x is', x)
x = 2
print('Changed local x to', x)
func(x)
print('x is still', x)
|
"""
321. Create Maximum Number
Given two arrays of length m and n with digits 0-9 representing two numbers. Create the maximum number of length k <= m + n from digits of the two. The relative order of the digits from the same array must be preserved. Return an array of the k digits.
Note: You should try to optimize your time and space complexity.
"""
# simple math problem
# Runtime: 420 ms, faster than 69.02% of Python3 online submissions for Create Maximum Number.
# Memory Usage: 14 MB, less than 53.99% of Python3 online submissions for Create Maximum Number.
class Solution:
def maxNumber(self, nums1: List[int], nums2: List[int], k: int) -> List[int]:
def getK(nums, k):
n = len(nums)
to_pop = n - k
ans = []
for num in nums:
while len(ans) > 0 and num > ans[-1] and to_pop > 0:
to_pop -= 1
ans.pop()
ans.append(num)
return ans[:k]
def getMax(nums1, nums2):
ans = []
while nums1 and nums2:
if nums1 > nums2:
ans.append(nums1.pop(0))
else:
ans.append(nums2.pop(0))
if nums1:
ans += nums1
else:
ans += nums2
return ans
n1 = len(nums1)
n2 = len(nums2)
ans = []
for k1 in range(k+1):
k2 = k - k1
if k1 > n1 or k2 > n2:
continue
ans = max(ans, getMax(getK(nums1, k1), getK(nums2, k2)))
return ans
|
"""
321. Create Maximum Number
Given two arrays of length m and n with digits 0-9 representing two numbers. Create the maximum number of length k <= m + n from digits of the two. The relative order of the digits from the same array must be preserved. Return an array of the k digits.
Note: You should try to optimize your time and space complexity.
"""
class Solution:
def max_number(self, nums1: List[int], nums2: List[int], k: int) -> List[int]:
def get_k(nums, k):
n = len(nums)
to_pop = n - k
ans = []
for num in nums:
while len(ans) > 0 and num > ans[-1] and (to_pop > 0):
to_pop -= 1
ans.pop()
ans.append(num)
return ans[:k]
def get_max(nums1, nums2):
ans = []
while nums1 and nums2:
if nums1 > nums2:
ans.append(nums1.pop(0))
else:
ans.append(nums2.pop(0))
if nums1:
ans += nums1
else:
ans += nums2
return ans
n1 = len(nums1)
n2 = len(nums2)
ans = []
for k1 in range(k + 1):
k2 = k - k1
if k1 > n1 or k2 > n2:
continue
ans = max(ans, get_max(get_k(nums1, k1), get_k(nums2, k2)))
return ans
|
catName1 = input()
print('Enter the name of cat 2:')
catName2 = input()
print('Enter the name of cat 3:')
catName3 = input()
print('Enter the name of cat 4:')
catName4 = input()
print('Enter the name of cat 5:')
catName5 = input()
print('Enter the name of cat 6:')
catName6 = input()
print(catName1 + ' ' + catName2 + ' ' + catName3 + ' ' +
catName4 + ' ' + catName5 + ' ' + catName6)
|
cat_name1 = input()
print('Enter the name of cat 2:')
cat_name2 = input()
print('Enter the name of cat 3:')
cat_name3 = input()
print('Enter the name of cat 4:')
cat_name4 = input()
print('Enter the name of cat 5:')
cat_name5 = input()
print('Enter the name of cat 6:')
cat_name6 = input()
print(catName1 + ' ' + catName2 + ' ' + catName3 + ' ' + catName4 + ' ' + catName5 + ' ' + catName6)
|
# -*- coding: utf-8 -*-
#
# __init__.py
#
# This module is part of skxtend.
#
"""
Initializer of skxtend tests.
"""
__author__ = 'Severin E. R. Langberg'
__email__ = '[email protected]'
__status__ = 'Operational'
|
"""
Initializer of skxtend tests.
"""
__author__ = 'Severin E. R. Langberg'
__email__ = '[email protected]'
__status__ = 'Operational'
|
TYPE_NAME = "mock"
def handler(value, **kwargs):
return "mock"
|
type_name = 'mock'
def handler(value, **kwargs):
return 'mock'
|
# ETA represents the learning rate. Higher values penalize feature weights more strongly
# Create your housing DMatrix: housing_dmatrix
housing_dmatrix = xgb.DMatrix(data=X, label=y)
# Create the parameter dictionary for each tree (boosting round)
params = {"objective":"reg:linear", "max_depth":3}
# Create list of eta values and empty list to store final round rmse per xgboost model
eta_vals = [0.001, 0.01, 0.1]
best_rmse = []
# Systematically vary the eta
for curr_val in eta_vals:
params["eta"] = curr_val
# Perform cross-validation: cv_results
cv_results = xgb.cv(
dtrain=housing_dmatrix, params=params, nfold=3, num_boost_round=10,
early_stopping_rounds=5, metrics="rmse", seed=123, as_pandas=True
)
# Append the final round rmse to best_rmse
best_rmse.append(cv_results["test-rmse-mean"].tail().values[-1])
# Print the resultant DataFrame
print(pd.DataFrame(list(zip(eta_vals, best_rmse)), columns=["eta","best_rmse"]))
|
housing_dmatrix = xgb.DMatrix(data=X, label=y)
params = {'objective': 'reg:linear', 'max_depth': 3}
eta_vals = [0.001, 0.01, 0.1]
best_rmse = []
for curr_val in eta_vals:
params['eta'] = curr_val
cv_results = xgb.cv(dtrain=housing_dmatrix, params=params, nfold=3, num_boost_round=10, early_stopping_rounds=5, metrics='rmse', seed=123, as_pandas=True)
best_rmse.append(cv_results['test-rmse-mean'].tail().values[-1])
print(pd.DataFrame(list(zip(eta_vals, best_rmse)), columns=['eta', 'best_rmse']))
|
class ProjectAttributes:
def __init__(self, project_instance):
self.project_instance = project_instance
self.proj_name = project_instance.get_project_name()
self.proj_loc = project_instance.get_project_loc()
self.source_file_count = len(project_instance.get_project_source_files().get_files())
def get_project_name(self):
"""
Returns the project name.
:param: None
:returns: Name of the project
:rtype: str
"""
return self.proj_name
def get_project_loc(self):
"""
Returns the project kloc.
:param: None
:returns: KLOC of the project
:rtype: float
"""
return self.proj_loc
def get_source_file_count(self):
"""
Returns the count of source files in the project.
:param: None
:returns: Count of source files in the project
:rtype: int
"""
return self.source_file_count
|
class Projectattributes:
def __init__(self, project_instance):
self.project_instance = project_instance
self.proj_name = project_instance.get_project_name()
self.proj_loc = project_instance.get_project_loc()
self.source_file_count = len(project_instance.get_project_source_files().get_files())
def get_project_name(self):
"""
Returns the project name.
:param: None
:returns: Name of the project
:rtype: str
"""
return self.proj_name
def get_project_loc(self):
"""
Returns the project kloc.
:param: None
:returns: KLOC of the project
:rtype: float
"""
return self.proj_loc
def get_source_file_count(self):
"""
Returns the count of source files in the project.
:param: None
:returns: Count of source files in the project
:rtype: int
"""
return self.source_file_count
|
"""
Definition of TreeNode:
class TreeNode:
def __init__(self, val):
self.val = val
self.left, self.right = None, None
"""
# Solution1: No more to say.
class Solution:
"""
@param inorder: A list of integers that inorder traversal of a tree
@param postorder: A list of integers that postorder traversal of a tree
@return: Root of a tree
"""
def buildTree(self, inorder, postorder):
if inorder and postorder:
middle = TreeNode(postorder[-1])
index = inorder.index(postorder[-1])
middle.left = self.buildTree(inorder[:index], postorder[:index])
middle.right = self.buildTree(inorder[index+1:], postorder[index:-1])
return middle
|
"""
Definition of TreeNode:
class TreeNode:
def __init__(self, val):
self.val = val
self.left, self.right = None, None
"""
class Solution:
"""
@param inorder: A list of integers that inorder traversal of a tree
@param postorder: A list of integers that postorder traversal of a tree
@return: Root of a tree
"""
def build_tree(self, inorder, postorder):
if inorder and postorder:
middle = tree_node(postorder[-1])
index = inorder.index(postorder[-1])
middle.left = self.buildTree(inorder[:index], postorder[:index])
middle.right = self.buildTree(inorder[index + 1:], postorder[index:-1])
return middle
|
#
# PySNMP MIB module NBASE-EXP-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/NBASE-EXP-MIB
# Produced by pysmi-0.3.4 at Wed May 1 14:17:07 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, ConstraintsIntersection, ValueRangeConstraint, ConstraintsUnion, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ConstraintsIntersection", "ValueRangeConstraint", "ConstraintsUnion", "SingleValueConstraint")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
ObjectIdentity, enterprises, iso, Integer32, Bits, MibScalar, MibTable, MibTableRow, MibTableColumn, NotificationType, Counter32, TimeTicks, Counter64, Gauge32, ModuleIdentity, Unsigned32, IpAddress, MibIdentifier = mibBuilder.importSymbols("SNMPv2-SMI", "ObjectIdentity", "enterprises", "iso", "Integer32", "Bits", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "NotificationType", "Counter32", "TimeTicks", "Counter64", "Gauge32", "ModuleIdentity", "Unsigned32", "IpAddress", "MibIdentifier")
TextualConvention, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DisplayString")
nbase = MibIdentifier((1, 3, 6, 1, 4, 1, 629))
nbSwitchG1 = MibIdentifier((1, 3, 6, 1, 4, 1, 629, 1))
nbsMegaMibs = MibIdentifier((1, 3, 6, 1, 4, 1, 629, 1, 16))
nbsExpansionPortMIB = MibIdentifier((1, 3, 6, 1, 4, 1, 629, 1, 16, 1))
nbsAtmLanePortMIB = MibIdentifier((1, 3, 6, 1, 4, 1, 629, 1, 16, 2))
nbsFddiPortMIB = MibIdentifier((1, 3, 6, 1, 4, 1, 629, 1, 16, 3))
nbsExpPortMaxNum = MibScalar((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortMaxNum.setStatus('mandatory')
nbsExpPortTable = MibTable((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2), )
if mibBuilder.loadTexts: nbsExpPortTable.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTable.setDescription('A table of Expansion Ports in the devices.')
nbsExpPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1), ).setIndexNames((0, "NBASE-EXP-MIB", "nbsExpPortTblPortNumber"))
if mibBuilder.loadTexts: nbsExpPortEntry.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortEntry.setDescription('Contains the features general to NBase Expansion port modules.')
nbsExpPortTblPortNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortTblPortNumber.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTblPortNumber.setDescription('The Port Number of the Expansion Port. This port number is the same as the port number used for all other purposes.')
nbsExpPortTblHwType = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("other", 1), ("cpu-card", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortTblHwType.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTblHwType.setDescription('The Hardware Type of the Expansion port.')
nbsExpPortTblSwType = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5))).clone(namedValues=NamedValues(("other", 1), ("atm-lec", 2), ("atm-mpoa", 3), ("fddi", 4), ("wan-router", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortTblSwType.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTblSwType.setDescription('The Software Type of the Expansion port.')
nbsExpPortTblSquall = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 4), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortTblSquall.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTblSquall.setDescription('The Squall Module, if any, attached to this Expansion Port.')
nbsExpPortTblHwVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 5), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortTblHwVersion.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTblHwVersion.setDescription('A description of the Hardware Version of the Expansion Port.')
nbsExpPortTblMCodeVrsn = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 6), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortTblMCodeVrsn.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTblMCodeVrsn.setDescription('A description of the Hardware Version of the Expansion Port.')
nbsExpPortTblSwVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 7), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortTblSwVersion.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTblSwVersion.setDescription('A description of the Software Version of the Expansion Port.')
nbsExpPortTblStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 8), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("other", 1), ("ok", 2), ("error", 3)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsExpPortTblStatus.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTblStatus.setDescription('The status of the Expansion Port.')
nbsExpPortTftpSwFileName = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 9), DisplayString()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: nbsExpPortTftpSwFileName.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortTftpSwFileName.setDescription('The Software File Name for the Expansion Port. This is the remote file name string provided to the TFTP client application when starting a Firmware Update process. This value is stored in the system NVRAM as well as in the SNMP Agent current configuration.')
nbsExpPortInitDownload = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 10), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("active", 1), ("inactive", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: nbsExpPortInitDownload.setStatus('mandatory')
if mibBuilder.loadTexts: nbsExpPortInitDownload.setDescription('This is used to initiate a download session from the TFTP server. The filename which will be requested my be modified via the nbsExpPortTftpSwFileName object. Note that the only writeable value is active(1), if no session is active at this moment.')
nbsAtmLanePortMaxNum = MibScalar((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsAtmLanePortMaxNum.setStatus('mandatory')
nbsAtmLanePortTable = MibTable((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2), )
if mibBuilder.loadTexts: nbsAtmLanePortTable.setStatus('mandatory')
if mibBuilder.loadTexts: nbsAtmLanePortTable.setDescription('A table of Lan Emulation Clients, indexed by the physical port number.')
nbsAtmLanePortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1), ).setIndexNames((0, "NBASE-EXP-MIB", "nbsAtmLanePortNumber"))
if mibBuilder.loadTexts: nbsAtmLanePortEntry.setStatus('mandatory')
if mibBuilder.loadTexts: nbsAtmLanePortEntry.setDescription('Contains the features specific to the ATM Lan Emulation Client.')
nbsAtmLanePortNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsAtmLanePortNumber.setStatus('mandatory')
if mibBuilder.loadTexts: nbsAtmLanePortNumber.setDescription('The Port Number of the Lan Emulation Client.')
laneLecsAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1, 2), OctetString().subtype(subtypeSpec=ValueSizeConstraint(20, 20)).setFixedLength(20)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: laneLecsAddress.setStatus('mandatory')
if mibBuilder.loadTexts: laneLecsAddress.setDescription('The ATM Address (20 Octet string) of the desired Lan Emulation Configuration Server.')
sonetCircuitId = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1, 3), DisplayString()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: sonetCircuitId.setStatus('mandatory')
if mibBuilder.loadTexts: sonetCircuitId.setDescription('The Circuit Identifier, if any for the SONET interface. This information is typically provided by the owner of the SONET physical line.')
signalingStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("up", 1), ("down", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: signalingStatus.setStatus('mandatory')
if mibBuilder.loadTexts: signalingStatus.setDescription('The Status of the ATM UNI signaling between the uplink and the ATM switch')
nbsFddiPortMaxNum = MibScalar((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsFddiPortMaxNum.setStatus('mandatory')
nbsFddiPortTable = MibTable((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 2), )
if mibBuilder.loadTexts: nbsFddiPortTable.setStatus('mandatory')
if mibBuilder.loadTexts: nbsFddiPortTable.setDescription('A table of FDDI ports, indexed by the physical port number.')
nbsFddiPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 2, 1), ).setIndexNames((0, "NBASE-EXP-MIB", "nbsFddiPortNumber"))
if mibBuilder.loadTexts: nbsFddiPortEntry.setStatus('mandatory')
if mibBuilder.loadTexts: nbsFddiPortEntry.setDescription('Contains the features specific to the FDDI Port.')
nbsFddiPortNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 2, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsFddiPortNumber.setStatus('mandatory')
if mibBuilder.loadTexts: nbsFddiPortNumber.setDescription('The Port Number of the Lan Emulation Client.')
nbsFddiSmtIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 2, 1, 2), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nbsFddiSmtIndex.setStatus('mandatory')
if mibBuilder.loadTexts: nbsFddiSmtIndex.setDescription('The FDDI MIB SMT index number of this port')
mibBuilder.exportSymbols("NBASE-EXP-MIB", nbsFddiPortMIB=nbsFddiPortMIB, nbsFddiPortEntry=nbsFddiPortEntry, laneLecsAddress=laneLecsAddress, nbsExpPortInitDownload=nbsExpPortInitDownload, signalingStatus=signalingStatus, nbsMegaMibs=nbsMegaMibs, nbsAtmLanePortNumber=nbsAtmLanePortNumber, nbsExpPortMaxNum=nbsExpPortMaxNum, nbsAtmLanePortMIB=nbsAtmLanePortMIB, nbsExpPortTftpSwFileName=nbsExpPortTftpSwFileName, nbsFddiPortTable=nbsFddiPortTable, nbsFddiPortNumber=nbsFddiPortNumber, nbSwitchG1=nbSwitchG1, nbsExpPortTable=nbsExpPortTable, nbsExpPortTblStatus=nbsExpPortTblStatus, nbsExpansionPortMIB=nbsExpansionPortMIB, nbsExpPortTblPortNumber=nbsExpPortTblPortNumber, nbsExpPortTblSwType=nbsExpPortTblSwType, nbsExpPortEntry=nbsExpPortEntry, sonetCircuitId=sonetCircuitId, nbase=nbase, nbsAtmLanePortTable=nbsAtmLanePortTable, nbsExpPortTblHwVersion=nbsExpPortTblHwVersion, nbsExpPortTblSquall=nbsExpPortTblSquall, nbsFddiPortMaxNum=nbsFddiPortMaxNum, nbsExpPortTblHwType=nbsExpPortTblHwType, nbsExpPortTblSwVersion=nbsExpPortTblSwVersion, nbsExpPortTblMCodeVrsn=nbsExpPortTblMCodeVrsn, nbsAtmLanePortEntry=nbsAtmLanePortEntry, nbsFddiSmtIndex=nbsFddiSmtIndex, nbsAtmLanePortMaxNum=nbsAtmLanePortMaxNum)
|
(object_identifier, octet_string, integer) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'OctetString', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, constraints_intersection, value_range_constraint, constraints_union, single_value_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'ConstraintsIntersection', 'ValueRangeConstraint', 'ConstraintsUnion', 'SingleValueConstraint')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(object_identity, enterprises, iso, integer32, bits, mib_scalar, mib_table, mib_table_row, mib_table_column, notification_type, counter32, time_ticks, counter64, gauge32, module_identity, unsigned32, ip_address, mib_identifier) = mibBuilder.importSymbols('SNMPv2-SMI', 'ObjectIdentity', 'enterprises', 'iso', 'Integer32', 'Bits', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'NotificationType', 'Counter32', 'TimeTicks', 'Counter64', 'Gauge32', 'ModuleIdentity', 'Unsigned32', 'IpAddress', 'MibIdentifier')
(textual_convention, display_string) = mibBuilder.importSymbols('SNMPv2-TC', 'TextualConvention', 'DisplayString')
nbase = mib_identifier((1, 3, 6, 1, 4, 1, 629))
nb_switch_g1 = mib_identifier((1, 3, 6, 1, 4, 1, 629, 1))
nbs_mega_mibs = mib_identifier((1, 3, 6, 1, 4, 1, 629, 1, 16))
nbs_expansion_port_mib = mib_identifier((1, 3, 6, 1, 4, 1, 629, 1, 16, 1))
nbs_atm_lane_port_mib = mib_identifier((1, 3, 6, 1, 4, 1, 629, 1, 16, 2))
nbs_fddi_port_mib = mib_identifier((1, 3, 6, 1, 4, 1, 629, 1, 16, 3))
nbs_exp_port_max_num = mib_scalar((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortMaxNum.setStatus('mandatory')
nbs_exp_port_table = mib_table((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2))
if mibBuilder.loadTexts:
nbsExpPortTable.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTable.setDescription('A table of Expansion Ports in the devices.')
nbs_exp_port_entry = mib_table_row((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1)).setIndexNames((0, 'NBASE-EXP-MIB', 'nbsExpPortTblPortNumber'))
if mibBuilder.loadTexts:
nbsExpPortEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortEntry.setDescription('Contains the features general to NBase Expansion port modules.')
nbs_exp_port_tbl_port_number = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortTblPortNumber.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTblPortNumber.setDescription('The Port Number of the Expansion Port. This port number is the same as the port number used for all other purposes.')
nbs_exp_port_tbl_hw_type = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('other', 1), ('cpu-card', 2)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortTblHwType.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTblHwType.setDescription('The Hardware Type of the Expansion port.')
nbs_exp_port_tbl_sw_type = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 3), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4, 5))).clone(namedValues=named_values(('other', 1), ('atm-lec', 2), ('atm-mpoa', 3), ('fddi', 4), ('wan-router', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortTblSwType.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTblSwType.setDescription('The Software Type of the Expansion port.')
nbs_exp_port_tbl_squall = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 4), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortTblSquall.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTblSquall.setDescription('The Squall Module, if any, attached to this Expansion Port.')
nbs_exp_port_tbl_hw_version = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 5), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortTblHwVersion.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTblHwVersion.setDescription('A description of the Hardware Version of the Expansion Port.')
nbs_exp_port_tbl_m_code_vrsn = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 6), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortTblMCodeVrsn.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTblMCodeVrsn.setDescription('A description of the Hardware Version of the Expansion Port.')
nbs_exp_port_tbl_sw_version = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 7), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortTblSwVersion.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTblSwVersion.setDescription('A description of the Software Version of the Expansion Port.')
nbs_exp_port_tbl_status = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 8), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('other', 1), ('ok', 2), ('error', 3)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsExpPortTblStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTblStatus.setDescription('The status of the Expansion Port.')
nbs_exp_port_tftp_sw_file_name = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 9), display_string()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
nbsExpPortTftpSwFileName.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortTftpSwFileName.setDescription('The Software File Name for the Expansion Port. This is the remote file name string provided to the TFTP client application when starting a Firmware Update process. This value is stored in the system NVRAM as well as in the SNMP Agent current configuration.')
nbs_exp_port_init_download = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 1, 2, 1, 10), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('active', 1), ('inactive', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
nbsExpPortInitDownload.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsExpPortInitDownload.setDescription('This is used to initiate a download session from the TFTP server. The filename which will be requested my be modified via the nbsExpPortTftpSwFileName object. Note that the only writeable value is active(1), if no session is active at this moment.')
nbs_atm_lane_port_max_num = mib_scalar((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsAtmLanePortMaxNum.setStatus('mandatory')
nbs_atm_lane_port_table = mib_table((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2))
if mibBuilder.loadTexts:
nbsAtmLanePortTable.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsAtmLanePortTable.setDescription('A table of Lan Emulation Clients, indexed by the physical port number.')
nbs_atm_lane_port_entry = mib_table_row((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1)).setIndexNames((0, 'NBASE-EXP-MIB', 'nbsAtmLanePortNumber'))
if mibBuilder.loadTexts:
nbsAtmLanePortEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsAtmLanePortEntry.setDescription('Contains the features specific to the ATM Lan Emulation Client.')
nbs_atm_lane_port_number = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsAtmLanePortNumber.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsAtmLanePortNumber.setDescription('The Port Number of the Lan Emulation Client.')
lane_lecs_address = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1, 2), octet_string().subtype(subtypeSpec=value_size_constraint(20, 20)).setFixedLength(20)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
laneLecsAddress.setStatus('mandatory')
if mibBuilder.loadTexts:
laneLecsAddress.setDescription('The ATM Address (20 Octet string) of the desired Lan Emulation Configuration Server.')
sonet_circuit_id = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1, 3), display_string()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
sonetCircuitId.setStatus('mandatory')
if mibBuilder.loadTexts:
sonetCircuitId.setDescription('The Circuit Identifier, if any for the SONET interface. This information is typically provided by the owner of the SONET physical line.')
signaling_status = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 2, 2, 1, 4), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('up', 1), ('down', 2)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
signalingStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
signalingStatus.setDescription('The Status of the ATM UNI signaling between the uplink and the ATM switch')
nbs_fddi_port_max_num = mib_scalar((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsFddiPortMaxNum.setStatus('mandatory')
nbs_fddi_port_table = mib_table((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 2))
if mibBuilder.loadTexts:
nbsFddiPortTable.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsFddiPortTable.setDescription('A table of FDDI ports, indexed by the physical port number.')
nbs_fddi_port_entry = mib_table_row((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 2, 1)).setIndexNames((0, 'NBASE-EXP-MIB', 'nbsFddiPortNumber'))
if mibBuilder.loadTexts:
nbsFddiPortEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsFddiPortEntry.setDescription('Contains the features specific to the FDDI Port.')
nbs_fddi_port_number = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 2, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsFddiPortNumber.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsFddiPortNumber.setDescription('The Port Number of the Lan Emulation Client.')
nbs_fddi_smt_index = mib_table_column((1, 3, 6, 1, 4, 1, 629, 1, 16, 3, 2, 1, 2), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nbsFddiSmtIndex.setStatus('mandatory')
if mibBuilder.loadTexts:
nbsFddiSmtIndex.setDescription('The FDDI MIB SMT index number of this port')
mibBuilder.exportSymbols('NBASE-EXP-MIB', nbsFddiPortMIB=nbsFddiPortMIB, nbsFddiPortEntry=nbsFddiPortEntry, laneLecsAddress=laneLecsAddress, nbsExpPortInitDownload=nbsExpPortInitDownload, signalingStatus=signalingStatus, nbsMegaMibs=nbsMegaMibs, nbsAtmLanePortNumber=nbsAtmLanePortNumber, nbsExpPortMaxNum=nbsExpPortMaxNum, nbsAtmLanePortMIB=nbsAtmLanePortMIB, nbsExpPortTftpSwFileName=nbsExpPortTftpSwFileName, nbsFddiPortTable=nbsFddiPortTable, nbsFddiPortNumber=nbsFddiPortNumber, nbSwitchG1=nbSwitchG1, nbsExpPortTable=nbsExpPortTable, nbsExpPortTblStatus=nbsExpPortTblStatus, nbsExpansionPortMIB=nbsExpansionPortMIB, nbsExpPortTblPortNumber=nbsExpPortTblPortNumber, nbsExpPortTblSwType=nbsExpPortTblSwType, nbsExpPortEntry=nbsExpPortEntry, sonetCircuitId=sonetCircuitId, nbase=nbase, nbsAtmLanePortTable=nbsAtmLanePortTable, nbsExpPortTblHwVersion=nbsExpPortTblHwVersion, nbsExpPortTblSquall=nbsExpPortTblSquall, nbsFddiPortMaxNum=nbsFddiPortMaxNum, nbsExpPortTblHwType=nbsExpPortTblHwType, nbsExpPortTblSwVersion=nbsExpPortTblSwVersion, nbsExpPortTblMCodeVrsn=nbsExpPortTblMCodeVrsn, nbsAtmLanePortEntry=nbsAtmLanePortEntry, nbsFddiSmtIndex=nbsFddiSmtIndex, nbsAtmLanePortMaxNum=nbsAtmLanePortMaxNum)
|
#
# PySNMP MIB module EXTREME-LACP-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/EXTREME-LACP-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 18:54:07 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, Integer, OctetString = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "Integer", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, ValueRangeConstraint, ConstraintsUnion, ConstraintsIntersection, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ValueRangeConstraint", "ConstraintsUnion", "ConstraintsIntersection", "SingleValueConstraint")
extremeAgent, = mibBuilder.importSymbols("EXTREME-BASE-MIB", "extremeAgent")
NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ModuleCompliance")
Bits, Integer32, Counter64, ObjectIdentity, ModuleIdentity, NotificationType, IpAddress, TimeTicks, Gauge32, Counter32, Unsigned32, MibIdentifier, MibScalar, MibTable, MibTableRow, MibTableColumn, iso = mibBuilder.importSymbols("SNMPv2-SMI", "Bits", "Integer32", "Counter64", "ObjectIdentity", "ModuleIdentity", "NotificationType", "IpAddress", "TimeTicks", "Gauge32", "Counter32", "Unsigned32", "MibIdentifier", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "iso")
TruthValue, RowStatus, DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "TruthValue", "RowStatus", "DisplayString", "TextualConvention")
extremeLacp = ModuleIdentity((1, 3, 6, 1, 4, 1, 1916, 1, 19))
if mibBuilder.loadTexts: extremeLacp.setLastUpdated('0502151530Z')
if mibBuilder.loadTexts: extremeLacp.setOrganization('Extreme Networks, Inc.')
class LacpGroupId(DisplayString):
status = 'current'
subtypeSpec = DisplayString.subtypeSpec + ValueSizeConstraint(1, 32)
class LacpMemberPort(TextualConvention, Unsigned32):
status = 'current'
subtypeSpec = Unsigned32.subtypeSpec + ValueRangeConstraint(0, 4294967295)
extremeLacpTable = MibTable((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1), )
if mibBuilder.loadTexts: extremeLacpTable.setStatus('current')
extremeLacpEntry = MibTableRow((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1, 1), ).setIndexNames((0, "EXTREME-LACP-MIB", "extremeLacpGroup"), (0, "EXTREME-LACP-MIB", "extremeLacpMemberPort"))
if mibBuilder.loadTexts: extremeLacpEntry.setStatus('current')
extremeLacpGroup = MibTableColumn((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1, 1, 1), LacpGroupId()).setMaxAccess("readonly")
if mibBuilder.loadTexts: extremeLacpGroup.setStatus('current')
extremeLacpMemberPort = MibTableColumn((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1, 1, 2), LacpMemberPort()).setMaxAccess("readonly")
if mibBuilder.loadTexts: extremeLacpMemberPort.setStatus('current')
extremeLacpAggStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1, 1, 3), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: extremeLacpAggStatus.setStatus('current')
mibBuilder.exportSymbols("EXTREME-LACP-MIB", extremeLacpGroup=extremeLacpGroup, LacpGroupId=LacpGroupId, extremeLacpAggStatus=extremeLacpAggStatus, extremeLacpEntry=extremeLacpEntry, extremeLacpTable=extremeLacpTable, LacpMemberPort=LacpMemberPort, extremeLacpMemberPort=extremeLacpMemberPort, PYSNMP_MODULE_ID=extremeLacp, extremeLacp=extremeLacp)
|
(object_identifier, integer, octet_string) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'Integer', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, value_range_constraint, constraints_union, constraints_intersection, single_value_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'ValueRangeConstraint', 'ConstraintsUnion', 'ConstraintsIntersection', 'SingleValueConstraint')
(extreme_agent,) = mibBuilder.importSymbols('EXTREME-BASE-MIB', 'extremeAgent')
(notification_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'NotificationGroup', 'ModuleCompliance')
(bits, integer32, counter64, object_identity, module_identity, notification_type, ip_address, time_ticks, gauge32, counter32, unsigned32, mib_identifier, mib_scalar, mib_table, mib_table_row, mib_table_column, iso) = mibBuilder.importSymbols('SNMPv2-SMI', 'Bits', 'Integer32', 'Counter64', 'ObjectIdentity', 'ModuleIdentity', 'NotificationType', 'IpAddress', 'TimeTicks', 'Gauge32', 'Counter32', 'Unsigned32', 'MibIdentifier', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'iso')
(truth_value, row_status, display_string, textual_convention) = mibBuilder.importSymbols('SNMPv2-TC', 'TruthValue', 'RowStatus', 'DisplayString', 'TextualConvention')
extreme_lacp = module_identity((1, 3, 6, 1, 4, 1, 1916, 1, 19))
if mibBuilder.loadTexts:
extremeLacp.setLastUpdated('0502151530Z')
if mibBuilder.loadTexts:
extremeLacp.setOrganization('Extreme Networks, Inc.')
class Lacpgroupid(DisplayString):
status = 'current'
subtype_spec = DisplayString.subtypeSpec + value_size_constraint(1, 32)
class Lacpmemberport(TextualConvention, Unsigned32):
status = 'current'
subtype_spec = Unsigned32.subtypeSpec + value_range_constraint(0, 4294967295)
extreme_lacp_table = mib_table((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1))
if mibBuilder.loadTexts:
extremeLacpTable.setStatus('current')
extreme_lacp_entry = mib_table_row((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1, 1)).setIndexNames((0, 'EXTREME-LACP-MIB', 'extremeLacpGroup'), (0, 'EXTREME-LACP-MIB', 'extremeLacpMemberPort'))
if mibBuilder.loadTexts:
extremeLacpEntry.setStatus('current')
extreme_lacp_group = mib_table_column((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1, 1, 1), lacp_group_id()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
extremeLacpGroup.setStatus('current')
extreme_lacp_member_port = mib_table_column((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1, 1, 2), lacp_member_port()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
extremeLacpMemberPort.setStatus('current')
extreme_lacp_agg_status = mib_table_column((1, 3, 6, 1, 4, 1, 1916, 1, 19, 1, 1, 3), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
extremeLacpAggStatus.setStatus('current')
mibBuilder.exportSymbols('EXTREME-LACP-MIB', extremeLacpGroup=extremeLacpGroup, LacpGroupId=LacpGroupId, extremeLacpAggStatus=extremeLacpAggStatus, extremeLacpEntry=extremeLacpEntry, extremeLacpTable=extremeLacpTable, LacpMemberPort=LacpMemberPort, extremeLacpMemberPort=extremeLacpMemberPort, PYSNMP_MODULE_ID=extremeLacp, extremeLacp=extremeLacp)
|
# Copyright (c) 2012 The Chromium Authors. All rights reserved.
# Use of this source code is governed by a BSD-style license that can be
# found in the LICENSE file.
# This is used as the top-level gyp file for building WebView in the Android
# tree. It should depend only on native code, as we cannot currently generate
# correct makefiles to build Java code via gyp in the Android tree.
{
'targets': [
{
'target_name': 'All',
'type': 'none',
'dependencies': [
'android_webview.gyp:libwebviewchromium',
# Needed by android_webview_java
'../base/base.gyp:base_java_activity_state',
'../base/base.gyp:base_java_memory_pressure_level_list',
'../content/content.gyp:page_transition_types_java',
'../content/content.gyp:result_codes_java',
'../content/content.gyp:speech_recognition_error_java',
'../net/net.gyp:certificate_mime_types_java',
'../net/net.gyp:cert_verify_result_android_java',
'../net/net.gyp:net_errors_java',
'../net/net.gyp:private_key_types_java',
],
}, # target_name: All
], # targets
}
|
{'targets': [{'target_name': 'All', 'type': 'none', 'dependencies': ['android_webview.gyp:libwebviewchromium', '../base/base.gyp:base_java_activity_state', '../base/base.gyp:base_java_memory_pressure_level_list', '../content/content.gyp:page_transition_types_java', '../content/content.gyp:result_codes_java', '../content/content.gyp:speech_recognition_error_java', '../net/net.gyp:certificate_mime_types_java', '../net/net.gyp:cert_verify_result_android_java', '../net/net.gyp:net_errors_java', '../net/net.gyp:private_key_types_java']}]}
|
class Solution:
# @param {integer[]} nums
# @return {integer}
def majorityElement(self, nums):
candidate = None
count = 0
for num in nums:
if num == candidate:
count += 1
elif count == 0:
candidate = num
count = 1
else:
count -= 1
return candidate
|
class Solution:
def majority_element(self, nums):
candidate = None
count = 0
for num in nums:
if num == candidate:
count += 1
elif count == 0:
candidate = num
count = 1
else:
count -= 1
return candidate
|
class Sql:
custlist = "SELECT * FROM cust";
custlistone = "SELECT * FROM cust WHERE id= '%s' ";
custinsert = "INSERT INTO cust VALUES ('%s','%s','%s')";
custdelete = "DELETE FROM cust WHERE id= '%s' ";
custupdate = "UPDATE cust SET pwd='%s',name='%s' WHERE id='%s' ";
itemlist = "SELECT * FROM item";
itemlistone = "SELECT * FROM item WHERE id= %d ";
iteminsert = "INSERT INTO item VALUES (NULL,'%s',%d,'%s',CURRENT_DATE())";
itemdelete = "DELETE FROM item WHERE id= %d ";
itemupdate = "UPDATE item SET name='%s',price=%d, imgname='%s' WHERE id= %d ";
|
class Sql:
custlist = 'SELECT * FROM cust'
custlistone = "SELECT * FROM cust WHERE id= '%s' "
custinsert = "INSERT INTO cust VALUES ('%s','%s','%s')"
custdelete = "DELETE FROM cust WHERE id= '%s' "
custupdate = "UPDATE cust SET pwd='%s',name='%s' WHERE id='%s' "
itemlist = 'SELECT * FROM item'
itemlistone = 'SELECT * FROM item WHERE id= %d '
iteminsert = "INSERT INTO item VALUES (NULL,'%s',%d,'%s',CURRENT_DATE())"
itemdelete = 'DELETE FROM item WHERE id= %d '
itemupdate = "UPDATE item SET name='%s',price=%d, imgname='%s' WHERE id= %d "
|
'''
@author: Tibor Hercz // Tiboonn
@Link: https://github.com/Tiboonn/AWS-DeepRacer
@License: N/D
'''
def reward_function(params):
'''
Example of rewarding the agent to follow center line
'''
# Read input parameters
track_width = params['track_width']
distance_from_center = params['distance_from_center']
all_wheels_on_track = params['all_wheels_on_track']
steering = abs(params['steering_angle'])
speed = params['speed']
is_left_of_center = params['is_left_of_center']
# Calculate 3 markers that are at varying distances away from the center line
marker_1 = 0.1 * track_width
marker_2 = 0.15 * track_width
marker_3 = 0.25 * track_width
marker_4 = 0.5 * track_width
# Give higher reward if the car is closer to center line and vice versa
if not all_wheels_on_track:
reward = 1e-3
return reward
elif distance_from_center <= marker_1:
reward = 1.0 * speed
if is_left_of_center:
reward = reward + 0.1
elif distance_from_center <= marker_2:
reward = 0.8 * speed
if is_left_of_center:
reward = reward + 0.1
elif distance_from_center <= marker_3:
reward = 0.3 * speed
if is_left_of_center:
reward = reward + 0.1
elif distance_from_center <= marker_4:
reward = 0.1 * speed
if is_left_of_center:
reward = reward + 0.1
else:
reward = 1e-3 # likely crashed/ close to off track
ABS_STEERING_THRESHOLD = 15
if steering > ABS_STEERING_THRESHOLD:
reward *= 0.8
return float(reward)
|
"""
@author: Tibor Hercz // Tiboonn
@Link: https://github.com/Tiboonn/AWS-DeepRacer
@License: N/D
"""
def reward_function(params):
"""
Example of rewarding the agent to follow center line
"""
track_width = params['track_width']
distance_from_center = params['distance_from_center']
all_wheels_on_track = params['all_wheels_on_track']
steering = abs(params['steering_angle'])
speed = params['speed']
is_left_of_center = params['is_left_of_center']
marker_1 = 0.1 * track_width
marker_2 = 0.15 * track_width
marker_3 = 0.25 * track_width
marker_4 = 0.5 * track_width
if not all_wheels_on_track:
reward = 0.001
return reward
elif distance_from_center <= marker_1:
reward = 1.0 * speed
if is_left_of_center:
reward = reward + 0.1
elif distance_from_center <= marker_2:
reward = 0.8 * speed
if is_left_of_center:
reward = reward + 0.1
elif distance_from_center <= marker_3:
reward = 0.3 * speed
if is_left_of_center:
reward = reward + 0.1
elif distance_from_center <= marker_4:
reward = 0.1 * speed
if is_left_of_center:
reward = reward + 0.1
else:
reward = 0.001
abs_steering_threshold = 15
if steering > ABS_STEERING_THRESHOLD:
reward *= 0.8
return float(reward)
|
vowels = set(['a', 'e', 'i', 'o', 'u', 'A', 'E', 'I', 'O', 'U'])
punc = set(['.', '!', '?', ' '])
while True:
sIn = input().strip()
lis = []
last = 0
for i, char in enumerate(sIn):
if char in punc:
if i - last > 0:
lis.append(sIn[last: i])
last = i + 1
if sIn[-1] not in punc:
lis.append(sIn[last:])
wordVal = 0
hashOf = 0
for word in lis:
hashOf += wordVal
wordVal = 0
vowelC = 1
for letter in word:
if letter in vowels:
wordVal += vowelC
vowelC += 1
else:
wordVal += ord(letter)
hashOf += wordVal
if sIn[-1] in punc:
hashOf += wordVal
for char in sIn:
if char in punc:
hashOf += ord(char)
print(f'The hash is {hashOf % 100}.')
if input().strip() == 'n': break
|
vowels = set(['a', 'e', 'i', 'o', 'u', 'A', 'E', 'I', 'O', 'U'])
punc = set(['.', '!', '?', ' '])
while True:
s_in = input().strip()
lis = []
last = 0
for (i, char) in enumerate(sIn):
if char in punc:
if i - last > 0:
lis.append(sIn[last:i])
last = i + 1
if sIn[-1] not in punc:
lis.append(sIn[last:])
word_val = 0
hash_of = 0
for word in lis:
hash_of += wordVal
word_val = 0
vowel_c = 1
for letter in word:
if letter in vowels:
word_val += vowelC
vowel_c += 1
else:
word_val += ord(letter)
hash_of += wordVal
if sIn[-1] in punc:
hash_of += wordVal
for char in sIn:
if char in punc:
hash_of += ord(char)
print(f'The hash is {hashOf % 100}.')
if input().strip() == 'n':
break
|
"""
Defines two dictionaries for converting
between text and integer sequences.
"""
char_map_str = """
' 0
<SPACE> 1
a 2
b 3
c 4
d 5
e 6
f 7
g 8
h 9
i 10
j 11
k 12
l 13
m 14
n 15
o 16
p 17
q 18
r 19
s 20
t 21
u 22
v 23
w 24
x 25
y 26
z 27
"""
# the "blank" character is mapped to 28
char_map = {}
index_map = {}
for line in char_map_str.strip().split('\n'):
ch, index = line.split()
char_map[ch] = int(index)
index_map[int(index)+1] = ch
index_map[2] = ' '
|
"""
Defines two dictionaries for converting
between text and integer sequences.
"""
char_map_str = "\n' 0\n<SPACE> 1\na 2\nb 3\nc 4\nd 5\ne 6\nf 7\ng 8\nh 9\ni 10\nj 11\nk 12\nl 13\nm 14\nn 15\no 16\np 17\nq 18\nr 19\ns 20\nt 21\nu 22\nv 23\nw 24\nx 25\ny 26\nz 27\n"
char_map = {}
index_map = {}
for line in char_map_str.strip().split('\n'):
(ch, index) = line.split()
char_map[ch] = int(index)
index_map[int(index) + 1] = ch
index_map[2] = ' '
|
@graph
def context_from_path():
sg = Shotgun()
sgfs = SGFS(root=sandbox, shotgun=sg)
fix = Fixture(sg)
proj = fix.Project('Example Project')
seq = proj.Sequence("AA")
shot = seq.Shot('AA_001')
step = fix.Step('Anm')
task = shot.Task('Do Work', id=123, step=step)
task2 = shot.Task('Do More Work', id=234, step=step)
ctx = sgfs.context_from_entities([task])
yield ctx.dot()
ctx = sgfs.context_from_entities([task, task2])
yield ctx.dot()
|
@graph
def context_from_path():
sg = shotgun()
sgfs = sgfs(root=sandbox, shotgun=sg)
fix = fixture(sg)
proj = fix.Project('Example Project')
seq = proj.Sequence('AA')
shot = seq.Shot('AA_001')
step = fix.Step('Anm')
task = shot.Task('Do Work', id=123, step=step)
task2 = shot.Task('Do More Work', id=234, step=step)
ctx = sgfs.context_from_entities([task])
yield ctx.dot()
ctx = sgfs.context_from_entities([task, task2])
yield ctx.dot()
|
# -*- coding: utf-8 -*-
def command():
return "create-farm"
def init_argument(parser):
parser.add_argument("--farm-name", required=True)
parser.add_argument("--template-no", required=True)
parser.add_argument("--comment")
def execute(requester, args):
farm_name = args.farm_name
template_no = args.template_no
comment = args.comment
parameters = {}
parameters["FarmName"] = farm_name
parameters["TemplateNo"] = template_no
if (comment != None):
parameters["Comment"] = comment
return requester.execute("/CreateFarm", parameters)
|
def command():
return 'create-farm'
def init_argument(parser):
parser.add_argument('--farm-name', required=True)
parser.add_argument('--template-no', required=True)
parser.add_argument('--comment')
def execute(requester, args):
farm_name = args.farm_name
template_no = args.template_no
comment = args.comment
parameters = {}
parameters['FarmName'] = farm_name
parameters['TemplateNo'] = template_no
if comment != None:
parameters['Comment'] = comment
return requester.execute('/CreateFarm', parameters)
|
#!/usr/bin/env python
print("This is example file 3")
|
print('This is example file 3')
|
#!/usr/bin/env python
#####################################
# Installation module for empire
#####################################
# AUTHOR OF MODULE NAME
AUTHOR="Ian Smith"
# DESCRIPTION OF THE MODULE
DESCRIPTION="This module will install/update Empire - post exploitation python/powershell for windows and nix/osx"
# INSTALL TYPE GIT, SVN, FILE DOWNLOAD
# OPTIONS = GIT, SVN, FILE
INSTALL_TYPE="GIT"
# LOCATION OF THE FILE OR GIT/SVN REPOSITORY
REPOSITORY_LOCATION="https://github.com/BC-SECURITY/Empire"
# WHERE DO YOU WANT TO INSTALL IT
INSTALL_LOCATION="empire3"
# DEPENDS FOR DEBIAN INSTALLS
DEBIAN="git"
FEDORA="git"
# COMMANDS TO RUN AFTER
AFTER_COMMANDS='cd {INSTALL_LOCATION},echo -e "\n" | ./setup/install.sh'
# DON'T RUN AFTER COMMANDS ON UPDATE
BYPASS_UPDATE="NO"
# LAUNCHER
LAUNCHER="empire"
|
author = 'Ian Smith'
description = 'This module will install/update Empire - post exploitation python/powershell for windows and nix/osx'
install_type = 'GIT'
repository_location = 'https://github.com/BC-SECURITY/Empire'
install_location = 'empire3'
debian = 'git'
fedora = 'git'
after_commands = 'cd {INSTALL_LOCATION},echo -e "\n" | ./setup/install.sh'
bypass_update = 'NO'
launcher = 'empire'
|
def imosh_test(
name,
srcs=[],
data=[],
**kargs):
if len(srcs) != 1:
fail("Exactly one source file must be given.")
native.genrule(
name = name + "_genrule_sh",
srcs = ["//bin:imosh_test_generate"],
outs = [name + "_genrule.sh"],
cmd = "$(BINDIR)/bin/imosh_test_generate " +
PACKAGE_NAME + "/" + srcs[0] + " >$@",
)
native.sh_test(
name = name,
srcs = [name + "_genrule.sh"],
data = [":" + srcs[0]] + data + ["//bin:imosh"],
**kargs)
|
def imosh_test(name, srcs=[], data=[], **kargs):
if len(srcs) != 1:
fail('Exactly one source file must be given.')
native.genrule(name=name + '_genrule_sh', srcs=['//bin:imosh_test_generate'], outs=[name + '_genrule.sh'], cmd='$(BINDIR)/bin/imosh_test_generate ' + PACKAGE_NAME + '/' + srcs[0] + ' >$@')
native.sh_test(name=name, srcs=[name + '_genrule.sh'], data=[':' + srcs[0]] + data + ['//bin:imosh'], **kargs)
|
# -*- coding: utf-8 -*-
name = 'usdview'
version = '20.05'
requires = [
'pyside-1.2',
'usd-20.05',
'ocio_configs',
'turret_usd'
]
def commands():
env.DEFAULT_USD.set('{root}/bin/DefaultUSD.usda')
|
name = 'usdview'
version = '20.05'
requires = ['pyside-1.2', 'usd-20.05', 'ocio_configs', 'turret_usd']
def commands():
env.DEFAULT_USD.set('{root}/bin/DefaultUSD.usda')
|
def make_ends(nums):
first = nums[0]
last = nums[len(nums)-1]
newArr = []
newArr.append(first)
newArr.append(last)
return newArr
|
def make_ends(nums):
first = nums[0]
last = nums[len(nums) - 1]
new_arr = []
newArr.append(first)
newArr.append(last)
return newArr
|
class EnumBase(object):
class Meta:
allowed_types = tuple()
zero_value = None
@classmethod
def names(klass, with_zero_value=True):
def _get_names():
names = []
for n in dir(klass):
if '__' not in n and n != 'Meta':
value = getattr(klass, n)
if isinstance(value, klass.Meta.allowed_types):
if with_zero_value or value != klass.Meta.zero_value:
names.append(n)
return names
if with_zero_value:
if not hasattr(klass, '_cache__iterable_names_with_zero'):
klass._cache__iterable_names_with_zero = _get_names()
return klass._cache__iterable_names_with_zero
else:
if not hasattr(klass, '_cache__iterable_names_without_zero'):
klass._cache__iterable_names_without_zero = _get_names()
return klass._cache__iterable_names_without_zero
@classmethod
def values(klass):
return tuple(klass.iter())
@classmethod
def lookup(klass, instance):
d = {}
for n in klass.names():
v = getattr(klass, n)
if not isinstance(v, klass.Meta.allowed_types):
continue
d[v] = n
return d[instance]
@classmethod
def reverse_lookup(klass, name):
return dict(klass.choices(with_zero_value=True))[name]
@classmethod
def iter(klass):
values = [getattr(klass, n) for n in klass.names()]
values.sort()
for v in values:
if v == klass.Meta.zero_value:
continue
yield v
@classmethod
def next_value(cls, cur_value):
index_of = cls.all().index(cur_value)
return cls.all()[index_of + 1 % len(cls.all())]
@classmethod
def all(klass, with_zero_value=True):
def _get_values():
values = [getattr(klass, n) for n in klass.names(with_zero_value=with_zero_value) if isinstance(getattr(klass, n), klass.Meta.allowed_types)]
values.sort()
return values
if with_zero_value:
if not hasattr(klass, '_cache__iterable_values_with_zero'):
klass._cache__iterable_values_with_zero = _get_values()
return klass._cache__iterable_values_with_zero
else:
if not hasattr(klass, '_cache__iterable_values_without_zero'):
klass._cache__iterable_values_without_zero = _get_values()
return klass._cache__iterable_values_without_zero
@classmethod
def all_set(cls):
if not hasattr(cls, "_cache__iterable_values_set"):
cls._cache__iterable_values_set = set(cls.all())
return cls._cache__iterable_values_set
@classmethod
def choices(klass, reverse=False, with_zero_value=False):
lst = []
for n in klass.names(with_zero_value=with_zero_value):
v = getattr(klass, n)
if reverse:
lst.append((v, n))
else:
lst.append((n, v))
return lst
class IntEnum(EnumBase):
class Meta:
allowed_types = (int, long,)
zero_value = 0
class StringEnum(EnumBase):
class Meta:
allowed_types = (basestring,)
zero_value = ''
class BooleanEnum(EnumBase):
class Meta:
allowed_types = (bool,)
zero_value = None
class ListEnum(EnumBase):
class Meta:
allowed_types = (list, tuple,)
zero_value = []
class FloatEnum(EnumBase):
class Meta:
allowed_types = (float,)
zero_value = 0.0
"""
Some helper functions that makes using `enum` classes in python a little easier
"""
def generate_enum_reverse_lookup(klass):
"""
Returns a lookup to verify that a certain value exists in an enum class
And also returns to you it's Attribute Name in that class
"""
dct = {}
for k in dir(klass):
if k.startswith('__'):
continue
val = getattr(klass, k, None)
if not isinstance(val, (int, long)):
continue
if val in dct:
raise ValueError('Can only have a value in a reverse lookup once, sorry dude')
dct[val] = k
return dct
def generate_choices_tuple(klass, reverse=False):
lst = []
for prop in dir(klass):
if prop.startswith('_'):
continue
attr = getattr(klass, prop)
if not isinstance(attr, (long,int)):
continue
if reverse:
lst.append((attr, prop))
else:
lst.append((prop, attr))
return tuple(lst)
|
class Enumbase(object):
class Meta:
allowed_types = tuple()
zero_value = None
@classmethod
def names(klass, with_zero_value=True):
def _get_names():
names = []
for n in dir(klass):
if '__' not in n and n != 'Meta':
value = getattr(klass, n)
if isinstance(value, klass.Meta.allowed_types):
if with_zero_value or value != klass.Meta.zero_value:
names.append(n)
return names
if with_zero_value:
if not hasattr(klass, '_cache__iterable_names_with_zero'):
klass._cache__iterable_names_with_zero = _get_names()
return klass._cache__iterable_names_with_zero
else:
if not hasattr(klass, '_cache__iterable_names_without_zero'):
klass._cache__iterable_names_without_zero = _get_names()
return klass._cache__iterable_names_without_zero
@classmethod
def values(klass):
return tuple(klass.iter())
@classmethod
def lookup(klass, instance):
d = {}
for n in klass.names():
v = getattr(klass, n)
if not isinstance(v, klass.Meta.allowed_types):
continue
d[v] = n
return d[instance]
@classmethod
def reverse_lookup(klass, name):
return dict(klass.choices(with_zero_value=True))[name]
@classmethod
def iter(klass):
values = [getattr(klass, n) for n in klass.names()]
values.sort()
for v in values:
if v == klass.Meta.zero_value:
continue
yield v
@classmethod
def next_value(cls, cur_value):
index_of = cls.all().index(cur_value)
return cls.all()[index_of + 1 % len(cls.all())]
@classmethod
def all(klass, with_zero_value=True):
def _get_values():
values = [getattr(klass, n) for n in klass.names(with_zero_value=with_zero_value) if isinstance(getattr(klass, n), klass.Meta.allowed_types)]
values.sort()
return values
if with_zero_value:
if not hasattr(klass, '_cache__iterable_values_with_zero'):
klass._cache__iterable_values_with_zero = _get_values()
return klass._cache__iterable_values_with_zero
else:
if not hasattr(klass, '_cache__iterable_values_without_zero'):
klass._cache__iterable_values_without_zero = _get_values()
return klass._cache__iterable_values_without_zero
@classmethod
def all_set(cls):
if not hasattr(cls, '_cache__iterable_values_set'):
cls._cache__iterable_values_set = set(cls.all())
return cls._cache__iterable_values_set
@classmethod
def choices(klass, reverse=False, with_zero_value=False):
lst = []
for n in klass.names(with_zero_value=with_zero_value):
v = getattr(klass, n)
if reverse:
lst.append((v, n))
else:
lst.append((n, v))
return lst
class Intenum(EnumBase):
class Meta:
allowed_types = (int, long)
zero_value = 0
class Stringenum(EnumBase):
class Meta:
allowed_types = (basestring,)
zero_value = ''
class Booleanenum(EnumBase):
class Meta:
allowed_types = (bool,)
zero_value = None
class Listenum(EnumBase):
class Meta:
allowed_types = (list, tuple)
zero_value = []
class Floatenum(EnumBase):
class Meta:
allowed_types = (float,)
zero_value = 0.0
'\nSome helper functions that makes using `enum` classes in python a little easier\n'
def generate_enum_reverse_lookup(klass):
"""
Returns a lookup to verify that a certain value exists in an enum class
And also returns to you it's Attribute Name in that class
"""
dct = {}
for k in dir(klass):
if k.startswith('__'):
continue
val = getattr(klass, k, None)
if not isinstance(val, (int, long)):
continue
if val in dct:
raise value_error('Can only have a value in a reverse lookup once, sorry dude')
dct[val] = k
return dct
def generate_choices_tuple(klass, reverse=False):
lst = []
for prop in dir(klass):
if prop.startswith('_'):
continue
attr = getattr(klass, prop)
if not isinstance(attr, (long, int)):
continue
if reverse:
lst.append((attr, prop))
else:
lst.append((prop, attr))
return tuple(lst)
|
# intro to function
def my_function():
print("Hello, this is function")
# calling function
my_function()
|
def my_function():
print('Hello, this is function')
my_function()
|
class Solution:
def numDifferentIntegers(self, word: str) -> int:
stripped = {}
i = 0
for c in word:
if c in {"0":1, "1":1, "2":1, "3":1, "4":1, "5":1, "6":1, "7":1, "8":1, "9":1}:
if i in stripped:
if stripped[i] == "0":
stripped[i] = c
else:
stripped[i] = stripped[i] + c
else:
stripped[i] = c
else:
i = i + 1
counter = {}
for key in stripped:
if stripped[key] not in counter:
counter[stripped[key]] = 1
else:
counter[stripped[key]] = counter[stripped[key]] + 1
return len(counter)
|
class Solution:
def num_different_integers(self, word: str) -> int:
stripped = {}
i = 0
for c in word:
if c in {'0': 1, '1': 1, '2': 1, '3': 1, '4': 1, '5': 1, '6': 1, '7': 1, '8': 1, '9': 1}:
if i in stripped:
if stripped[i] == '0':
stripped[i] = c
else:
stripped[i] = stripped[i] + c
else:
stripped[i] = c
else:
i = i + 1
counter = {}
for key in stripped:
if stripped[key] not in counter:
counter[stripped[key]] = 1
else:
counter[stripped[key]] = counter[stripped[key]] + 1
return len(counter)
|
"""
Illustrates how to embed Beaker cache functionality within
the Query object, allowing full cache control as well as the
ability to pull "lazy loaded" attributes from long term cache
as well.
In this demo, the following techniques are illustrated:
* Using custom subclasses of Query
* Basic technique of circumventing Query to pull from a
custom cache source instead of the database.
* Rudimental caching with Beaker, using "regions" which allow
global control over a fixed set of configurations.
* Using custom MapperOption objects to configure options on
a Query, including the ability to invoke the options
deep within an object graph when lazy loads occur.
E.g.::
# query for Person objects, specifying cache
q = Session.query(Person).options(FromCache("default", "all_people"))
# specify that each Person's "addresses" collection comes from
# cache too
q = q.options(RelationCache("default", "by_person", Person.addresses))
# query
print q.all()
To run, both SQLAlchemy and Beaker (1.4 or greater) must be
installed or on the current PYTHONPATH. The demo will create a local
directory for datafiles, insert initial data, and run. Running the
demo a second time will utilize the cache files already present, and
exactly one SQL statement against two tables will be emitted - the
displayed result however will utilize dozens of lazyloads that all
pull from cache.
The demo scripts themselves, in order of complexity, are run as follows::
python examples/beaker_caching/helloworld.py
python examples/beaker_caching/relation_caching.py
python examples/beaker_caching/advanced.py
python examples/beaker_caching/local_session_caching.py
Listing of files:
environment.py - Establish data / cache file paths, and configurations,
bootstrap fixture data if necessary.
meta.py - Represent persistence structures which allow the usage of
Beaker caching with SQLAlchemy. Introduces a query option called
FromCache.
model.py - The datamodel, which represents Person that has multiple
Address objects, each with PostalCode, City, Country
fixture_data.py - creates demo PostalCode, Address, Person objects
in the database.
helloworld.py - the basic idea.
relation_caching.py - Illustrates how to add cache options on
relation endpoints, so that lazyloads load from cache.
advanced.py - Further examples of how to use FromCache. Combines
techniques from the first two scripts.
local_session_caching.py - Grok everything so far ? This example
creates a new Beaker container that will persist data in a dictionary
which is local to the current session. remove() the session
and the cache is gone.
"""
|
"""
Illustrates how to embed Beaker cache functionality within
the Query object, allowing full cache control as well as the
ability to pull "lazy loaded" attributes from long term cache
as well.
In this demo, the following techniques are illustrated:
* Using custom subclasses of Query
* Basic technique of circumventing Query to pull from a
custom cache source instead of the database.
* Rudimental caching with Beaker, using "regions" which allow
global control over a fixed set of configurations.
* Using custom MapperOption objects to configure options on
a Query, including the ability to invoke the options
deep within an object graph when lazy loads occur.
E.g.::
# query for Person objects, specifying cache
q = Session.query(Person).options(FromCache("default", "all_people"))
# specify that each Person's "addresses" collection comes from
# cache too
q = q.options(RelationCache("default", "by_person", Person.addresses))
# query
print q.all()
To run, both SQLAlchemy and Beaker (1.4 or greater) must be
installed or on the current PYTHONPATH. The demo will create a local
directory for datafiles, insert initial data, and run. Running the
demo a second time will utilize the cache files already present, and
exactly one SQL statement against two tables will be emitted - the
displayed result however will utilize dozens of lazyloads that all
pull from cache.
The demo scripts themselves, in order of complexity, are run as follows::
python examples/beaker_caching/helloworld.py
python examples/beaker_caching/relation_caching.py
python examples/beaker_caching/advanced.py
python examples/beaker_caching/local_session_caching.py
Listing of files:
environment.py - Establish data / cache file paths, and configurations,
bootstrap fixture data if necessary.
meta.py - Represent persistence structures which allow the usage of
Beaker caching with SQLAlchemy. Introduces a query option called
FromCache.
model.py - The datamodel, which represents Person that has multiple
Address objects, each with PostalCode, City, Country
fixture_data.py - creates demo PostalCode, Address, Person objects
in the database.
helloworld.py - the basic idea.
relation_caching.py - Illustrates how to add cache options on
relation endpoints, so that lazyloads load from cache.
advanced.py - Further examples of how to use FromCache. Combines
techniques from the first two scripts.
local_session_caching.py - Grok everything so far ? This example
creates a new Beaker container that will persist data in a dictionary
which is local to the current session. remove() the session
and the cache is gone.
"""
|
## @package serde
# Module caffe2.python.predictor.serde
def serialize_protobuf_struct(protobuf_struct):
return protobuf_struct.SerializeToString()
def deserialize_protobuf_struct(serialized_protobuf, struct_type):
deser = struct_type()
deser.ParseFromString(serialized_protobuf)
return deser
|
def serialize_protobuf_struct(protobuf_struct):
return protobuf_struct.SerializeToString()
def deserialize_protobuf_struct(serialized_protobuf, struct_type):
deser = struct_type()
deser.ParseFromString(serialized_protobuf)
return deser
|
# You can import and use this in a DAG in the parent folder like usual in
# Python, i.e. `import python_callables.compliance`
def check_port_22_open():
pass
|
def check_port_22_open():
pass
|
#!/usr/bin/python
with open("vita.md") as fp:
lines = fp.readlines()
lines2 = lines[6:]
lines3 = lines[8:]
# print lines2
with open("vita_noyaml.md", "w") as fp:
fp.writelines(lines2)
# print lines3
with open("vita_noyaml_nocvaspdf.md", "w") as fp:
fp.writelines(lines3)
# onepage
with open("vita_onepage.md") as fp:
lines = fp.readlines()
lines2 = lines[5:]
lines3 = lines[7:]
with open("vita_onepage_noyaml.md", "w") as fp:
fp.writelines(lines2)
with open("vita_onepage_nocvaspdf.md", "w") as fp:
fp.writelines(lines3)
|
with open('vita.md') as fp:
lines = fp.readlines()
lines2 = lines[6:]
lines3 = lines[8:]
with open('vita_noyaml.md', 'w') as fp:
fp.writelines(lines2)
with open('vita_noyaml_nocvaspdf.md', 'w') as fp:
fp.writelines(lines3)
with open('vita_onepage.md') as fp:
lines = fp.readlines()
lines2 = lines[5:]
lines3 = lines[7:]
with open('vita_onepage_noyaml.md', 'w') as fp:
fp.writelines(lines2)
with open('vita_onepage_nocvaspdf.md', 'w') as fp:
fp.writelines(lines3)
|
__author__ = 'nikaashpuri'
'''
TCP_SERVER_IP = '162.251.84.104'
SYSTEM_PATH_TO_APPEND = '/public_html/aquabrim_project'
LOG_FILE_LOCATION = '/logs/django_log'
TCP_SERVER_FILE_PATH = '/public_html/aquabrim_project/machine/tcp_ip_server.py'
DATABASE_PATH = '/sites_database/dev.db'
'''
TCP_SERVER_IP = 'localhost'
LOG_FILE_LOCATION = '/Users/nikaashpuri/Documents/alibi_projects/aquabrim_project/logs/django_log'
TCP_SERVER_FILE_PATH = '/Users/nikaashpuri/Documents/alibi_projects/aquabrim_project/machine/tcp_ip_server.py'
SYSTEM_PATH_TO_APPEND = '/Users/nikaashpuri/Documents/alibi_projects/aquabrim_project/'
DATABASE_PATH = 'dev.db'
TCP_SERVER_PORT = 40000
NUMBER_OF_SERVER_START_ATTEMPTS = 5
|
__author__ = 'nikaashpuri'
"\nTCP_SERVER_IP = '162.251.84.104'\nSYSTEM_PATH_TO_APPEND = '/public_html/aquabrim_project'\nLOG_FILE_LOCATION = '/logs/django_log'\nTCP_SERVER_FILE_PATH = '/public_html/aquabrim_project/machine/tcp_ip_server.py'\nDATABASE_PATH = '/sites_database/dev.db'\n"
tcp_server_ip = 'localhost'
log_file_location = '/Users/nikaashpuri/Documents/alibi_projects/aquabrim_project/logs/django_log'
tcp_server_file_path = '/Users/nikaashpuri/Documents/alibi_projects/aquabrim_project/machine/tcp_ip_server.py'
system_path_to_append = '/Users/nikaashpuri/Documents/alibi_projects/aquabrim_project/'
database_path = 'dev.db'
tcp_server_port = 40000
number_of_server_start_attempts = 5
|
class Solution:
# @param candidates, a list of integers
# @param target, integer
# @return a list of lists of integers
def combinationSum(self, candidates, target):
if not candidates:
return []
candidates.sort()
n = len(candidates)
res = []
def solve(start, target, tmp):
if target < 0:
return
if target == 0:
res.append(tmp[:])
return
for i in xrange(start, n):
tmp.append(candidates[i])
solve(i, target-candidates[i], tmp)
tmp.pop()
solve(0, target, [])
return res
|
class Solution:
def combination_sum(self, candidates, target):
if not candidates:
return []
candidates.sort()
n = len(candidates)
res = []
def solve(start, target, tmp):
if target < 0:
return
if target == 0:
res.append(tmp[:])
return
for i in xrange(start, n):
tmp.append(candidates[i])
solve(i, target - candidates[i], tmp)
tmp.pop()
solve(0, target, [])
return res
|
# Unless explicitly stated otherwise all files in this repository are licensed
# under the Apache License Version 2.0.
# This product includes software developed at Datadog (https://www.datadoghq.com/).
# Copyright 2018 Datadog, Inc.
# (C) Datadog, Inc. 2010-2016
# All rights reserved
# Licensed under Simplified BSD License (see LICENSE)
BASIC_METRICS = {
'cpu.extra': {
's_type' : 'delta',
'unit' : 'millisecond',
'rollup' : 'summation',
'entity' : ['VirtualMachine']
},
'cpu.ready': {
's_type' : 'delta',
'unit' : 'millisecond',
'rollup' : 'summation',
'entity' : ['VirtualMachine', 'HostSystem']
},
'cpu.usage': {
's_type' : 'rate',
'unit' : 'percent',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem']
},
'cpu.usagemhz': {
's_type' : 'rate',
'unit' : 'megaHertz',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem', 'ResourcePool']
},
'disk.commandsAborted': {
's_type' : 'delta',
'unit' : 'number',
'rollup' : 'summation',
'entity' : ['VirtualMachine', 'HostSystem', 'Datastore']
},
'disk.deviceLatency': {
's_type' : 'absolute',
'unit' : 'millisecond',
'rollup' : 'average',
'entity' : ['HostSystem']
},
'disk.deviceReadLatency': {
's_type' : 'absolute',
'unit' : 'millisecond',
'rollup' : 'average',
'entity' : ['HostSystem']
},
'disk.deviceWriteLatency': {
's_type' : 'absolute',
'unit' : 'millisecond',
'rollup' : 'average',
'entity' : ['HostSystem']
},
'disk.queueLatency': {
's_type' : 'absolute',
'unit' : 'millisecond',
'rollup' : 'average',
'entity' : ['HostSystem']
},
'disk.totalLatency': {
's_type' : 'absolute',
'unit' : 'millisecond',
'rollup' : 'average',
'entity' : ['HostSystemDatastore']
},
'mem.active': {
's_type' : 'absolute',
'unit' : 'kiloBytes',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem', 'ResourcePool']
},
'mem.compressed': {
's_type' : 'absolute',
'unit' : 'kiloBytes',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem', 'ResourcePool']
},
'mem.consumed': {
's_type' : 'absolute',
'unit' : 'kiloBytes',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem', 'ResourcePool']
},
'mem.overhead': {
's_type' : 'absolute',
'unit' : 'kiloBytes',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem', 'ResourcePool']
},
'mem.vmmemctl': {
's_type' : 'absolute',
'unit' : 'kiloBytes',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem', 'ResourcePool']
},
'network.received': {
's_type' : 'rate',
'unit' : 'kiloBytesPerSecond',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem']
},
'network.transmitted': {
's_type' : 'rate',
'unit' : 'kiloBytesPerSecond',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem']
},
'net.received': {
's_type' : 'rate',
'unit' : 'kiloBytesPerSecond',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem']
},
'net.transmitted': {
's_type' : 'rate',
'unit' : 'kiloBytesPerSecond',
'rollup' : 'average',
'entity' : ['VirtualMachine', 'HostSystem']
},
}
|
basic_metrics = {'cpu.extra': {'s_type': 'delta', 'unit': 'millisecond', 'rollup': 'summation', 'entity': ['VirtualMachine']}, 'cpu.ready': {'s_type': 'delta', 'unit': 'millisecond', 'rollup': 'summation', 'entity': ['VirtualMachine', 'HostSystem']}, 'cpu.usage': {'s_type': 'rate', 'unit': 'percent', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem']}, 'cpu.usagemhz': {'s_type': 'rate', 'unit': 'megaHertz', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem', 'ResourcePool']}, 'disk.commandsAborted': {'s_type': 'delta', 'unit': 'number', 'rollup': 'summation', 'entity': ['VirtualMachine', 'HostSystem', 'Datastore']}, 'disk.deviceLatency': {'s_type': 'absolute', 'unit': 'millisecond', 'rollup': 'average', 'entity': ['HostSystem']}, 'disk.deviceReadLatency': {'s_type': 'absolute', 'unit': 'millisecond', 'rollup': 'average', 'entity': ['HostSystem']}, 'disk.deviceWriteLatency': {'s_type': 'absolute', 'unit': 'millisecond', 'rollup': 'average', 'entity': ['HostSystem']}, 'disk.queueLatency': {'s_type': 'absolute', 'unit': 'millisecond', 'rollup': 'average', 'entity': ['HostSystem']}, 'disk.totalLatency': {'s_type': 'absolute', 'unit': 'millisecond', 'rollup': 'average', 'entity': ['HostSystemDatastore']}, 'mem.active': {'s_type': 'absolute', 'unit': 'kiloBytes', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem', 'ResourcePool']}, 'mem.compressed': {'s_type': 'absolute', 'unit': 'kiloBytes', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem', 'ResourcePool']}, 'mem.consumed': {'s_type': 'absolute', 'unit': 'kiloBytes', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem', 'ResourcePool']}, 'mem.overhead': {'s_type': 'absolute', 'unit': 'kiloBytes', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem', 'ResourcePool']}, 'mem.vmmemctl': {'s_type': 'absolute', 'unit': 'kiloBytes', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem', 'ResourcePool']}, 'network.received': {'s_type': 'rate', 'unit': 'kiloBytesPerSecond', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem']}, 'network.transmitted': {'s_type': 'rate', 'unit': 'kiloBytesPerSecond', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem']}, 'net.received': {'s_type': 'rate', 'unit': 'kiloBytesPerSecond', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem']}, 'net.transmitted': {'s_type': 'rate', 'unit': 'kiloBytesPerSecond', 'rollup': 'average', 'entity': ['VirtualMachine', 'HostSystem']}}
|
# !/usr/bin/env python3
# -*- cosing: utf-8 -*-
fileptr = open("file2.txt", "a")
fileptr.write("Python has an easy syntax and user-friendly interaction.")
fileptr.close()
|
fileptr = open('file2.txt', 'a')
fileptr.write('Python has an easy syntax and user-friendly interaction.')
fileptr.close()
|
main_menu = [
["1", "Spam Tools", "Amino-Tools"],
["2", "Chat Tools"],
["3", "Activity Tools"],
["4", "profile Tools"],
["5", "raid Tools"],
["0", "Exit"]
]
spam_tools_menu = [
["1", "Spam Bot", "Amino-Tools"],
["2", "Wiki Spam Bot"],
["3", "Wall Spam Bot"],
["4", "Blog Spam Bot"]
]
chat_tools_menu = [
["1", "ChatId Finder", "Amino-Tools"],
["2", "Crash Chat Description"],
["3", "Transfer Fake Coins"]
]
activity_tools_menu = [
["1", "Invite Bot", "Amino-Tools"],
["2", "Like Bot"],
["3", "Follow Bot"],
["4", "Unfollow Bot"]
]
profile_tools_menu = [
["1", "Blogs Spam Bot", "Amino-Tools"],
["2", "Wiki Spam Bot"]
]
raid_tools_menu = [
["1", "Spam System Messages", "Amino-Tools"],
["2", "Send System Message"],
["3", "Spam With Join And Leave"],
["4", "Join Active Chats"]
]
chat_id_finder_menu = [
["1", "Get Public Chats ChatId", "Amino-Tools"],
["2", "Get Joined Chats ChatId"]
]
chat_invite_bot_menu = [
["1", "Invite Online Users", "Amino-Tools"],
["2", "Invite Recent Users"]
]
follow_bot_menu = [
["1", "Follow Online Users", "Amino-Tools"],
["2", "Follow Recent Users"]
]
|
main_menu = [['1', 'Spam Tools', 'Amino-Tools'], ['2', 'Chat Tools'], ['3', 'Activity Tools'], ['4', 'profile Tools'], ['5', 'raid Tools'], ['0', 'Exit']]
spam_tools_menu = [['1', 'Spam Bot', 'Amino-Tools'], ['2', 'Wiki Spam Bot'], ['3', 'Wall Spam Bot'], ['4', 'Blog Spam Bot']]
chat_tools_menu = [['1', 'ChatId Finder', 'Amino-Tools'], ['2', 'Crash Chat Description'], ['3', 'Transfer Fake Coins']]
activity_tools_menu = [['1', 'Invite Bot', 'Amino-Tools'], ['2', 'Like Bot'], ['3', 'Follow Bot'], ['4', 'Unfollow Bot']]
profile_tools_menu = [['1', 'Blogs Spam Bot', 'Amino-Tools'], ['2', 'Wiki Spam Bot']]
raid_tools_menu = [['1', 'Spam System Messages', 'Amino-Tools'], ['2', 'Send System Message'], ['3', 'Spam With Join And Leave'], ['4', 'Join Active Chats']]
chat_id_finder_menu = [['1', 'Get Public Chats ChatId', 'Amino-Tools'], ['2', 'Get Joined Chats ChatId']]
chat_invite_bot_menu = [['1', 'Invite Online Users', 'Amino-Tools'], ['2', 'Invite Recent Users']]
follow_bot_menu = [['1', 'Follow Online Users', 'Amino-Tools'], ['2', 'Follow Recent Users']]
|
# Good morning! Here's your coding interview problem for today.
# This problem was asked by Google.
# A unival tree (which stands for "universal value") is a tree where all nodes under it have the same value.
# Given the root to a binary tree, count the number of unival subtrees.
# For example, the following tree has 5 unival subtrees:
# 0
# / \
# 1 0
# / \
# 1 0
# / \
# 1 1
class node:
def __init__(self,value,left=None,right=None):
self.value = value
self.left = left
self.right = right
def print(self):
print(self.left, '<--',self.value, '-->',self.right)
tree = node(False,node(True),node(False,node(True,node(True),node(True)),node(False)))
count = 0
def unival(tree):
global count
if tree == None:
return True
else :
if unival(tree.left) == unival(tree.right):
count +=1
return tree.value
unival(tree)
print(count)
|
class Node:
def __init__(self, value, left=None, right=None):
self.value = value
self.left = left
self.right = right
def print(self):
print(self.left, '<--', self.value, '-->', self.right)
tree = node(False, node(True), node(False, node(True, node(True), node(True)), node(False)))
count = 0
def unival(tree):
global count
if tree == None:
return True
else:
if unival(tree.left) == unival(tree.right):
count += 1
return tree.value
unival(tree)
print(count)
|
"""
By default, Disco looks at an input URL and extracts its scheme in order to figure out which input stream to use.
When Disco determines the URL scheme, it tries to import the name `input_stream` from `disco.schemes.scheme_[SCHEME]`, where `[SCHEME]` is replaced by the scheme identified.
For instance, an input URL of `http://discoproject.org` would import and use :func:`disco.schemes.scheme_http.input_stream`.
"""
|
"""
By default, Disco looks at an input URL and extracts its scheme in order to figure out which input stream to use.
When Disco determines the URL scheme, it tries to import the name `input_stream` from `disco.schemes.scheme_[SCHEME]`, where `[SCHEME]` is replaced by the scheme identified.
For instance, an input URL of `http://discoproject.org` would import and use :func:`disco.schemes.scheme_http.input_stream`.
"""
|
# Natural Language Toolkit: Shoebox Errors
#
# Copyright (C) 2001-2006 NLTK Project
# Author: Stuart Robinson <[email protected]>
# URL: <http://www.nltk.org/>
# For license information, see LICENSE.TXT
"""
This module provides Shoebox exceptions.
"""
# ---------------------------------------------------------------------
# CLASS: ShoeboxError
# DESC: ???
# ---------------------------------------------------------------------
class ShoeboxError(Exception):
"""
This is the base class for all Shoebox errors.
"""
def __init__(self):
self._msg = ""
# ---------------------------------------------
# CLASS: ValidationError
# DESC: ???
# ---------------------------------------------
class NonUniqueEntryError(ShoeboxError):
"""
???
"""
def __init__(self) :
pass
class ValidationError(ShoeboxError):
def __init__(self):
pass
def setField(self, field):
self._field = field
def getField(self):
return self._field
# ---------------------------------------------
# CLASS: NoMetadataFound
# DESC: ???
# ---------------------------------------------
class NoMetadataFound(ValidationError):
def __init__(self, field):
self._field = field
class FieldError(ShoeboxError):
def __init__(self):
pass
def __str__(self) :
return self.get_message()
class NonUniqueFieldError(FieldError):
"""
Error raised when an attempt is made to retrieve a unique field which has more than one value
"""
def __init__(self, entry):
self._entry = entry
def setEntry(self, entry):
self._entry = entry
def getEntry(self):
return self._entry
# ---------------------------------------------
# CLASS: BadFieldValue
# DESC: ???
# ---------------------------------------------
class BadFieldValueError(ValidationError, FieldError):
FIELD_VALUE_ERROR_RANGE_SET = '1'
FIELD_VALUE_ERROR_NO_WORD_WRAP = '2'
FIELD_VALUE_ERROR_EMPTY_VALUE = '3'
FIELD_VALUE_ERROR_SINGLE_WORD = '4'
errorTypes = {
'1': "Range Set",
'2': "No Word Wrap",
'3': "Empty Value",
'4': "Single Word"
}
def __init__(self, errorType, entry, field, fmMetadata):
self._entry = entry
self._errorType = errorType
self._field = field
self._fmMetadata = fmMetadata
def __str__(self):
e = self.getEntry()
f = self.getField()
typ = self.getErrorDescription()
s = "'%s' error in '\\%s' field of record %i!\nRecord:\n%s" % (typ, f.getMarker(), e.getNumber(), e.getRawText())
return s
def getFieldMarkerMetadata(self):
return self._fmMetadata
def setFieldMarkerMetadata(self, fmMetadata):
self._fmMetadata = fmMetadata
def getErrorDescription(self):
try:
return self.errorTypes[self.getErrorType()]
except:
return None
def getErrorType(self):
return self._errorType
def setErrorType(self, errorType):
self._errorType = errorType
def getEntry(self):
return self._entry
def setEntry(self, entry):
self._entry = entry
|
"""
This module provides Shoebox exceptions.
"""
class Shoeboxerror(Exception):
"""
This is the base class for all Shoebox errors.
"""
def __init__(self):
self._msg = ''
class Nonuniqueentryerror(ShoeboxError):
"""
???
"""
def __init__(self):
pass
class Validationerror(ShoeboxError):
def __init__(self):
pass
def set_field(self, field):
self._field = field
def get_field(self):
return self._field
class Nometadatafound(ValidationError):
def __init__(self, field):
self._field = field
class Fielderror(ShoeboxError):
def __init__(self):
pass
def __str__(self):
return self.get_message()
class Nonuniquefielderror(FieldError):
"""
Error raised when an attempt is made to retrieve a unique field which has more than one value
"""
def __init__(self, entry):
self._entry = entry
def set_entry(self, entry):
self._entry = entry
def get_entry(self):
return self._entry
class Badfieldvalueerror(ValidationError, FieldError):
field_value_error_range_set = '1'
field_value_error_no_word_wrap = '2'
field_value_error_empty_value = '3'
field_value_error_single_word = '4'
error_types = {'1': 'Range Set', '2': 'No Word Wrap', '3': 'Empty Value', '4': 'Single Word'}
def __init__(self, errorType, entry, field, fmMetadata):
self._entry = entry
self._errorType = errorType
self._field = field
self._fmMetadata = fmMetadata
def __str__(self):
e = self.getEntry()
f = self.getField()
typ = self.getErrorDescription()
s = "'%s' error in '\\%s' field of record %i!\nRecord:\n%s" % (typ, f.getMarker(), e.getNumber(), e.getRawText())
return s
def get_field_marker_metadata(self):
return self._fmMetadata
def set_field_marker_metadata(self, fmMetadata):
self._fmMetadata = fmMetadata
def get_error_description(self):
try:
return self.errorTypes[self.getErrorType()]
except:
return None
def get_error_type(self):
return self._errorType
def set_error_type(self, errorType):
self._errorType = errorType
def get_entry(self):
return self._entry
def set_entry(self, entry):
self._entry = entry
|
#Declare variables to hold the file name and access mode
fileName = "GuestList.txt"
accessMode = "w"
#Open the file for writing
myFile = open(fileName, accessMode)
#Write the guest names and ages to the file
#I can write an entire record in one write statement
myFile.write("Doyle McCarty,27\n")
myFile.write("Jodi Mills,25\n")
myFile.write("Nicholas Rose,32\n")
#I could write the name and age in separate write statements
myFile.write("Kian Goddard")
myFile.write(",36\n")
myFile.write("Zuha Hanania")
myFile.write(",26\n")
#Close the file
myFile.close()
|
file_name = 'GuestList.txt'
access_mode = 'w'
my_file = open(fileName, accessMode)
myFile.write('Doyle McCarty,27\n')
myFile.write('Jodi Mills,25\n')
myFile.write('Nicholas Rose,32\n')
myFile.write('Kian Goddard')
myFile.write(',36\n')
myFile.write('Zuha Hanania')
myFile.write(',26\n')
myFile.close()
|
""" fizzbuzz for 1 to 100
fizz on 3
buzz on 5
fiizzbuzz on 15
"""
for i in range(1, 101):
if i % 15 == 0:
print("fizzbuzz")
continue
if i % 3 == 0:
print('fizz')
continue
if i % 5 == 0:
print('buzz')
continue
print(i)
|
""" fizzbuzz for 1 to 100
fizz on 3
buzz on 5
fiizzbuzz on 15
"""
for i in range(1, 101):
if i % 15 == 0:
print('fizzbuzz')
continue
if i % 3 == 0:
print('fizz')
continue
if i % 5 == 0:
print('buzz')
continue
print(i)
|
#Date: 033122
#Difficulty: Medium
class Solution(object):
def longestPalindrome(self, s):
"""
:type s: str
:rtype: str
"""
start=end=0
for i in range(len(s)):
length1=self.expandFromMiddle(s,i,i)
length2=self.expandFromMiddle(s,i,i+1)
maxLength=max(length1,length2)
if maxLength>end-start+1:
start=i-(maxLength-1)//2
end=i+maxLength//2
return s[start:end+1]
def expandFromMiddle(self,s,left,right):
while left>=0 and right<len(s) and s[left]==s[right]:
left-=1
right+=1
return right-left-1
|
class Solution(object):
def longest_palindrome(self, s):
"""
:type s: str
:rtype: str
"""
start = end = 0
for i in range(len(s)):
length1 = self.expandFromMiddle(s, i, i)
length2 = self.expandFromMiddle(s, i, i + 1)
max_length = max(length1, length2)
if maxLength > end - start + 1:
start = i - (maxLength - 1) // 2
end = i + maxLength // 2
return s[start:end + 1]
def expand_from_middle(self, s, left, right):
while left >= 0 and right < len(s) and (s[left] == s[right]):
left -= 1
right += 1
return right - left - 1
|
def set_dimensions(dimensions):
"""
Set properly dimensions that we want to load
@dimensions: list
"""
result = []
for i in dimensions:
d = {
'name': i
}
result.append(d)
return result
def set_metrics(metrics):
"""
Set properly metrics that we want to load
@metrics: list
"""
result = []
for i in metrics:
d = {
'expression': i
}
result.append(d)
return result
def set_date_range(start_date, end_date):
"""
Set properly date range
@start_date: string date "yyyy-mm-dd"
@end_date: string date "yyyy-mm-dd"
"""
return [{'startDate': start_date, 'endDate': end_date}]
def get_report(analytics, view_id, dimensions, metrics, start_date, end_date, sampling_level="LARGE",
metric_filter=None, dimension_filter=None, segments=None,page_token=None):
"""
Use the Analytics Service Object to query the Analytics Reporting API V4.
@analytics: result of initialize_api function
@view_id: Id of Customer's Google Analytics View
@dimensions: list of dimensions (set at the top of the script)
@metrics: list of metrics (set at the top of the script)
@start_date: string date "yyyy-mm-dd"
@end_date: string date "yyyy-mm-dd"
@samplingLevel : samplingLevel, "LARGE" by default
return : API response
"""
body = {
'reportRequests': [
{
'viewId': view_id,
'dateRanges': set_date_range(start_date, end_date),
'dimensions': set_dimensions(dimensions),
'metrics': set_metrics(metrics),
'samplingLevel': sampling_level,
"pageToken": page_token
}]
}
if metric_filter:
body["reportRequests"][0]["metricFilterClauses"] = metric_filter
if dimension_filter:
body["reportRequests"][0]["dimensionFilterClauses"] = dimension_filter
if segments:
body["reportRequests"][0]["segments"] = segments
response = analytics.reports().batchGet(body=body).execute()
return response
|
def set_dimensions(dimensions):
"""
Set properly dimensions that we want to load
@dimensions: list
"""
result = []
for i in dimensions:
d = {'name': i}
result.append(d)
return result
def set_metrics(metrics):
"""
Set properly metrics that we want to load
@metrics: list
"""
result = []
for i in metrics:
d = {'expression': i}
result.append(d)
return result
def set_date_range(start_date, end_date):
"""
Set properly date range
@start_date: string date "yyyy-mm-dd"
@end_date: string date "yyyy-mm-dd"
"""
return [{'startDate': start_date, 'endDate': end_date}]
def get_report(analytics, view_id, dimensions, metrics, start_date, end_date, sampling_level='LARGE', metric_filter=None, dimension_filter=None, segments=None, page_token=None):
"""
Use the Analytics Service Object to query the Analytics Reporting API V4.
@analytics: result of initialize_api function
@view_id: Id of Customer's Google Analytics View
@dimensions: list of dimensions (set at the top of the script)
@metrics: list of metrics (set at the top of the script)
@start_date: string date "yyyy-mm-dd"
@end_date: string date "yyyy-mm-dd"
@samplingLevel : samplingLevel, "LARGE" by default
return : API response
"""
body = {'reportRequests': [{'viewId': view_id, 'dateRanges': set_date_range(start_date, end_date), 'dimensions': set_dimensions(dimensions), 'metrics': set_metrics(metrics), 'samplingLevel': sampling_level, 'pageToken': page_token}]}
if metric_filter:
body['reportRequests'][0]['metricFilterClauses'] = metric_filter
if dimension_filter:
body['reportRequests'][0]['dimensionFilterClauses'] = dimension_filter
if segments:
body['reportRequests'][0]['segments'] = segments
response = analytics.reports().batchGet(body=body).execute()
return response
|
# based on: https://github.com/tigertv/secretpy/blob/master/secretpy/ciphers/autokey.py
class cipher_autokey:
def process(self, alphabet, key, text, isEncrypt):
ans = ""
for i in range(len(text)):
m = text[i]
if i < len(key):
k = key[i]
else:
if isEncrypt == 1:
k = text[i - len(key)]
else:
k = ans[i - len(key)]
try:
alphI = alphabet.index(m)
except ValueError:
wrchar = m.encode('utf-8')
raise Exception("Can't find char '" + wrchar + "' of text in alphabet!")
try:
alphI += isEncrypt * alphabet.index(k)
except ValueError:
wrchar = k.encode('utf-8')
raise Exception("Can't find char '" + wrchar + "' of text in alphabet!")
alphI = alphI % len(alphabet)
enc = alphabet[alphI]
ans += enc
return ans
def encrypt(self, text, key, alphabet=u"abcdefghijklmnopqrstuvwxyz"):
return self.process(alphabet, key, text, 1)
def decrypt(self, text, key, alphabet=u"abcdefghijklmnopqrstuvwxyz"):
return self.process(alphabet, key, text, -1)
|
class Cipher_Autokey:
def process(self, alphabet, key, text, isEncrypt):
ans = ''
for i in range(len(text)):
m = text[i]
if i < len(key):
k = key[i]
elif isEncrypt == 1:
k = text[i - len(key)]
else:
k = ans[i - len(key)]
try:
alph_i = alphabet.index(m)
except ValueError:
wrchar = m.encode('utf-8')
raise exception("Can't find char '" + wrchar + "' of text in alphabet!")
try:
alph_i += isEncrypt * alphabet.index(k)
except ValueError:
wrchar = k.encode('utf-8')
raise exception("Can't find char '" + wrchar + "' of text in alphabet!")
alph_i = alphI % len(alphabet)
enc = alphabet[alphI]
ans += enc
return ans
def encrypt(self, text, key, alphabet=u'abcdefghijklmnopqrstuvwxyz'):
return self.process(alphabet, key, text, 1)
def decrypt(self, text, key, alphabet=u'abcdefghijklmnopqrstuvwxyz'):
return self.process(alphabet, key, text, -1)
|
class Settings:
"""
The Settings class offer a convenient method to child class to attribute
values from a dictionary to the class variables for which name and key match
"""
def setProperties(self, settings: dict):
"""
set variable value with dictionary value if the key is the same than the variable name
---
Parameters:
-settings: dictionary with keys possible equivalent to variable names
and values = values to set in variables
"""
if not settings:
return
for key in settings:
if hasattr(self, key):
setattr(self, key, settings[key])
|
class Settings:
"""
The Settings class offer a convenient method to child class to attribute
values from a dictionary to the class variables for which name and key match
"""
def set_properties(self, settings: dict):
"""
set variable value with dictionary value if the key is the same than the variable name
---
Parameters:
-settings: dictionary with keys possible equivalent to variable names
and values = values to set in variables
"""
if not settings:
return
for key in settings:
if hasattr(self, key):
setattr(self, key, settings[key])
|
class User:
user_list =[]
user_list = []
def __init__(self, user_name, email, password):
'''
saving user credentials into user_list for login
'''
self.user_name = user_name
self.email = email
self.password = password
def save_user(self):
'''
saving a user into our list of users
'''
User.user_list.append(self)
def delete_user(self):
'''
delete a user from our list of users
'''
User.user_list.remove(self)
def check_existing_user(self):
return User.check_existing_user(self)
def display_users(self):
'''
function that saves Users
'''
return User.display_users(self)
@classmethod
def find_by_password(user_name, password):
# '''
# Method that takes in a name and returns a name that matches that user_name.
# Args:
# name: password to search for
# Returns :
# name of person that matches the name.
# '''
for user in cls.user_list:
if user.user_name == User:
return User
|
class User:
user_list = []
user_list = []
def __init__(self, user_name, email, password):
"""
saving user credentials into user_list for login
"""
self.user_name = user_name
self.email = email
self.password = password
def save_user(self):
"""
saving a user into our list of users
"""
User.user_list.append(self)
def delete_user(self):
"""
delete a user from our list of users
"""
User.user_list.remove(self)
def check_existing_user(self):
return User.check_existing_user(self)
def display_users(self):
"""
function that saves Users
"""
return User.display_users(self)
@classmethod
def find_by_password(user_name, password):
for user in cls.user_list:
if user.user_name == User:
return User
|
init_config = {
'username': '[email protected]',
'pwd': 'password',
'mongodb': {
'host': 'mongodb://localhost:27017/'
}
}
|
init_config = {'username': '[email protected]', 'pwd': 'password', 'mongodb': {'host': 'mongodb://localhost:27017/'}}
|
#!/usr/bin/env python
__all__ = ["dendrogram", "dotplot", "drawable", "letter", "logo"]
__copyright__ = "Copyright 2007-2020, The Cogent Project"
__contributors__ = [
"Peter Maxwell",
"Gavin Huttley",
"Rob Knight",
"Zongzhi Liu",
"Matthew Wakefield",
"Stephanie Wilson",
"Rahul Ghangas",
"Sheng Han Moses Koh",
]
__license__ = "BSD-3"
__version__ = "2020.7.2a"
__status__ = "Production"
|
__all__ = ['dendrogram', 'dotplot', 'drawable', 'letter', 'logo']
__copyright__ = 'Copyright 2007-2020, The Cogent Project'
__contributors__ = ['Peter Maxwell', 'Gavin Huttley', 'Rob Knight', 'Zongzhi Liu', 'Matthew Wakefield', 'Stephanie Wilson', 'Rahul Ghangas', 'Sheng Han Moses Koh']
__license__ = 'BSD-3'
__version__ = '2020.7.2a'
__status__ = 'Production'
|
#
# PySNMP MIB module Dell-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/Dell-MIB
# Produced by pysmi-0.3.4 at Wed May 1 12:55:18 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, ConstraintsUnion, ConstraintsIntersection, SingleValueConstraint, ValueRangeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ConstraintsUnion", "ConstraintsIntersection", "SingleValueConstraint", "ValueRangeConstraint")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
Bits, TimeTicks, Counter64, NotificationType, ObjectIdentity, MibScalar, MibTable, MibTableRow, MibTableColumn, MibIdentifier, iso, Counter32, enterprises, ModuleIdentity, Unsigned32, Gauge32, IpAddress, Integer32 = mibBuilder.importSymbols("SNMPv2-SMI", "Bits", "TimeTicks", "Counter64", "NotificationType", "ObjectIdentity", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "MibIdentifier", "iso", "Counter32", "enterprises", "ModuleIdentity", "Unsigned32", "Gauge32", "IpAddress", "Integer32")
DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention")
class Percents(Integer32):
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(0, 100)
class NetNumber(OctetString):
subtypeSpec = OctetString.subtypeSpec + ValueSizeConstraint(4, 4)
fixedLength = 4
class VlanPriority(Integer32):
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(0, 7)
rnd = ModuleIdentity((1, 3, 6, 1, 4, 1, 89))
rnd.setRevisions(('2007-01-02 00:00',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts: rnd.setRevisionsDescriptions(('Initial revision.',))
if mibBuilder.loadTexts: rnd.setLastUpdated('200701020000Z')
if mibBuilder.loadTexts: rnd.setOrganization('Dell')
if mibBuilder.loadTexts: rnd.setContactInfo('www.dell.com')
if mibBuilder.loadTexts: rnd.setDescription('This private MIB module defines Dell private MIBs.')
rndNotifications = ObjectIdentity((1, 3, 6, 1, 4, 1, 89, 0))
if mibBuilder.loadTexts: rndNotifications.setStatus('current')
if mibBuilder.loadTexts: rndNotifications.setDescription(" All the rnd notifications will reside under this branch as specified in RFC2578 'Structure of Management Information Version 2 (SMIv2)' 8.5")
rndMng = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 1))
rndDeviceParams = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 2))
rndBootP = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 24))
ipSpec = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 26))
rsTunning = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 29))
rndApplications = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 35))
rsUDP = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 42))
swInterfaces = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 43))
rlIPmulticast = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 46))
rlFFT = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 47))
vlan = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 48))
rlRmonControl = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 49))
rlBrgMacSwitch = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 50))
rlExperience = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 51))
rlCli = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 52))
rlPhysicalDescription = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 53))
rlIfInterfaces = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 54))
rlMacMulticast = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 55))
rlGalileo = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 56))
rlpBridgeMIBObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 57))
rlTelnet = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 58))
rlPolicy = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 59))
rlArpSpoofing = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 60))
rlMir = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 61))
rlIpMRouteStdMIB = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 62))
rl3sw2swTables = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 63))
rlGvrp = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 64))
rlDot3adAgg = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 65))
rlEmbWeb = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 66))
rlSwPackageVersion = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 67))
rlBroadcom = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 68))
rlMultiSessionTerminal = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 69))
rlRCli = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 70))
rlBgp = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 71))
rlAgentsCapabilitiesGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 72))
rlAggregateVlan = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 73))
rlGmrp = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 75))
rlDhcpCl = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 76))
rlStormCtrl = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 77))
rlSsh = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 78))
rlAAA = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 79))
rlRadius = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 80))
rlTraceRoute = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 81))
rlSyslog = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 82))
rlEnv = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 83))
rlSmon = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 84))
rlSocket = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 85))
rlDigitalKeyManage = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 86))
rlCopy = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 87))
rlQosCliMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 88))
rlMngInf = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 89))
rlPhy = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 90))
rlJumboFrames = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 91))
rlTimeSynchronization = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 92))
rlDnsCl = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 93))
rlCDB = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 94))
rldot1x = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 95))
rlFile = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 96))
rlAAAEap = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 97))
rlSNMP = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 98))
rlSsl = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 100))
rlMacBasePrio = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 101))
rlWlanAccessPoint = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 102))
rlLocalization = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 103))
rlRs232 = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 104))
rlNicRedundancy = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 105))
rlAmap = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 106))
rlStack = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 107))
rlPoe = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 108))
rlUPnP = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 109))
rlLldp = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 110))
rlOib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 111))
rlBridgeSecurity = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 112))
rlDhcpSpoofing = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 113))
rlBonjour = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 114))
rlLinksysSmartMIB = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 115))
rlBrgMulticast = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 116))
rlBrgMcMngr = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 117))
rlGlobalIpAddrTable = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 118))
dlPrivate = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 119))
rlSecuritySuiteMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 120))
rlIntel = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 121))
rlTunnel = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 122))
rlAutoUpdate = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 123))
rlCpuCounters = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 124))
rlLbd = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 127))
rlErrdisableRecovery = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 128))
rlIPv6 = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 129))
rlActionAcl = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 130))
rlSafeGuard = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 131))
rlProtectedPorts = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 132))
rlBanner = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 133))
rlGreenEth = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 134))
rlDlf = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 135))
rlVlanTrunking = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 136))
rlCdp = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 137))
rlTrafficSeg = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 138))
rlImpbFeatures = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 139))
rlSmartPorts = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 140))
rlStatistics = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 141))
rlDeleteImg = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 142))
rlCustom1BonjourService = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 143))
rlSpecialBpdu = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 144))
rlTBIMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 145))
rlWeightedRandomTailDrop = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 146))
rlsFlowMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 147))
rlPfcMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 148))
rlEee = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 149))
rlEventsMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 150))
rlWlanMIB = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 200))
rlEtsMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 201))
rlQcnMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 202))
rlSctMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 203))
rlSysmngMib = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 204))
rlFip = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 205))
rlDebugCapabilities = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 206))
rlIpStdAcl = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 207))
rlWBA = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 208))
rlSecSd = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 209))
rlOspf = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 210))
rlRtRedist = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 211))
rlIpPrefList = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 212))
rlVoipSnoop = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 213))
rlDhcpv6 = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 214))
rlIpv6Fhs = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 215))
rlInventoryEnt = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 217))
rlUdld = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 218))
rndEndOfMibGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 89, 1000))
mibBuilder.exportSymbols("Dell-MIB", rlTBIMib=rlTBIMib, rlCDB=rlCDB, rndNotifications=rndNotifications, rlExperience=rlExperience, rlRCli=rlRCli, rlSecuritySuiteMib=rlSecuritySuiteMib, rlDhcpCl=rlDhcpCl, rlWeightedRandomTailDrop=rlWeightedRandomTailDrop, rlAgentsCapabilitiesGroups=rlAgentsCapabilitiesGroups, rlPolicy=rlPolicy, rlGvrp=rlGvrp, rlEtsMib=rlEtsMib, rl3sw2swTables=rl3sw2swTables, rlImpbFeatures=rlImpbFeatures, Percents=Percents, rlTunnel=rlTunnel, rlTrafficSeg=rlTrafficSeg, rlIfInterfaces=rlIfInterfaces, rlGreenEth=rlGreenEth, rlDhcpSpoofing=rlDhcpSpoofing, rlRs232=rlRs232, rlPoe=rlPoe, rlFip=rlFip, rlStormCtrl=rlStormCtrl, rlQosCliMib=rlQosCliMib, rlIpv6Fhs=rlIpv6Fhs, rlCli=rlCli, rlSNMP=rlSNMP, rlFile=rlFile, rlRmonControl=rlRmonControl, NetNumber=NetNumber, rlDigitalKeyManage=rlDigitalKeyManage, rlDhcpv6=rlDhcpv6, rlEmbWeb=rlEmbWeb, rndMng=rndMng, rlIPv6=rlIPv6, rlBgp=rlBgp, rlTimeSynchronization=rlTimeSynchronization, rlIpPrefList=rlIpPrefList, rlDot3adAgg=rlDot3adAgg, rlQcnMib=rlQcnMib, rlBroadcom=rlBroadcom, rlNicRedundancy=rlNicRedundancy, rlCopy=rlCopy, rlTelnet=rlTelnet, rlFFT=rlFFT, rlIpStdAcl=rlIpStdAcl, rlLinksysSmartMIB=rlLinksysSmartMIB, rlAAA=rlAAA, rlCpuCounters=rlCpuCounters, rlDebugCapabilities=rlDebugCapabilities, ipSpec=ipSpec, rsTunning=rsTunning, rlGmrp=rlGmrp, rlCustom1BonjourService=rlCustom1BonjourService, PYSNMP_MODULE_ID=rnd, rlUPnP=rlUPnP, rlVoipSnoop=rlVoipSnoop, rlSmon=rlSmon, rlBrgMacSwitch=rlBrgMacSwitch, rlSecSd=rlSecSd, rlSsl=rlSsl, rlSocket=rlSocket, rlLbd=rlLbd, rlBanner=rlBanner, rlPhysicalDescription=rlPhysicalDescription, rlBridgeSecurity=rlBridgeSecurity, rlEee=rlEee, rlLocalization=rlLocalization, rlSysmngMib=rlSysmngMib, rlRtRedist=rlRtRedist, VlanPriority=VlanPriority, rlAutoUpdate=rlAutoUpdate, rlsFlowMib=rlsFlowMib, rlTraceRoute=rlTraceRoute, rlWlanAccessPoint=rlWlanAccessPoint, rlPhy=rlPhy, dlPrivate=dlPrivate, rnd=rnd, rlBrgMcMngr=rlBrgMcMngr, rlAggregateVlan=rlAggregateVlan, rlAAAEap=rlAAAEap, rlJumboFrames=rlJumboFrames, rlMngInf=rlMngInf, rlSmartPorts=rlSmartPorts, vlan=vlan, rlEnv=rlEnv, rlBrgMulticast=rlBrgMulticast, rlCdp=rlCdp, swInterfaces=swInterfaces, rndEndOfMibGroup=rndEndOfMibGroup, rlSctMib=rlSctMib, rlOspf=rlOspf, rndDeviceParams=rndDeviceParams, rlIpMRouteStdMIB=rlIpMRouteStdMIB, rlGlobalIpAddrTable=rlGlobalIpAddrTable, rlMir=rlMir, rndApplications=rndApplications, rlStack=rlStack, rlProtectedPorts=rlProtectedPorts, rlWlanMIB=rlWlanMIB, rlAmap=rlAmap, rlInventoryEnt=rlInventoryEnt, rlPfcMib=rlPfcMib, rlDeleteImg=rlDeleteImg, rlMacMulticast=rlMacMulticast, rlSwPackageVersion=rlSwPackageVersion, rlMultiSessionTerminal=rlMultiSessionTerminal, rsUDP=rsUDP, rlDnsCl=rlDnsCl, rlSyslog=rlSyslog, rlVlanTrunking=rlVlanTrunking, rndBootP=rndBootP, rlOib=rlOib, rlIPmulticast=rlIPmulticast, rlSsh=rlSsh, rlBonjour=rlBonjour, rlActionAcl=rlActionAcl, rlDlf=rlDlf, rldot1x=rldot1x, rlRadius=rlRadius, rlStatistics=rlStatistics, rlpBridgeMIBObjects=rlpBridgeMIBObjects, rlErrdisableRecovery=rlErrdisableRecovery, rlWBA=rlWBA, rlLldp=rlLldp, rlSpecialBpdu=rlSpecialBpdu, rlGalileo=rlGalileo, rlMacBasePrio=rlMacBasePrio, rlIntel=rlIntel, rlUdld=rlUdld, rlArpSpoofing=rlArpSpoofing, rlSafeGuard=rlSafeGuard, rlEventsMib=rlEventsMib)
|
(object_identifier, octet_string, integer) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'OctetString', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, constraints_union, constraints_intersection, single_value_constraint, value_range_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'ConstraintsUnion', 'ConstraintsIntersection', 'SingleValueConstraint', 'ValueRangeConstraint')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(bits, time_ticks, counter64, notification_type, object_identity, mib_scalar, mib_table, mib_table_row, mib_table_column, mib_identifier, iso, counter32, enterprises, module_identity, unsigned32, gauge32, ip_address, integer32) = mibBuilder.importSymbols('SNMPv2-SMI', 'Bits', 'TimeTicks', 'Counter64', 'NotificationType', 'ObjectIdentity', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'MibIdentifier', 'iso', 'Counter32', 'enterprises', 'ModuleIdentity', 'Unsigned32', 'Gauge32', 'IpAddress', 'Integer32')
(display_string, textual_convention) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TextualConvention')
class Percents(Integer32):
subtype_spec = Integer32.subtypeSpec + value_range_constraint(0, 100)
class Netnumber(OctetString):
subtype_spec = OctetString.subtypeSpec + value_size_constraint(4, 4)
fixed_length = 4
class Vlanpriority(Integer32):
subtype_spec = Integer32.subtypeSpec + value_range_constraint(0, 7)
rnd = module_identity((1, 3, 6, 1, 4, 1, 89))
rnd.setRevisions(('2007-01-02 00:00',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts:
rnd.setRevisionsDescriptions(('Initial revision.',))
if mibBuilder.loadTexts:
rnd.setLastUpdated('200701020000Z')
if mibBuilder.loadTexts:
rnd.setOrganization('Dell')
if mibBuilder.loadTexts:
rnd.setContactInfo('www.dell.com')
if mibBuilder.loadTexts:
rnd.setDescription('This private MIB module defines Dell private MIBs.')
rnd_notifications = object_identity((1, 3, 6, 1, 4, 1, 89, 0))
if mibBuilder.loadTexts:
rndNotifications.setStatus('current')
if mibBuilder.loadTexts:
rndNotifications.setDescription(" All the rnd notifications will reside under this branch as specified in RFC2578 'Structure of Management Information Version 2 (SMIv2)' 8.5")
rnd_mng = mib_identifier((1, 3, 6, 1, 4, 1, 89, 1))
rnd_device_params = mib_identifier((1, 3, 6, 1, 4, 1, 89, 2))
rnd_boot_p = mib_identifier((1, 3, 6, 1, 4, 1, 89, 24))
ip_spec = mib_identifier((1, 3, 6, 1, 4, 1, 89, 26))
rs_tunning = mib_identifier((1, 3, 6, 1, 4, 1, 89, 29))
rnd_applications = mib_identifier((1, 3, 6, 1, 4, 1, 89, 35))
rs_udp = mib_identifier((1, 3, 6, 1, 4, 1, 89, 42))
sw_interfaces = mib_identifier((1, 3, 6, 1, 4, 1, 89, 43))
rl_i_pmulticast = mib_identifier((1, 3, 6, 1, 4, 1, 89, 46))
rl_fft = mib_identifier((1, 3, 6, 1, 4, 1, 89, 47))
vlan = mib_identifier((1, 3, 6, 1, 4, 1, 89, 48))
rl_rmon_control = mib_identifier((1, 3, 6, 1, 4, 1, 89, 49))
rl_brg_mac_switch = mib_identifier((1, 3, 6, 1, 4, 1, 89, 50))
rl_experience = mib_identifier((1, 3, 6, 1, 4, 1, 89, 51))
rl_cli = mib_identifier((1, 3, 6, 1, 4, 1, 89, 52))
rl_physical_description = mib_identifier((1, 3, 6, 1, 4, 1, 89, 53))
rl_if_interfaces = mib_identifier((1, 3, 6, 1, 4, 1, 89, 54))
rl_mac_multicast = mib_identifier((1, 3, 6, 1, 4, 1, 89, 55))
rl_galileo = mib_identifier((1, 3, 6, 1, 4, 1, 89, 56))
rlp_bridge_mib_objects = mib_identifier((1, 3, 6, 1, 4, 1, 89, 57))
rl_telnet = mib_identifier((1, 3, 6, 1, 4, 1, 89, 58))
rl_policy = mib_identifier((1, 3, 6, 1, 4, 1, 89, 59))
rl_arp_spoofing = mib_identifier((1, 3, 6, 1, 4, 1, 89, 60))
rl_mir = mib_identifier((1, 3, 6, 1, 4, 1, 89, 61))
rl_ip_m_route_std_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 62))
rl3sw2sw_tables = mib_identifier((1, 3, 6, 1, 4, 1, 89, 63))
rl_gvrp = mib_identifier((1, 3, 6, 1, 4, 1, 89, 64))
rl_dot3ad_agg = mib_identifier((1, 3, 6, 1, 4, 1, 89, 65))
rl_emb_web = mib_identifier((1, 3, 6, 1, 4, 1, 89, 66))
rl_sw_package_version = mib_identifier((1, 3, 6, 1, 4, 1, 89, 67))
rl_broadcom = mib_identifier((1, 3, 6, 1, 4, 1, 89, 68))
rl_multi_session_terminal = mib_identifier((1, 3, 6, 1, 4, 1, 89, 69))
rl_r_cli = mib_identifier((1, 3, 6, 1, 4, 1, 89, 70))
rl_bgp = mib_identifier((1, 3, 6, 1, 4, 1, 89, 71))
rl_agents_capabilities_groups = mib_identifier((1, 3, 6, 1, 4, 1, 89, 72))
rl_aggregate_vlan = mib_identifier((1, 3, 6, 1, 4, 1, 89, 73))
rl_gmrp = mib_identifier((1, 3, 6, 1, 4, 1, 89, 75))
rl_dhcp_cl = mib_identifier((1, 3, 6, 1, 4, 1, 89, 76))
rl_storm_ctrl = mib_identifier((1, 3, 6, 1, 4, 1, 89, 77))
rl_ssh = mib_identifier((1, 3, 6, 1, 4, 1, 89, 78))
rl_aaa = mib_identifier((1, 3, 6, 1, 4, 1, 89, 79))
rl_radius = mib_identifier((1, 3, 6, 1, 4, 1, 89, 80))
rl_trace_route = mib_identifier((1, 3, 6, 1, 4, 1, 89, 81))
rl_syslog = mib_identifier((1, 3, 6, 1, 4, 1, 89, 82))
rl_env = mib_identifier((1, 3, 6, 1, 4, 1, 89, 83))
rl_smon = mib_identifier((1, 3, 6, 1, 4, 1, 89, 84))
rl_socket = mib_identifier((1, 3, 6, 1, 4, 1, 89, 85))
rl_digital_key_manage = mib_identifier((1, 3, 6, 1, 4, 1, 89, 86))
rl_copy = mib_identifier((1, 3, 6, 1, 4, 1, 89, 87))
rl_qos_cli_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 88))
rl_mng_inf = mib_identifier((1, 3, 6, 1, 4, 1, 89, 89))
rl_phy = mib_identifier((1, 3, 6, 1, 4, 1, 89, 90))
rl_jumbo_frames = mib_identifier((1, 3, 6, 1, 4, 1, 89, 91))
rl_time_synchronization = mib_identifier((1, 3, 6, 1, 4, 1, 89, 92))
rl_dns_cl = mib_identifier((1, 3, 6, 1, 4, 1, 89, 93))
rl_cdb = mib_identifier((1, 3, 6, 1, 4, 1, 89, 94))
rldot1x = mib_identifier((1, 3, 6, 1, 4, 1, 89, 95))
rl_file = mib_identifier((1, 3, 6, 1, 4, 1, 89, 96))
rl_aaa_eap = mib_identifier((1, 3, 6, 1, 4, 1, 89, 97))
rl_snmp = mib_identifier((1, 3, 6, 1, 4, 1, 89, 98))
rl_ssl = mib_identifier((1, 3, 6, 1, 4, 1, 89, 100))
rl_mac_base_prio = mib_identifier((1, 3, 6, 1, 4, 1, 89, 101))
rl_wlan_access_point = mib_identifier((1, 3, 6, 1, 4, 1, 89, 102))
rl_localization = mib_identifier((1, 3, 6, 1, 4, 1, 89, 103))
rl_rs232 = mib_identifier((1, 3, 6, 1, 4, 1, 89, 104))
rl_nic_redundancy = mib_identifier((1, 3, 6, 1, 4, 1, 89, 105))
rl_amap = mib_identifier((1, 3, 6, 1, 4, 1, 89, 106))
rl_stack = mib_identifier((1, 3, 6, 1, 4, 1, 89, 107))
rl_poe = mib_identifier((1, 3, 6, 1, 4, 1, 89, 108))
rl_u_pn_p = mib_identifier((1, 3, 6, 1, 4, 1, 89, 109))
rl_lldp = mib_identifier((1, 3, 6, 1, 4, 1, 89, 110))
rl_oib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 111))
rl_bridge_security = mib_identifier((1, 3, 6, 1, 4, 1, 89, 112))
rl_dhcp_spoofing = mib_identifier((1, 3, 6, 1, 4, 1, 89, 113))
rl_bonjour = mib_identifier((1, 3, 6, 1, 4, 1, 89, 114))
rl_linksys_smart_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 115))
rl_brg_multicast = mib_identifier((1, 3, 6, 1, 4, 1, 89, 116))
rl_brg_mc_mngr = mib_identifier((1, 3, 6, 1, 4, 1, 89, 117))
rl_global_ip_addr_table = mib_identifier((1, 3, 6, 1, 4, 1, 89, 118))
dl_private = mib_identifier((1, 3, 6, 1, 4, 1, 89, 119))
rl_security_suite_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 120))
rl_intel = mib_identifier((1, 3, 6, 1, 4, 1, 89, 121))
rl_tunnel = mib_identifier((1, 3, 6, 1, 4, 1, 89, 122))
rl_auto_update = mib_identifier((1, 3, 6, 1, 4, 1, 89, 123))
rl_cpu_counters = mib_identifier((1, 3, 6, 1, 4, 1, 89, 124))
rl_lbd = mib_identifier((1, 3, 6, 1, 4, 1, 89, 127))
rl_errdisable_recovery = mib_identifier((1, 3, 6, 1, 4, 1, 89, 128))
rl_i_pv6 = mib_identifier((1, 3, 6, 1, 4, 1, 89, 129))
rl_action_acl = mib_identifier((1, 3, 6, 1, 4, 1, 89, 130))
rl_safe_guard = mib_identifier((1, 3, 6, 1, 4, 1, 89, 131))
rl_protected_ports = mib_identifier((1, 3, 6, 1, 4, 1, 89, 132))
rl_banner = mib_identifier((1, 3, 6, 1, 4, 1, 89, 133))
rl_green_eth = mib_identifier((1, 3, 6, 1, 4, 1, 89, 134))
rl_dlf = mib_identifier((1, 3, 6, 1, 4, 1, 89, 135))
rl_vlan_trunking = mib_identifier((1, 3, 6, 1, 4, 1, 89, 136))
rl_cdp = mib_identifier((1, 3, 6, 1, 4, 1, 89, 137))
rl_traffic_seg = mib_identifier((1, 3, 6, 1, 4, 1, 89, 138))
rl_impb_features = mib_identifier((1, 3, 6, 1, 4, 1, 89, 139))
rl_smart_ports = mib_identifier((1, 3, 6, 1, 4, 1, 89, 140))
rl_statistics = mib_identifier((1, 3, 6, 1, 4, 1, 89, 141))
rl_delete_img = mib_identifier((1, 3, 6, 1, 4, 1, 89, 142))
rl_custom1_bonjour_service = mib_identifier((1, 3, 6, 1, 4, 1, 89, 143))
rl_special_bpdu = mib_identifier((1, 3, 6, 1, 4, 1, 89, 144))
rl_tbi_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 145))
rl_weighted_random_tail_drop = mib_identifier((1, 3, 6, 1, 4, 1, 89, 146))
rls_flow_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 147))
rl_pfc_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 148))
rl_eee = mib_identifier((1, 3, 6, 1, 4, 1, 89, 149))
rl_events_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 150))
rl_wlan_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 200))
rl_ets_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 201))
rl_qcn_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 202))
rl_sct_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 203))
rl_sysmng_mib = mib_identifier((1, 3, 6, 1, 4, 1, 89, 204))
rl_fip = mib_identifier((1, 3, 6, 1, 4, 1, 89, 205))
rl_debug_capabilities = mib_identifier((1, 3, 6, 1, 4, 1, 89, 206))
rl_ip_std_acl = mib_identifier((1, 3, 6, 1, 4, 1, 89, 207))
rl_wba = mib_identifier((1, 3, 6, 1, 4, 1, 89, 208))
rl_sec_sd = mib_identifier((1, 3, 6, 1, 4, 1, 89, 209))
rl_ospf = mib_identifier((1, 3, 6, 1, 4, 1, 89, 210))
rl_rt_redist = mib_identifier((1, 3, 6, 1, 4, 1, 89, 211))
rl_ip_pref_list = mib_identifier((1, 3, 6, 1, 4, 1, 89, 212))
rl_voip_snoop = mib_identifier((1, 3, 6, 1, 4, 1, 89, 213))
rl_dhcpv6 = mib_identifier((1, 3, 6, 1, 4, 1, 89, 214))
rl_ipv6_fhs = mib_identifier((1, 3, 6, 1, 4, 1, 89, 215))
rl_inventory_ent = mib_identifier((1, 3, 6, 1, 4, 1, 89, 217))
rl_udld = mib_identifier((1, 3, 6, 1, 4, 1, 89, 218))
rnd_end_of_mib_group = mib_identifier((1, 3, 6, 1, 4, 1, 89, 1000))
mibBuilder.exportSymbols('Dell-MIB', rlTBIMib=rlTBIMib, rlCDB=rlCDB, rndNotifications=rndNotifications, rlExperience=rlExperience, rlRCli=rlRCli, rlSecuritySuiteMib=rlSecuritySuiteMib, rlDhcpCl=rlDhcpCl, rlWeightedRandomTailDrop=rlWeightedRandomTailDrop, rlAgentsCapabilitiesGroups=rlAgentsCapabilitiesGroups, rlPolicy=rlPolicy, rlGvrp=rlGvrp, rlEtsMib=rlEtsMib, rl3sw2swTables=rl3sw2swTables, rlImpbFeatures=rlImpbFeatures, Percents=Percents, rlTunnel=rlTunnel, rlTrafficSeg=rlTrafficSeg, rlIfInterfaces=rlIfInterfaces, rlGreenEth=rlGreenEth, rlDhcpSpoofing=rlDhcpSpoofing, rlRs232=rlRs232, rlPoe=rlPoe, rlFip=rlFip, rlStormCtrl=rlStormCtrl, rlQosCliMib=rlQosCliMib, rlIpv6Fhs=rlIpv6Fhs, rlCli=rlCli, rlSNMP=rlSNMP, rlFile=rlFile, rlRmonControl=rlRmonControl, NetNumber=NetNumber, rlDigitalKeyManage=rlDigitalKeyManage, rlDhcpv6=rlDhcpv6, rlEmbWeb=rlEmbWeb, rndMng=rndMng, rlIPv6=rlIPv6, rlBgp=rlBgp, rlTimeSynchronization=rlTimeSynchronization, rlIpPrefList=rlIpPrefList, rlDot3adAgg=rlDot3adAgg, rlQcnMib=rlQcnMib, rlBroadcom=rlBroadcom, rlNicRedundancy=rlNicRedundancy, rlCopy=rlCopy, rlTelnet=rlTelnet, rlFFT=rlFFT, rlIpStdAcl=rlIpStdAcl, rlLinksysSmartMIB=rlLinksysSmartMIB, rlAAA=rlAAA, rlCpuCounters=rlCpuCounters, rlDebugCapabilities=rlDebugCapabilities, ipSpec=ipSpec, rsTunning=rsTunning, rlGmrp=rlGmrp, rlCustom1BonjourService=rlCustom1BonjourService, PYSNMP_MODULE_ID=rnd, rlUPnP=rlUPnP, rlVoipSnoop=rlVoipSnoop, rlSmon=rlSmon, rlBrgMacSwitch=rlBrgMacSwitch, rlSecSd=rlSecSd, rlSsl=rlSsl, rlSocket=rlSocket, rlLbd=rlLbd, rlBanner=rlBanner, rlPhysicalDescription=rlPhysicalDescription, rlBridgeSecurity=rlBridgeSecurity, rlEee=rlEee, rlLocalization=rlLocalization, rlSysmngMib=rlSysmngMib, rlRtRedist=rlRtRedist, VlanPriority=VlanPriority, rlAutoUpdate=rlAutoUpdate, rlsFlowMib=rlsFlowMib, rlTraceRoute=rlTraceRoute, rlWlanAccessPoint=rlWlanAccessPoint, rlPhy=rlPhy, dlPrivate=dlPrivate, rnd=rnd, rlBrgMcMngr=rlBrgMcMngr, rlAggregateVlan=rlAggregateVlan, rlAAAEap=rlAAAEap, rlJumboFrames=rlJumboFrames, rlMngInf=rlMngInf, rlSmartPorts=rlSmartPorts, vlan=vlan, rlEnv=rlEnv, rlBrgMulticast=rlBrgMulticast, rlCdp=rlCdp, swInterfaces=swInterfaces, rndEndOfMibGroup=rndEndOfMibGroup, rlSctMib=rlSctMib, rlOspf=rlOspf, rndDeviceParams=rndDeviceParams, rlIpMRouteStdMIB=rlIpMRouteStdMIB, rlGlobalIpAddrTable=rlGlobalIpAddrTable, rlMir=rlMir, rndApplications=rndApplications, rlStack=rlStack, rlProtectedPorts=rlProtectedPorts, rlWlanMIB=rlWlanMIB, rlAmap=rlAmap, rlInventoryEnt=rlInventoryEnt, rlPfcMib=rlPfcMib, rlDeleteImg=rlDeleteImg, rlMacMulticast=rlMacMulticast, rlSwPackageVersion=rlSwPackageVersion, rlMultiSessionTerminal=rlMultiSessionTerminal, rsUDP=rsUDP, rlDnsCl=rlDnsCl, rlSyslog=rlSyslog, rlVlanTrunking=rlVlanTrunking, rndBootP=rndBootP, rlOib=rlOib, rlIPmulticast=rlIPmulticast, rlSsh=rlSsh, rlBonjour=rlBonjour, rlActionAcl=rlActionAcl, rlDlf=rlDlf, rldot1x=rldot1x, rlRadius=rlRadius, rlStatistics=rlStatistics, rlpBridgeMIBObjects=rlpBridgeMIBObjects, rlErrdisableRecovery=rlErrdisableRecovery, rlWBA=rlWBA, rlLldp=rlLldp, rlSpecialBpdu=rlSpecialBpdu, rlGalileo=rlGalileo, rlMacBasePrio=rlMacBasePrio, rlIntel=rlIntel, rlUdld=rlUdld, rlArpSpoofing=rlArpSpoofing, rlSafeGuard=rlSafeGuard, rlEventsMib=rlEventsMib)
|
description = 'setup for the cache server'
group = 'special'
devices = dict(
DB=device('nicos.services.cache.server.FlatfileCacheDatabase',
description='On disk storage for Cache Server',
storepath=configdata('config.DATA_PATH') + 'cache',
loglevel='info', ),
Server=device('nicos.services.cache.server.CacheServer',
db='DB',
server='',
loglevel='info',
),
)
|
description = 'setup for the cache server'
group = 'special'
devices = dict(DB=device('nicos.services.cache.server.FlatfileCacheDatabase', description='On disk storage for Cache Server', storepath=configdata('config.DATA_PATH') + 'cache', loglevel='info'), Server=device('nicos.services.cache.server.CacheServer', db='DB', server='', loglevel='info'))
|
# 1.5 Find One Missing Number from 1 to 10
def find_missing_number(list_numbers):
list_sum = 0
for number in list_numbers:
list_sum += number
return 55 - list_sum
|
def find_missing_number(list_numbers):
list_sum = 0
for number in list_numbers:
list_sum += number
return 55 - list_sum
|
## Prime number is divide by 1 and itself
## Display 50 prime numbers in 5 lines, each containing 10 numbers
NUMBER_OF_PRIMES = 50 # Number of primes to display
NUMBER_OF_PRIMES_PER_LINE = 10 # Display 10 per line
count = 0 # Count number of prime numbers
number = 2 # a number to test prime number
while count < NUMBER_OF_PRIMES:
## Check condition to see isPrime = True or False
## Once number % a divisor, isPrime = False immediately and break out of loop; then continue increase number (until number < 50) to check
## If number % a divisor != 0, continue increase divisor (until divisor <= number/2) to check. Until divisor <= number/2 finishes and not break, isPrime = True; and count increases. Then, then continue increase number (until number < 50) to check
isPrime = True
divisor = 2
while divisor <= number / 2:
if number % divisor == 0:
isPrime = False
break
divisor += 1
if isPrime:
count += 1
print(format(number, "2d"), end = ' ')
if count % NUMBER_OF_PRIMES_PER_LINE == 0:
print()
number += 1
|
number_of_primes = 50
number_of_primes_per_line = 10
count = 0
number = 2
while count < NUMBER_OF_PRIMES:
is_prime = True
divisor = 2
while divisor <= number / 2:
if number % divisor == 0:
is_prime = False
break
divisor += 1
if isPrime:
count += 1
print(format(number, '2d'), end=' ')
if count % NUMBER_OF_PRIMES_PER_LINE == 0:
print()
number += 1
|
"""
C++ FOREVER
"""
def hello():
"""
UNREACHABLE GNU Lesser General Public License v3.0
http://opensource.org/licenses/MIT-LICENSE
"""
print("Haskell TOP")
|
"""
C++ FOREVER
"""
def hello():
"""
UNREACHABLE GNU Lesser General Public License v3.0
http://opensource.org/licenses/MIT-LICENSE
"""
print('Haskell TOP')
|
a =[72,73,75,84,85,87,104,105,107,116,117,119]
b =[97,98,99,100,101,102,103]
c =[97,98,99,100,101,103,106]
d =[65,72,74,75,77,79,90,97,104,106,107,109,111,122]
e =[66,67,78,79,84,85,88,89,98,99,110,111,116,117,120,121]
f =[104,105,106,107,108,109,110,111]
g =[112,113,114,117,118,119]
res = [bytearray([a1, b1, c1, d1, e1, f1, g1]) for a1 in a for b1 in b for c1 in c for d1 in d for e1 in e for f1 in f for g1 in g]
enc_bytes = bytearray([13,23,6,25,0,95,27,13,80,16,14,23,5,69,17,8,13,12,13,7,70,6,81,83,9,58,59,51,28,9,82,24,0,92,20,26])
def xor(data, key):
l = len(key)
decoded = bytearray()
for i in range(0, len(data)):
decoded.append(data[i]^key[i % l])
return decoded.decode("ascii")
for key in res:
ka = xor(enc_bytes,key)
if "n00bCTF"in ka:
print(ka)
break
|
a = [72, 73, 75, 84, 85, 87, 104, 105, 107, 116, 117, 119]
b = [97, 98, 99, 100, 101, 102, 103]
c = [97, 98, 99, 100, 101, 103, 106]
d = [65, 72, 74, 75, 77, 79, 90, 97, 104, 106, 107, 109, 111, 122]
e = [66, 67, 78, 79, 84, 85, 88, 89, 98, 99, 110, 111, 116, 117, 120, 121]
f = [104, 105, 106, 107, 108, 109, 110, 111]
g = [112, 113, 114, 117, 118, 119]
res = [bytearray([a1, b1, c1, d1, e1, f1, g1]) for a1 in a for b1 in b for c1 in c for d1 in d for e1 in e for f1 in f for g1 in g]
enc_bytes = bytearray([13, 23, 6, 25, 0, 95, 27, 13, 80, 16, 14, 23, 5, 69, 17, 8, 13, 12, 13, 7, 70, 6, 81, 83, 9, 58, 59, 51, 28, 9, 82, 24, 0, 92, 20, 26])
def xor(data, key):
l = len(key)
decoded = bytearray()
for i in range(0, len(data)):
decoded.append(data[i] ^ key[i % l])
return decoded.decode('ascii')
for key in res:
ka = xor(enc_bytes, key)
if 'n00bCTF' in ka:
print(ka)
break
|
class AttnDecoderRNN(nn.Module):
def __init__(self, dec_hidden_size, enc_hidden_size, dec_output_size, dropout_p=0):
super(AttnDecoderRNN, self).__init__()
self.hidden_size = dec_hidden_size
self.output_size = dec_output_size
self.dropout_p = dropout_p
self.lin_decoder = nn.Linear(dec_hidden_size, dec_hidden_size) # to convert input
self.lin_encoder = nn.Linear(enc_hidden_size, dec_hidden_size) # to convert encoder_outputs
self.linear_out = nn.Linear(dec_hidden_size + enc_hidden_size , dec_hidden_size, bias=False)
def forward(self, input, hidden, encoder_outputs):
# hidden not a tuple (htx, ctx) -> batch X dec_hid
# encoder_outputs -> batch X seq X enc_hid
# input -> batch x 1 X dec_hid
projected_context = F.tanh(self.lin_encoder(encoder_outputs)) # # batch X seq X enc_hid -> batch X seq X dec_hid
projected_input = F.tanh(self.lin_decoder(input)).unsqueeze(2) # batch X dec_hid X 1
# RAW ATTENTION
attn_dot = torch.bmm(projected_context, projected_input).squeeze(2) # batch X seq X 1 -> batch X seq
attn = F.softmax(attn_dot, dim=1) # NORMALIZED ATTENTION
reshaped_attn = attn.unsqueeze(1) # batch X 1 X seq
weighted_context = torch.bmm(reshaped_attn, encoder_outputs).squeeze(1) # batch X 1 X seq * batch X seq X enc_hid
# -> batch X 1 x enc_hid -> batch X enc_hid
h_tilde = torch.cat((weighted_context, hidden), 1) # -> batch X dec_hid+enc_hid
h_tilde = F.tanh(self.linear_out(h_tilde))
return h_tilde, attn
|
class Attndecoderrnn(nn.Module):
def __init__(self, dec_hidden_size, enc_hidden_size, dec_output_size, dropout_p=0):
super(AttnDecoderRNN, self).__init__()
self.hidden_size = dec_hidden_size
self.output_size = dec_output_size
self.dropout_p = dropout_p
self.lin_decoder = nn.Linear(dec_hidden_size, dec_hidden_size)
self.lin_encoder = nn.Linear(enc_hidden_size, dec_hidden_size)
self.linear_out = nn.Linear(dec_hidden_size + enc_hidden_size, dec_hidden_size, bias=False)
def forward(self, input, hidden, encoder_outputs):
projected_context = F.tanh(self.lin_encoder(encoder_outputs))
projected_input = F.tanh(self.lin_decoder(input)).unsqueeze(2)
attn_dot = torch.bmm(projected_context, projected_input).squeeze(2)
attn = F.softmax(attn_dot, dim=1)
reshaped_attn = attn.unsqueeze(1)
weighted_context = torch.bmm(reshaped_attn, encoder_outputs).squeeze(1)
h_tilde = torch.cat((weighted_context, hidden), 1)
h_tilde = F.tanh(self.linear_out(h_tilde))
return (h_tilde, attn)
|
class FailureMessageAccessor(object,IDisposable):
""" Restricted accessor for FailureMessage. """
def CloneFailureMessage(self):
"""
CloneFailureMessage(self: FailureMessageAccessor) -> FailureMessage
Creates a copy of the FailureMessage.
Returns: Copy of the FailureMesassge.
"""
pass
def Dispose(self):
""" Dispose(self: FailureMessageAccessor) """
pass
def GetAdditionalElementIds(self):
"""
GetAdditionalElementIds(self: FailureMessageAccessor) -> ICollection[ElementId]
Retrieves Ids of Elements that have not caused the failure but are related to
it
Checks if the failure has resolution of a given resolution type.
Returns: Ids of Elements related to the failure
"""
pass
def GetCurrentResolutionType(self):
"""
GetCurrentResolutionType(self: FailureMessageAccessor) -> FailureResolutionType
Retrieves the type of resolution to be used to resolve the failure.
Returns: The type of failure resolution to be used to resolve the failure.
"""
pass
def GetDefaultResolutionCaption(self):
"""
GetDefaultResolutionCaption(self: FailureMessageAccessor) -> str
Retrieves the caption of default resolution of the failure.
Returns: The caption of default resolution of the failure.
"""
pass
def GetDescriptionText(self):
"""
GetDescriptionText(self: FailureMessageAccessor) -> str
Retrieves the description of the failure.
Returns: The description text.
"""
pass
def GetFailingElementIds(self):
"""
GetFailingElementIds(self: FailureMessageAccessor) -> ICollection[ElementId]
Retrieves Ids of Elements that have caused the failure.
Returns: Ids of Elements that have caused the failure.
"""
pass
def GetFailureDefinitionId(self):
"""
GetFailureDefinitionId(self: FailureMessageAccessor) -> FailureDefinitionId
Retrieves the Id of the FailureDefinition of the failure.
Returns: The Id of the FailureDefinition of the failure.
"""
pass
def GetNumberOfResolutions(self):
"""
GetNumberOfResolutions(self: FailureMessageAccessor) -> int
Retrieves number of resolutions that can be used to resolve failure.
Returns: Number of resolutions that can be used to resolve failure
"""
pass
def GetSeverity(self):
"""
GetSeverity(self: FailureMessageAccessor) -> FailureSeverity
Retrieves the severity of the failure.
Returns: The severity of the failure.
"""
pass
def HasResolutionOfType(self,type):
"""
HasResolutionOfType(self: FailureMessageAccessor,type: FailureResolutionType) -> bool
Checks if failure has a resolution of a given type.
type: The type of resolution.
Returns: True if failure has a resolution of a given type,false otherwise.
"""
pass
def HasResolutions(self):
"""
HasResolutions(self: FailureMessageAccessor) -> bool
Checks if the failure has any resolutions.
Returns: True if the failure has any resolutions,false otherwise.
"""
pass
def ReleaseUnmanagedResources(self,*args):
""" ReleaseUnmanagedResources(self: FailureMessageAccessor,disposing: bool) """
pass
def SetCurrentResolutionType(self,resolutionType):
"""
SetCurrentResolutionType(self: FailureMessageAccessor,resolutionType: FailureResolutionType)
Sets the type of a resolution to be used to resolve the failure.
resolutionType: The type of failure resolution to be used to resolve the failure.
"""
pass
def ShouldMergeWithMessage(self,messageToMergeWith):
"""
ShouldMergeWithMessage(self: FailureMessageAccessor,messageToMergeWith: FailureMessageAccessor) -> bool
Checks if the FailureMessage should be merged with the other FailureMessage for
better user experience.
Returns: True if messages should be merged
"""
pass
def __enter__(self,*args):
""" __enter__(self: IDisposable) -> object """
pass
def __exit__(self,*args):
""" __exit__(self: IDisposable,exc_type: object,exc_value: object,exc_back: object) """
pass
def __init__(self,*args):
""" x.__init__(...) initializes x; see x.__class__.__doc__ for signaturex.__init__(...) initializes x; see x.__class__.__doc__ for signaturex.__init__(...) initializes x; see x.__class__.__doc__ for signature """
pass
def __repr__(self,*args):
""" __repr__(self: object) -> str """
pass
IsValidObject=property(lambda self: object(),lambda self,v: None,lambda self: None)
"""Specifies whether the .NET object represents a valid Revit entity.
Get: IsValidObject(self: FailureMessageAccessor) -> bool
"""
|
class Failuremessageaccessor(object, IDisposable):
""" Restricted accessor for FailureMessage. """
def clone_failure_message(self):
"""
CloneFailureMessage(self: FailureMessageAccessor) -> FailureMessage
Creates a copy of the FailureMessage.
Returns: Copy of the FailureMesassge.
"""
pass
def dispose(self):
""" Dispose(self: FailureMessageAccessor) """
pass
def get_additional_element_ids(self):
"""
GetAdditionalElementIds(self: FailureMessageAccessor) -> ICollection[ElementId]
Retrieves Ids of Elements that have not caused the failure but are related to
it
Checks if the failure has resolution of a given resolution type.
Returns: Ids of Elements related to the failure
"""
pass
def get_current_resolution_type(self):
"""
GetCurrentResolutionType(self: FailureMessageAccessor) -> FailureResolutionType
Retrieves the type of resolution to be used to resolve the failure.
Returns: The type of failure resolution to be used to resolve the failure.
"""
pass
def get_default_resolution_caption(self):
"""
GetDefaultResolutionCaption(self: FailureMessageAccessor) -> str
Retrieves the caption of default resolution of the failure.
Returns: The caption of default resolution of the failure.
"""
pass
def get_description_text(self):
"""
GetDescriptionText(self: FailureMessageAccessor) -> str
Retrieves the description of the failure.
Returns: The description text.
"""
pass
def get_failing_element_ids(self):
"""
GetFailingElementIds(self: FailureMessageAccessor) -> ICollection[ElementId]
Retrieves Ids of Elements that have caused the failure.
Returns: Ids of Elements that have caused the failure.
"""
pass
def get_failure_definition_id(self):
"""
GetFailureDefinitionId(self: FailureMessageAccessor) -> FailureDefinitionId
Retrieves the Id of the FailureDefinition of the failure.
Returns: The Id of the FailureDefinition of the failure.
"""
pass
def get_number_of_resolutions(self):
"""
GetNumberOfResolutions(self: FailureMessageAccessor) -> int
Retrieves number of resolutions that can be used to resolve failure.
Returns: Number of resolutions that can be used to resolve failure
"""
pass
def get_severity(self):
"""
GetSeverity(self: FailureMessageAccessor) -> FailureSeverity
Retrieves the severity of the failure.
Returns: The severity of the failure.
"""
pass
def has_resolution_of_type(self, type):
"""
HasResolutionOfType(self: FailureMessageAccessor,type: FailureResolutionType) -> bool
Checks if failure has a resolution of a given type.
type: The type of resolution.
Returns: True if failure has a resolution of a given type,false otherwise.
"""
pass
def has_resolutions(self):
"""
HasResolutions(self: FailureMessageAccessor) -> bool
Checks if the failure has any resolutions.
Returns: True if the failure has any resolutions,false otherwise.
"""
pass
def release_unmanaged_resources(self, *args):
""" ReleaseUnmanagedResources(self: FailureMessageAccessor,disposing: bool) """
pass
def set_current_resolution_type(self, resolutionType):
"""
SetCurrentResolutionType(self: FailureMessageAccessor,resolutionType: FailureResolutionType)
Sets the type of a resolution to be used to resolve the failure.
resolutionType: The type of failure resolution to be used to resolve the failure.
"""
pass
def should_merge_with_message(self, messageToMergeWith):
"""
ShouldMergeWithMessage(self: FailureMessageAccessor,messageToMergeWith: FailureMessageAccessor) -> bool
Checks if the FailureMessage should be merged with the other FailureMessage for
better user experience.
Returns: True if messages should be merged
"""
pass
def __enter__(self, *args):
""" __enter__(self: IDisposable) -> object """
pass
def __exit__(self, *args):
""" __exit__(self: IDisposable,exc_type: object,exc_value: object,exc_back: object) """
pass
def __init__(self, *args):
""" x.__init__(...) initializes x; see x.__class__.__doc__ for signaturex.__init__(...) initializes x; see x.__class__.__doc__ for signaturex.__init__(...) initializes x; see x.__class__.__doc__ for signature """
pass
def __repr__(self, *args):
""" __repr__(self: object) -> str """
pass
is_valid_object = property(lambda self: object(), lambda self, v: None, lambda self: None)
'Specifies whether the .NET object represents a valid Revit entity.\n\n\n\nGet: IsValidObject(self: FailureMessageAccessor) -> bool\n\n\n\n'
|
"""
This module provides the Status class, which encapsulates
a status code for Icinga.
"""
class Status(object):
"""
Encapsulates an Icinga status, which holds a name and
an exit code.
"""
def __init__(self, name, exit_code):
"""
Creates a new status object for Icinga with the given name and
exit code.
**Note**: In general, this should never be called since the standard
statuses are exported from ``pycinga``.
"""
if not isinstance(exit_code, int):
raise ValueError("exit_code must be an int, not %s" % type(exit_code))
if not isinstance(name, str):
raise ValueError("name must be a str, not %s" % type(exit_code))
self.name = name
self.exit_code = exit_code
def __repr__(self):
return "Status(name=%s, exit_code=%d)" % (repr(self.name), self.exit_code)
def __lt__(self, other):
return (self.exit_code < other.exit_code)
def __eq__(self, other):
return (self.exit_code == other.exit_code)
def __ne__(self, other):
return (self.exit_code != other.exit_code)
def __gt__(self, other):
return (self.exit_code > other.exit_code)
|
"""
This module provides the Status class, which encapsulates
a status code for Icinga.
"""
class Status(object):
"""
Encapsulates an Icinga status, which holds a name and
an exit code.
"""
def __init__(self, name, exit_code):
"""
Creates a new status object for Icinga with the given name and
exit code.
**Note**: In general, this should never be called since the standard
statuses are exported from ``pycinga``.
"""
if not isinstance(exit_code, int):
raise value_error('exit_code must be an int, not %s' % type(exit_code))
if not isinstance(name, str):
raise value_error('name must be a str, not %s' % type(exit_code))
self.name = name
self.exit_code = exit_code
def __repr__(self):
return 'Status(name=%s, exit_code=%d)' % (repr(self.name), self.exit_code)
def __lt__(self, other):
return self.exit_code < other.exit_code
def __eq__(self, other):
return self.exit_code == other.exit_code
def __ne__(self, other):
return self.exit_code != other.exit_code
def __gt__(self, other):
return self.exit_code > other.exit_code
|
_base_ = [
'../_base_/datasets/coco_detection.py',
'../_base_/schedules/schedule_1x.py', '../_base_/default_runtime.py'
]
model = dict(
type='FasterRCNN',
backbone=dict(
type='SwinTransformer',
embed_dims=128,
depths=[2, 2, 18, 2],
num_heads=[4, 8, 16, 32],
window_size=7,
mlp_ratio=4,
qkv_bias=True,
qk_scale=None,
drop_rate=0.,
attn_drop_rate=0.,
drop_path_rate=0.3,
patch_norm=True,
out_indices=(0, 1, 2, 3),
with_cp=True,
init_cfg=dict(type='Pretrained', checkpoint='https://download.openmmlab.com/mmclassification/v0/swin-transformer/convert/swin_base_patch4_window7_224_22kto1k-f967f799.pth')),
neck=dict(
type='FPN',
in_channels=[128, 256, 512, 1024],
out_channels=256,
num_outs=5),
rpn_head=dict(
type='GARPNHead',
in_channels=256,
feat_channels=256,
approx_anchor_generator=dict(
type='AnchorGenerator',
octave_base_scale=8,
scales_per_octave=3,
ratios=[0.5, 51.0, 2.0, 3.0, 4.0, 5.0],
strides=[4, 8, 16, 32, 64]),
square_anchor_generator=dict(
type='AnchorGenerator',
ratios=[1.0],
scales=[8],
strides=[4, 8, 16, 32, 64]),
anchor_coder=dict(
type='DeltaXYWHBBoxCoder',
target_means=[.0, .0, .0, .0],
target_stds=[0.07, 0.07, 0.14, 0.14]),
bbox_coder=dict(
type='DeltaXYWHBBoxCoder',
target_means=[.0, .0, .0, .0],
target_stds=[0.07, 0.07, 0.11, 0.11]),
loc_filter_thr=0.01,
loss_loc=dict(
type='FocalLoss',
use_sigmoid=True,
gamma=2.0,
alpha=0.25,
loss_weight=1.0),
loss_shape=dict(type='BoundedIoULoss', beta=0.2, loss_weight=1.0),
loss_cls=dict(type='CrossEntropyLoss', use_sigmoid=True, loss_weight=1.0),
loss_bbox=dict(type='SmoothL1Loss', beta=1.0, loss_weight=1.0)),
roi_head=dict(
type='StandardRoIHead',
bbox_roi_extractor=dict(
type='SingleRoIExtractor',
roi_layer=dict(type='RoIAlign', output_size=7, sampling_ratio=0),
out_channels=256,
featmap_strides=[4, 8, 16, 32]),
bbox_head=dict(
type='Shared2FCBBoxHead',
in_channels=256,
fc_out_channels=1024,
roi_feat_size=7,
num_classes=34,
bbox_coder=dict(
type='DeltaXYWHBBoxCoder',
target_means=[0., 0., 0., 0.],
target_stds=[0.05, 0.05, 0.1, 0.1]),
reg_class_agnostic=True,
loss_cls=dict(type='CrossEntropyLoss', use_sigmoid=False, loss_weight=1.0),
reg_decoded_bbox=True,
loss_bbox=dict(type='CIoULoss', loss_weight=12.0))),
# model training and testing settings
train_cfg=dict(
rpn=dict(
assigner=dict(
type='MaxIoUAssigner',
pos_iou_thr=0.7,
neg_iou_thr=0.3,
min_pos_iou=0.3,
match_low_quality=True,
ignore_iof_thr=-1),
sampler=dict(
type='RandomSampler',
num=256,
pos_fraction=0.5,
neg_pos_ub=-1,
add_gt_as_proposals=False),
ga_assigner=dict(
type='ApproxMaxIoUAssigner',
pos_iou_thr=0.7,
neg_iou_thr=0.3,
min_pos_iou=0.3,
ignore_iof_thr=-1),
ga_sampler=dict(
type='RandomSampler',
num=256,
pos_fraction=0.5,
neg_pos_ub=-1,
add_gt_as_proposals=False),
allowed_border=-1,
center_ratio=0.2,
ignore_ratio=0.5,
pos_weight=-1,
debug=False),
rpn_proposal=dict(
nms_pre=2000,
nms_post=1000,
max_per_img=300,
nms=dict(type='nms', iou_threshold=0.7),
min_bbox_size=0),
rcnn=dict(
assigner=dict(
type='MaxIoUAssigner',
pos_iou_thr=0.6,
neg_iou_thr=0.6,
min_pos_iou=0.6,
match_low_quality=False,
ignore_iof_thr=-1),
sampler=dict(
type='RandomSampler',
num=256,
pos_fraction=0.25,
neg_pos_ub=-1,
add_gt_as_proposals=True),
pos_weight=-1,
debug=False)),
test_cfg=dict(
rpn=dict(
nms_pre=1000,
nms_post=1000,
max_per_img=300,
nms=dict(type='nms', iou_threshold=0.7),
min_bbox_size=0),
rcnn=dict(
score_thr=0.05,
nms=dict(type='nms', iou_threshold=0.5),
max_per_img=100)))
# data setting
dataset_type = 'CocoDataset'
data_root = '/content/data/'
img_norm_cfg = dict(mean=[123.675, 116.28, 103.53], std=[58.395, 57.12, 57.375], to_rgb=True)
albu_train_transforms = [
dict(type='ShiftScaleRotate', shift_limit=0.0625, scale_limit=0, rotate_limit=0, interpolation=1, p=0.5, border_mode = 0),
dict(type='RandomBrightnessContrast', brightness_limit=0.1, contrast_limit=0.1),
dict(type='RGBShift', r_shift_limit=10, g_shift_limit=10, b_shift_limit=10),
dict(type='HueSaturationValue', hue_shift_limit=20, sat_shift_limit=30, val_shift_limit=20),
dict(type='ChannelShuffle'),
dict(
type='OneOf',
transforms=[
dict(type='Blur', blur_limit=3, p=1.0),
dict(type='MedianBlur', blur_limit=3, p=1.0)
],
p=0.1),
]
train_pipeline = [
dict(type='LoadImageFromFile', to_float32=True),
dict(type='LoadAnnotations', with_bbox=True),
dict(
type='RandomCrop',
crop_type='relative_range',
crop_size=(0.9, 0.9)),
dict(
type='Resize',
img_scale=[(640, 640), (800, 800)],
multiscale_mode='range',
keep_ratio=True),
dict(
type='CutOut',
n_holes=(5, 10),
cutout_shape=[(4, 4), (4, 8), (8, 4), (8, 8),
(16, 8), (8, 16), (16, 16), (16, 32), (32, 16), (32, 32),
(32, 48), (48, 32), (48, 48)]),
dict(type='RandomFlip', flip_ratio=0.5),
dict(
type='Albu',
transforms=albu_train_transforms,
bbox_params=dict(
type='BboxParams',
format='pascal_voc',
label_fields=['gt_labels'],
min_visibility=0.0,
filter_lost_elements=True),
keymap={
'img': 'image',
'gt_bboxes': 'bboxes'
},
update_pad_shape=False,
skip_img_without_anno=True),
dict(type='Pad', size_divisor=800),
dict(type='Normalize', **img_norm_cfg),
dict(type='DefaultFormatBundle'),
dict(type='Collect', keys=['img', 'gt_bboxes', 'gt_labels']),
]
test_pipeline = [
dict(type='LoadImageFromFile'),
dict(
type='MultiScaleFlipAug',
img_scale=(800, 800),
flip=False,
transforms=[
dict(type='Resize', keep_ratio=True),
dict(type='RandomFlip'),
dict(type='Normalize', **img_norm_cfg),
dict(type='Pad', size_divisor=32),
dict(type='DefaultFormatBundle'),
dict(type='Collect', keys=['img']),
])
]
data = dict(
samples_per_gpu=12,
workers_per_gpu=4,
train=dict(type = dataset_type,
ann_file = data_root + '/annotations/instances_train2017.json',
img_prefix = 'train_images/',
pipeline=train_pipeline),
val=dict(type = dataset_type,
ann_file = data_root + '/annotations/instances_val2017.json',
img_prefix = 'val_images/',
pipeline=test_pipeline,
samples_per_gpu = 24),
test=dict(pipeline=test_pipeline))
# optimizer
optimizer = dict(
_delete_ = True,
type='AdamW',
lr=0.0001,
betas=(0.9, 0.999),
weight_decay=0.05,
paramwise_cfg=dict(
custom_keys={
'absolute_pos_embed': dict(decay_mult=0.),
'relative_position_bias_table': dict(decay_mult=0.),
'norm': dict(decay_mult=0.)}))
optimizer_config = dict(grad_clip=None)
log_config = dict(interval = 10)
# learning policy
lr_config = dict(
_delete_ = True,
policy='CosineAnnealing',
min_lr_ratio = 0.12,
warmup='linear',
warmup_iters=500,
warmup_ratio=1.0 / 3,
)
runner = dict(type='IterBasedRunner', max_iters=10000, max_epochs = None)
checkpoint_config = dict(interval = 100)
evaluation = dict(interval = 100, metric = 'bbox')
fp16 = dict(loss_scale = 512.)
# runtime
load_from = None
resume_from = None
workflow = [('train', 1)]
|
_base_ = ['../_base_/datasets/coco_detection.py', '../_base_/schedules/schedule_1x.py', '../_base_/default_runtime.py']
model = dict(type='FasterRCNN', backbone=dict(type='SwinTransformer', embed_dims=128, depths=[2, 2, 18, 2], num_heads=[4, 8, 16, 32], window_size=7, mlp_ratio=4, qkv_bias=True, qk_scale=None, drop_rate=0.0, attn_drop_rate=0.0, drop_path_rate=0.3, patch_norm=True, out_indices=(0, 1, 2, 3), with_cp=True, init_cfg=dict(type='Pretrained', checkpoint='https://download.openmmlab.com/mmclassification/v0/swin-transformer/convert/swin_base_patch4_window7_224_22kto1k-f967f799.pth')), neck=dict(type='FPN', in_channels=[128, 256, 512, 1024], out_channels=256, num_outs=5), rpn_head=dict(type='GARPNHead', in_channels=256, feat_channels=256, approx_anchor_generator=dict(type='AnchorGenerator', octave_base_scale=8, scales_per_octave=3, ratios=[0.5, 51.0, 2.0, 3.0, 4.0, 5.0], strides=[4, 8, 16, 32, 64]), square_anchor_generator=dict(type='AnchorGenerator', ratios=[1.0], scales=[8], strides=[4, 8, 16, 32, 64]), anchor_coder=dict(type='DeltaXYWHBBoxCoder', target_means=[0.0, 0.0, 0.0, 0.0], target_stds=[0.07, 0.07, 0.14, 0.14]), bbox_coder=dict(type='DeltaXYWHBBoxCoder', target_means=[0.0, 0.0, 0.0, 0.0], target_stds=[0.07, 0.07, 0.11, 0.11]), loc_filter_thr=0.01, loss_loc=dict(type='FocalLoss', use_sigmoid=True, gamma=2.0, alpha=0.25, loss_weight=1.0), loss_shape=dict(type='BoundedIoULoss', beta=0.2, loss_weight=1.0), loss_cls=dict(type='CrossEntropyLoss', use_sigmoid=True, loss_weight=1.0), loss_bbox=dict(type='SmoothL1Loss', beta=1.0, loss_weight=1.0)), roi_head=dict(type='StandardRoIHead', bbox_roi_extractor=dict(type='SingleRoIExtractor', roi_layer=dict(type='RoIAlign', output_size=7, sampling_ratio=0), out_channels=256, featmap_strides=[4, 8, 16, 32]), bbox_head=dict(type='Shared2FCBBoxHead', in_channels=256, fc_out_channels=1024, roi_feat_size=7, num_classes=34, bbox_coder=dict(type='DeltaXYWHBBoxCoder', target_means=[0.0, 0.0, 0.0, 0.0], target_stds=[0.05, 0.05, 0.1, 0.1]), reg_class_agnostic=True, loss_cls=dict(type='CrossEntropyLoss', use_sigmoid=False, loss_weight=1.0), reg_decoded_bbox=True, loss_bbox=dict(type='CIoULoss', loss_weight=12.0))), train_cfg=dict(rpn=dict(assigner=dict(type='MaxIoUAssigner', pos_iou_thr=0.7, neg_iou_thr=0.3, min_pos_iou=0.3, match_low_quality=True, ignore_iof_thr=-1), sampler=dict(type='RandomSampler', num=256, pos_fraction=0.5, neg_pos_ub=-1, add_gt_as_proposals=False), ga_assigner=dict(type='ApproxMaxIoUAssigner', pos_iou_thr=0.7, neg_iou_thr=0.3, min_pos_iou=0.3, ignore_iof_thr=-1), ga_sampler=dict(type='RandomSampler', num=256, pos_fraction=0.5, neg_pos_ub=-1, add_gt_as_proposals=False), allowed_border=-1, center_ratio=0.2, ignore_ratio=0.5, pos_weight=-1, debug=False), rpn_proposal=dict(nms_pre=2000, nms_post=1000, max_per_img=300, nms=dict(type='nms', iou_threshold=0.7), min_bbox_size=0), rcnn=dict(assigner=dict(type='MaxIoUAssigner', pos_iou_thr=0.6, neg_iou_thr=0.6, min_pos_iou=0.6, match_low_quality=False, ignore_iof_thr=-1), sampler=dict(type='RandomSampler', num=256, pos_fraction=0.25, neg_pos_ub=-1, add_gt_as_proposals=True), pos_weight=-1, debug=False)), test_cfg=dict(rpn=dict(nms_pre=1000, nms_post=1000, max_per_img=300, nms=dict(type='nms', iou_threshold=0.7), min_bbox_size=0), rcnn=dict(score_thr=0.05, nms=dict(type='nms', iou_threshold=0.5), max_per_img=100)))
dataset_type = 'CocoDataset'
data_root = '/content/data/'
img_norm_cfg = dict(mean=[123.675, 116.28, 103.53], std=[58.395, 57.12, 57.375], to_rgb=True)
albu_train_transforms = [dict(type='ShiftScaleRotate', shift_limit=0.0625, scale_limit=0, rotate_limit=0, interpolation=1, p=0.5, border_mode=0), dict(type='RandomBrightnessContrast', brightness_limit=0.1, contrast_limit=0.1), dict(type='RGBShift', r_shift_limit=10, g_shift_limit=10, b_shift_limit=10), dict(type='HueSaturationValue', hue_shift_limit=20, sat_shift_limit=30, val_shift_limit=20), dict(type='ChannelShuffle'), dict(type='OneOf', transforms=[dict(type='Blur', blur_limit=3, p=1.0), dict(type='MedianBlur', blur_limit=3, p=1.0)], p=0.1)]
train_pipeline = [dict(type='LoadImageFromFile', to_float32=True), dict(type='LoadAnnotations', with_bbox=True), dict(type='RandomCrop', crop_type='relative_range', crop_size=(0.9, 0.9)), dict(type='Resize', img_scale=[(640, 640), (800, 800)], multiscale_mode='range', keep_ratio=True), dict(type='CutOut', n_holes=(5, 10), cutout_shape=[(4, 4), (4, 8), (8, 4), (8, 8), (16, 8), (8, 16), (16, 16), (16, 32), (32, 16), (32, 32), (32, 48), (48, 32), (48, 48)]), dict(type='RandomFlip', flip_ratio=0.5), dict(type='Albu', transforms=albu_train_transforms, bbox_params=dict(type='BboxParams', format='pascal_voc', label_fields=['gt_labels'], min_visibility=0.0, filter_lost_elements=True), keymap={'img': 'image', 'gt_bboxes': 'bboxes'}, update_pad_shape=False, skip_img_without_anno=True), dict(type='Pad', size_divisor=800), dict(type='Normalize', **img_norm_cfg), dict(type='DefaultFormatBundle'), dict(type='Collect', keys=['img', 'gt_bboxes', 'gt_labels'])]
test_pipeline = [dict(type='LoadImageFromFile'), dict(type='MultiScaleFlipAug', img_scale=(800, 800), flip=False, transforms=[dict(type='Resize', keep_ratio=True), dict(type='RandomFlip'), dict(type='Normalize', **img_norm_cfg), dict(type='Pad', size_divisor=32), dict(type='DefaultFormatBundle'), dict(type='Collect', keys=['img'])])]
data = dict(samples_per_gpu=12, workers_per_gpu=4, train=dict(type=dataset_type, ann_file=data_root + '/annotations/instances_train2017.json', img_prefix='train_images/', pipeline=train_pipeline), val=dict(type=dataset_type, ann_file=data_root + '/annotations/instances_val2017.json', img_prefix='val_images/', pipeline=test_pipeline, samples_per_gpu=24), test=dict(pipeline=test_pipeline))
optimizer = dict(_delete_=True, type='AdamW', lr=0.0001, betas=(0.9, 0.999), weight_decay=0.05, paramwise_cfg=dict(custom_keys={'absolute_pos_embed': dict(decay_mult=0.0), 'relative_position_bias_table': dict(decay_mult=0.0), 'norm': dict(decay_mult=0.0)}))
optimizer_config = dict(grad_clip=None)
log_config = dict(interval=10)
lr_config = dict(_delete_=True, policy='CosineAnnealing', min_lr_ratio=0.12, warmup='linear', warmup_iters=500, warmup_ratio=1.0 / 3)
runner = dict(type='IterBasedRunner', max_iters=10000, max_epochs=None)
checkpoint_config = dict(interval=100)
evaluation = dict(interval=100, metric='bbox')
fp16 = dict(loss_scale=512.0)
load_from = None
resume_from = None
workflow = [('train', 1)]
|
#!/usr/bin/env python3
# '+=' for variables, this operator adds a value to,
# then sets variable name to new value.
# this formula shortcut can be used with any
# mathmatical operator.
# string example
y = 'one'
y += 'two' # adding to and equaling
print(y)
# int example
x = 1 # x has value of one
x += 2 # same as x = x+2, now x = 3
print(x)
|
y = 'one'
y += 'two'
print(y)
x = 1
x += 2
print(x)
|
class SimpleButton(object):
"""Represents a single button that is connected to the ESP32"""
def __init__(self, pin):
self.pin = pin
def read_pressed(self):
print("Reading button on pin {}".format(self.pin))
# TODO: Actually call MicroPython code to get the value
return False
|
class Simplebutton(object):
"""Represents a single button that is connected to the ESP32"""
def __init__(self, pin):
self.pin = pin
def read_pressed(self):
print('Reading button on pin {}'.format(self.pin))
return False
|
def execute(fn, *args):
return fn(*args)
def say_hello(name, my_name):
print(f"Hello, {name}, I am {my_name}")
def say_bye(name):
print(f"Bye, {name}")
execute(say_hello, "Peter", "George")
execute(say_bye, "Peter")
|
def execute(fn, *args):
return fn(*args)
def say_hello(name, my_name):
print(f'Hello, {name}, I am {my_name}')
def say_bye(name):
print(f'Bye, {name}')
execute(say_hello, 'Peter', 'George')
execute(say_bye, 'Peter')
|
# -*- coding: utf-8 -*-
"""
Created on Mon Oct 25 11:35:11 2021
@author: shangfr
"""
def ui_prediction():
pass
if __name__ == "__main__":
ui_prediction()
|
"""
Created on Mon Oct 25 11:35:11 2021
@author: shangfr
"""
def ui_prediction():
pass
if __name__ == '__main__':
ui_prediction()
|
#Write a function that finds if a given string argument is Palindrome. A Palindrome string is equal to its reverse, that is its reading is the same backward as forward.
#For example: efe, hannah, ava, anna are palindromes.
#Test your function with above examples and test with at least 3 different
# non-Palindrome examples. nixon, example, xxxzz
#You may use string functions in this function.
def check_palindrome(str_to_test):
reverse_str = str_to_test[::-1]
if reverse_str == str_to_test:
print(f"{str_to_test} is a palindrome")
else:
print(f"{str_to_test} is NOT a palindrome")
check_palindrome("efe")
check_palindrome("hannah")
check_palindrome("ava")
check_palindrome("anna")
check_palindrome("nixon")
check_palindrome( "example")
check_palindrome( "xxxzz")
check_palindrome("xxxzzxxx")
|
def check_palindrome(str_to_test):
reverse_str = str_to_test[::-1]
if reverse_str == str_to_test:
print(f'{str_to_test} is a palindrome')
else:
print(f'{str_to_test} is NOT a palindrome')
check_palindrome('efe')
check_palindrome('hannah')
check_palindrome('ava')
check_palindrome('anna')
check_palindrome('nixon')
check_palindrome('example')
check_palindrome('xxxzz')
check_palindrome('xxxzzxxx')
|
c_keyword_set = {
'auto',
'break',
'case',
'char',
'const',
'continue',
'default',
'define',
'do',
'double',
'elif',
'else',
'endif',
'enum',
'error',
'extern',
'float',
'for',
'goto',
'if',
'ifdef',
'ifndef',
'include',
'inline',
'int',
'line',
'long',
'noalias',
'pragma',
'register',
'restrict',
'return',
'short',
'signed',
'sizeof',
'static',
'struct',
'switch',
'typedef',
'undef',
'union',
'unsigned',
'void',
'volatile',
'while'
}
|
c_keyword_set = {'auto', 'break', 'case', 'char', 'const', 'continue', 'default', 'define', 'do', 'double', 'elif', 'else', 'endif', 'enum', 'error', 'extern', 'float', 'for', 'goto', 'if', 'ifdef', 'ifndef', 'include', 'inline', 'int', 'line', 'long', 'noalias', 'pragma', 'register', 'restrict', 'return', 'short', 'signed', 'sizeof', 'static', 'struct', 'switch', 'typedef', 'undef', 'union', 'unsigned', 'void', 'volatile', 'while'}
|
# Copyright 2017 The Forseti Security Authors. All rights reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
"""Fake groups data.
TODO: consolidate with other fake group test data.
"""
FAKE_GROUPS_DB_ROWS = [
{
'group_id': '1111aaaa1',
'member_role': 'OWNER',
'member_type': 'USER',
'member_email': '[email protected]'
},
{
'group_id': '2222bbbb2',
'member_role': 'MEMBER',
'member_type': 'GROUP',
'member_email': '[email protected]'
},
{
'group_id': '2222bbbb2',
'member_role': 'OWNER',
'member_type': 'GROUP',
'member_email': '[email protected]'
},
{
'group_id': '1111aaaa1',
'member_role': 'MEMBER',
'member_type': 'USER',
'member_email': '[email protected]'
},
{
'group_id': '1111aaaa1',
'member_role': 'MEMBER',
'member_type': 'USER',
'member_email': '[email protected]'
},
]
|
"""Fake groups data.
TODO: consolidate with other fake group test data.
"""
fake_groups_db_rows = [{'group_id': '1111aaaa1', 'member_role': 'OWNER', 'member_type': 'USER', 'member_email': '[email protected]'}, {'group_id': '2222bbbb2', 'member_role': 'MEMBER', 'member_type': 'GROUP', 'member_email': '[email protected]'}, {'group_id': '2222bbbb2', 'member_role': 'OWNER', 'member_type': 'GROUP', 'member_email': '[email protected]'}, {'group_id': '1111aaaa1', 'member_role': 'MEMBER', 'member_type': 'USER', 'member_email': '[email protected]'}, {'group_id': '1111aaaa1', 'member_role': 'MEMBER', 'member_type': 'USER', 'member_email': '[email protected]'}]
|
__version_tuple__ = (0, 6, 0, 'alpha.5')
__version__ = '0.6.0-alpha.5'
__version_tuple_js__ = (0, 6, 0, 'alpha.4')
__version_js__ = '0.6.0-alpha.4'
# kept for embedding in offline mode, we don't care about the patch version since it should be compatible
__version_threejs__ = '0.97'
|
__version_tuple__ = (0, 6, 0, 'alpha.5')
__version__ = '0.6.0-alpha.5'
__version_tuple_js__ = (0, 6, 0, 'alpha.4')
__version_js__ = '0.6.0-alpha.4'
__version_threejs__ = '0.97'
|
def read():
for dx in [1, 3, 5, 7]:
x = 0
tree = 0
with open('input.txt') as fh:
first_line = True
for line in fh.readlines():
if first_line:
first_line = False
continue
x = (x + dx) % len(line.strip())
if line[x] == '#':
tree += 1
print(dx, tree)
def read_dy2():
for dx in [1]:
x = 0
tree = 0
with open('input.txt') as fh:
first_line = True
i = 0
for line in fh.readlines():
if first_line:
first_line = False
continue
i += 1
x = (x + dx) % len(line.strip())
if i % 2 == 1:
# "going down 2"
continue
if line[x] == '#':
tree += 1
print("for dy=2")
print(dx, tree)
if __name__ == '__main__':
read()
read_dy2()
print(62*184*80*74*36)
|
def read():
for dx in [1, 3, 5, 7]:
x = 0
tree = 0
with open('input.txt') as fh:
first_line = True
for line in fh.readlines():
if first_line:
first_line = False
continue
x = (x + dx) % len(line.strip())
if line[x] == '#':
tree += 1
print(dx, tree)
def read_dy2():
for dx in [1]:
x = 0
tree = 0
with open('input.txt') as fh:
first_line = True
i = 0
for line in fh.readlines():
if first_line:
first_line = False
continue
i += 1
x = (x + dx) % len(line.strip())
if i % 2 == 1:
continue
if line[x] == '#':
tree += 1
print('for dy=2')
print(dx, tree)
if __name__ == '__main__':
read()
read_dy2()
print(62 * 184 * 80 * 74 * 36)
|
""" dict functions """
def flatten_dict(nested: dict) -> dict:
"""Take a nested dictionary and flatten it. For example:
{'a': {'b': 'c'}} will be flattened to {'a_b': c}
Args:
nested: a dictionary to be flattened
Returns:
Dict. flattened version of the original dictionary
"""
ans = {}
for key, val in nested.items():
# if val is a dict, unflatten val, recursively
if isinstance(val, dict):
flattened = flatten_dict(val)
for subkey, subval in flattened.items():
flattened_key = f"{key}_{subkey}"
ans[flattened_key] = subval
else:
ans[key] = val
return ans
|
""" dict functions """
def flatten_dict(nested: dict) -> dict:
"""Take a nested dictionary and flatten it. For example:
{'a': {'b': 'c'}} will be flattened to {'a_b': c}
Args:
nested: a dictionary to be flattened
Returns:
Dict. flattened version of the original dictionary
"""
ans = {}
for (key, val) in nested.items():
if isinstance(val, dict):
flattened = flatten_dict(val)
for (subkey, subval) in flattened.items():
flattened_key = f'{key}_{subkey}'
ans[flattened_key] = subval
else:
ans[key] = val
return ans
|
class Solution:
def dfs(self, s):
if(s == len(self.graph) - 1):
self.path.append(len(self.graph)-1)
self.res.append(self.path[::])
self.path.pop()
return;
self.path.append(s)
for i in range(len(self.graph[s])):
self.dfs(self.graph[s][i])
self.path.pop()
def allPathsSourceTarget(self, graph: List[List[int]]) -> List[List[int]]:
self.res = []
self.graph = graph
self.path = []
self.dfs(0)
return self.res
|
class Solution:
def dfs(self, s):
if s == len(self.graph) - 1:
self.path.append(len(self.graph) - 1)
self.res.append(self.path[:])
self.path.pop()
return
self.path.append(s)
for i in range(len(self.graph[s])):
self.dfs(self.graph[s][i])
self.path.pop()
def all_paths_source_target(self, graph: List[List[int]]) -> List[List[int]]:
self.res = []
self.graph = graph
self.path = []
self.dfs(0)
return self.res
|
"""
# REPEATED DNA SEQUENCES
All DNA is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T', for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.
Example 1:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]
Example 2:
Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]
Constraints:
0 <= s.length <= 105
s[i] is 'A', 'C', 'G', or 'T'.
"""
class Solution:
def findRepeatedDnaSequences(self, s: str):
res = {}
result = []
i = 0
while i <= len(s) - 10:
st = s[i:i+10]
i += 1
if st in res:
res[st] += 1
else:
res[st] = 1
print(res)
for x in res:
if res[x] > 1:
result.append(x)
return result
|
"""
# REPEATED DNA SEQUENCES
All DNA is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T', for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.
Example 1:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]
Example 2:
Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]
Constraints:
0 <= s.length <= 105
s[i] is 'A', 'C', 'G', or 'T'.
"""
class Solution:
def find_repeated_dna_sequences(self, s: str):
res = {}
result = []
i = 0
while i <= len(s) - 10:
st = s[i:i + 10]
i += 1
if st in res:
res[st] += 1
else:
res[st] = 1
print(res)
for x in res:
if res[x] > 1:
result.append(x)
return result
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.