content
stringlengths 7
1.05M
| fixed_cases
stringlengths 1
1.28M
|
|---|---|
class person:
def __init__(self, first_name, last_name, age):
self.first_name = first_name
self.last_name = last_name
self.age = age
def get_full_name(self):
return f"{self.first_name} {self.last_name}"
def introduce(self):
return f"Hi. I'm {self.first_name}. {self.last_name}. I'm {self.age} years old"
Phuong = person ('Phoang', 'hoang', 25)
full_name = Phuong.get_full_name
print(f"{full_name}: {Phuong.introduce()}")
#print (f" i'm {Phuong.first_name} {Phuong.last_name}. I'm {Phuong.age} years old")
#https://www.youtube.com/c/TechWithTim/playlists
|
class Person:
def __init__(self, first_name, last_name, age):
self.first_name = first_name
self.last_name = last_name
self.age = age
def get_full_name(self):
return f'{self.first_name} {self.last_name}'
def introduce(self):
return f"Hi. I'm {self.first_name}. {self.last_name}. I'm {self.age} years old"
phuong = person('Phoang', 'hoang', 25)
full_name = Phuong.get_full_name
print(f'{full_name}: {Phuong.introduce()}')
|
# factoryboy_utils.py
@classmethod
def _get_manager(cls, model_class):
return super(cls, cls)._get_manager(model_class).using(cls.database)
class DBAwareFactory(object):
"""
Context manager to make model factories db aware
Usage:
with DBAwareFactory(PersonFactory, 'db_qa') as personfactory_on_qa:
person_on_qa = personfactory_on_qa()
...
"""
def __init__(self, cls, db):
# Take a copy of the original cls
self.original_cls = cls
# Patch with needed bits for dynamic db support
setattr(cls, 'database', db)
setattr(cls, '_get_manager', _get_manager)
# save the patched class
self.patched_cls = cls
def __enter__(self):
return self.patched_cls
def __exit__(self, type, value, traceback):
return self.original_cls
|
@classmethod
def _get_manager(cls, model_class):
return super(cls, cls)._get_manager(model_class).using(cls.database)
class Dbawarefactory(object):
"""
Context manager to make model factories db aware
Usage:
with DBAwareFactory(PersonFactory, 'db_qa') as personfactory_on_qa:
person_on_qa = personfactory_on_qa()
...
"""
def __init__(self, cls, db):
self.original_cls = cls
setattr(cls, 'database', db)
setattr(cls, '_get_manager', _get_manager)
self.patched_cls = cls
def __enter__(self):
return self.patched_cls
def __exit__(self, type, value, traceback):
return self.original_cls
|
#
# PySNMP MIB module HPN-ICF-FLASH-MAN-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/HPN-ICF-FLASH-MAN-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 19:26:48 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, ConstraintsUnion, ValueRangeConstraint, SingleValueConstraint, ConstraintsIntersection = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ConstraintsUnion", "ValueRangeConstraint", "SingleValueConstraint", "ConstraintsIntersection")
PhysicalIndex, = mibBuilder.importSymbols("ENTITY-MIB", "PhysicalIndex")
CounterBasedGauge64, = mibBuilder.importSymbols("HCNUM-TC", "CounterBasedGauge64")
hpnicfCommon, = mibBuilder.importSymbols("HPN-ICF-OID-MIB", "hpnicfCommon")
InetAddress, InetAddressType = mibBuilder.importSymbols("INET-ADDRESS-MIB", "InetAddress", "InetAddressType")
NotificationGroup, ObjectGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ObjectGroup", "ModuleCompliance")
ModuleIdentity, TimeTicks, Counter64, Integer32, ObjectIdentity, IpAddress, Bits, Unsigned32, MibIdentifier, MibScalar, MibTable, MibTableRow, MibTableColumn, Counter32, Gauge32, iso, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "ModuleIdentity", "TimeTicks", "Counter64", "Integer32", "ObjectIdentity", "IpAddress", "Bits", "Unsigned32", "MibIdentifier", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Counter32", "Gauge32", "iso", "NotificationType")
TruthValue, RowStatus, TextualConvention, DisplayString, TimeStamp = mibBuilder.importSymbols("SNMPv2-TC", "TruthValue", "RowStatus", "TextualConvention", "DisplayString", "TimeStamp")
hpnicfFlash = ModuleIdentity((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5))
hpnicfFlash.setRevisions(('2013-05-23 00:00',))
if mibBuilder.loadTexts: hpnicfFlash.setLastUpdated('201305230000Z')
if mibBuilder.loadTexts: hpnicfFlash.setOrganization('')
class HpnicfFlashOperationStatus(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31))
namedValues = NamedValues(("opInProgress", 1), ("opSuccess", 2), ("opInvalid", 3), ("opInvalidProtocol", 4), ("opInvalidSourceName", 5), ("opInvalidDestName", 6), ("opInvalidServerAddress", 7), ("opDeviceBusy", 8), ("opDeviceOpenError", 9), ("opDeviceError", 10), ("opDeviceNotProgrammable", 11), ("opDeviceFull", 12), ("opFileOpenError", 13), ("opFileTransferError", 14), ("opFileChecksumError", 15), ("opNoMemory", 16), ("opAuthFail", 17), ("opTimeout", 18), ("opUnknownFailure", 19), ("opDeleteFileOpenError", 20), ("opDeleteInvalidDevice", 21), ("opDeleteInvalidFunction", 22), ("opDeleteOperationError", 23), ("opDeleteInvalidFileName", 24), ("opDeleteDeviceBusy", 25), ("opDeleteParaError", 26), ("opDeleteInvalidPath", 27), ("opDeleteFileNotExistInSlave", 28), ("opDeleteFileFailedInSlave", 29), ("opSlaveFull", 30), ("opCopyToSlaveFailure", 31))
class HpnicfFlashPartitionUpgradeMode(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3))
namedValues = NamedValues(("unknown", 1), ("rxbootFLH", 2), ("direct", 3))
class HpnicfFlashPartitionStatus(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3))
namedValues = NamedValues(("readOnly", 1), ("runFromFlash", 2), ("readWrite", 3))
hpnicfFlashManMIBObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1))
hpnicfFlashDevice = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1))
hpnicfFlhSupportNum = MibScalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhSupportNum.setStatus('current')
hpnicfFlashTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2), )
if mibBuilder.loadTexts: hpnicfFlashTable.setStatus('current')
hpnicfFlashEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"))
if mibBuilder.loadTexts: hpnicfFlashEntry.setStatus('current')
hpnicfFlhIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhIndex.setStatus('current')
hpnicfFlhSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 2), Integer32()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhSize.setStatus('deprecated')
hpnicfFlhPos = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 3), PhysicalIndex()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPos.setStatus('current')
hpnicfFlhName = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 4), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhName.setStatus('current')
hpnicfFlhChipNum = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipNum.setStatus('current')
hpnicfFlhDescr = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 6), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhDescr.setStatus('current')
hpnicfFlhInitTime = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 8), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhInitTime.setStatus('current')
hpnicfFlhRemovable = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 9), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhRemovable.setStatus('current')
hpnicfFlhPartitionBool = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 11), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpnicfFlhPartitionBool.setStatus('current')
hpnicfFlhMinPartitionSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 12), Integer32()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhMinPartitionSize.setStatus('current')
hpnicfFlhMaxPartitions = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 13), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 8))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhMaxPartitions.setStatus('current')
hpnicfFlhPartitionNum = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 14), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartitionNum.setStatus('current')
hpnicfFlhKbyteSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 15), Integer32()).setUnits('kbytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhKbyteSize.setStatus('current')
hpnicfFlhHCSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 16), CounterBasedGauge64()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhHCSize.setStatus('current')
hpnicfFlashChips = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3))
hpnicfFlhChipTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1), )
if mibBuilder.loadTexts: hpnicfFlhChipTable.setStatus('current')
hpnicfFlhChipEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"), (0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipSerialNo"))
if mibBuilder.loadTexts: hpnicfFlhChipEntry.setStatus('current')
hpnicfFlhChipSerialNo = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 64)))
if mibBuilder.loadTexts: hpnicfFlhChipSerialNo.setStatus('current')
hpnicfFlhChipID = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 2), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 5))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipID.setStatus('current')
hpnicfFlhChipDescr = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 32))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipDescr.setStatus('current')
hpnicfFlhChipWriteTimesLimit = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipWriteTimesLimit.setStatus('current')
hpnicfFlhChipWriteTimes = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 5), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipWriteTimes.setStatus('current')
hpnicfFlhChipEraseTimesLimit = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 6), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipEraseTimesLimit.setStatus('current')
hpnicfFlhChipEraseTimes = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 7), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhChipEraseTimes.setStatus('current')
hpnicfFlashPartitions = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4))
hpnicfFlhPartitionTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1), )
if mibBuilder.loadTexts: hpnicfFlhPartitionTable.setStatus('current')
hpnicfFlhPartitionEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"), (0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartIndex"))
if mibBuilder.loadTexts: hpnicfFlhPartitionEntry.setStatus('current')
hpnicfFlhPartIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 8)))
if mibBuilder.loadTexts: hpnicfFlhPartIndex.setStatus('current')
hpnicfFlhPartFirstChip = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartFirstChip.setStatus('current')
hpnicfFlhPartLastChip = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 64))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartLastChip.setStatus('current')
hpnicfFlhPartSpace = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 4), Integer32()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartSpace.setStatus('deprecated')
hpnicfFlhPartSpaceFree = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 5), Gauge32()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartSpaceFree.setStatus('deprecated')
hpnicfFlhPartFileNum = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 6), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartFileNum.setStatus('current')
hpnicfFlhPartChecksumMethod = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("simpleChecksum", 1), ("undefined", 2), ("simpleCRC", 3)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartChecksumMethod.setStatus('current')
hpnicfFlhPartStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 8), HpnicfFlashPartitionStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartStatus.setStatus('current')
hpnicfFlhPartUpgradeMode = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 9), HpnicfFlashPartitionUpgradeMode()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartUpgradeMode.setStatus('current')
hpnicfFlhPartName = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 10), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartName.setStatus('current')
hpnicfFlhPartRequireErase = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 11), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartRequireErase.setStatus('current')
hpnicfFlhPartFileNameLen = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 12), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 256))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartFileNameLen.setStatus('current')
hpnicfFlhPartBootable = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 13), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartBootable.setStatus('current')
hpnicfFlhPartPathForGlobalOpt = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 14), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hpnicfFlhPartPathForGlobalOpt.setStatus('current')
hpnicfFlhPartHCSpace = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 15), CounterBasedGauge64()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartHCSpace.setStatus('current')
hpnicfFlhPartHCSpaceFree = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 16), CounterBasedGauge64()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhPartHCSpaceFree.setStatus('current')
hpnicfFlhFiles = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2))
hpnicfFlhFileTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1), )
if mibBuilder.loadTexts: hpnicfFlhFileTable.setStatus('current')
hpnicfFlhFileEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"), (0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartIndex"), (0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileIndex"))
if mibBuilder.loadTexts: hpnicfFlhFileEntry.setStatus('current')
hpnicfFlhFileIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647)))
if mibBuilder.loadTexts: hpnicfFlhFileIndex.setStatus('current')
hpnicfFlhFileName = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 2), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileName.setStatus('current')
hpnicfFlhFileSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 3), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileSize.setStatus('deprecated')
hpnicfFlhFileStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("deleted", 1), ("invalidChecksum", 2), ("valid", 3)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileStatus.setStatus('current')
hpnicfFlhFileChecksum = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 5), OctetString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileChecksum.setStatus('current')
hpnicfFlhFileHCSize = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 6), CounterBasedGauge64()).setUnits('bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhFileHCSize.setStatus('current')
hpnicfFlashOperate = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2))
hpnicfFlhOpTable = MibTable((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1), )
if mibBuilder.loadTexts: hpnicfFlhOpTable.setStatus('current')
hpnicfFlhOpEntry = MibTableRow((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1), ).setIndexNames((0, "HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperIndex"))
if mibBuilder.loadTexts: hpnicfFlhOpEntry.setStatus('current')
hpnicfFlhOperIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647)))
if mibBuilder.loadTexts: hpnicfFlhOperIndex.setStatus('current')
hpnicfFlhOperType = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5))).clone(namedValues=NamedValues(("net2FlashWithErase", 1), ("net2FlashWithoutErase", 2), ("flash2Net", 3), ("delete", 4), ("rename", 5)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperType.setStatus('current')
hpnicfFlhOperProtocol = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("ftp", 1), ("tftp", 2), ("clusterftp", 3), ("clustertftp", 4))).clone('ftp')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperProtocol.setStatus('current')
hpnicfFlhOperServerAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 4), IpAddress().clone(hexValue="FFFFFFFF")).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperServerAddress.setStatus('deprecated')
hpnicfFlhOperServerUser = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 5), DisplayString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperServerUser.setStatus('current')
hpnicfFlhOperPassword = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 6), DisplayString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperPassword.setStatus('current')
hpnicfFlhOperSourceFile = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 7), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 255))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperSourceFile.setStatus('current')
hpnicfFlhOperDestinationFile = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 8), DisplayString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperDestinationFile.setStatus('current')
hpnicfFlhOperStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 9), HpnicfFlashOperationStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhOperStatus.setStatus('current')
hpnicfFlhOperEndNotification = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 10), TruthValue().clone('false')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperEndNotification.setStatus('current')
hpnicfFlhOperProgress = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 11), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhOperProgress.setStatus('current')
hpnicfFlhOperRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 12), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperRowStatus.setStatus('current')
hpnicfFlhOperServerPort = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 13), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 65535))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperServerPort.setStatus('current')
hpnicfFlhOperFailReason = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 14), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hpnicfFlhOperFailReason.setStatus('current')
hpnicfFlhOperSrvAddrType = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 15), InetAddressType()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperSrvAddrType.setStatus('current')
hpnicfFlhOperSrvAddrRev = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 16), InetAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperSrvAddrRev.setStatus('current')
hpnicfFlhOperSrvVPNName = MibTableColumn((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 17), DisplayString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hpnicfFlhOperSrvVPNName.setStatus('current')
hpnicfFlashNotification = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 3))
hpnicfFlhOperNotification = NotificationType((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 3, 1)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperStatus"))
if mibBuilder.loadTexts: hpnicfFlhOperNotification.setStatus('current')
hpnicfFlashMIBConformance = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2))
hpnicfFlhMIBCompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 1))
hpnicfFlhMIBCompliance = ModuleCompliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 1, 1)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartitionGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperationGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhNotificationGroup"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhMIBCompliance = hpnicfFlhMIBCompliance.setStatus('current')
hpnicfFlashMIBGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2))
hpnicfFlhGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 1)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhSupportNum"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhSize"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPos"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhName"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipNum"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhDescr"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhInitTime"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhRemovable"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartitionBool"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhMinPartitionSize"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhMaxPartitions"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartitionNum"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhIndex"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhKbyteSize"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhGroup = hpnicfFlhGroup.setStatus('current')
hpnicfFlhChipGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 3)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipID"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipDescr"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipWriteTimesLimit"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipWriteTimes"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipEraseTimesLimit"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhChipEraseTimes"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhChipGroup = hpnicfFlhChipGroup.setStatus('current')
hpnicfFlhPartitionGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 4)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartFirstChip"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartLastChip"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartSpace"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartSpaceFree"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartFileNum"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartChecksumMethod"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartStatus"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartUpgradeMode"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartName"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartRequireErase"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartFileNameLen"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartBootable"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhPartPathForGlobalOpt"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhPartitionGroup = hpnicfFlhPartitionGroup.setStatus('current')
hpnicfFlhFileGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 5)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileName"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileSize"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileStatus"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhFileChecksum"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhFileGroup = hpnicfFlhFileGroup.setStatus('current')
hpnicfFlhOperationGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 6)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperType"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperProtocol"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperServerAddress"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperServerUser"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperPassword"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperSourceFile"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperDestinationFile"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperStatus"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperEndNotification"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperProgress"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperRowStatus"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperServerPort"), ("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperFailReason"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhOperationGroup = hpnicfFlhOperationGroup.setStatus('current')
hpnicfFlhNotificationGroup = NotificationGroup((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 7)).setObjects(("HPN-ICF-FLASH-MAN-MIB", "hpnicfFlhOperNotification"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicfFlhNotificationGroup = hpnicfFlhNotificationGroup.setStatus('current')
mibBuilder.exportSymbols("HPN-ICF-FLASH-MAN-MIB", HpnicfFlashPartitionUpgradeMode=HpnicfFlashPartitionUpgradeMode, hpnicfFlhChipTable=hpnicfFlhChipTable, hpnicfFlhFileHCSize=hpnicfFlhFileHCSize, hpnicfFlhChipDescr=hpnicfFlhChipDescr, hpnicfFlhOperSrvAddrType=hpnicfFlhOperSrvAddrType, hpnicfFlashOperate=hpnicfFlashOperate, hpnicfFlhPartStatus=hpnicfFlhPartStatus, hpnicfFlhPartitionBool=hpnicfFlhPartitionBool, hpnicfFlhOperSrvAddrRev=hpnicfFlhOperSrvAddrRev, hpnicfFlashMIBConformance=hpnicfFlashMIBConformance, hpnicfFlhDescr=hpnicfFlhDescr, hpnicfFlhFileName=hpnicfFlhFileName, hpnicfFlhHCSize=hpnicfFlhHCSize, hpnicfFlhOperSrvVPNName=hpnicfFlhOperSrvVPNName, hpnicfFlhPartFileNum=hpnicfFlhPartFileNum, hpnicfFlhMIBCompliances=hpnicfFlhMIBCompliances, hpnicfFlhSize=hpnicfFlhSize, hpnicfFlhPartHCSpace=hpnicfFlhPartHCSpace, hpnicfFlhOperType=hpnicfFlhOperType, hpnicfFlhPartitionEntry=hpnicfFlhPartitionEntry, hpnicfFlhOperProtocol=hpnicfFlhOperProtocol, hpnicfFlhFileStatus=hpnicfFlhFileStatus, hpnicfFlhPartRequireErase=hpnicfFlhPartRequireErase, hpnicfFlashDevice=hpnicfFlashDevice, hpnicfFlhOperRowStatus=hpnicfFlhOperRowStatus, hpnicfFlhOperationGroup=hpnicfFlhOperationGroup, hpnicfFlhPartitionNum=hpnicfFlhPartitionNum, hpnicfFlhFileIndex=hpnicfFlhFileIndex, hpnicfFlhChipID=hpnicfFlhChipID, hpnicfFlhOperServerUser=hpnicfFlhOperServerUser, hpnicfFlhOperDestinationFile=hpnicfFlhOperDestinationFile, hpnicfFlhOperIndex=hpnicfFlhOperIndex, hpnicfFlhChipWriteTimesLimit=hpnicfFlhChipWriteTimesLimit, hpnicfFlhNotificationGroup=hpnicfFlhNotificationGroup, hpnicfFlhOperEndNotification=hpnicfFlhOperEndNotification, hpnicfFlhSupportNum=hpnicfFlhSupportNum, hpnicfFlhPartChecksumMethod=hpnicfFlhPartChecksumMethod, hpnicfFlhPos=hpnicfFlhPos, hpnicfFlhOperSourceFile=hpnicfFlhOperSourceFile, hpnicfFlhPartFirstChip=hpnicfFlhPartFirstChip, hpnicfFlhFileGroup=hpnicfFlhFileGroup, hpnicfFlhOperFailReason=hpnicfFlhOperFailReason, hpnicfFlhFileEntry=hpnicfFlhFileEntry, hpnicfFlhChipNum=hpnicfFlhChipNum, hpnicfFlhPartSpace=hpnicfFlhPartSpace, hpnicfFlashTable=hpnicfFlashTable, hpnicfFlhMinPartitionSize=hpnicfFlhMinPartitionSize, hpnicfFlhFiles=hpnicfFlhFiles, HpnicfFlashPartitionStatus=HpnicfFlashPartitionStatus, hpnicfFlhPartIndex=hpnicfFlhPartIndex, hpnicfFlhInitTime=hpnicfFlhInitTime, hpnicfFlhPartitionTable=hpnicfFlhPartitionTable, hpnicfFlhOpTable=hpnicfFlhOpTable, hpnicfFlhOperNotification=hpnicfFlhOperNotification, hpnicfFlhChipWriteTimes=hpnicfFlhChipWriteTimes, hpnicfFlhFileTable=hpnicfFlhFileTable, hpnicfFlash=hpnicfFlash, PYSNMP_MODULE_ID=hpnicfFlash, hpnicfFlhChipEraseTimes=hpnicfFlhChipEraseTimes, hpnicfFlashMIBGroups=hpnicfFlashMIBGroups, hpnicfFlhMaxPartitions=hpnicfFlhMaxPartitions, hpnicfFlhChipSerialNo=hpnicfFlhChipSerialNo, hpnicfFlashChips=hpnicfFlashChips, hpnicfFlhPartName=hpnicfFlhPartName, hpnicfFlhOperServerAddress=hpnicfFlhOperServerAddress, hpnicfFlhChipEntry=hpnicfFlhChipEntry, hpnicfFlhName=hpnicfFlhName, hpnicfFlhPartSpaceFree=hpnicfFlhPartSpaceFree, hpnicfFlhOperProgress=hpnicfFlhOperProgress, hpnicfFlashEntry=hpnicfFlashEntry, hpnicfFlhPartPathForGlobalOpt=hpnicfFlhPartPathForGlobalOpt, hpnicfFlhOperPassword=hpnicfFlhOperPassword, hpnicfFlashManMIBObjects=hpnicfFlashManMIBObjects, hpnicfFlhPartUpgradeMode=hpnicfFlhPartUpgradeMode, hpnicfFlashPartitions=hpnicfFlashPartitions, hpnicfFlhIndex=hpnicfFlhIndex, hpnicfFlashNotification=hpnicfFlashNotification, hpnicfFlhOperServerPort=hpnicfFlhOperServerPort, hpnicfFlhChipEraseTimesLimit=hpnicfFlhChipEraseTimesLimit, hpnicfFlhOperStatus=hpnicfFlhOperStatus, hpnicfFlhOpEntry=hpnicfFlhOpEntry, hpnicfFlhGroup=hpnicfFlhGroup, hpnicfFlhPartHCSpaceFree=hpnicfFlhPartHCSpaceFree, hpnicfFlhRemovable=hpnicfFlhRemovable, hpnicfFlhPartLastChip=hpnicfFlhPartLastChip, hpnicfFlhChipGroup=hpnicfFlhChipGroup, hpnicfFlhKbyteSize=hpnicfFlhKbyteSize, hpnicfFlhFileSize=hpnicfFlhFileSize, hpnicfFlhPartitionGroup=hpnicfFlhPartitionGroup, hpnicfFlhPartBootable=hpnicfFlhPartBootable, HpnicfFlashOperationStatus=HpnicfFlashOperationStatus, hpnicfFlhMIBCompliance=hpnicfFlhMIBCompliance, hpnicfFlhFileChecksum=hpnicfFlhFileChecksum, hpnicfFlhPartFileNameLen=hpnicfFlhPartFileNameLen)
|
(object_identifier, octet_string, integer) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'OctetString', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, constraints_union, value_range_constraint, single_value_constraint, constraints_intersection) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'ConstraintsUnion', 'ValueRangeConstraint', 'SingleValueConstraint', 'ConstraintsIntersection')
(physical_index,) = mibBuilder.importSymbols('ENTITY-MIB', 'PhysicalIndex')
(counter_based_gauge64,) = mibBuilder.importSymbols('HCNUM-TC', 'CounterBasedGauge64')
(hpnicf_common,) = mibBuilder.importSymbols('HPN-ICF-OID-MIB', 'hpnicfCommon')
(inet_address, inet_address_type) = mibBuilder.importSymbols('INET-ADDRESS-MIB', 'InetAddress', 'InetAddressType')
(notification_group, object_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'NotificationGroup', 'ObjectGroup', 'ModuleCompliance')
(module_identity, time_ticks, counter64, integer32, object_identity, ip_address, bits, unsigned32, mib_identifier, mib_scalar, mib_table, mib_table_row, mib_table_column, counter32, gauge32, iso, notification_type) = mibBuilder.importSymbols('SNMPv2-SMI', 'ModuleIdentity', 'TimeTicks', 'Counter64', 'Integer32', 'ObjectIdentity', 'IpAddress', 'Bits', 'Unsigned32', 'MibIdentifier', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Counter32', 'Gauge32', 'iso', 'NotificationType')
(truth_value, row_status, textual_convention, display_string, time_stamp) = mibBuilder.importSymbols('SNMPv2-TC', 'TruthValue', 'RowStatus', 'TextualConvention', 'DisplayString', 'TimeStamp')
hpnicf_flash = module_identity((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5))
hpnicfFlash.setRevisions(('2013-05-23 00:00',))
if mibBuilder.loadTexts:
hpnicfFlash.setLastUpdated('201305230000Z')
if mibBuilder.loadTexts:
hpnicfFlash.setOrganization('')
class Hpnicfflashoperationstatus(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31))
named_values = named_values(('opInProgress', 1), ('opSuccess', 2), ('opInvalid', 3), ('opInvalidProtocol', 4), ('opInvalidSourceName', 5), ('opInvalidDestName', 6), ('opInvalidServerAddress', 7), ('opDeviceBusy', 8), ('opDeviceOpenError', 9), ('opDeviceError', 10), ('opDeviceNotProgrammable', 11), ('opDeviceFull', 12), ('opFileOpenError', 13), ('opFileTransferError', 14), ('opFileChecksumError', 15), ('opNoMemory', 16), ('opAuthFail', 17), ('opTimeout', 18), ('opUnknownFailure', 19), ('opDeleteFileOpenError', 20), ('opDeleteInvalidDevice', 21), ('opDeleteInvalidFunction', 22), ('opDeleteOperationError', 23), ('opDeleteInvalidFileName', 24), ('opDeleteDeviceBusy', 25), ('opDeleteParaError', 26), ('opDeleteInvalidPath', 27), ('opDeleteFileNotExistInSlave', 28), ('opDeleteFileFailedInSlave', 29), ('opSlaveFull', 30), ('opCopyToSlaveFailure', 31))
class Hpnicfflashpartitionupgrademode(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3))
named_values = named_values(('unknown', 1), ('rxbootFLH', 2), ('direct', 3))
class Hpnicfflashpartitionstatus(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3))
named_values = named_values(('readOnly', 1), ('runFromFlash', 2), ('readWrite', 3))
hpnicf_flash_man_mib_objects = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1))
hpnicf_flash_device = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1))
hpnicf_flh_support_num = mib_scalar((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhSupportNum.setStatus('current')
hpnicf_flash_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2))
if mibBuilder.loadTexts:
hpnicfFlashTable.setStatus('current')
hpnicf_flash_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'))
if mibBuilder.loadTexts:
hpnicfFlashEntry.setStatus('current')
hpnicf_flh_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 2147483647))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhIndex.setStatus('current')
hpnicf_flh_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 2), integer32()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhSize.setStatus('deprecated')
hpnicf_flh_pos = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 3), physical_index()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPos.setStatus('current')
hpnicf_flh_name = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 4), display_string().subtype(subtypeSpec=value_size_constraint(0, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhName.setStatus('current')
hpnicf_flh_chip_num = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 5), integer32().subtype(subtypeSpec=value_range_constraint(1, 64))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipNum.setStatus('current')
hpnicf_flh_descr = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 6), display_string().subtype(subtypeSpec=value_size_constraint(0, 64))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhDescr.setStatus('current')
hpnicf_flh_init_time = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 8), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhInitTime.setStatus('current')
hpnicf_flh_removable = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 9), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhRemovable.setStatus('current')
hpnicf_flh_partition_bool = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 11), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpnicfFlhPartitionBool.setStatus('current')
hpnicf_flh_min_partition_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 12), integer32()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhMinPartitionSize.setStatus('current')
hpnicf_flh_max_partitions = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 13), integer32().subtype(subtypeSpec=value_range_constraint(1, 8))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhMaxPartitions.setStatus('current')
hpnicf_flh_partition_num = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 14), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartitionNum.setStatus('current')
hpnicf_flh_kbyte_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 15), integer32()).setUnits('kbytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhKbyteSize.setStatus('current')
hpnicf_flh_hc_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 2, 1, 16), counter_based_gauge64()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhHCSize.setStatus('current')
hpnicf_flash_chips = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3))
hpnicf_flh_chip_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1))
if mibBuilder.loadTexts:
hpnicfFlhChipTable.setStatus('current')
hpnicf_flh_chip_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'), (0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipSerialNo'))
if mibBuilder.loadTexts:
hpnicfFlhChipEntry.setStatus('current')
hpnicf_flh_chip_serial_no = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 64)))
if mibBuilder.loadTexts:
hpnicfFlhChipSerialNo.setStatus('current')
hpnicf_flh_chip_id = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 2), display_string().subtype(subtypeSpec=value_size_constraint(0, 5))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipID.setStatus('current')
hpnicf_flh_chip_descr = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 3), display_string().subtype(subtypeSpec=value_size_constraint(0, 32))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipDescr.setStatus('current')
hpnicf_flh_chip_write_times_limit = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 4), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipWriteTimesLimit.setStatus('current')
hpnicf_flh_chip_write_times = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 5), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipWriteTimes.setStatus('current')
hpnicf_flh_chip_erase_times_limit = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 6), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipEraseTimesLimit.setStatus('current')
hpnicf_flh_chip_erase_times = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 3, 1, 1, 7), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhChipEraseTimes.setStatus('current')
hpnicf_flash_partitions = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4))
hpnicf_flh_partition_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1))
if mibBuilder.loadTexts:
hpnicfFlhPartitionTable.setStatus('current')
hpnicf_flh_partition_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'), (0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartIndex'))
if mibBuilder.loadTexts:
hpnicfFlhPartitionEntry.setStatus('current')
hpnicf_flh_part_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 8)))
if mibBuilder.loadTexts:
hpnicfFlhPartIndex.setStatus('current')
hpnicf_flh_part_first_chip = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(1, 64))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartFirstChip.setStatus('current')
hpnicf_flh_part_last_chip = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(1, 64))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartLastChip.setStatus('current')
hpnicf_flh_part_space = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 4), integer32()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartSpace.setStatus('deprecated')
hpnicf_flh_part_space_free = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 5), gauge32()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartSpaceFree.setStatus('deprecated')
hpnicf_flh_part_file_num = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 6), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartFileNum.setStatus('current')
hpnicf_flh_part_checksum_method = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('simpleChecksum', 1), ('undefined', 2), ('simpleCRC', 3)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartChecksumMethod.setStatus('current')
hpnicf_flh_part_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 8), hpnicf_flash_partition_status()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartStatus.setStatus('current')
hpnicf_flh_part_upgrade_mode = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 9), hpnicf_flash_partition_upgrade_mode()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartUpgradeMode.setStatus('current')
hpnicf_flh_part_name = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 10), display_string().subtype(subtypeSpec=value_size_constraint(0, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartName.setStatus('current')
hpnicf_flh_part_require_erase = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 11), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartRequireErase.setStatus('current')
hpnicf_flh_part_file_name_len = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 12), integer32().subtype(subtypeSpec=value_range_constraint(1, 256))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartFileNameLen.setStatus('current')
hpnicf_flh_part_bootable = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 13), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartBootable.setStatus('current')
hpnicf_flh_part_path_for_global_opt = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 14), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hpnicfFlhPartPathForGlobalOpt.setStatus('current')
hpnicf_flh_part_hc_space = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 15), counter_based_gauge64()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartHCSpace.setStatus('current')
hpnicf_flh_part_hc_space_free = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 1, 1, 16), counter_based_gauge64()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhPartHCSpaceFree.setStatus('current')
hpnicf_flh_files = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2))
hpnicf_flh_file_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1))
if mibBuilder.loadTexts:
hpnicfFlhFileTable.setStatus('current')
hpnicf_flh_file_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'), (0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartIndex'), (0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileIndex'))
if mibBuilder.loadTexts:
hpnicfFlhFileEntry.setStatus('current')
hpnicf_flh_file_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 2147483647)))
if mibBuilder.loadTexts:
hpnicfFlhFileIndex.setStatus('current')
hpnicf_flh_file_name = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 2), display_string().subtype(subtypeSpec=value_size_constraint(1, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileName.setStatus('current')
hpnicf_flh_file_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 3), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileSize.setStatus('deprecated')
hpnicf_flh_file_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 4), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('deleted', 1), ('invalidChecksum', 2), ('valid', 3)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileStatus.setStatus('current')
hpnicf_flh_file_checksum = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 5), octet_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileChecksum.setStatus('current')
hpnicf_flh_file_hc_size = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 1, 4, 2, 1, 1, 6), counter_based_gauge64()).setUnits('bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhFileHCSize.setStatus('current')
hpnicf_flash_operate = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2))
hpnicf_flh_op_table = mib_table((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1))
if mibBuilder.loadTexts:
hpnicfFlhOpTable.setStatus('current')
hpnicf_flh_op_entry = mib_table_row((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1)).setIndexNames((0, 'HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperIndex'))
if mibBuilder.loadTexts:
hpnicfFlhOpEntry.setStatus('current')
hpnicf_flh_oper_index = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 2147483647)))
if mibBuilder.loadTexts:
hpnicfFlhOperIndex.setStatus('current')
hpnicf_flh_oper_type = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4, 5))).clone(namedValues=named_values(('net2FlashWithErase', 1), ('net2FlashWithoutErase', 2), ('flash2Net', 3), ('delete', 4), ('rename', 5)))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperType.setStatus('current')
hpnicf_flh_oper_protocol = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 3), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('ftp', 1), ('tftp', 2), ('clusterftp', 3), ('clustertftp', 4))).clone('ftp')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperProtocol.setStatus('current')
hpnicf_flh_oper_server_address = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 4), ip_address().clone(hexValue='FFFFFFFF')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperServerAddress.setStatus('deprecated')
hpnicf_flh_oper_server_user = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 5), display_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperServerUser.setStatus('current')
hpnicf_flh_oper_password = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 6), display_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperPassword.setStatus('current')
hpnicf_flh_oper_source_file = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 7), display_string().subtype(subtypeSpec=value_size_constraint(1, 255))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperSourceFile.setStatus('current')
hpnicf_flh_oper_destination_file = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 8), display_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperDestinationFile.setStatus('current')
hpnicf_flh_oper_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 9), hpnicf_flash_operation_status()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhOperStatus.setStatus('current')
hpnicf_flh_oper_end_notification = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 10), truth_value().clone('false')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperEndNotification.setStatus('current')
hpnicf_flh_oper_progress = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 11), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhOperProgress.setStatus('current')
hpnicf_flh_oper_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 12), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperRowStatus.setStatus('current')
hpnicf_flh_oper_server_port = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 13), integer32().subtype(subtypeSpec=value_range_constraint(0, 65535))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperServerPort.setStatus('current')
hpnicf_flh_oper_fail_reason = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 14), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hpnicfFlhOperFailReason.setStatus('current')
hpnicf_flh_oper_srv_addr_type = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 15), inet_address_type()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperSrvAddrType.setStatus('current')
hpnicf_flh_oper_srv_addr_rev = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 16), inet_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperSrvAddrRev.setStatus('current')
hpnicf_flh_oper_srv_vpn_name = mib_table_column((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 2, 1, 1, 17), display_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hpnicfFlhOperSrvVPNName.setStatus('current')
hpnicf_flash_notification = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 3))
hpnicf_flh_oper_notification = notification_type((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 1, 3, 1)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperStatus'))
if mibBuilder.loadTexts:
hpnicfFlhOperNotification.setStatus('current')
hpnicf_flash_mib_conformance = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2))
hpnicf_flh_mib_compliances = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 1))
hpnicf_flh_mib_compliance = module_compliance((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 1, 1)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartitionGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperationGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhNotificationGroup'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_mib_compliance = hpnicfFlhMIBCompliance.setStatus('current')
hpnicf_flash_mib_groups = mib_identifier((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2))
hpnicf_flh_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 1)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhSupportNum'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhSize'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPos'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhName'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipNum'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhDescr'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhInitTime'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhRemovable'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartitionBool'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhMinPartitionSize'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhMaxPartitions'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartitionNum'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhIndex'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhKbyteSize'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_group = hpnicfFlhGroup.setStatus('current')
hpnicf_flh_chip_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 3)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipID'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipDescr'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipWriteTimesLimit'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipWriteTimes'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipEraseTimesLimit'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhChipEraseTimes'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_chip_group = hpnicfFlhChipGroup.setStatus('current')
hpnicf_flh_partition_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 4)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartFirstChip'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartLastChip'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartSpace'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartSpaceFree'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartFileNum'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartChecksumMethod'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartStatus'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartUpgradeMode'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartName'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartRequireErase'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartFileNameLen'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartBootable'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhPartPathForGlobalOpt'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_partition_group = hpnicfFlhPartitionGroup.setStatus('current')
hpnicf_flh_file_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 5)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileName'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileSize'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileStatus'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhFileChecksum'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_file_group = hpnicfFlhFileGroup.setStatus('current')
hpnicf_flh_operation_group = object_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 6)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperType'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperProtocol'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperServerAddress'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperServerUser'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperPassword'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperSourceFile'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperDestinationFile'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperStatus'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperEndNotification'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperProgress'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperRowStatus'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperServerPort'), ('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperFailReason'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_operation_group = hpnicfFlhOperationGroup.setStatus('current')
hpnicf_flh_notification_group = notification_group((1, 3, 6, 1, 4, 1, 11, 2, 14, 11, 15, 2, 5, 2, 2, 7)).setObjects(('HPN-ICF-FLASH-MAN-MIB', 'hpnicfFlhOperNotification'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
hpnicf_flh_notification_group = hpnicfFlhNotificationGroup.setStatus('current')
mibBuilder.exportSymbols('HPN-ICF-FLASH-MAN-MIB', HpnicfFlashPartitionUpgradeMode=HpnicfFlashPartitionUpgradeMode, hpnicfFlhChipTable=hpnicfFlhChipTable, hpnicfFlhFileHCSize=hpnicfFlhFileHCSize, hpnicfFlhChipDescr=hpnicfFlhChipDescr, hpnicfFlhOperSrvAddrType=hpnicfFlhOperSrvAddrType, hpnicfFlashOperate=hpnicfFlashOperate, hpnicfFlhPartStatus=hpnicfFlhPartStatus, hpnicfFlhPartitionBool=hpnicfFlhPartitionBool, hpnicfFlhOperSrvAddrRev=hpnicfFlhOperSrvAddrRev, hpnicfFlashMIBConformance=hpnicfFlashMIBConformance, hpnicfFlhDescr=hpnicfFlhDescr, hpnicfFlhFileName=hpnicfFlhFileName, hpnicfFlhHCSize=hpnicfFlhHCSize, hpnicfFlhOperSrvVPNName=hpnicfFlhOperSrvVPNName, hpnicfFlhPartFileNum=hpnicfFlhPartFileNum, hpnicfFlhMIBCompliances=hpnicfFlhMIBCompliances, hpnicfFlhSize=hpnicfFlhSize, hpnicfFlhPartHCSpace=hpnicfFlhPartHCSpace, hpnicfFlhOperType=hpnicfFlhOperType, hpnicfFlhPartitionEntry=hpnicfFlhPartitionEntry, hpnicfFlhOperProtocol=hpnicfFlhOperProtocol, hpnicfFlhFileStatus=hpnicfFlhFileStatus, hpnicfFlhPartRequireErase=hpnicfFlhPartRequireErase, hpnicfFlashDevice=hpnicfFlashDevice, hpnicfFlhOperRowStatus=hpnicfFlhOperRowStatus, hpnicfFlhOperationGroup=hpnicfFlhOperationGroup, hpnicfFlhPartitionNum=hpnicfFlhPartitionNum, hpnicfFlhFileIndex=hpnicfFlhFileIndex, hpnicfFlhChipID=hpnicfFlhChipID, hpnicfFlhOperServerUser=hpnicfFlhOperServerUser, hpnicfFlhOperDestinationFile=hpnicfFlhOperDestinationFile, hpnicfFlhOperIndex=hpnicfFlhOperIndex, hpnicfFlhChipWriteTimesLimit=hpnicfFlhChipWriteTimesLimit, hpnicfFlhNotificationGroup=hpnicfFlhNotificationGroup, hpnicfFlhOperEndNotification=hpnicfFlhOperEndNotification, hpnicfFlhSupportNum=hpnicfFlhSupportNum, hpnicfFlhPartChecksumMethod=hpnicfFlhPartChecksumMethod, hpnicfFlhPos=hpnicfFlhPos, hpnicfFlhOperSourceFile=hpnicfFlhOperSourceFile, hpnicfFlhPartFirstChip=hpnicfFlhPartFirstChip, hpnicfFlhFileGroup=hpnicfFlhFileGroup, hpnicfFlhOperFailReason=hpnicfFlhOperFailReason, hpnicfFlhFileEntry=hpnicfFlhFileEntry, hpnicfFlhChipNum=hpnicfFlhChipNum, hpnicfFlhPartSpace=hpnicfFlhPartSpace, hpnicfFlashTable=hpnicfFlashTable, hpnicfFlhMinPartitionSize=hpnicfFlhMinPartitionSize, hpnicfFlhFiles=hpnicfFlhFiles, HpnicfFlashPartitionStatus=HpnicfFlashPartitionStatus, hpnicfFlhPartIndex=hpnicfFlhPartIndex, hpnicfFlhInitTime=hpnicfFlhInitTime, hpnicfFlhPartitionTable=hpnicfFlhPartitionTable, hpnicfFlhOpTable=hpnicfFlhOpTable, hpnicfFlhOperNotification=hpnicfFlhOperNotification, hpnicfFlhChipWriteTimes=hpnicfFlhChipWriteTimes, hpnicfFlhFileTable=hpnicfFlhFileTable, hpnicfFlash=hpnicfFlash, PYSNMP_MODULE_ID=hpnicfFlash, hpnicfFlhChipEraseTimes=hpnicfFlhChipEraseTimes, hpnicfFlashMIBGroups=hpnicfFlashMIBGroups, hpnicfFlhMaxPartitions=hpnicfFlhMaxPartitions, hpnicfFlhChipSerialNo=hpnicfFlhChipSerialNo, hpnicfFlashChips=hpnicfFlashChips, hpnicfFlhPartName=hpnicfFlhPartName, hpnicfFlhOperServerAddress=hpnicfFlhOperServerAddress, hpnicfFlhChipEntry=hpnicfFlhChipEntry, hpnicfFlhName=hpnicfFlhName, hpnicfFlhPartSpaceFree=hpnicfFlhPartSpaceFree, hpnicfFlhOperProgress=hpnicfFlhOperProgress, hpnicfFlashEntry=hpnicfFlashEntry, hpnicfFlhPartPathForGlobalOpt=hpnicfFlhPartPathForGlobalOpt, hpnicfFlhOperPassword=hpnicfFlhOperPassword, hpnicfFlashManMIBObjects=hpnicfFlashManMIBObjects, hpnicfFlhPartUpgradeMode=hpnicfFlhPartUpgradeMode, hpnicfFlashPartitions=hpnicfFlashPartitions, hpnicfFlhIndex=hpnicfFlhIndex, hpnicfFlashNotification=hpnicfFlashNotification, hpnicfFlhOperServerPort=hpnicfFlhOperServerPort, hpnicfFlhChipEraseTimesLimit=hpnicfFlhChipEraseTimesLimit, hpnicfFlhOperStatus=hpnicfFlhOperStatus, hpnicfFlhOpEntry=hpnicfFlhOpEntry, hpnicfFlhGroup=hpnicfFlhGroup, hpnicfFlhPartHCSpaceFree=hpnicfFlhPartHCSpaceFree, hpnicfFlhRemovable=hpnicfFlhRemovable, hpnicfFlhPartLastChip=hpnicfFlhPartLastChip, hpnicfFlhChipGroup=hpnicfFlhChipGroup, hpnicfFlhKbyteSize=hpnicfFlhKbyteSize, hpnicfFlhFileSize=hpnicfFlhFileSize, hpnicfFlhPartitionGroup=hpnicfFlhPartitionGroup, hpnicfFlhPartBootable=hpnicfFlhPartBootable, HpnicfFlashOperationStatus=HpnicfFlashOperationStatus, hpnicfFlhMIBCompliance=hpnicfFlhMIBCompliance, hpnicfFlhFileChecksum=hpnicfFlhFileChecksum, hpnicfFlhPartFileNameLen=hpnicfFlhPartFileNameLen)
|
#
# PySNMP MIB module BENU-IP-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/BENU-IP-MIB
# Produced by pysmi-0.3.4 at Wed May 1 11:37:23 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, ObjectIdentifier, OctetString = mibBuilder.importSymbols("ASN1", "Integer", "ObjectIdentifier", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsUnion, ValueSizeConstraint, ValueRangeConstraint, ConstraintsIntersection, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "ValueSizeConstraint", "ValueRangeConstraint", "ConstraintsIntersection", "SingleValueConstraint")
benuPlatform, = mibBuilder.importSymbols("BENU-PLATFORM-MIB", "benuPlatform")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
ModuleIdentity, Counter32, Unsigned32, ObjectIdentity, Integer32, NotificationType, IpAddress, MibIdentifier, TimeTicks, MibScalar, MibTable, MibTableRow, MibTableColumn, iso, Counter64, Gauge32, Bits = mibBuilder.importSymbols("SNMPv2-SMI", "ModuleIdentity", "Counter32", "Unsigned32", "ObjectIdentity", "Integer32", "NotificationType", "IpAddress", "MibIdentifier", "TimeTicks", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "iso", "Counter64", "Gauge32", "Bits")
TextualConvention, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DisplayString")
bIPMIB = ModuleIdentity((1, 3, 6, 1, 4, 1, 39406, 1, 6))
bIPMIB.setRevisions(('2014-12-17 00:00', '2013-11-28 00:00', '2013-05-31 00:00',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts: bIPMIB.setRevisionsDescriptions(('updated MIB file with change in bIPNotifObjects', 'Marked bIPPortTxFramesWoErrExclPausFrame as deprecated as it is not supported. Removed unnecessary IMPORTS and added missing. Also, Changed SYNTAX of bIPPortIndex from Integer32 to Unsigned32.', 'Initial Version',))
if mibBuilder.loadTexts: bIPMIB.setLastUpdated('201412170000Z')
if mibBuilder.loadTexts: bIPMIB.setOrganization('Benu Networks')
if mibBuilder.loadTexts: bIPMIB.setContactInfo('Benu Networks Inc, 300 Concord Road, Billerca MA 01821 Email: [email protected]')
if mibBuilder.loadTexts: bIPMIB.setDescription('This MIB module defines IP utilization statistics. Copyright (C) 2001, 2008 by Benu Networks, Inc. All rights reserved.')
bIPMIBObjects = ObjectIdentity((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1))
if mibBuilder.loadTexts: bIPMIBObjects.setStatus('current')
if mibBuilder.loadTexts: bIPMIBObjects.setDescription('MIB objects for IP utilization statistics are defined in this branch.')
bIPNotifObjects = ObjectIdentity((1, 3, 6, 1, 4, 1, 39406, 1, 6, 0))
if mibBuilder.loadTexts: bIPNotifObjects.setStatus('current')
if mibBuilder.loadTexts: bIPNotifObjects.setDescription('Notifications of IP utilization statistics are defined in this branch.')
bIPPortTable = MibTable((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1), )
if mibBuilder.loadTexts: bIPPortTable.setStatus('current')
if mibBuilder.loadTexts: bIPPortTable.setDescription('The table of IP utilization performance metrics of each interface.')
bIPPortEntry = MibTableRow((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1), ).setIndexNames((0, "BENU-IP-MIB", "bIPPortIndex"))
if mibBuilder.loadTexts: bIPPortEntry.setStatus('current')
if mibBuilder.loadTexts: bIPPortEntry.setDescription('An entry containing IP utilization performance metrics for each interface.')
bIPPortIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 1), Unsigned32())
if mibBuilder.loadTexts: bIPPortIndex.setStatus('current')
if mibBuilder.loadTexts: bIPPortIndex.setDescription('Interface index of the port This will be similar to ifIndex of IF-MIB.')
bIPPortInterfaceName = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortInterfaceName.setStatus('current')
if mibBuilder.loadTexts: bIPPortInterfaceName.setDescription('Name of the interface associated with this port.')
bIPPortTxBytesInFrameWoErr = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxBytesInFrameWoErr.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxBytesInFrameWoErr.setDescription('Total bytes transmitted without errors.')
bIPPortTxFramesWoErrExclPausFrame = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxFramesWoErrExclPausFrame.setStatus('deprecated')
if mibBuilder.loadTexts: bIPPortTxFramesWoErrExclPausFrame.setDescription('Total frames transmitted without errors excluding pause frames.')
bIPPortTxBcastFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxBcastFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxBcastFrames.setDescription('Total broadcast frames transmitted.')
bIPPortTxL2McastFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 6), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxL2McastFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxL2McastFrames.setDescription('Total Layer 2 multicast frames transmitted.')
bIPPortTxPausFrame = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 7), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxPausFrame.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxPausFrame.setDescription('Total broadcast frames transmitted.')
bIPPortTx64byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 8), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx64byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx64byteFrames.setDescription('Total 64-byte frames transmitted.')
bIPPortTx65to127byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 9), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx65to127byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx65to127byteFrames.setDescription('Total 65 to 127-byte frames transmitted.')
bIPPortTx128to255byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 10), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx128to255byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx128to255byteFrames.setDescription('Total 128 to 255-byte frames transmitted.')
bIPPortTx256to511byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 11), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx256to511byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx256to511byteFrames.setDescription('Total 256 to 511-byte frames transmitted.')
bIPPortTx512to1023byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 12), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx512to1023byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx512to1023byteFrames.setDescription('Total 512 to 1023-byte frames transmitted.')
bIPPortTx1024to1518byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 13), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx1024to1518byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx1024to1518byteFrames.setDescription('Total 1024 to 1518-byte frames transmitted.')
bIPPortTx1519to1522byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 14), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx1519to1522byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx1519to1522byteFrames.setDescription('Total 1519 to 1522-byte frames transmitted.')
bIPPortTx1523toMaxByteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 15), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx1523toMaxByteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx1523toMaxByteFrames.setDescription('Total 1523 to Max-byte frames transmitted.')
bIPPortTx17to63byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 16), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTx17to63byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTx17to63byteFrames.setDescription('Total 17 to 63-byte frames transmitted.')
bIPPortTxBadFcsFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 17), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortTxBadFcsFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortTxBadFcsFrames.setDescription('Total bad FCS frames transmitted.')
bIPPortRxBytesInFrameWoErr = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 18), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxBytesInFrameWoErr.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxBytesInFrameWoErr.setDescription('Total bytes received without errors.')
bIPPortRxBcastFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 19), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxBcastFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxBcastFrames.setDescription('Total broadcast frames received.')
bIPPortRxL2McastFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 20), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxL2McastFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxL2McastFrames.setDescription('Total multicase frames received.')
bIPPortRxPausFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 21), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxPausFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxPausFrames.setDescription('Total pause frames received.')
bIPPortRx64byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 22), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx64byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx64byteFrames.setDescription('Total 64-byte frames received.')
bIPPortRx65to127byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 23), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx65to127byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx65to127byteFrames.setDescription('Total 65 to 127-byte frames received.')
bIPPortRx128to255byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 24), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx128to255byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx128to255byteFrames.setDescription('Total 128 to 255-byte frames received.')
bIPPortRx256to511byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 25), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx256to511byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx256to511byteFrames.setDescription('Total 256 to 511-byte frames received.')
bIPPortRx512to1023byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 26), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx512to1023byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx512to1023byteFrames.setDescription('Total 512 to 1023-byte frames received.')
bIPPortRx1024to1518byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 27), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx1024to1518byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx1024to1518byteFrames.setDescription('Total 1024 to 1518-byte frames received.')
bIPPortRx1519to1522byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 28), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx1519to1522byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx1519to1522byteFrames.setDescription('Total 1519 to 1522-byte frames received.')
bIPPortRx1523to10368byteFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 29), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRx1523to10368byteFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRx1523to10368byteFrames.setDescription('Total 1523 to 10368-byte frames received.')
bIPPortRxShortFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 30), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxShortFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxShortFrames.setDescription('Total short frames received.')
bIPPortRxJabberFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 31), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxJabberFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxJabberFrames.setDescription('Total jabber frames received.')
bIPPortRxOvrSzFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 32), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxOvrSzFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxOvrSzFrames.setDescription('Total oversize frames received.')
bIPPortRxLenFldErrFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 33), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxLenFldErrFrames.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxLenFldErrFrames.setDescription('Total length field error frames received.')
bIPPortRxSymbErrs = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 34), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxSymbErrs.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxSymbErrs.setDescription('Total symbol error frames received.')
bIPPortRxIntrPktJunk = MibTableColumn((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 35), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: bIPPortRxIntrPktJunk.setStatus('current')
if mibBuilder.loadTexts: bIPPortRxIntrPktJunk.setDescription('Total inter packet junk error frames received.')
mibBuilder.exportSymbols("BENU-IP-MIB", bIPPortTx64byteFrames=bIPPortTx64byteFrames, bIPPortRxJabberFrames=bIPPortRxJabberFrames, bIPPortIndex=bIPPortIndex, bIPPortTx65to127byteFrames=bIPPortTx65to127byteFrames, bIPPortTx1523toMaxByteFrames=bIPPortTx1523toMaxByteFrames, bIPPortTxFramesWoErrExclPausFrame=bIPPortTxFramesWoErrExclPausFrame, bIPPortTxL2McastFrames=bIPPortTxL2McastFrames, PYSNMP_MODULE_ID=bIPMIB, bIPPortRxSymbErrs=bIPPortRxSymbErrs, bIPPortRx512to1023byteFrames=bIPPortRx512to1023byteFrames, bIPPortRx256to511byteFrames=bIPPortRx256to511byteFrames, bIPPortRx65to127byteFrames=bIPPortRx65to127byteFrames, bIPPortRxLenFldErrFrames=bIPPortRxLenFldErrFrames, bIPNotifObjects=bIPNotifObjects, bIPPortTxBadFcsFrames=bIPPortTxBadFcsFrames, bIPPortRx1024to1518byteFrames=bIPPortRx1024to1518byteFrames, bIPPortRx128to255byteFrames=bIPPortRx128to255byteFrames, bIPPortRxOvrSzFrames=bIPPortRxOvrSzFrames, bIPPortRxPausFrames=bIPPortRxPausFrames, bIPPortTx1024to1518byteFrames=bIPPortTx1024to1518byteFrames, bIPPortRxBytesInFrameWoErr=bIPPortRxBytesInFrameWoErr, bIPPortTx17to63byteFrames=bIPPortTx17to63byteFrames, bIPPortRx1519to1522byteFrames=bIPPortRx1519to1522byteFrames, bIPPortRxBcastFrames=bIPPortRxBcastFrames, bIPPortTable=bIPPortTable, bIPPortTx1519to1522byteFrames=bIPPortTx1519to1522byteFrames, bIPPortTxBcastFrames=bIPPortTxBcastFrames, bIPPortRxShortFrames=bIPPortRxShortFrames, bIPPortTx128to255byteFrames=bIPPortTx128to255byteFrames, bIPMIBObjects=bIPMIBObjects, bIPPortTx512to1023byteFrames=bIPPortTx512to1023byteFrames, bIPPortEntry=bIPPortEntry, bIPPortTx256to511byteFrames=bIPPortTx256to511byteFrames, bIPPortRx64byteFrames=bIPPortRx64byteFrames, bIPPortRx1523to10368byteFrames=bIPPortRx1523to10368byteFrames, bIPPortInterfaceName=bIPPortInterfaceName, bIPMIB=bIPMIB, bIPPortRxIntrPktJunk=bIPPortRxIntrPktJunk, bIPPortRxL2McastFrames=bIPPortRxL2McastFrames, bIPPortTxBytesInFrameWoErr=bIPPortTxBytesInFrameWoErr, bIPPortTxPausFrame=bIPPortTxPausFrame)
|
(integer, object_identifier, octet_string) = mibBuilder.importSymbols('ASN1', 'Integer', 'ObjectIdentifier', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(constraints_union, value_size_constraint, value_range_constraint, constraints_intersection, single_value_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsUnion', 'ValueSizeConstraint', 'ValueRangeConstraint', 'ConstraintsIntersection', 'SingleValueConstraint')
(benu_platform,) = mibBuilder.importSymbols('BENU-PLATFORM-MIB', 'benuPlatform')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(module_identity, counter32, unsigned32, object_identity, integer32, notification_type, ip_address, mib_identifier, time_ticks, mib_scalar, mib_table, mib_table_row, mib_table_column, iso, counter64, gauge32, bits) = mibBuilder.importSymbols('SNMPv2-SMI', 'ModuleIdentity', 'Counter32', 'Unsigned32', 'ObjectIdentity', 'Integer32', 'NotificationType', 'IpAddress', 'MibIdentifier', 'TimeTicks', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'iso', 'Counter64', 'Gauge32', 'Bits')
(textual_convention, display_string) = mibBuilder.importSymbols('SNMPv2-TC', 'TextualConvention', 'DisplayString')
b_ipmib = module_identity((1, 3, 6, 1, 4, 1, 39406, 1, 6))
bIPMIB.setRevisions(('2014-12-17 00:00', '2013-11-28 00:00', '2013-05-31 00:00'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts:
bIPMIB.setRevisionsDescriptions(('updated MIB file with change in bIPNotifObjects', 'Marked bIPPortTxFramesWoErrExclPausFrame as deprecated as it is not supported. Removed unnecessary IMPORTS and added missing. Also, Changed SYNTAX of bIPPortIndex from Integer32 to Unsigned32.', 'Initial Version'))
if mibBuilder.loadTexts:
bIPMIB.setLastUpdated('201412170000Z')
if mibBuilder.loadTexts:
bIPMIB.setOrganization('Benu Networks')
if mibBuilder.loadTexts:
bIPMIB.setContactInfo('Benu Networks Inc, 300 Concord Road, Billerca MA 01821 Email: [email protected]')
if mibBuilder.loadTexts:
bIPMIB.setDescription('This MIB module defines IP utilization statistics. Copyright (C) 2001, 2008 by Benu Networks, Inc. All rights reserved.')
b_ipmib_objects = object_identity((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1))
if mibBuilder.loadTexts:
bIPMIBObjects.setStatus('current')
if mibBuilder.loadTexts:
bIPMIBObjects.setDescription('MIB objects for IP utilization statistics are defined in this branch.')
b_ip_notif_objects = object_identity((1, 3, 6, 1, 4, 1, 39406, 1, 6, 0))
if mibBuilder.loadTexts:
bIPNotifObjects.setStatus('current')
if mibBuilder.loadTexts:
bIPNotifObjects.setDescription('Notifications of IP utilization statistics are defined in this branch.')
b_ip_port_table = mib_table((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1))
if mibBuilder.loadTexts:
bIPPortTable.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTable.setDescription('The table of IP utilization performance metrics of each interface.')
b_ip_port_entry = mib_table_row((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1)).setIndexNames((0, 'BENU-IP-MIB', 'bIPPortIndex'))
if mibBuilder.loadTexts:
bIPPortEntry.setStatus('current')
if mibBuilder.loadTexts:
bIPPortEntry.setDescription('An entry containing IP utilization performance metrics for each interface.')
b_ip_port_index = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 1), unsigned32())
if mibBuilder.loadTexts:
bIPPortIndex.setStatus('current')
if mibBuilder.loadTexts:
bIPPortIndex.setDescription('Interface index of the port This will be similar to ifIndex of IF-MIB.')
b_ip_port_interface_name = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortInterfaceName.setStatus('current')
if mibBuilder.loadTexts:
bIPPortInterfaceName.setDescription('Name of the interface associated with this port.')
b_ip_port_tx_bytes_in_frame_wo_err = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 3), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxBytesInFrameWoErr.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxBytesInFrameWoErr.setDescription('Total bytes transmitted without errors.')
b_ip_port_tx_frames_wo_err_excl_paus_frame = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 4), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxFramesWoErrExclPausFrame.setStatus('deprecated')
if mibBuilder.loadTexts:
bIPPortTxFramesWoErrExclPausFrame.setDescription('Total frames transmitted without errors excluding pause frames.')
b_ip_port_tx_bcast_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 5), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxBcastFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxBcastFrames.setDescription('Total broadcast frames transmitted.')
b_ip_port_tx_l2_mcast_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 6), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxL2McastFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxL2McastFrames.setDescription('Total Layer 2 multicast frames transmitted.')
b_ip_port_tx_paus_frame = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 7), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxPausFrame.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxPausFrame.setDescription('Total broadcast frames transmitted.')
b_ip_port_tx64byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 8), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx64byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx64byteFrames.setDescription('Total 64-byte frames transmitted.')
b_ip_port_tx65to127byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 9), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx65to127byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx65to127byteFrames.setDescription('Total 65 to 127-byte frames transmitted.')
b_ip_port_tx128to255byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 10), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx128to255byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx128to255byteFrames.setDescription('Total 128 to 255-byte frames transmitted.')
b_ip_port_tx256to511byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 11), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx256to511byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx256to511byteFrames.setDescription('Total 256 to 511-byte frames transmitted.')
b_ip_port_tx512to1023byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 12), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx512to1023byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx512to1023byteFrames.setDescription('Total 512 to 1023-byte frames transmitted.')
b_ip_port_tx1024to1518byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 13), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx1024to1518byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx1024to1518byteFrames.setDescription('Total 1024 to 1518-byte frames transmitted.')
b_ip_port_tx1519to1522byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 14), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx1519to1522byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx1519to1522byteFrames.setDescription('Total 1519 to 1522-byte frames transmitted.')
b_ip_port_tx1523to_max_byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 15), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx1523toMaxByteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx1523toMaxByteFrames.setDescription('Total 1523 to Max-byte frames transmitted.')
b_ip_port_tx17to63byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 16), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTx17to63byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTx17to63byteFrames.setDescription('Total 17 to 63-byte frames transmitted.')
b_ip_port_tx_bad_fcs_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 17), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortTxBadFcsFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortTxBadFcsFrames.setDescription('Total bad FCS frames transmitted.')
b_ip_port_rx_bytes_in_frame_wo_err = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 18), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxBytesInFrameWoErr.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxBytesInFrameWoErr.setDescription('Total bytes received without errors.')
b_ip_port_rx_bcast_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 19), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxBcastFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxBcastFrames.setDescription('Total broadcast frames received.')
b_ip_port_rx_l2_mcast_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 20), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxL2McastFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxL2McastFrames.setDescription('Total multicase frames received.')
b_ip_port_rx_paus_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 21), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxPausFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxPausFrames.setDescription('Total pause frames received.')
b_ip_port_rx64byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 22), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx64byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx64byteFrames.setDescription('Total 64-byte frames received.')
b_ip_port_rx65to127byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 23), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx65to127byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx65to127byteFrames.setDescription('Total 65 to 127-byte frames received.')
b_ip_port_rx128to255byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 24), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx128to255byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx128to255byteFrames.setDescription('Total 128 to 255-byte frames received.')
b_ip_port_rx256to511byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 25), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx256to511byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx256to511byteFrames.setDescription('Total 256 to 511-byte frames received.')
b_ip_port_rx512to1023byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 26), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx512to1023byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx512to1023byteFrames.setDescription('Total 512 to 1023-byte frames received.')
b_ip_port_rx1024to1518byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 27), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx1024to1518byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx1024to1518byteFrames.setDescription('Total 1024 to 1518-byte frames received.')
b_ip_port_rx1519to1522byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 28), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx1519to1522byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx1519to1522byteFrames.setDescription('Total 1519 to 1522-byte frames received.')
b_ip_port_rx1523to10368byte_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 29), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRx1523to10368byteFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRx1523to10368byteFrames.setDescription('Total 1523 to 10368-byte frames received.')
b_ip_port_rx_short_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 30), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxShortFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxShortFrames.setDescription('Total short frames received.')
b_ip_port_rx_jabber_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 31), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxJabberFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxJabberFrames.setDescription('Total jabber frames received.')
b_ip_port_rx_ovr_sz_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 32), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxOvrSzFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxOvrSzFrames.setDescription('Total oversize frames received.')
b_ip_port_rx_len_fld_err_frames = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 33), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxLenFldErrFrames.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxLenFldErrFrames.setDescription('Total length field error frames received.')
b_ip_port_rx_symb_errs = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 34), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxSymbErrs.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxSymbErrs.setDescription('Total symbol error frames received.')
b_ip_port_rx_intr_pkt_junk = mib_table_column((1, 3, 6, 1, 4, 1, 39406, 1, 6, 1, 1, 1, 35), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
bIPPortRxIntrPktJunk.setStatus('current')
if mibBuilder.loadTexts:
bIPPortRxIntrPktJunk.setDescription('Total inter packet junk error frames received.')
mibBuilder.exportSymbols('BENU-IP-MIB', bIPPortTx64byteFrames=bIPPortTx64byteFrames, bIPPortRxJabberFrames=bIPPortRxJabberFrames, bIPPortIndex=bIPPortIndex, bIPPortTx65to127byteFrames=bIPPortTx65to127byteFrames, bIPPortTx1523toMaxByteFrames=bIPPortTx1523toMaxByteFrames, bIPPortTxFramesWoErrExclPausFrame=bIPPortTxFramesWoErrExclPausFrame, bIPPortTxL2McastFrames=bIPPortTxL2McastFrames, PYSNMP_MODULE_ID=bIPMIB, bIPPortRxSymbErrs=bIPPortRxSymbErrs, bIPPortRx512to1023byteFrames=bIPPortRx512to1023byteFrames, bIPPortRx256to511byteFrames=bIPPortRx256to511byteFrames, bIPPortRx65to127byteFrames=bIPPortRx65to127byteFrames, bIPPortRxLenFldErrFrames=bIPPortRxLenFldErrFrames, bIPNotifObjects=bIPNotifObjects, bIPPortTxBadFcsFrames=bIPPortTxBadFcsFrames, bIPPortRx1024to1518byteFrames=bIPPortRx1024to1518byteFrames, bIPPortRx128to255byteFrames=bIPPortRx128to255byteFrames, bIPPortRxOvrSzFrames=bIPPortRxOvrSzFrames, bIPPortRxPausFrames=bIPPortRxPausFrames, bIPPortTx1024to1518byteFrames=bIPPortTx1024to1518byteFrames, bIPPortRxBytesInFrameWoErr=bIPPortRxBytesInFrameWoErr, bIPPortTx17to63byteFrames=bIPPortTx17to63byteFrames, bIPPortRx1519to1522byteFrames=bIPPortRx1519to1522byteFrames, bIPPortRxBcastFrames=bIPPortRxBcastFrames, bIPPortTable=bIPPortTable, bIPPortTx1519to1522byteFrames=bIPPortTx1519to1522byteFrames, bIPPortTxBcastFrames=bIPPortTxBcastFrames, bIPPortRxShortFrames=bIPPortRxShortFrames, bIPPortTx128to255byteFrames=bIPPortTx128to255byteFrames, bIPMIBObjects=bIPMIBObjects, bIPPortTx512to1023byteFrames=bIPPortTx512to1023byteFrames, bIPPortEntry=bIPPortEntry, bIPPortTx256to511byteFrames=bIPPortTx256to511byteFrames, bIPPortRx64byteFrames=bIPPortRx64byteFrames, bIPPortRx1523to10368byteFrames=bIPPortRx1523to10368byteFrames, bIPPortInterfaceName=bIPPortInterfaceName, bIPMIB=bIPMIB, bIPPortRxIntrPktJunk=bIPPortRxIntrPktJunk, bIPPortRxL2McastFrames=bIPPortRxL2McastFrames, bIPPortTxBytesInFrameWoErr=bIPPortTxBytesInFrameWoErr, bIPPortTxPausFrame=bIPPortTxPausFrame)
|
"""This problem was asked by Pinterest.
At a party, there is a single person who everyone knows, but who does not
know anyone in return (the "celebrity"). To help figure out who this is,
you have access to an O(1) method called knows(a, b), which returns True
if person a knows person b, else False.
Given a list of N people and the above operation,
find a way to identify the celebrity in O(N) time.
"""
|
"""This problem was asked by Pinterest.
At a party, there is a single person who everyone knows, but who does not
know anyone in return (the "celebrity"). To help figure out who this is,
you have access to an O(1) method called knows(a, b), which returns True
if person a knows person b, else False.
Given a list of N people and the above operation,
find a way to identify the celebrity in O(N) time.
"""
|
class Item:
def __init__(self, name, price, rarity, typ):
self.__name = name
self.__price = price
self.__rarity = rarity
self.__typ = typ
def getName(self):
return self.__name
def setName(self, name):
self.__name = name
def getPrice(self):
return self.__price
def setPrice(self, price):
self.__price = price
def getRarity(self):
return self.__rarity
def setRarity(self, rarity):
self.__rarity = rarity
def getType(self):
return self.__typ
def setType(self, typ):
self.__typ = typ
|
class Item:
def __init__(self, name, price, rarity, typ):
self.__name = name
self.__price = price
self.__rarity = rarity
self.__typ = typ
def get_name(self):
return self.__name
def set_name(self, name):
self.__name = name
def get_price(self):
return self.__price
def set_price(self, price):
self.__price = price
def get_rarity(self):
return self.__rarity
def set_rarity(self, rarity):
self.__rarity = rarity
def get_type(self):
return self.__typ
def set_type(self, typ):
self.__typ = typ
|
def hex2int(hex_str):
"""
Convert hex characters (e.g. "23" or "011a") to int (35 or 282)
:param hex_str: hex character string
:return: int integer
"""
return int(hex_str, 16)
def hex2value10(hex_str):
"""
Convert 2 hex characters (e.g. "23") to float (3.5)
:param hex_str: hex character string
:return: float value
"""
return hex2int(hex_str) / 10.0
def parse_aqburk(hex_str, port=None):
"""
Parse payload like "2a2a0021002c002800300056003b0000" float values
:param hex_str: AQLoRaBurk hex payload
:param port: LoRaWAN port
:return: dict containing float values
"""
data = {
'pm25min': hex2value10(hex_str[4:8]),
'pm25max': hex2value10(hex_str[8:12]),
'pm25avg': hex2value10(hex_str[12:16]),
'pm25med': hex2value10(hex_str[16:20]),
'pm10min': hex2value10(hex_str[20:24]),
'pm10max': hex2value10(hex_str[24:28]),
'pm10avg': hex2value10(hex_str[28:32]),
'pm10med': hex2value10(hex_str[32:36]),
}
if len(hex_str) == 52:
data['temp'] = round(hex2value10(hex_str[36:40]) - 100, 1)
data['humi'] = hex2value10(hex_str[40:44])
data['pres'] = hex2value10(hex_str[44:48])
data['gas'] = hex2value10(hex_str[48:52])
return data
|
def hex2int(hex_str):
"""
Convert hex characters (e.g. "23" or "011a") to int (35 or 282)
:param hex_str: hex character string
:return: int integer
"""
return int(hex_str, 16)
def hex2value10(hex_str):
"""
Convert 2 hex characters (e.g. "23") to float (3.5)
:param hex_str: hex character string
:return: float value
"""
return hex2int(hex_str) / 10.0
def parse_aqburk(hex_str, port=None):
"""
Parse payload like "2a2a0021002c002800300056003b0000" float values
:param hex_str: AQLoRaBurk hex payload
:param port: LoRaWAN port
:return: dict containing float values
"""
data = {'pm25min': hex2value10(hex_str[4:8]), 'pm25max': hex2value10(hex_str[8:12]), 'pm25avg': hex2value10(hex_str[12:16]), 'pm25med': hex2value10(hex_str[16:20]), 'pm10min': hex2value10(hex_str[20:24]), 'pm10max': hex2value10(hex_str[24:28]), 'pm10avg': hex2value10(hex_str[28:32]), 'pm10med': hex2value10(hex_str[32:36])}
if len(hex_str) == 52:
data['temp'] = round(hex2value10(hex_str[36:40]) - 100, 1)
data['humi'] = hex2value10(hex_str[40:44])
data['pres'] = hex2value10(hex_str[44:48])
data['gas'] = hex2value10(hex_str[48:52])
return data
|
class Quantity(object):
def __get__(self, instance, owner):
return getattr(instance, self.target_name)
def __set__(self, instance, value):
if not hasattr(self, 'target_name'):
self.set_target_names(instance)
if value > 0:
setattr(instance, self.target_name, value)
else:
raise ValueError('value must be > 0')
def set_target_names(self, instance, owner=None):
owner = owner if owner else instance.__class__
for key, attr in owner.__dict__.items():
if hasattr(attr, 'set_target_names'):
setattr(attr, 'target_name', '_%s__%s' % (owner.__name__, key))
class LineItem(object):
weight = Quantity()
price = Quantity()
def __init__(self, description, weight, price):
self.description = description
self.weight = weight
self.price = price
def subtotal(self):
return self.weight * self.price
|
class Quantity(object):
def __get__(self, instance, owner):
return getattr(instance, self.target_name)
def __set__(self, instance, value):
if not hasattr(self, 'target_name'):
self.set_target_names(instance)
if value > 0:
setattr(instance, self.target_name, value)
else:
raise value_error('value must be > 0')
def set_target_names(self, instance, owner=None):
owner = owner if owner else instance.__class__
for (key, attr) in owner.__dict__.items():
if hasattr(attr, 'set_target_names'):
setattr(attr, 'target_name', '_%s__%s' % (owner.__name__, key))
class Lineitem(object):
weight = quantity()
price = quantity()
def __init__(self, description, weight, price):
self.description = description
self.weight = weight
self.price = price
def subtotal(self):
return self.weight * self.price
|
def sort_012(inputList):
next0 = 0
next2 = len(inputList) - 1
frontIndex = 0
while frontIndex <= next2:
if inputList[frontIndex] is 0:
inputList[frontIndex] = inputList[next0]
inputList[next0] = 0
next0 += 1
frontIndex += 1
elif inputList[frontIndex] == 2:
inputList[frontIndex] = inputList[next2]
inputList[next2] = 2
next2 -= 1
else:
frontIndex += 1
return inputList
print(sort_012([0, 0, 2, 2, 2, 1, 1, 1, 2, 0, 2]));
# 0, 0, 0, 1, 1, 1, 2, 2, 2, 2, 2]
print(sort_012([1,0]));
# [0, 1]
print(sort_012([]));
# []
|
def sort_012(inputList):
next0 = 0
next2 = len(inputList) - 1
front_index = 0
while frontIndex <= next2:
if inputList[frontIndex] is 0:
inputList[frontIndex] = inputList[next0]
inputList[next0] = 0
next0 += 1
front_index += 1
elif inputList[frontIndex] == 2:
inputList[frontIndex] = inputList[next2]
inputList[next2] = 2
next2 -= 1
else:
front_index += 1
return inputList
print(sort_012([0, 0, 2, 2, 2, 1, 1, 1, 2, 0, 2]))
print(sort_012([1, 0]))
print(sort_012([]))
|
class Node:
def __init__(self, data):
self.data = data
self.left = None
self.right = None
def __repr__(self):
if type(self.data) != 'str':
return str(self.data)
return self.data
def inorder(root, is_last_node=False):
if root:
inorder(root.left)
print('{}->'.format(root), end='')
inorder(root.right)
return
def preorder(root):
if root:
print('{}->'.format(root), end='')
preorder(root.left)
preorder(root.right)
return
def postorder(root):
if root:
postorder(root.left)
postorder(root.right)
print('{}->'.format(root), end='')
return
def level_order(root):
if root is None:
return
queue = []
queue.append(root)
while(len(queue) > 0):
print(queue[0].data, end=' ')
node = queue.pop(0)
if node.left is not None:
queue.append(node.left)
if node.right is not None:
queue.append(node.right)
return
def build_tree_one():
root = Node(1)
root.left = Node(2)
root.right = Node(3)
root.left.left = Node(4)
root.left.right = Node(5)
return root
def build_tree_two():
root = Node(1)
root.left = Node(12)
root.right = Node(9)
root.left.left = Node(5)
root.left.right = Node(6)
return root
if __name__ == '__main__':
tree_one = build_tree_one()
print('*** Tree One ***')
print('Inorder Traversal')
inorder(tree_one)
print('\nPreorder Traversal')
preorder(tree_one)
print('\nPostorder Traversal')
postorder(tree_one)
print('\nLevel Order Traversal')
level_order(tree_one)
tree_two = build_tree_two()
print('\n\n*** Tree Two ***')
print('Inorder Traversal')
inorder(tree_two)
print('\nPreorder Traversal')
preorder(tree_two)
print('\nPostorder Traversal')
postorder(tree_two)
print('\nLevel Order Traversal')
level_order(tree_two)
|
class Node:
def __init__(self, data):
self.data = data
self.left = None
self.right = None
def __repr__(self):
if type(self.data) != 'str':
return str(self.data)
return self.data
def inorder(root, is_last_node=False):
if root:
inorder(root.left)
print('{}->'.format(root), end='')
inorder(root.right)
return
def preorder(root):
if root:
print('{}->'.format(root), end='')
preorder(root.left)
preorder(root.right)
return
def postorder(root):
if root:
postorder(root.left)
postorder(root.right)
print('{}->'.format(root), end='')
return
def level_order(root):
if root is None:
return
queue = []
queue.append(root)
while len(queue) > 0:
print(queue[0].data, end=' ')
node = queue.pop(0)
if node.left is not None:
queue.append(node.left)
if node.right is not None:
queue.append(node.right)
return
def build_tree_one():
root = node(1)
root.left = node(2)
root.right = node(3)
root.left.left = node(4)
root.left.right = node(5)
return root
def build_tree_two():
root = node(1)
root.left = node(12)
root.right = node(9)
root.left.left = node(5)
root.left.right = node(6)
return root
if __name__ == '__main__':
tree_one = build_tree_one()
print('*** Tree One ***')
print('Inorder Traversal')
inorder(tree_one)
print('\nPreorder Traversal')
preorder(tree_one)
print('\nPostorder Traversal')
postorder(tree_one)
print('\nLevel Order Traversal')
level_order(tree_one)
tree_two = build_tree_two()
print('\n\n*** Tree Two ***')
print('Inorder Traversal')
inorder(tree_two)
print('\nPreorder Traversal')
preorder(tree_two)
print('\nPostorder Traversal')
postorder(tree_two)
print('\nLevel Order Traversal')
level_order(tree_two)
|
class Credentials:
"""
Class that generates new instances of credentials.
"""
credentials_list = []
def __init__(self,account_name, username, password):
"""
__init__method to help us create new instances of the class credentials
"""
self.account_name = account_name
self.username = username
self.password = password
def save_account(self):
"""Method to save new account to the credentials_list"""
Credentials.credentials_list.append(self)
@classmethod
def account_exist(cls, username):
'''
Method that checks if an account exists from the credentials list.
Returns :
Boolean: True or false depending if the account exists
'''
for Credentials in cls.credentials_list:
if Credentials.username == username:
return True
return False
@classmethod
def find_by_account_name(cls, account_name):
"""
method to search account by account name
"""
for account in cls.credentials_list:
if account.account_name == account_name:
return account
def delete_account(self):
'''
method to delete a saved account credentials from the credentials_list
'''
Credentials.credentials_list.remove(self)
@classmethod
def display_account(cls):
'''
method that returns the credentials list
'''
return cls.credentials_list
|
class Credentials:
"""
Class that generates new instances of credentials.
"""
credentials_list = []
def __init__(self, account_name, username, password):
"""
__init__method to help us create new instances of the class credentials
"""
self.account_name = account_name
self.username = username
self.password = password
def save_account(self):
"""Method to save new account to the credentials_list"""
Credentials.credentials_list.append(self)
@classmethod
def account_exist(cls, username):
"""
Method that checks if an account exists from the credentials list.
Returns :
Boolean: True or false depending if the account exists
"""
for credentials in cls.credentials_list:
if Credentials.username == username:
return True
return False
@classmethod
def find_by_account_name(cls, account_name):
"""
method to search account by account name
"""
for account in cls.credentials_list:
if account.account_name == account_name:
return account
def delete_account(self):
"""
method to delete a saved account credentials from the credentials_list
"""
Credentials.credentials_list.remove(self)
@classmethod
def display_account(cls):
"""
method that returns the credentials list
"""
return cls.credentials_list
|
sum=0
for i in range(5):
a=int(input())
if a<40:
a=40
sum+=a
print(sum//5)
|
sum = 0
for i in range(5):
a = int(input())
if a < 40:
a = 40
sum += a
print(sum // 5)
|
# Some constants to work for https://github.com/Di-Ny/LoRaPacketForwarderDomoticzConfigurator
#
# Author: DiNy
###########
## Global
GW_UNIT_ID=10
###########
## LORA
DR_2_SFBW_EU868 = {
"0":["12","125.0","5"],
"1":["11","125.0","5"],
"2":["10","125.0","5"],
"3":["9","125.0","5"],
"4":["8","125.0","5"],
"5":["7","125.0","5"],
"6":["7","250.0","5"],
"7":["12","125.0","7"],
"8":["12","62.5","5"],
"9":["12","62.5","7"],
"10":["12","31.25","5"],
"11":["12","31.25","7"],
"12":["10","125.0","7"],
"13":["10","62.5","5"],
"14":["10","62.5","7"],
"15":["8","62.5","5"]
}
|
gw_unit_id = 10
dr_2_sfbw_eu868 = {'0': ['12', '125.0', '5'], '1': ['11', '125.0', '5'], '2': ['10', '125.0', '5'], '3': ['9', '125.0', '5'], '4': ['8', '125.0', '5'], '5': ['7', '125.0', '5'], '6': ['7', '250.0', '5'], '7': ['12', '125.0', '7'], '8': ['12', '62.5', '5'], '9': ['12', '62.5', '7'], '10': ['12', '31.25', '5'], '11': ['12', '31.25', '7'], '12': ['10', '125.0', '7'], '13': ['10', '62.5', '5'], '14': ['10', '62.5', '7'], '15': ['8', '62.5', '5']}
|
# Login information for the 6.034 Automated Tester
USERNAME="lcchiang_MIT_EDU"
PASSWORD="yu7Q4nPJNRALMY3AJ6ze"
XMLRPC_URL="https://ai6034.mit.edu/labs/xmlrpc/"
|
username = 'lcchiang_MIT_EDU'
password = 'yu7Q4nPJNRALMY3AJ6ze'
xmlrpc_url = 'https://ai6034.mit.edu/labs/xmlrpc/'
|
ENDPOINT = "https://en.wikipedia.org/w/api.php"
def make_url(id, is_expanded=False, is_html=False):
# TODO: isdigit is not robust enough, title could be number instead of string
return make_id_url(id, is_expanded, is_html) if str(id).isdigit() else make_title_url(id, is_expanded, is_html)
def make_title_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + "?action=query&titles=" + url_safe_spaces(str(id)) + "&prop=revisions|pageprops&rvprop=content&format=json"
if is_expanded:
url += "&rvexpandtemplates"
if is_html:
url = ENDPOINT + "?format=json&rvprop=content&prop=revisions&rvparse=&titles=" + url_safe_spaces(str(id)) + "&rvlimit=1&action=query"
return url
def make_id_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + "?action=query&pageids=" + url_safe_spaces(str(id)) + "&prop=revisions|pageprops&rvprop=content&format=json"
if is_expanded:
url += "&rvexpandtemplates"
if is_html:
url = ENDPOINT + "?format=json&rvprop=content&prop=revisions&rvparse=&pageids=" + url_safe_spaces(str(id)) + "&rvlimit=1&action=query"
return url
def url_safe_spaces(text):
return text.replace(" ", "%20")
|
endpoint = 'https://en.wikipedia.org/w/api.php'
def make_url(id, is_expanded=False, is_html=False):
return make_id_url(id, is_expanded, is_html) if str(id).isdigit() else make_title_url(id, is_expanded, is_html)
def make_title_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + '?action=query&titles=' + url_safe_spaces(str(id)) + '&prop=revisions|pageprops&rvprop=content&format=json'
if is_expanded:
url += '&rvexpandtemplates'
if is_html:
url = ENDPOINT + '?format=json&rvprop=content&prop=revisions&rvparse=&titles=' + url_safe_spaces(str(id)) + '&rvlimit=1&action=query'
return url
def make_id_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + '?action=query&pageids=' + url_safe_spaces(str(id)) + '&prop=revisions|pageprops&rvprop=content&format=json'
if is_expanded:
url += '&rvexpandtemplates'
if is_html:
url = ENDPOINT + '?format=json&rvprop=content&prop=revisions&rvparse=&pageids=' + url_safe_spaces(str(id)) + '&rvlimit=1&action=query'
return url
def url_safe_spaces(text):
return text.replace(' ', '%20')
|
#!/usr/bin/python3
def main():
buffersize = 50000
infile = open('obama.png', 'rb')
outfile = open('obama-copy.png', 'wb')
buffer = infile.read(buffersize)
while len(buffer):
outfile.write(buffer)
print('.', end = '')
buffer = infile.read(buffersize)
print()
print('Done.')
if __name__ == "__main__": main()
|
def main():
buffersize = 50000
infile = open('obama.png', 'rb')
outfile = open('obama-copy.png', 'wb')
buffer = infile.read(buffersize)
while len(buffer):
outfile.write(buffer)
print('.', end='')
buffer = infile.read(buffersize)
print()
print('Done.')
if __name__ == '__main__':
main()
|
a, b, c = sorted(list(map(float, input().split())))
if(((a+b) > c)and((c-a) < b)):
print('It is a triangle.')
if(((a**2)+(b**2)) == (c**2)):
print('-> also a Right triangle.')
if(not(a-b)):
print('-> Wow it\'s a Isosceles right triangle!')
else:
print('not a triangle.')
|
(a, b, c) = sorted(list(map(float, input().split())))
if a + b > c and c - a < b:
print('It is a triangle.')
if a ** 2 + b ** 2 == c ** 2:
print('-> also a Right triangle.')
if not a - b:
print("-> Wow it's a Isosceles right triangle!")
else:
print('not a triangle.')
|
def alternating(list_of_ints):
pass
print(alternating([1, 2, 3, 4]))
print(alternating([10, 11, 1, 12]))
print(alternating([10, 21, 22, -5, 100, 101, 2]))
|
def alternating(list_of_ints):
pass
print(alternating([1, 2, 3, 4]))
print(alternating([10, 11, 1, 12]))
print(alternating([10, 21, 22, -5, 100, 101, 2]))
|
DEVICE_NAME = '00002a00-0000-1000-8000-00805f9b34fb'
MODEL_NUMBER = '00002a24-0000-1000-8000-00805f9b34fb'
SERIAL_NUMBER = '00002a25-0000-1000-8000-00805f9b34fb'
FIRMWARE_VERSION = '00002a26-0000-1000-8000-00805f9b34fb'
HARDWARE_VERSION = '00002a27-0000-1000-8000-00805f9b34fb'
MANUFACTURER_NAME = '00002a29-0000-1000-8000-00805f9b34fb'
LYWSD02_DATA = 'EBE0CCC1-7A0A-4B0C-8A1A-6FF2997DA3A6'
CGG_DATA = '00000100-0000-1000-8000-00805f9b34fb'
MJHT_DATA = '00000001-0000-1000-8000-00805f9b34fb'
MJHT_BATTERY = '00002a19-0000-1000-8000-00805f9b34fb'
|
device_name = '00002a00-0000-1000-8000-00805f9b34fb'
model_number = '00002a24-0000-1000-8000-00805f9b34fb'
serial_number = '00002a25-0000-1000-8000-00805f9b34fb'
firmware_version = '00002a26-0000-1000-8000-00805f9b34fb'
hardware_version = '00002a27-0000-1000-8000-00805f9b34fb'
manufacturer_name = '00002a29-0000-1000-8000-00805f9b34fb'
lywsd02_data = 'EBE0CCC1-7A0A-4B0C-8A1A-6FF2997DA3A6'
cgg_data = '00000100-0000-1000-8000-00805f9b34fb'
mjht_data = '00000001-0000-1000-8000-00805f9b34fb'
mjht_battery = '00002a19-0000-1000-8000-00805f9b34fb'
|
pkgname = "libusbmuxd"
pkgver = "2.0.2"
pkgrel = 0
build_style = "gnu_configure"
hostmakedepends = ["pkgconf", "automake", "libtool"]
makedepends = ["libusb-devel", "libplist-devel"]
pkgdesc = "Client library to multiplex connections to/from iOS devices"
maintainer = "q66 <[email protected]>"
license = "LGPL-2.1-only"
url = "https://libimobiledevice.org"
source = f"https://github.com/libimobiledevice/{pkgname}/archive/{pkgver}.tar.gz"
sha256 = "8ae3e1d9340177f8f3a785be276435869363de79f491d05d8a84a59efc8a8fdc"
def pre_configure(self):
self.do("autoreconf", "-if")
@subpackage("libusbmuxd-devel")
def _devel(self):
return self.default_devel()
@subpackage("libusbmuxd-progs")
def _progs(self):
return self.default_progs()
|
pkgname = 'libusbmuxd'
pkgver = '2.0.2'
pkgrel = 0
build_style = 'gnu_configure'
hostmakedepends = ['pkgconf', 'automake', 'libtool']
makedepends = ['libusb-devel', 'libplist-devel']
pkgdesc = 'Client library to multiplex connections to/from iOS devices'
maintainer = 'q66 <[email protected]>'
license = 'LGPL-2.1-only'
url = 'https://libimobiledevice.org'
source = f'https://github.com/libimobiledevice/{pkgname}/archive/{pkgver}.tar.gz'
sha256 = '8ae3e1d9340177f8f3a785be276435869363de79f491d05d8a84a59efc8a8fdc'
def pre_configure(self):
self.do('autoreconf', '-if')
@subpackage('libusbmuxd-devel')
def _devel(self):
return self.default_devel()
@subpackage('libusbmuxd-progs')
def _progs(self):
return self.default_progs()
|
def main():
return 'THIS_IS_MAIN_MAIN'
def func():
return 'THIS_IS_MAIN_FUNC'
|
def main():
return 'THIS_IS_MAIN_MAIN'
def func():
return 'THIS_IS_MAIN_FUNC'
|
"""
Boolean Data Type(bool):
- Only be True or False
- None is false
- All numbers are True, except 0.
- All strings are True, except Empty strings. ie ""
- All Collections(list, tuple, set, and dictionary) are True, except Empty ones.ie. (), [], {},
- Objects from a class with a __len__ function that returns 0 is always false
"""
# Empty, 0 or null value are False Values
print(bool(None)) # Null
print(bool(False)) # false
print(bool(0)) # 0 Number
print(bool("")) # empty String
print(bool(())) # empty Tuple
print(bool([])) # empty List
print(bool({})) # empty Dictionary
# Class with__len__ returning 0 is False
class TestClass():
def __len__(self):
return 0
testObj = TestClass()
# Can use to assert if its empty, null or return 0 in __len__
if bool(testObj):
print("Object is True ", bool(testObj),"\n")
else:
print("Object is False ", bool(testObj), "\n")
print(bool(True)) # True
print(bool(2.75)) # Non 0 Number
print(bool("Hitesh")) # Non empty String
print(bool(('Hitesh', 'Sahu'))) # Non empty Tuple
print(bool(['Hitesh', 'Sahu'])) # Non empty List
print(bool({'firstName':'Hitesh',
'lastName': 'Sahu'})) # Nonempty Dictionary
|
"""
Boolean Data Type(bool):
- Only be True or False
- None is false
- All numbers are True, except 0.
- All strings are True, except Empty strings. ie ""
- All Collections(list, tuple, set, and dictionary) are True, except Empty ones.ie. (), [], {},
- Objects from a class with a __len__ function that returns 0 is always false
"""
print(bool(None))
print(bool(False))
print(bool(0))
print(bool(''))
print(bool(()))
print(bool([]))
print(bool({}))
class Testclass:
def __len__(self):
return 0
test_obj = test_class()
if bool(testObj):
print('Object is True ', bool(testObj), '\n')
else:
print('Object is False ', bool(testObj), '\n')
print(bool(True))
print(bool(2.75))
print(bool('Hitesh'))
print(bool(('Hitesh', 'Sahu')))
print(bool(['Hitesh', 'Sahu']))
print(bool({'firstName': 'Hitesh', 'lastName': 'Sahu'}))
|
def get_msg_with_punctuations(old, new):
new_org_text = new
for i in range(len(old)):
if not str.isalpha(old[i]):
new_org_text = new_org_text[0:i] + old[i] + new_org_text[i:]
for i in range(len(old)):
if str.isupper(old[i]):
new_org_text = new_org_text[0:i] + str.upper(new_org_text[i]) + new_org_text[i + 1:]
return new_org_text
def get_alphabetic_msg(text):
normal = ''
for ch in text:
if str.isalpha(ch):
normal += ch
return normal
|
def get_msg_with_punctuations(old, new):
new_org_text = new
for i in range(len(old)):
if not str.isalpha(old[i]):
new_org_text = new_org_text[0:i] + old[i] + new_org_text[i:]
for i in range(len(old)):
if str.isupper(old[i]):
new_org_text = new_org_text[0:i] + str.upper(new_org_text[i]) + new_org_text[i + 1:]
return new_org_text
def get_alphabetic_msg(text):
normal = ''
for ch in text:
if str.isalpha(ch):
normal += ch
return normal
|
class Solution:
def lowestCommonAncestor(self, root, p, q):
if root is None or p == root or q == root:
return root
l = self.lowestCommonAncestor(root.left, p, q)
r = self.lowestCommonAncestor(root.right, p, q)
if l is None:
return r
if r is None:
return l
return root
|
class Solution:
def lowest_common_ancestor(self, root, p, q):
if root is None or p == root or q == root:
return root
l = self.lowestCommonAncestor(root.left, p, q)
r = self.lowestCommonAncestor(root.right, p, q)
if l is None:
return r
if r is None:
return l
return root
|
def Logo():
print("""
____________________ ______________ ____________
| | | | | @
| ____________| | ______ | | _______. #
| | | | | | | | | #
| | __________ | | | | | | | #
| | | | | | | | | | | $
| | | | | | | | | | | $
| | ------| | | | | | | | | #
| |________| | | ------ | | |______| @
|__________________| |____________| |__________@
""")
|
def logo():
print('\n____________________ ______________ ____________\n| | | | | @\n| ____________| | ______ | | _______. #\n| | | | | | | | | #\n| | __________ | | | | | | | #\n| | | | | | | | | | | $\n| | | | | | | | | | | $\n| | ------| | | | | | | | | #\n| |________| | | ------ | | |______| @\n|__________________| |____________| |__________@\n\n')
|
### This program subtracts ###
def minus(a, b):
sub = a - b
print(sub)
print("Welcome to subtracting your life version 1.0.0.0.0.0.0.1!")
x,y = input("Please input the digits of your life that you wish to subtract: ").split()
x = int(x)
y = int(y)
minus(x,y)
|
def minus(a, b):
sub = a - b
print(sub)
print('Welcome to subtracting your life version 1.0.0.0.0.0.0.1!')
(x, y) = input('Please input the digits of your life that you wish to subtract: ').split()
x = int(x)
y = int(y)
minus(x, y)
|
class XmlServiceTransport(object):
"""XMLSERVICE transport base class
Args:
ctl (str): XMLSERVICE control options, see
http://yips.idevcloud.com/wiki/index.php/XMLService/XMLSERVICEQuick#ctl
ipc (str): An XMLSERVICE ipc key for stateful conections, see
http://yips.idevcloud.com/wiki/index.php/XMLService/XMLSERVICEConnect
"""
def __init__(self, ctl="*here *cdata", ipc="*na"):
self.ipc = ipc
self.ctl = ctl
self.trace_attrs = ["ipc", "ctl"]
def trace_data(self):
output = ""
for i in self.trace_attrs:
if isinstance(i, tuple):
trace, attr = i
else:
trace = attr = i
output += " {}({})".format(trace, getattr(self, attr))
return output
def call(self, tk):
"""Call XMLSERVICE with accumulated actions
Args:
tk (iToolKit): An iToolkit object
Returns:
str: The XML returned from XMLSERVICE
"""
raise NotImplementedError
|
class Xmlservicetransport(object):
"""XMLSERVICE transport base class
Args:
ctl (str): XMLSERVICE control options, see
http://yips.idevcloud.com/wiki/index.php/XMLService/XMLSERVICEQuick#ctl
ipc (str): An XMLSERVICE ipc key for stateful conections, see
http://yips.idevcloud.com/wiki/index.php/XMLService/XMLSERVICEConnect
"""
def __init__(self, ctl='*here *cdata', ipc='*na'):
self.ipc = ipc
self.ctl = ctl
self.trace_attrs = ['ipc', 'ctl']
def trace_data(self):
output = ''
for i in self.trace_attrs:
if isinstance(i, tuple):
(trace, attr) = i
else:
trace = attr = i
output += ' {}({})'.format(trace, getattr(self, attr))
return output
def call(self, tk):
"""Call XMLSERVICE with accumulated actions
Args:
tk (iToolKit): An iToolkit object
Returns:
str: The XML returned from XMLSERVICE
"""
raise NotImplementedError
|
class ListNode:
def __init__(self, x):
self.val = x
self.next = None
class Solution:
def reverseList(self, head: ListNode) -> ListNode:
if head == None or head.next == None:
return head
next_node = head.next
head.next = None
while next_node:
next_next_node = next_node.next
next_node.next = head
head = next_node
next_node = next_next_node
return head
def reverseList_recursive(self, head: ListNode) -> ListNode:
if head.next == None:
return head
remaining = head.next
head.next = None
remaining = self.reverseList_recursive(remaining)
cur = remaining
while cur.next:
cur = cur.next
cur.next = head
return remaining
if __name__ == "__main__":
h = ListNode(1)
h.next = ListNode(2)
h.next.next = ListNode(3)
h.next.next.next = ListNode(4)
solu = Solution()
solu.reverseList_recursive(h)
|
class Listnode:
def __init__(self, x):
self.val = x
self.next = None
class Solution:
def reverse_list(self, head: ListNode) -> ListNode:
if head == None or head.next == None:
return head
next_node = head.next
head.next = None
while next_node:
next_next_node = next_node.next
next_node.next = head
head = next_node
next_node = next_next_node
return head
def reverse_list_recursive(self, head: ListNode) -> ListNode:
if head.next == None:
return head
remaining = head.next
head.next = None
remaining = self.reverseList_recursive(remaining)
cur = remaining
while cur.next:
cur = cur.next
cur.next = head
return remaining
if __name__ == '__main__':
h = list_node(1)
h.next = list_node(2)
h.next.next = list_node(3)
h.next.next.next = list_node(4)
solu = solution()
solu.reverseList_recursive(h)
|
def Cel():
celsius = float(input("Enter the temperature in Celsius ")) # It will take user input
fahrenheit :float = (celsius * 9 / 5) + 32 # calculation part
print("Value in Fahrenheit ", fahrenheit)
def Far():
fahrenheit = float(input("Enter the temperature in Fahrenheit ")) # It will take user input
celsius :float = (fahrenheit - 32) * 5 / 9 # calculation part
print(" Value in Celsius", celsius)
def condition():
cont=int(input((" Enter 1 to continue or else to exit ")))
if cont ==1:
main()
condition()
def main():
print(" To convert Temperatures")
choice=int(input("Enter 1 to convert Celsius to Fahrenheit 0r Enter 2 for vice versa "))
if choice ==1 :
Cel()
elif choice ==2 :
Far()
else :
print(' Wrong choice ')
return
main()
condition()
|
def cel():
celsius = float(input('Enter the temperature in Celsius '))
fahrenheit: float = celsius * 9 / 5 + 32
print('Value in Fahrenheit ', fahrenheit)
def far():
fahrenheit = float(input('Enter the temperature in Fahrenheit '))
celsius: float = (fahrenheit - 32) * 5 / 9
print(' Value in Celsius', celsius)
def condition():
cont = int(input(' Enter 1 to continue or else to exit '))
if cont == 1:
main()
condition()
def main():
print(' To convert Temperatures')
choice = int(input('Enter 1 to convert Celsius to Fahrenheit 0r Enter 2 for vice versa '))
if choice == 1:
cel()
elif choice == 2:
far()
else:
print(' Wrong choice ')
return
main()
condition()
|
#CP2
#Thomas Franceschi
#Kyle Williams
#import sys
class baseParser:
def __init__(self, expression, length, counter):
self.expression = expression #String being parsed
self.length = length #Max range for token
self.counter = counter #Token
self.M = '' #Output
def parseRegexp(self):
self.M = self.parseUnion()
if self.counter == self.length:
return self.M
else:
print('regex error, count: ' + str(self.counter) + ' length: ' + str(self.length))
return 1 #ERROR
def parseUnion(self):
self.M = self.parseConcat()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '|': #If next token is |
self.counter = self.counter + 1 #'read' |
self.M = self.union(self.M, self.parseConcat())
return self.M
def parseConcat(self):
if self.counter == self.length:
return self.epsilon()
if self.expression[self.counter] == '|' or self.expression[self.counter] == ')':
return self.epsilon()
else:
self.M = self.parseUnary()
while self.counter < self.length and self.expression[self.counter] != '|' and self.expression[self.counter] != ')':
self.M = self.concat(self.M, self.parseUnary())
return self.M
def parseUnary(self):
self.M = self.parsePrimary()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '*':
self.counter = self.counter + 1; #read *
return self.star(self.M)
else:
return self.M
def parsePrimary(self):
if self.expression[self.counter] == '(':
self.counter = self.counter + 1 #read (
self.M = self.parseUnion()
self.counter = self.counter + 1 #read )
return self.M
elif self.expression[self.counter] == '@':
self.counter = self.counter + 1 #read @
return self.emptyset()
elif self.expression[self.counter] != '(' and self.expression[self.counter] != ')' and self.expression[self.counter] != '*' and self.expression[self.counter] != '|':
a = self.expression[self.counter]
self.counter = self.counter + 1
return self.symbol(a)
else:
print('parse primary error')
return 1 #Error
#Placeholders
def emptyset(self):
return 'emptyset()'
def epsilon(self):
return 'epsilon()'
def symbol(self, a):
return 'symbol(' + str(a) + ')'
def union(self, M1, M2):
return 'union(' + str(M1) + ',' + str(M2) + ')'
def concat(self, M1,M2):
return 'concat(' + str(M1) + ',' + str(M2) + ')'
def star(self, M):
return 'star(' + M + ')'
if __name__ == "__main__":
#expression = '(ab|a)*'
length = len(expression)
counter = 0
parser = baseParser(expression, length, counter)
M = parser.parseRegexp()
print(M)
|
class Baseparser:
def __init__(self, expression, length, counter):
self.expression = expression
self.length = length
self.counter = counter
self.M = ''
def parse_regexp(self):
self.M = self.parseUnion()
if self.counter == self.length:
return self.M
else:
print('regex error, count: ' + str(self.counter) + ' length: ' + str(self.length))
return 1
def parse_union(self):
self.M = self.parseConcat()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '|':
self.counter = self.counter + 1
self.M = self.union(self.M, self.parseConcat())
return self.M
def parse_concat(self):
if self.counter == self.length:
return self.epsilon()
if self.expression[self.counter] == '|' or self.expression[self.counter] == ')':
return self.epsilon()
else:
self.M = self.parseUnary()
while self.counter < self.length and self.expression[self.counter] != '|' and (self.expression[self.counter] != ')'):
self.M = self.concat(self.M, self.parseUnary())
return self.M
def parse_unary(self):
self.M = self.parsePrimary()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '*':
self.counter = self.counter + 1
return self.star(self.M)
else:
return self.M
def parse_primary(self):
if self.expression[self.counter] == '(':
self.counter = self.counter + 1
self.M = self.parseUnion()
self.counter = self.counter + 1
return self.M
elif self.expression[self.counter] == '@':
self.counter = self.counter + 1
return self.emptyset()
elif self.expression[self.counter] != '(' and self.expression[self.counter] != ')' and (self.expression[self.counter] != '*') and (self.expression[self.counter] != '|'):
a = self.expression[self.counter]
self.counter = self.counter + 1
return self.symbol(a)
else:
print('parse primary error')
return 1
def emptyset(self):
return 'emptyset()'
def epsilon(self):
return 'epsilon()'
def symbol(self, a):
return 'symbol(' + str(a) + ')'
def union(self, M1, M2):
return 'union(' + str(M1) + ',' + str(M2) + ')'
def concat(self, M1, M2):
return 'concat(' + str(M1) + ',' + str(M2) + ')'
def star(self, M):
return 'star(' + M + ')'
if __name__ == '__main__':
length = len(expression)
counter = 0
parser = base_parser(expression, length, counter)
m = parser.parseRegexp()
print(M)
|
""" Problem Set 1 - Problem 3
Assume s is a string of lower case characters.
Write a program that prints the longest substring of s in which the letters occur in alphabetical order. For example, if s = 'azcbobobegghakl', then your program should print
Longest substring in alphabetical order is: beggh
In the case of ties, print the first substring. For example, if s = 'abcbcd', then your program should print
Longest substring in alphabetical order is: abc"""
# s = 'abcbcd'
maxLength = 0
current = s[0]
longest = s[0]
for i in range(len(s)-1):
if s[i + 1] >= s[i]:
current += s[i + 1]
print(current)
if len(current) > maxLength:
maxLength = len(current)
longest = current
else:
current = s[i+1]
i += 1
print ("Longest substring in alphabetical order is: " + longest)
|
""" Problem Set 1 - Problem 3
Assume s is a string of lower case characters.
Write a program that prints the longest substring of s in which the letters occur in alphabetical order. For example, if s = 'azcbobobegghakl', then your program should print
Longest substring in alphabetical order is: beggh
In the case of ties, print the first substring. For example, if s = 'abcbcd', then your program should print
Longest substring in alphabetical order is: abc"""
max_length = 0
current = s[0]
longest = s[0]
for i in range(len(s) - 1):
if s[i + 1] >= s[i]:
current += s[i + 1]
print(current)
if len(current) > maxLength:
max_length = len(current)
longest = current
else:
current = s[i + 1]
i += 1
print('Longest substring in alphabetical order is: ' + longest)
|
"""Simple example test."""
def test_simple():
"""Simple example test."""
assert True
|
"""Simple example test."""
def test_simple():
"""Simple example test."""
assert True
|
__all__ = [
'PrimaryStatus',
'InputStatus',
'OutputStatus',
'StopReason'
]
class PrimaryStatus:
QUEUING_CHECKS = "QUEUING_CHECKS"
# one of checks tasks has been started
CHECKING = "CHECKING"
# when all first level tasks has been finished
CHECKS_FINISHED = "CHECKS_FINISHED"
# It will be set outside of tasks,
# when CHECKS_FINISHED and not INPUTS_DOWNLOADING
QUEUING_INPUTS_DOWNLOADING = "QUEUING_INPUTS_DOWNLOADING"
# when one of checks tasks has been started
INPUTS_DOWNLOADING = "INPUTS_DOWNLOADING"
# when downloading all inputs has been finished
ALL_INPUTS_DOWNLOADED = "ALL_INPUTS_DOWNLOADED"
# It will be set outside of tasks,
# when ALL_INPUTS_DOWNLOADED and not QUEUING_OUTPUTS
QUEUING_OUTPUTS = "QUEUING_OUTPUTS"
# when one of level3 chains has been started
OUTPUTS_PROGRESSING = "OUTPUTS_PROGRESSING"
# when all outputs are finished
# means total_outputs == (ready_outputs + revoked_outputs + failed_outputs)
FINISHED = "FINISHED"
# when all outputs revoked
REVOKED = "REVOKED"
# when one of checks has been failed, one of inputs has been failed,
# or all outputs has been failed
FAILED = "FAILED"
class InputStatus:
# for every input
PREPARATION_DOWNLOAD = "PREPARATION_DOWNLOAD"
DOWNLOADING = "DOWNLOADING"
DOWNLOADING_FINISHED = "DOWNLOADING_FINISHED"
QUEUING_TO_ANALYZE = "QUEUING_TO_ANALYZE"
ANALYZING = "ANALYZING"
ANALYZING_FINISHED = "ANALYZING_FINISHED"
INPUT_REVOKED = "INPUT_REVOKED"
INPUT_FAILED = "INPUT_FAILED"
class OutputStatus:
# for every output
OUTPUT_REVOKED = "OUTPUT_REVOKED"
OUTPUT_FAILED = "OUTPUT_FAILED"
PREPARATION_PROCESSING = "PREPARATION_PROCESSING"
PROCESSING = "PROCESSING"
PROCESSING_FINISHED = "PROCESSING_FINISHED"
# It will be set outside of tasks,
# when PROCESSING_FINISHED and not UPLOADING
QUEUING_UPLOADING = "QUEUING_UPLOADING"
UPLOADING = "UPLOADING"
UPLOADING_FINISHED = "UPLOADING_FINISHED"
class StopReason:
FORCE_REVOKED = "FORCE_REVOKED"
INTERNAL_ERROR = "INTERNAL_ERROR"
# CheckInputKeyTask and DownloadInputTask
INPUT_VIDEO_ON_S3_IS_404_OR_403 = "INPUT_VIDEO_ON_S3_IS_404_OR_403"
# CheckInputKeyTask
FAILED_INPUT_KEY_CHECKING = "FAILED_INPUT_KEY_CHECKING"
# CheckOutputBucketTask
FAILED_OUTPUT_BUCKET_CHECKING = "FAILED_OUTPUT_BUCKET_CHECKING"
OUTPUT_BUCKET_ON_S3_IS_404_OR_403 = "OUTPUT_BUCKET_ON_S3_IS_404_OR_403"
# CheckOutputKeyTask
FAILED_OUTPUT_KEY_CHECKING = "FAILED_OUTPUT_KEY_CHECKING"
OUTPUT_KEY_IS_ALREADY_EXIST = "OUTPUT_KEY_IS_ALREADY_EXIST"
# DownloadInputTask
DOWNLOADING_FAILED = "DOWNLOADING_FAILED"
# AnalyzeInputTask
FAILED_ANALYZE_INPUT = "FAILED_ANALYZE_INPUT"
# AnalyzeInputTask
INPUT_VIDEO_CODEC_TYPE_IN_NOT_VIDEO = "INPUT_VIDEO_CODEC_TYPE_IN_NOT_VIDEO"
# InputsFunnelTask
AGGREGATE_INPUTS_FAILED = "AGGREGATE_INPUTS_FAILED"
# CreatePlaylistTask
FAILED_CREATE_PLAYLIST = "FAILED_CREATE_PLAYLIST"
INPUT_VIDEO_SIZE_CAN_NOT_BE_ZERO = "INPUT_VIDEO_SIZE_CAN_NOT_BE_ZERO"
REPRESENTATION_NEEDS_BOTH_SIZE_AND_BITRATE = "REPRESENTATION_NEEDS_BOTH_SIZE_AND_BITRATE"
# UploadDirectoryTask
FAILED_UPLOAD_DIRECTORY = "FAILED_UPLOAD_DIRECTORY"
# GenerateThumbnailTask
FAILED_GENERATE_THUMBNAIL = "FAILED_GENERATE_THUMBNAIL"
# UploadFileTask
FAILED_UPLOAD_FILE = "FAILED_UPLOAD_FILE"
# AddWatermarkTask
FAILED_ADD_WATERMARK = "FAILED_ADD_WATERMARK"
# InputsFunnelTask
# when job_details not found
JOB_TIMEOUT = "JOB_TIMEOUT"
|
__all__ = ['PrimaryStatus', 'InputStatus', 'OutputStatus', 'StopReason']
class Primarystatus:
queuing_checks = 'QUEUING_CHECKS'
checking = 'CHECKING'
checks_finished = 'CHECKS_FINISHED'
queuing_inputs_downloading = 'QUEUING_INPUTS_DOWNLOADING'
inputs_downloading = 'INPUTS_DOWNLOADING'
all_inputs_downloaded = 'ALL_INPUTS_DOWNLOADED'
queuing_outputs = 'QUEUING_OUTPUTS'
outputs_progressing = 'OUTPUTS_PROGRESSING'
finished = 'FINISHED'
revoked = 'REVOKED'
failed = 'FAILED'
class Inputstatus:
preparation_download = 'PREPARATION_DOWNLOAD'
downloading = 'DOWNLOADING'
downloading_finished = 'DOWNLOADING_FINISHED'
queuing_to_analyze = 'QUEUING_TO_ANALYZE'
analyzing = 'ANALYZING'
analyzing_finished = 'ANALYZING_FINISHED'
input_revoked = 'INPUT_REVOKED'
input_failed = 'INPUT_FAILED'
class Outputstatus:
output_revoked = 'OUTPUT_REVOKED'
output_failed = 'OUTPUT_FAILED'
preparation_processing = 'PREPARATION_PROCESSING'
processing = 'PROCESSING'
processing_finished = 'PROCESSING_FINISHED'
queuing_uploading = 'QUEUING_UPLOADING'
uploading = 'UPLOADING'
uploading_finished = 'UPLOADING_FINISHED'
class Stopreason:
force_revoked = 'FORCE_REVOKED'
internal_error = 'INTERNAL_ERROR'
input_video_on_s3_is_404_or_403 = 'INPUT_VIDEO_ON_S3_IS_404_OR_403'
failed_input_key_checking = 'FAILED_INPUT_KEY_CHECKING'
failed_output_bucket_checking = 'FAILED_OUTPUT_BUCKET_CHECKING'
output_bucket_on_s3_is_404_or_403 = 'OUTPUT_BUCKET_ON_S3_IS_404_OR_403'
failed_output_key_checking = 'FAILED_OUTPUT_KEY_CHECKING'
output_key_is_already_exist = 'OUTPUT_KEY_IS_ALREADY_EXIST'
downloading_failed = 'DOWNLOADING_FAILED'
failed_analyze_input = 'FAILED_ANALYZE_INPUT'
input_video_codec_type_in_not_video = 'INPUT_VIDEO_CODEC_TYPE_IN_NOT_VIDEO'
aggregate_inputs_failed = 'AGGREGATE_INPUTS_FAILED'
failed_create_playlist = 'FAILED_CREATE_PLAYLIST'
input_video_size_can_not_be_zero = 'INPUT_VIDEO_SIZE_CAN_NOT_BE_ZERO'
representation_needs_both_size_and_bitrate = 'REPRESENTATION_NEEDS_BOTH_SIZE_AND_BITRATE'
failed_upload_directory = 'FAILED_UPLOAD_DIRECTORY'
failed_generate_thumbnail = 'FAILED_GENERATE_THUMBNAIL'
failed_upload_file = 'FAILED_UPLOAD_FILE'
failed_add_watermark = 'FAILED_ADD_WATERMARK'
job_timeout = 'JOB_TIMEOUT'
|
# __getattr__ is not implemented by default
# __getattribute__ run for every attribute access (w/o looking at attributes on object)
# __getattr__ only run when attribute not found in normal ways
class Foo(object):
def __getattribute__(self, item):
print('Foo called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Foo called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
class Bar(Foo):
def __getattribute__(self, item):
print('Bar called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Bar called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
if __name__ == '__main__':
b = Bar()
# b.x = 4
b.x
|
class Foo(object):
def __getattribute__(self, item):
print('Foo called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Foo called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
class Bar(Foo):
def __getattribute__(self, item):
print('Bar called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Bar called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
if __name__ == '__main__':
b = bar()
b.x
|
# palindrome_check.py
# recursion in strings
def isPalindrome(s):
# check if string is a palindrome
def toChars(s):
# convert string to characters
s = s.lower()
ans = ''
for c in s:
if c in 'abcdefghijklmnopqrstuvwxy':
ans = ans + c
return ans
def isPal(s):
#Return true/false if string is a palindrome
if len(s) <= 1:
return True
else:
return s[0] == s[-1] and isPal(s[1:-1])
return isPal(toChars(s))
# test goes here:
test1 = isPalindrome('ama')
print(test1)
|
def is_palindrome(s):
def to_chars(s):
s = s.lower()
ans = ''
for c in s:
if c in 'abcdefghijklmnopqrstuvwxy':
ans = ans + c
return ans
def is_pal(s):
if len(s) <= 1:
return True
else:
return s[0] == s[-1] and is_pal(s[1:-1])
return is_pal(to_chars(s))
test1 = is_palindrome('ama')
print(test1)
|
f = open('./deu.txt','r')
fwde = open('./deu.de','w')
fwen = open('./deu.en','w')
lines = [line for line in f.read().split('\n') if line]
for line in lines:
items = line.split('\t')
assert len(items)==3
fwen.write(items[0] + '\n')
fwde.write(items[1] + '\n')
fwde.close()
fwen.close()
|
f = open('./deu.txt', 'r')
fwde = open('./deu.de', 'w')
fwen = open('./deu.en', 'w')
lines = [line for line in f.read().split('\n') if line]
for line in lines:
items = line.split('\t')
assert len(items) == 3
fwen.write(items[0] + '\n')
fwde.write(items[1] + '\n')
fwde.close()
fwen.close()
|
height_map = [int(e.strip()) for e in input().strip().split(',')]
count = 0
negative = False
for i in height_map:
if i < 0:
negative = True
else:
if negative:
count += 1
negative = False
print(count)
|
height_map = [int(e.strip()) for e in input().strip().split(',')]
count = 0
negative = False
for i in height_map:
if i < 0:
negative = True
else:
if negative:
count += 1
negative = False
print(count)
|
# Find value that occurs in odd number of elements.
# Find the number in an non-empty array that does not have pair
# Array [9,3,9,3,9,7,9] pairs
# A[0] = 9 and A[2] = 9
# A[1] = 3 and A[3] = 3
# A[4] = 9 and A[6] = 9
# A[5] = 7 no pair
# the function should return 7, as explained in the example above.
# Important
# N is an odd integer within the range [1..1,000,000];
# each element of array A is an integer within the range [1..1,000,000,000];
# all but one of the values in A occur an even number of times.
def solution(A):
A = sorted(A)
current = A[0]
count = 0
for i in A:
if current == i:
count += 1
else:
if count % 2 != 0:
return current
count = 1
current = i
return current
# Testing
print(solution([9,3,9,3,9,7,9]))
# Result
# Detected time complexity: O(N) or O(N*log(N))
|
def solution(A):
a = sorted(A)
current = A[0]
count = 0
for i in A:
if current == i:
count += 1
else:
if count % 2 != 0:
return current
count = 1
current = i
return current
print(solution([9, 3, 9, 3, 9, 7, 9]))
|
# -*- coding: utf-8 -*-
{
'name': 'Gastos unidos a facturas',
'version': '1.0',
'category': 'Accounting/Expenses',
'sequence': 6,
'summary': 'Gastos unidos a facturas',
'description': """ Cambios a gastos para unirlas a facturas """,
'website': 'http://aquih.com',
'author': 'Rodrigo Fernandez',
'depends': ['hr_expense'],
'data': [
'views/hr_expense_views.xml',
'views/account_move_views.xml',
'security/ir.model.access.csv',
],
'qweb': [
],
'installable': True,
'auto_install': False,
}
|
{'name': 'Gastos unidos a facturas', 'version': '1.0', 'category': 'Accounting/Expenses', 'sequence': 6, 'summary': 'Gastos unidos a facturas', 'description': ' Cambios a gastos para unirlas a facturas ', 'website': 'http://aquih.com', 'author': 'Rodrigo Fernandez', 'depends': ['hr_expense'], 'data': ['views/hr_expense_views.xml', 'views/account_move_views.xml', 'security/ir.model.access.csv'], 'qweb': [], 'installable': True, 'auto_install': False}
|
Data_File = open("Day2_Data.txt")
Data = Data_File.read()
Data = Data.split(',')
for i in range(len(Data)):
Data[i]=int(Data[i])
Data_Backup = Data.copy()
for noun in range (100):
for verb in range(100):
Data = Data_Backup.copy()
Data[1] = noun
Data[2] = verb
Index_Number = 0
while(True):
if(Data[Index_Number] == 1):
Data[Data[Index_Number+3]] = Data[Data[Index_Number+1]] + Data[Data[Index_Number+2]]
Index_Number +=4
elif(Data[Index_Number] ==2):
Data[Data[Index_Number + 3]] = Data[Data[Index_Number + 1]] * Data[Data[Index_Number + 2]]
Index_Number += 4
elif(Data[Index_Number] == 99):
#print("Terminated successfully")
break
else:
#print("Something has gone wrong, read opcode:"+ str(Data[Index_Number]))
#print("Terminated")
break
if(Data[0] == 19690720):
print("noun :" + str(noun) )
print("verb :" + str(verb) )
exit()
|
data__file = open('Day2_Data.txt')
data = Data_File.read()
data = Data.split(',')
for i in range(len(Data)):
Data[i] = int(Data[i])
data__backup = Data.copy()
for noun in range(100):
for verb in range(100):
data = Data_Backup.copy()
Data[1] = noun
Data[2] = verb
index__number = 0
while True:
if Data[Index_Number] == 1:
Data[Data[Index_Number + 3]] = Data[Data[Index_Number + 1]] + Data[Data[Index_Number + 2]]
index__number += 4
elif Data[Index_Number] == 2:
Data[Data[Index_Number + 3]] = Data[Data[Index_Number + 1]] * Data[Data[Index_Number + 2]]
index__number += 4
elif Data[Index_Number] == 99:
break
else:
break
if Data[0] == 19690720:
print('noun :' + str(noun))
print('verb :' + str(verb))
exit()
|
# https://www.facebook.com/roshan.philipines/posts/2769055946717382
# Subscribed by Roshaen
#Implementation of ISBN number
def isbn(n):
lst=[]
j=0
for i in range(len(n)):
lst.insert(j,n[i])
j+=1
i=0
sum=0
for i in range(len(lst)):
sum=sum+int(lst[i])*(10-i)
if(sum%11==0):
print("Valid ISBN number")
else:
print("Not a valid ISBN number")
inp=input("Enter isbn number: ")
isbn(inp)
|
def isbn(n):
lst = []
j = 0
for i in range(len(n)):
lst.insert(j, n[i])
j += 1
i = 0
sum = 0
for i in range(len(lst)):
sum = sum + int(lst[i]) * (10 - i)
if sum % 11 == 0:
print('Valid ISBN number')
else:
print('Not a valid ISBN number')
inp = input('Enter isbn number: ')
isbn(inp)
|
def get_defaults():
return {
"acceptable_size": 100,
"acceptable_time": 3,
"get_pages": True,
"get_assets": True,
"get_images": True,
"get_scripts": True,
"get_stylesheets": True,
"give_second_chance": True,
"logfile_location": "gyroscope.log",
"logfile_mode": "w",
"log_level": 30,
"log_too_big": True,
"log_too_slow": True,
"sites_file": "sites.json",
"asset_types": []
}
|
def get_defaults():
return {'acceptable_size': 100, 'acceptable_time': 3, 'get_pages': True, 'get_assets': True, 'get_images': True, 'get_scripts': True, 'get_stylesheets': True, 'give_second_chance': True, 'logfile_location': 'gyroscope.log', 'logfile_mode': 'w', 'log_level': 30, 'log_too_big': True, 'log_too_slow': True, 'sites_file': 'sites.json', 'asset_types': []}
|
#PROBLEM LINK:- https://leetcode.com/problems/shuffle-the-array/
class Solution:
def shuffle(self, nums, n):
v = []
for i in range(n):
v.append(nums[i])
v.append(nums[i+n])
return v
|
class Solution:
def shuffle(self, nums, n):
v = []
for i in range(n):
v.append(nums[i])
v.append(nums[i + n])
return v
|
# coding: utf-8
##############################################################################
# Copyright (C) 2018 Microchip Technology Inc. and its subsidiaries.
#
# Subject to your compliance with these terms, you may use Microchip software
# and any derivatives exclusively with Microchip products. It is your
# responsibility to comply with third party license terms applicable to your
# use of third party software (including open source software) that may
# accompany Microchip software.
#
# THIS SOFTWARE IS SUPPLIED BY MICROCHIP "AS IS". NO WARRANTIES, WHETHER
# EXPRESS, IMPLIED OR STATUTORY, APPLY TO THIS SOFTWARE, INCLUDING ANY IMPLIED
# WARRANTIES OF NON-INFRINGEMENT, MERCHANTABILITY, AND FITNESS FOR A
# PARTICULAR PURPOSE.
#
# IN NO EVENT WILL MICROCHIP BE LIABLE FOR ANY INDIRECT, SPECIAL, PUNITIVE,
# INCIDENTAL OR CONSEQUENTIAL LOSS, DAMAGE, COST OR EXPENSE OF ANY KIND
# WHATSOEVER RELATED TO THE SOFTWARE, HOWEVER CAUSED, EVEN IF MICROCHIP HAS
# BEEN ADVISED OF THE POSSIBILITY OR THE DAMAGES ARE FORESEEABLE. TO THE
# FULLEST EXTENT ALLOWED BY LAW, MICROCHIP'S TOTAL LIABILITY ON ALL CLAIMS IN
# ANY WAY RELATED TO THIS SOFTWARE WILL NOT EXCEED THE AMOUNT OF FEES, IF ANY,
# THAT YOU HAVE PAID DIRECTLY TO MICROCHIP FOR THIS SOFTWARE.
##############################################################################
def instantiateComponent(comp):
GFX_INTF_SMC_H = comp.createFileSymbol("GFX_INTF_SMC_H", None)
GFX_INTF_SMC_H.setDestPath("gfx/interface/")
GFX_INTF_SMC_H.setSourcePath("../drv_gfx_disp_intf.h")
GFX_INTF_SMC_H.setOutputName("drv_gfx_disp_intf.h")
GFX_INTF_SMC_H.setProjectPath("config/" + Variables.get("__CONFIGURATION_NAME") + "/gfx/interface")
GFX_INTF_SMC_H.setType("HEADER")
GFX_INTF_SMC = comp.createFileSymbol("GFX_INTF_SMC", None)
GFX_INTF_SMC.setDestPath("gfx/interface/parallel_smc/")
GFX_INTF_SMC.setSourcePath("templates/drv_gfx_disp_intf_parallel_smc.c.ftl")
GFX_INTF_SMC.setOutputName("drv_gfx_disp_intf_parallel_smc.c")
GFX_INTF_SMC.setProjectPath("config/" + Variables.get("__CONFIGURATION_NAME") + "/gfx/interface/parallel_smc")
GFX_INTF_SMC.setMarkup(True)
GFX_INTF_SMC.setType("SOURCE")
### Interface type is required for all interface components. This is queried by the driver to determine
### the display interface supported by the interface component. Valid values are "SPI 4-line", "Parallel 16-bit",
### and "Parallel 8-bit"
InterfaceType = comp.createStringSymbol("InterfaceType", None)
InterfaceType.setLabel("Interface Type")
InterfaceType.setDescription("The interface configuration")
InterfaceType.setDefaultValue("Parallel 16-bit")
InterfaceType.setVisible(False)
### Driver settings menu
DriverSettingsMenu = comp.createMenuSymbol("DriverSettingsMenu", None)
DriverSettingsMenu.setLabel("Driver Settings")
UseSyncBarriers = comp.createBooleanSymbol("UseSyncBarriers", DriverSettingsMenu)
UseSyncBarriers.setLabel("Use Synchronization Barriers")
UseSyncBarriers.setDescription("Use Synchronization Barriers.")
UseSyncBarriers.setDefaultValue(True)
UseSyncBarriers.setVisible(False)
DelayNOPCount = comp.createIntegerSymbol("DelayNOPCount", DriverSettingsMenu)
DelayNOPCount.setLabel("Number of NOP for delay")
DelayNOPCount.setDescription("Number of NOP for delay")
DelayNOPCount.setDefaultValue(4)
###
### Interface settings menu
InterfaceSettingsSMCMenu = comp.createMenuSymbol("InterfaceSettingsSMCMenu", None)
InterfaceSettingsSMCMenu.setLabel("Parallel 8080 Display Interface Settings")
EBIChipSelectIndex = comp.createIntegerSymbol("EBIChipSelectIndex", InterfaceSettingsSMCMenu)
EBIChipSelectIndex.setLabel("EBI Chip Select Index")
EBIChipSelectIndex.setDescription("The chip select index")
EBIChipSelectIndex.setDefaultValue(0)
EBIChipSelectIndex.setMin(0)
EBIChipSelectIndex.setMax(4)
EBIChipSelectIndex.setVisible(False)
ControlPinsMenu = comp.createMenuSymbol("ControlPinsMenu", InterfaceSettingsSMCMenu)
ControlPinsMenu.setLabel("Control Pin Settings")
ChipSelectControl = comp.createComboSymbol("ChipSelectControl", ControlPinsMenu, ["GPIO", "Peripheral"])
ChipSelectControl.setLabel("CS# Control")
ChipSelectControl.setDescription("Chip Select Control")
ChipSelectControl.setDefaultValue("GPIO")
ChipSelectControl.setReadOnly(True)
DataCommandSelectControl = comp.createComboSymbol("DataCommandSelectControl", ControlPinsMenu, ["GPIO", "Peripheral"])
DataCommandSelectControl.setLabel("D/C# Control")
DataCommandSelectControl.setDescription("Data Command Select Control")
DataCommandSelectControl.setDefaultValue("GPIO")
DataCommandSelectControl.setDependencies(onDataCommandSelectSet, ["DataCommandSelectControl"])
ReadStrobeControl = comp.createComboSymbol("ReadStrobeControl", ControlPinsMenu, ["GPIO", "Peripheral"])
ReadStrobeControl.setLabel("RD# Control")
ReadStrobeControl.setDescription("Read Strobe Control")
ReadStrobeControl.setDefaultValue("GPIO")
WriteStrobeControl = comp.createComboSymbol("WriteStrobeControl", ControlPinsMenu, ["GPIO", "Peripheral"])
WriteStrobeControl.setLabel("WR# Control")
WriteStrobeControl.setDescription("Write Strobe Control")
WriteStrobeControl.setDefaultValue("GPIO")
DCXAddressBit = comp.createIntegerSymbol("DCXAddressBit", DataCommandSelectControl)
DCXAddressBit.setLabel("DCX Address Bit")
DCXAddressBit.setDescription("Address bit used for DCX signal.")
DCXAddressBit.setDefaultValue(12)
DCXAddressBit.setMin(0)
DCXAddressBit.setMax(31)
###
def configureSMCComponent(comp, smcComponent):
print("Configuring SMC")
smcChipSelNum = comp.getSymbolValue("EBIChipSelectIndex")
smcComponent.setSymbolValue("SMC_CHIP_SELECT" + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue("SMC_MEM_SCRAMBLING_CS" + str(smcChipSelNum), False, 1)
# SMC Write Timings
smcComponent.setSymbolValue("SMC_NWE_SETUP_CS" + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue("SMC_NCS_WR_SETUP_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_NWE_PULSE_CS" + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue("SMC_NCS_WR_PULSE_CS" + str(smcChipSelNum), 10, 1)
smcComponent.setSymbolValue("SMC_DATA_BUS_CS" + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue("SMC_NWE_CYCLE_CS" + str(smcChipSelNum), 3, 1)
# SMC Read Timings
smcComponent.setSymbolValue("SMC_NRD_SETUP_CS" + str(smcChipSelNum), 2, 1)
smcComponent.setSymbolValue("SMC_NCS_RD_SETUP_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_NRD_PULSE_CS" + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue("SMC_NCS_RD_PULSE_CS" + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue("SMC_NRD_CYCLE_CS" + str(smcChipSelNum), 110, 1)
# SMC Mode Configuration
smcComponent.setSymbolValue("SMC_DATA_BUS_CS" + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue("SMC_BAT_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_READ_ENABLE_MODE_CS" + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue("SMC_WRITE_ENABLE_MODE_CS" + str(smcChipSelNum), False, 1)
def onDataCommandSelectSet(sourceSymbol, event):
if (sourceSymbol.getComponent().getSymbolByID("DataCommandSelectControl").getValue() == "GPIO"):
sourceSymbol.getComponent().getSymbolByID("DCXAddressBit").setVisible(False)
else:
sourceSymbol.getComponent().getSymbolByID("DCXAddressBit").setVisible(True)
def onInterfaceTypeChanged(sourceSymbol, event):
print("Interface type changed")
def onAttachmentConnected(source, target):
#print(source["component"].getID() + ": " + dependencyID + " dependent component added ")
if source["id"] == "SMC_CS":
configureSMCComponent(source["component"], target["component"])
|
def instantiate_component(comp):
gfx_intf_smc_h = comp.createFileSymbol('GFX_INTF_SMC_H', None)
GFX_INTF_SMC_H.setDestPath('gfx/interface/')
GFX_INTF_SMC_H.setSourcePath('../drv_gfx_disp_intf.h')
GFX_INTF_SMC_H.setOutputName('drv_gfx_disp_intf.h')
GFX_INTF_SMC_H.setProjectPath('config/' + Variables.get('__CONFIGURATION_NAME') + '/gfx/interface')
GFX_INTF_SMC_H.setType('HEADER')
gfx_intf_smc = comp.createFileSymbol('GFX_INTF_SMC', None)
GFX_INTF_SMC.setDestPath('gfx/interface/parallel_smc/')
GFX_INTF_SMC.setSourcePath('templates/drv_gfx_disp_intf_parallel_smc.c.ftl')
GFX_INTF_SMC.setOutputName('drv_gfx_disp_intf_parallel_smc.c')
GFX_INTF_SMC.setProjectPath('config/' + Variables.get('__CONFIGURATION_NAME') + '/gfx/interface/parallel_smc')
GFX_INTF_SMC.setMarkup(True)
GFX_INTF_SMC.setType('SOURCE')
interface_type = comp.createStringSymbol('InterfaceType', None)
InterfaceType.setLabel('Interface Type')
InterfaceType.setDescription('The interface configuration')
InterfaceType.setDefaultValue('Parallel 16-bit')
InterfaceType.setVisible(False)
driver_settings_menu = comp.createMenuSymbol('DriverSettingsMenu', None)
DriverSettingsMenu.setLabel('Driver Settings')
use_sync_barriers = comp.createBooleanSymbol('UseSyncBarriers', DriverSettingsMenu)
UseSyncBarriers.setLabel('Use Synchronization Barriers')
UseSyncBarriers.setDescription('Use Synchronization Barriers.')
UseSyncBarriers.setDefaultValue(True)
UseSyncBarriers.setVisible(False)
delay_nop_count = comp.createIntegerSymbol('DelayNOPCount', DriverSettingsMenu)
DelayNOPCount.setLabel('Number of NOP for delay')
DelayNOPCount.setDescription('Number of NOP for delay')
DelayNOPCount.setDefaultValue(4)
interface_settings_smc_menu = comp.createMenuSymbol('InterfaceSettingsSMCMenu', None)
InterfaceSettingsSMCMenu.setLabel('Parallel 8080 Display Interface Settings')
ebi_chip_select_index = comp.createIntegerSymbol('EBIChipSelectIndex', InterfaceSettingsSMCMenu)
EBIChipSelectIndex.setLabel('EBI Chip Select Index')
EBIChipSelectIndex.setDescription('The chip select index')
EBIChipSelectIndex.setDefaultValue(0)
EBIChipSelectIndex.setMin(0)
EBIChipSelectIndex.setMax(4)
EBIChipSelectIndex.setVisible(False)
control_pins_menu = comp.createMenuSymbol('ControlPinsMenu', InterfaceSettingsSMCMenu)
ControlPinsMenu.setLabel('Control Pin Settings')
chip_select_control = comp.createComboSymbol('ChipSelectControl', ControlPinsMenu, ['GPIO', 'Peripheral'])
ChipSelectControl.setLabel('CS# Control')
ChipSelectControl.setDescription('Chip Select Control')
ChipSelectControl.setDefaultValue('GPIO')
ChipSelectControl.setReadOnly(True)
data_command_select_control = comp.createComboSymbol('DataCommandSelectControl', ControlPinsMenu, ['GPIO', 'Peripheral'])
DataCommandSelectControl.setLabel('D/C# Control')
DataCommandSelectControl.setDescription('Data Command Select Control')
DataCommandSelectControl.setDefaultValue('GPIO')
DataCommandSelectControl.setDependencies(onDataCommandSelectSet, ['DataCommandSelectControl'])
read_strobe_control = comp.createComboSymbol('ReadStrobeControl', ControlPinsMenu, ['GPIO', 'Peripheral'])
ReadStrobeControl.setLabel('RD# Control')
ReadStrobeControl.setDescription('Read Strobe Control')
ReadStrobeControl.setDefaultValue('GPIO')
write_strobe_control = comp.createComboSymbol('WriteStrobeControl', ControlPinsMenu, ['GPIO', 'Peripheral'])
WriteStrobeControl.setLabel('WR# Control')
WriteStrobeControl.setDescription('Write Strobe Control')
WriteStrobeControl.setDefaultValue('GPIO')
dcx_address_bit = comp.createIntegerSymbol('DCXAddressBit', DataCommandSelectControl)
DCXAddressBit.setLabel('DCX Address Bit')
DCXAddressBit.setDescription('Address bit used for DCX signal.')
DCXAddressBit.setDefaultValue(12)
DCXAddressBit.setMin(0)
DCXAddressBit.setMax(31)
def configure_smc_component(comp, smcComponent):
print('Configuring SMC')
smc_chip_sel_num = comp.getSymbolValue('EBIChipSelectIndex')
smcComponent.setSymbolValue('SMC_CHIP_SELECT' + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue('SMC_MEM_SCRAMBLING_CS' + str(smcChipSelNum), False, 1)
smcComponent.setSymbolValue('SMC_NWE_SETUP_CS' + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue('SMC_NCS_WR_SETUP_CS' + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue('SMC_NWE_PULSE_CS' + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue('SMC_NCS_WR_PULSE_CS' + str(smcChipSelNum), 10, 1)
smcComponent.setSymbolValue('SMC_DATA_BUS_CS' + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue('SMC_NWE_CYCLE_CS' + str(smcChipSelNum), 3, 1)
smcComponent.setSymbolValue('SMC_NRD_SETUP_CS' + str(smcChipSelNum), 2, 1)
smcComponent.setSymbolValue('SMC_NCS_RD_SETUP_CS' + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue('SMC_NRD_PULSE_CS' + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue('SMC_NCS_RD_PULSE_CS' + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue('SMC_NRD_CYCLE_CS' + str(smcChipSelNum), 110, 1)
smcComponent.setSymbolValue('SMC_DATA_BUS_CS' + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue('SMC_BAT_CS' + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue('SMC_READ_ENABLE_MODE_CS' + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue('SMC_WRITE_ENABLE_MODE_CS' + str(smcChipSelNum), False, 1)
def on_data_command_select_set(sourceSymbol, event):
if sourceSymbol.getComponent().getSymbolByID('DataCommandSelectControl').getValue() == 'GPIO':
sourceSymbol.getComponent().getSymbolByID('DCXAddressBit').setVisible(False)
else:
sourceSymbol.getComponent().getSymbolByID('DCXAddressBit').setVisible(True)
def on_interface_type_changed(sourceSymbol, event):
print('Interface type changed')
def on_attachment_connected(source, target):
if source['id'] == 'SMC_CS':
configure_smc_component(source['component'], target['component'])
|
input_numbers = input('Enter numbers separated by a space : ').split()
max = int(input_numbers[0])
min = int(input_numbers[0])
avg = 0
sum = 0
for i in range(0, len(input_numbers)):
input_numbers[i] = int(input_numbers[i])
sum = sum + input_numbers[i]
if input_numbers[i] > max:
max = input_numbers[i]
if input_numbers[i] < min:
min = input_numbers[i]
avg = sum / len(input_numbers)
print (max, min, avg)
|
input_numbers = input('Enter numbers separated by a space : ').split()
max = int(input_numbers[0])
min = int(input_numbers[0])
avg = 0
sum = 0
for i in range(0, len(input_numbers)):
input_numbers[i] = int(input_numbers[i])
sum = sum + input_numbers[i]
if input_numbers[i] > max:
max = input_numbers[i]
if input_numbers[i] < min:
min = input_numbers[i]
avg = sum / len(input_numbers)
print(max, min, avg)
|
'''3. Write a Python program to print the square and cube symbol in the
area of a rectangle and volume of a cylinder.
Sample output:
The area of the rectangle is 1256.66cm2
The volume of the cylinder is 1254.725cm3'''
area = 1256.66
volume = 1254.725
print(f"The area of the rectangle is {round(area, 2)}cm2")
print(f"The volume of the cylinder is {round(volume, 3)}cm3")
|
"""3. Write a Python program to print the square and cube symbol in the
area of a rectangle and volume of a cylinder.
Sample output:
The area of the rectangle is 1256.66cm2
The volume of the cylinder is 1254.725cm3"""
area = 1256.66
volume = 1254.725
print(f'The area of the rectangle is {round(area, 2)}cm2')
print(f'The volume of the cylinder is {round(volume, 3)}cm3')
|
#!/usr/bin/env python3
def clear_screen(lines=128):
if not isinstance(lines, int) or lines < 64:
lines = 64
print( '\n' * lines, end='' )
class Player:
def __init__(self, n):
self.score = 0
self.name = n
self.attack1 = ''
self.attack2 = ''
self.guard = ''
def step(self):
clear_screen()
print(self.name + '\'s turn:')
self.attack1 = ''
self.attack2 = ''
while len(self.attack1) <= 0 or len(self.attack2) <= 0:
print()
a = ''
if len(self.attack1) <= 0:
print('High or Low?')
if len(self.attack2) <= 0:
print('Left or Right?')
while len(a) <= 0:
a = input('Attack: ').lower()
# test input
if 'hi' in a:
self.attack1 = 'high'
elif 'lo' in a:
self.attack1 = 'low'
if 'le' in a:
self.attack2 = 'left'
elif 'ri' in a:
self.attack2 = 'right'
self.guard = ''
while len(self.guard) <= 0:
print()
a = ''
print('High, Low, Left, or Right?')
while len(a) <= 0:
a = input('Guard: ').lower()
# test input
if 'hi' in a:
self.guard = 'high'
elif 'lo' in a:
self.guard = 'low'
elif 'le' in a:
self.guard = 'left'
elif 'ri' in a:
self.guard = 'right'
clear_screen()
def attack(self, p):
print(self.name + ' attacks ' + p.name + ' with a ' + self.attack1 + ' ' + self.attack2 + '.')
print(p.name + ' guards ' + p.guard + '.')
if (self.attack1 != p.guard) and (self.attack2 != p.guard):
print('HIT!')
self.score += 1
else:
print('BLOCK!')
print()
class Engine:
def __init__(self):
self.players = list()
x = input("How many players?: ")
print()
try:
numOfPlayers = int(x)
except ValueError:
numOfPlayers = 2
if numOfPlayers > 8:
numOfPlayers = 8
elif numOfPlayers < 2:
numOfPlayers = 2
print('Setting to '+ str(numOfPlayers) +' players.\n')
x = 1
print('(Player Names)')
while len(self.players) < numOfPlayers:
a = input('Player '+str(x)+': ')
if len(a) > 0:
self.players.append(Player(a))
x += 1
print()
self.rounds = None
while not isinstance(self.rounds, int) or self.rounds < 1:
self.rounds = input('# of Rounds: ')
try:
self.rounds = int(self.rounds)
except ValueError:
self.rounds = None
self.roundsC = self.rounds
input("\nNOTE: You only need the first two letters. (HI LO LE RI) ")
def mainloop(self):
if len(self.players) > 1:
self.running = True
self.roundsC = self.rounds
for p in self.players:
p.score = 0
while self.running and self.roundsC > 0:
clear_screen()
print('Round ' + str((self.rounds - self.roundsC) + 1) + ':')
input('\n( Begin ) ...')
for p in self.players:
p.step()
# process player attacks
for p in self.players:
for q in self.players:
if p != q:
p.attack(q)
# display scores
for p in self.players:
print(p.name + ': ' + str(p.score))
a = ''
while 'ok' not in a:
a = input('\n( Type "ok" ) ').lower()
self.roundsC -= 1
print('\nFinal scores:\n')
for p in self.players:
print(p.name + ': ' + str(p.score) + '\n')
def main():
e = Engine()
e.mainloop()
if __name__=="__main__":
main()
|
def clear_screen(lines=128):
if not isinstance(lines, int) or lines < 64:
lines = 64
print('\n' * lines, end='')
class Player:
def __init__(self, n):
self.score = 0
self.name = n
self.attack1 = ''
self.attack2 = ''
self.guard = ''
def step(self):
clear_screen()
print(self.name + "'s turn:")
self.attack1 = ''
self.attack2 = ''
while len(self.attack1) <= 0 or len(self.attack2) <= 0:
print()
a = ''
if len(self.attack1) <= 0:
print('High or Low?')
if len(self.attack2) <= 0:
print('Left or Right?')
while len(a) <= 0:
a = input('Attack: ').lower()
if 'hi' in a:
self.attack1 = 'high'
elif 'lo' in a:
self.attack1 = 'low'
if 'le' in a:
self.attack2 = 'left'
elif 'ri' in a:
self.attack2 = 'right'
self.guard = ''
while len(self.guard) <= 0:
print()
a = ''
print('High, Low, Left, or Right?')
while len(a) <= 0:
a = input('Guard: ').lower()
if 'hi' in a:
self.guard = 'high'
elif 'lo' in a:
self.guard = 'low'
elif 'le' in a:
self.guard = 'left'
elif 'ri' in a:
self.guard = 'right'
clear_screen()
def attack(self, p):
print(self.name + ' attacks ' + p.name + ' with a ' + self.attack1 + ' ' + self.attack2 + '.')
print(p.name + ' guards ' + p.guard + '.')
if self.attack1 != p.guard and self.attack2 != p.guard:
print('HIT!')
self.score += 1
else:
print('BLOCK!')
print()
class Engine:
def __init__(self):
self.players = list()
x = input('How many players?: ')
print()
try:
num_of_players = int(x)
except ValueError:
num_of_players = 2
if numOfPlayers > 8:
num_of_players = 8
elif numOfPlayers < 2:
num_of_players = 2
print('Setting to ' + str(numOfPlayers) + ' players.\n')
x = 1
print('(Player Names)')
while len(self.players) < numOfPlayers:
a = input('Player ' + str(x) + ': ')
if len(a) > 0:
self.players.append(player(a))
x += 1
print()
self.rounds = None
while not isinstance(self.rounds, int) or self.rounds < 1:
self.rounds = input('# of Rounds: ')
try:
self.rounds = int(self.rounds)
except ValueError:
self.rounds = None
self.roundsC = self.rounds
input('\nNOTE: You only need the first two letters. (HI LO LE RI) ')
def mainloop(self):
if len(self.players) > 1:
self.running = True
self.roundsC = self.rounds
for p in self.players:
p.score = 0
while self.running and self.roundsC > 0:
clear_screen()
print('Round ' + str(self.rounds - self.roundsC + 1) + ':')
input('\n( Begin ) ...')
for p in self.players:
p.step()
for p in self.players:
for q in self.players:
if p != q:
p.attack(q)
for p in self.players:
print(p.name + ': ' + str(p.score))
a = ''
while 'ok' not in a:
a = input('\n( Type "ok" ) ').lower()
self.roundsC -= 1
print('\nFinal scores:\n')
for p in self.players:
print(p.name + ': ' + str(p.score) + '\n')
def main():
e = engine()
e.mainloop()
if __name__ == '__main__':
main()
|
class Plugin(object):
"""
Plugin Base Class
Meant to be inherited for plugins
"""
def __init__(self):
self._commands = {}
def command(self, name, **kwargs):
"""
Decorator to register a coroutine to a plugin command
:param name: Command Name
:return:
"""
kwargs = {i: kwargs[i] for i in kwargs.keys() if i != "_coro"}
def command_func(func):
self._commands[name] = {}
self._commands[name]["_coro"] = func
for i in kwargs.keys():
self._commands[name][i] = kwargs[i]
return func
return command_func
def on_load(self, bot):
"""
Function to be called when a plugin is loaded into a Bot. Meant to be overridden
:param bot: Bot Instance into which the Plugin is loaded
:return:
"""
pass
|
class Plugin(object):
"""
Plugin Base Class
Meant to be inherited for plugins
"""
def __init__(self):
self._commands = {}
def command(self, name, **kwargs):
"""
Decorator to register a coroutine to a plugin command
:param name: Command Name
:return:
"""
kwargs = {i: kwargs[i] for i in kwargs.keys() if i != '_coro'}
def command_func(func):
self._commands[name] = {}
self._commands[name]['_coro'] = func
for i in kwargs.keys():
self._commands[name][i] = kwargs[i]
return func
return command_func
def on_load(self, bot):
"""
Function to be called when a plugin is loaded into a Bot. Meant to be overridden
:param bot: Bot Instance into which the Plugin is loaded
:return:
"""
pass
|
class Assert(object):
@staticmethod
def is_instance(instance, instances_class):
assert isinstance(instance, instances_class), '{0} should be an instance of class {1}'.format(
instance.__name__, instances_class.__name__
)
|
class Assert(object):
@staticmethod
def is_instance(instance, instances_class):
assert isinstance(instance, instances_class), '{0} should be an instance of class {1}'.format(instance.__name__, instances_class.__name__)
|
#Prime Number Checker
#Parker Dinkins
'''
This program asks for a number between 0 and 5000
If the number isn't in that range it asks for it again
When a proper number is entered it checks if it is prime
If the numbr is prime it prints the two factors
If the number is not prime it prints all the factors
Finally it asks if you want run the checker again or not
'''
# This function takes a number and prints the factors
def print_factors(x):
print("The factors of", x, "are:")
for i in range(1, x + 1):
if x % i == 0:
print(i)
print(x, "is NOT a prime number")
# this functoin check to see if a number is prime and if so prints that out
# if the numbe is not prime it pushes the user input variable into the print_factors function
def prime_checker():
try:
# user input
a = int(input("Enter a number between 0 and 5000: "))
# checks to make sure the number is within the specified range
if a > 5000:
# prints out and error if the check fails and reruns the function with clean memory
print('\n\t****ERROR****')
print('Enter a number between 0 and 5000\n')
return prime_checker()
# place hold variable
k = 0
# this finds the number of factors of the number
for i in range(1, a):
if a % i == 0:
k = k + 1
# this checks to see if the number has less than or one factor
# if the number satisfies this then it is prime and it prints out
if k <= 1:
print('The factors of your number are:')
print('1')
print(a, 'is a prime number')
# if the number has more than one factor it is not prime and it lands here
# the number is then put into the print_factors function
else:
print_factors(x=a)
# this handles the error when the user inputs something other than number into the input statement
except ValueError:
print('\n\t****Invalid*Input****\n\tPlease enter a number\n')
# loop variables
run = True
run1 = True
# first loop that runs the functions when the program one time when the program is opened
while run1:
prime_checker()
break
# second loop that asks the user if they want to run the program again or quit
while run:
option = input("\nContinue and run again? [y/n]: ").lower()
if option == "y":
prime_checker()
elif option == "n":
break
else:
print("\nNot a valid option. Please enter 'y' or 'n'")
|
"""
This program asks for a number between 0 and 5000
If the number isn't in that range it asks for it again
When a proper number is entered it checks if it is prime
If the numbr is prime it prints the two factors
If the number is not prime it prints all the factors
Finally it asks if you want run the checker again or not
"""
def print_factors(x):
print('The factors of', x, 'are:')
for i in range(1, x + 1):
if x % i == 0:
print(i)
print(x, 'is NOT a prime number')
def prime_checker():
try:
a = int(input('Enter a number between 0 and 5000: '))
if a > 5000:
print('\n\t****ERROR****')
print('Enter a number between 0 and 5000\n')
return prime_checker()
k = 0
for i in range(1, a):
if a % i == 0:
k = k + 1
if k <= 1:
print('The factors of your number are:')
print('1')
print(a, 'is a prime number')
else:
print_factors(x=a)
except ValueError:
print('\n\t****Invalid*Input****\n\tPlease enter a number\n')
run = True
run1 = True
while run1:
prime_checker()
break
while run:
option = input('\nContinue and run again? [y/n]: ').lower()
if option == 'y':
prime_checker()
elif option == 'n':
break
else:
print("\nNot a valid option. Please enter 'y' or 'n'")
|
#!/usr/bin/env python3
# Write a program that computes the GC fraction of a DNA sequence in a window
# Window size is 11 nt
# Output with 4 significant figures using whichever method you prefer
# Use no nested loops. Instead, count only the first window
# Then 'move' the window by adding 1 letter on one side
# And subtracting 1 letter from the other side
# Describe the pros/cons of this algorith vs. nested loops
seq = 'ACGACGCAGGAGGAGAGTTTCAGAGATCACGAATACATCCATATTACCCAGAGAGAG'
w = 11
window = ""
count = 0
for i in range(w):
window += seq[i]
if seq[i] == 'G' or seq[i] == 'C':
count += 1
print(f'{0} {window} {count / w : .4f}')
for i in range(1, len(seq) - w + 1):
if window[0] == 'G' or window[0] == 'C':
count -= 1
if seq[i + w - 1] == 'G' or seq[i + w - 1] == 'C':
count += 1
window = window[1:] + seq[i + w - 1]
print(f'{i} {window} {count / w : .4f}')
|
seq = 'ACGACGCAGGAGGAGAGTTTCAGAGATCACGAATACATCCATATTACCCAGAGAGAG'
w = 11
window = ''
count = 0
for i in range(w):
window += seq[i]
if seq[i] == 'G' or seq[i] == 'C':
count += 1
print(f'{0} {window} {count / w: .4f}')
for i in range(1, len(seq) - w + 1):
if window[0] == 'G' or window[0] == 'C':
count -= 1
if seq[i + w - 1] == 'G' or seq[i + w - 1] == 'C':
count += 1
window = window[1:] + seq[i + w - 1]
print(f'{i} {window} {count / w: .4f}')
|
#!/usr/local/bin/python3
class Duet():
def __init__(self, instruction_list):
self.instruction_list = [ instruction.split() for instruction in instruction_list ]
self.program_counter = 0
self.registers = {}
self.played = None
self.nonZeroPlayed = False
self.__instr_set = {
'set': self.__set,
'add': self.__add,
'mul': self.__mul,
'mod': self.__mod,
'snd': self.__snd,
'rcv': self.__rcv,
'jgz': self.__jgz,
}
def __set(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] = int(y)
def __add(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] += int(y)
def __mul(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] *= int(y)
def __mod(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] %= int(y)
def __snd(self, x):
self.played = self.registers[x]
def __rcv(self, x):
if self.registers[x] != 0:
self.nonZeroPlayed = True
def __jgz(self, x, y):
if self.registers[x] > 0:
self.program_counter += int(y) - 1
def __exitCriteria(self):
if self.nonZeroPlayed:
return True
if self.program_counter >= len(self.instruction_list):
return True
return False
def __execute(self):
instruction = self.instruction_list[self.program_counter]
self.program_counter += 1
if instruction[1] not in self.registers:
self.registers[instruction[1]] = 0
self.__instr_set[instruction[0]](*instruction[1:])
def run(self):
while not self.__exitCriteria():
self.__execute()
with open("./input.txt") as f:
INPUT = f.readlines()
duet = Duet(INPUT)
duet.run()
print("Star 1: %s" % duet.played)
|
class Duet:
def __init__(self, instruction_list):
self.instruction_list = [instruction.split() for instruction in instruction_list]
self.program_counter = 0
self.registers = {}
self.played = None
self.nonZeroPlayed = False
self.__instr_set = {'set': self.__set, 'add': self.__add, 'mul': self.__mul, 'mod': self.__mod, 'snd': self.__snd, 'rcv': self.__rcv, 'jgz': self.__jgz}
def __set(self, x, y):
if y.isalpha():
y = self.registers[y]
self.registers[x] = int(y)
def __add(self, x, y):
if y.isalpha():
y = self.registers[y]
self.registers[x] += int(y)
def __mul(self, x, y):
if y.isalpha():
y = self.registers[y]
self.registers[x] *= int(y)
def __mod(self, x, y):
if y.isalpha():
y = self.registers[y]
self.registers[x] %= int(y)
def __snd(self, x):
self.played = self.registers[x]
def __rcv(self, x):
if self.registers[x] != 0:
self.nonZeroPlayed = True
def __jgz(self, x, y):
if self.registers[x] > 0:
self.program_counter += int(y) - 1
def __exit_criteria(self):
if self.nonZeroPlayed:
return True
if self.program_counter >= len(self.instruction_list):
return True
return False
def __execute(self):
instruction = self.instruction_list[self.program_counter]
self.program_counter += 1
if instruction[1] not in self.registers:
self.registers[instruction[1]] = 0
self.__instr_set[instruction[0]](*instruction[1:])
def run(self):
while not self.__exitCriteria():
self.__execute()
with open('./input.txt') as f:
input = f.readlines()
duet = duet(INPUT)
duet.run()
print('Star 1: %s' % duet.played)
|
def check_flux_balance(data_dict: dict) -> bool:
"""
When all fluxes are specified in the measRates sheet, check if all metabolites are mass balanced (well, the ones
that are marked as balanced in the mets sheet).
If everything is fine flag is 0, otherwise it is set to 1.
Args:
data_dict: a dictionary that represents the excel file with the GRASP model.
Returns:
Whether or not all metabolites mass is balanced.
"""
print('\nChecking if the fluxes for each metabolite production/consumptions add up to zero.\n')
flag = False
flux_df = data_dict['measRates']
mets_df = data_dict['mets']
stoic_df = data_dict['stoic']
if len(stoic_df.index) == len(flux_df.index):
met_in_rxns = dict()
for col in stoic_df.columns:
rxn_list = stoic_df.loc[stoic_df[col].ne(0), col]
met_in_rxns[col] = rxn_list.to_dict()
balanced_mets = set(mets_df.loc[mets_df['balanced?'].eq(1), 'balanced?'].index.values)
mean_col = flux_df.columns[0]
for met in met_in_rxns.keys():
flux_balance = sum([met_in_rxns[met][key] * flux_df.loc[key, mean_col] for key in met_in_rxns[met].keys()])
if abs(flux_balance) > 10**-8 and met in balanced_mets:
print(f'The flux for {met} is not balanced. The difference in flux is {flux_balance}')
flag = True
elif flux_balance == 0 and met not in balanced_mets:
print(f'{met} should be in balanced mets')
flag = True
if flag is False:
print('Everything seems to be OK.')
else:
print('Not all fluxes are specified in measRates.\n')
return flag
def check_balanced_metabolites(data_dict: dict) -> bool:
"""
Checks if metabolites that are both consumed and produced in the stoichiometric matrix are marked as balanced and
the other way around. Checking for mass balances is more accurate though.
If everything is fine flag is 0, otherwise it is set to 1.
Args:
data_dict: a dictionary that represents the excel file with the GRASP model.
Returns:
Whether or not metabolites are marked balanced/fixed correctly.
"""
print('\nChecking if metabolites are both consumed and produced in the stoichiometric matrix, and if',
'so checks if they are marked as balanced in the mets sheet. However, the metabolite might be',
'balanced/not balanced anyways depending on the flux of the reactions that consume/produce it,',
'so take this with a grain of salt.\n')
flag = False
stoic_df = data_dict['stoic']
mets_df = data_dict['mets']
for i, met in enumerate(stoic_df.columns):
if stoic_df[met].gt(0).any() and stoic_df[met].lt(0).any():
if mets_df['balanced?'][i] == 0:
print(f'{met} is marked as not balanced but it seems to be balanced.')
flag = True
else:
if mets_df['balanced?'][i] == 1:
print(f'{met} is marked as balanced but it does not seem to be balanced.')
flag = True
if flag is False:
print('Everything seems to be OK.')
return flag
|
def check_flux_balance(data_dict: dict) -> bool:
"""
When all fluxes are specified in the measRates sheet, check if all metabolites are mass balanced (well, the ones
that are marked as balanced in the mets sheet).
If everything is fine flag is 0, otherwise it is set to 1.
Args:
data_dict: a dictionary that represents the excel file with the GRASP model.
Returns:
Whether or not all metabolites mass is balanced.
"""
print('\nChecking if the fluxes for each metabolite production/consumptions add up to zero.\n')
flag = False
flux_df = data_dict['measRates']
mets_df = data_dict['mets']
stoic_df = data_dict['stoic']
if len(stoic_df.index) == len(flux_df.index):
met_in_rxns = dict()
for col in stoic_df.columns:
rxn_list = stoic_df.loc[stoic_df[col].ne(0), col]
met_in_rxns[col] = rxn_list.to_dict()
balanced_mets = set(mets_df.loc[mets_df['balanced?'].eq(1), 'balanced?'].index.values)
mean_col = flux_df.columns[0]
for met in met_in_rxns.keys():
flux_balance = sum([met_in_rxns[met][key] * flux_df.loc[key, mean_col] for key in met_in_rxns[met].keys()])
if abs(flux_balance) > 10 ** (-8) and met in balanced_mets:
print(f'The flux for {met} is not balanced. The difference in flux is {flux_balance}')
flag = True
elif flux_balance == 0 and met not in balanced_mets:
print(f'{met} should be in balanced mets')
flag = True
if flag is False:
print('Everything seems to be OK.')
else:
print('Not all fluxes are specified in measRates.\n')
return flag
def check_balanced_metabolites(data_dict: dict) -> bool:
"""
Checks if metabolites that are both consumed and produced in the stoichiometric matrix are marked as balanced and
the other way around. Checking for mass balances is more accurate though.
If everything is fine flag is 0, otherwise it is set to 1.
Args:
data_dict: a dictionary that represents the excel file with the GRASP model.
Returns:
Whether or not metabolites are marked balanced/fixed correctly.
"""
print('\nChecking if metabolites are both consumed and produced in the stoichiometric matrix, and if', 'so checks if they are marked as balanced in the mets sheet. However, the metabolite might be', 'balanced/not balanced anyways depending on the flux of the reactions that consume/produce it,', 'so take this with a grain of salt.\n')
flag = False
stoic_df = data_dict['stoic']
mets_df = data_dict['mets']
for (i, met) in enumerate(stoic_df.columns):
if stoic_df[met].gt(0).any() and stoic_df[met].lt(0).any():
if mets_df['balanced?'][i] == 0:
print(f'{met} is marked as not balanced but it seems to be balanced.')
flag = True
elif mets_df['balanced?'][i] == 1:
print(f'{met} is marked as balanced but it does not seem to be balanced.')
flag = True
if flag is False:
print('Everything seems to be OK.')
return flag
|
def sum_of_digits(number):
"""
Calculating sum of digits of number
"""
sum = 0
number = abs(number)
while number > 0:
sum += number % 10
number = number // 10
return sum
def to_digits(number):
"""
Calculating the digits of the number
"""
digits = []
while number > 0:
digits.append(number % 10)
number = number // 10
digits.reverse()
return digits
def to_number(digits):
"""
Returning number containing digits
"""
number = 0
digits.reverse()
for digit_index in range(0, len(digits)):
number += digits[digit_index] * 10 ** digit_index
return number
def count_vowels(string):
"""
Calculating vowels
"""
vowels = "aeiouy"
return calculate_char_occurrences_in_str(vowels, string)
def count_consonants(string):
"""
Calculating consonants
"""
consonants = "bcdfghjklmnpqrstvwxz"
return calculate_char_occurrences_in_str(consonants, string)
def calculate_char_occurrences_in_str(characters, string):
"""
Calculating the occurrences
"""
occurrences = 0
string = string.casefold()
for character in characters:
occurrences += string.count(character)
return occurrences
def prime_number(number):
"""
Checks if a number is prime Checking for prime numbers
"""
for i in range(2, number - 1):
if number % i == 0:
return False
return number >= 1
def fact_digits(number):
"""
Calculating the sum of the factorials
"""
sum_fact = 0
for digit in to_digits(number):
sum_fact += fact(digit)
return sum_fact
def fact(number):
"""
Calculating the factorial of a number
"""
result = 1
for number in range(1, number + 1):
result *= number
return result
def fibonacci(elements_num):
"""
Calculating fibonacci sequence
"""
sequence = []
for i in range(1, elements_num + 1):
if i <= 2:
sequence.append(1)
continue
next_num = sequence[-2] + sequence[-1]
sequence.append(next_num)
return sequence
def fib_number(elements_num):
"""
Calculating fibonacci sequence
"""
string = ""
for number in fibonacci(elements_num):
string += str(number)
return int(string)
def palindrome(input):
"""
Checking for palindrome
"""
input = str(input)
return input[::-1] == input
def char_histogram(string):
"""
Map with characters
"""
result = {}
for char in string:
result[char] = string.count(char)
return result
|
def sum_of_digits(number):
"""
Calculating sum of digits of number
"""
sum = 0
number = abs(number)
while number > 0:
sum += number % 10
number = number // 10
return sum
def to_digits(number):
"""
Calculating the digits of the number
"""
digits = []
while number > 0:
digits.append(number % 10)
number = number // 10
digits.reverse()
return digits
def to_number(digits):
"""
Returning number containing digits
"""
number = 0
digits.reverse()
for digit_index in range(0, len(digits)):
number += digits[digit_index] * 10 ** digit_index
return number
def count_vowels(string):
"""
Calculating vowels
"""
vowels = 'aeiouy'
return calculate_char_occurrences_in_str(vowels, string)
def count_consonants(string):
"""
Calculating consonants
"""
consonants = 'bcdfghjklmnpqrstvwxz'
return calculate_char_occurrences_in_str(consonants, string)
def calculate_char_occurrences_in_str(characters, string):
"""
Calculating the occurrences
"""
occurrences = 0
string = string.casefold()
for character in characters:
occurrences += string.count(character)
return occurrences
def prime_number(number):
"""
Checks if a number is prime Checking for prime numbers
"""
for i in range(2, number - 1):
if number % i == 0:
return False
return number >= 1
def fact_digits(number):
"""
Calculating the sum of the factorials
"""
sum_fact = 0
for digit in to_digits(number):
sum_fact += fact(digit)
return sum_fact
def fact(number):
"""
Calculating the factorial of a number
"""
result = 1
for number in range(1, number + 1):
result *= number
return result
def fibonacci(elements_num):
"""
Calculating fibonacci sequence
"""
sequence = []
for i in range(1, elements_num + 1):
if i <= 2:
sequence.append(1)
continue
next_num = sequence[-2] + sequence[-1]
sequence.append(next_num)
return sequence
def fib_number(elements_num):
"""
Calculating fibonacci sequence
"""
string = ''
for number in fibonacci(elements_num):
string += str(number)
return int(string)
def palindrome(input):
"""
Checking for palindrome
"""
input = str(input)
return input[::-1] == input
def char_histogram(string):
"""
Map with characters
"""
result = {}
for char in string:
result[char] = string.count(char)
return result
|
NUM_ALLELES = 3
ALLELE_PRIOR = 1.0 / NUM_ALLELES
ALPHA = 1.5
MINUS_INFINITE = -1000000000
mBound = 6
jA = 10.0
jB = 0.5
pA = 0.1
pD = 0.1
pC = 1.0 - pD
pI = 0.1
if __name__ == '__main__':
print('This is a configuration file!')
|
num_alleles = 3
allele_prior = 1.0 / NUM_ALLELES
alpha = 1.5
minus_infinite = -1000000000
m_bound = 6
j_a = 10.0
j_b = 0.5
p_a = 0.1
p_d = 0.1
p_c = 1.0 - pD
p_i = 0.1
if __name__ == '__main__':
print('This is a configuration file!')
|
class A:
def feature1(self):
print("Feature 1 working")
def feature2(self):
print("Feature 2 working")
a1 = A()
a1.feature1()
class B(A):
def feature3(self):
print("feature 3 working")
def feature4(self):
print("feature 4 working")
b1 = B()
b1.feature2()
|
class A:
def feature1(self):
print('Feature 1 working')
def feature2(self):
print('Feature 2 working')
a1 = a()
a1.feature1()
class B(A):
def feature3(self):
print('feature 3 working')
def feature4(self):
print('feature 4 working')
b1 = b()
b1.feature2()
|
# Application Install Directory (Relative to Inside Container)
SNODAS_APP = '/app/cumulus/snodas/core'
# Archive of UNMASKED files downloaded from NSIDC
SNODAS_RAW_UNMASKED = '/app/data/snodas/raw_unmasked'
# Archive of MASKED files downloaded from NSIDC
SNODAS_RAW_MASKED = '/app/data/snodas/raw_masked'
|
snodas_app = '/app/cumulus/snodas/core'
snodas_raw_unmasked = '/app/data/snodas/raw_unmasked'
snodas_raw_masked = '/app/data/snodas/raw_masked'
|
expected_output = {
'vrf': {
'VRF501': {
'address_family': {
'ipv4': {
'routes': {
'192.168.111.1/32': {
'route': '192.168.111.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'Loopback501': {
'outgoing_interface': 'Loopback501',
'updated': '1d22h'
},
},
},
},
'192.168.4.0/24': {
'route': '192.168.4.0/24',
'active': True,
'source_protocol_codes': 'C',
'source_protocol': 'connected',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.501': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.501',
'updated': '20:03:59'
},
},
},
},
'192.168.4.1/32': {
'route': '192.168.4.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.501': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.501',
'updated': '20:03:59'
},
},
},
},
},
},
},
'last_resort': {
'gateway': 'not set'
},
},
'VRF502': {
'address_family': {
'ipv4': {
'routes': {
'10.144.0.0/24': {
'route': '10.144.0.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'10.144.1.0/24': {
'route': '10.144.1.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'10.144.2.0/24': {
'route': '10.144.2.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'192.168.4.1/32': {
'route': '192.168.4.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'Loopback502': {
'outgoing_interface': 'Loopback502',
'updated': '1d22h'
},
},
},
},
'192.168.154.0/24': {
'route': '192.168.154.0/24',
'active': True,
'source_protocol_codes': 'C',
'source_protocol': 'connected',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.502': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.502',
'updated': '20:03:59'
},
},
},
},
'192.168.154.1/32': {
'route': '192.168.154.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.502': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.502',
'updated': '20:03:59'
},
},
},
},
},
},
},
'last_resort': {
'gateway': 'not set'
},
},
},
}
|
expected_output = {'vrf': {'VRF501': {'address_family': {'ipv4': {'routes': {'192.168.111.1/32': {'route': '192.168.111.1/32', 'active': True, 'source_protocol_codes': 'L', 'source_protocol': 'local', 'next_hop': {'outgoing_interface': {'Loopback501': {'outgoing_interface': 'Loopback501', 'updated': '1d22h'}}}}, '192.168.4.0/24': {'route': '192.168.4.0/24', 'active': True, 'source_protocol_codes': 'C', 'source_protocol': 'connected', 'next_hop': {'outgoing_interface': {'GigabitEthernet0/0/0/0.501': {'outgoing_interface': 'GigabitEthernet0/0/0/0.501', 'updated': '20:03:59'}}}}, '192.168.4.1/32': {'route': '192.168.4.1/32', 'active': True, 'source_protocol_codes': 'L', 'source_protocol': 'local', 'next_hop': {'outgoing_interface': {'GigabitEthernet0/0/0/0.501': {'outgoing_interface': 'GigabitEthernet0/0/0/0.501', 'updated': '20:03:59'}}}}}}}, 'last_resort': {'gateway': 'not set'}}, 'VRF502': {'address_family': {'ipv4': {'routes': {'10.144.0.0/24': {'route': '10.144.0.0/24', 'active': True, 'source_protocol_codes': 'B', 'source_protocol': 'bgp', 'route_preference': 20, 'metric': 0, 'next_hop': {'next_hop_list': {1: {'index': 1, 'next_hop': '192.168.154.2', 'updated': '19:38:48'}}}}, '10.144.1.0/24': {'route': '10.144.1.0/24', 'active': True, 'source_protocol_codes': 'B', 'source_protocol': 'bgp', 'route_preference': 20, 'metric': 0, 'next_hop': {'next_hop_list': {1: {'index': 1, 'next_hop': '192.168.154.2', 'updated': '19:38:48'}}}}, '10.144.2.0/24': {'route': '10.144.2.0/24', 'active': True, 'source_protocol_codes': 'B', 'source_protocol': 'bgp', 'route_preference': 20, 'metric': 0, 'next_hop': {'next_hop_list': {1: {'index': 1, 'next_hop': '192.168.154.2', 'updated': '19:38:48'}}}}, '192.168.4.1/32': {'route': '192.168.4.1/32', 'active': True, 'source_protocol_codes': 'L', 'source_protocol': 'local', 'next_hop': {'outgoing_interface': {'Loopback502': {'outgoing_interface': 'Loopback502', 'updated': '1d22h'}}}}, '192.168.154.0/24': {'route': '192.168.154.0/24', 'active': True, 'source_protocol_codes': 'C', 'source_protocol': 'connected', 'next_hop': {'outgoing_interface': {'GigabitEthernet0/0/0/0.502': {'outgoing_interface': 'GigabitEthernet0/0/0/0.502', 'updated': '20:03:59'}}}}, '192.168.154.1/32': {'route': '192.168.154.1/32', 'active': True, 'source_protocol_codes': 'L', 'source_protocol': 'local', 'next_hop': {'outgoing_interface': {'GigabitEthernet0/0/0/0.502': {'outgoing_interface': 'GigabitEthernet0/0/0/0.502', 'updated': '20:03:59'}}}}}}}, 'last_resort': {'gateway': 'not set'}}}}
|
class Node:
def __init__(self, name=None, terminal=False):
self._name = name
self._children = []
self._level = None
self._terminal = terminal
# ====================
# GETTERS E SETTERS
@property
def name(self):
return self._name
@name.setter
def name(self, value):
self._name = value
@property
def terminal(self):
return self._terminal
@terminal.setter
def terminal(self, value):
self._terminal = value
@property
def level(self):
return self._level
@level.setter
def level(self, value):
self._level = value
@property
def children(self):
return self._children
@children.setter
def children(self, child):
self._children.append(child)
|
class Node:
def __init__(self, name=None, terminal=False):
self._name = name
self._children = []
self._level = None
self._terminal = terminal
@property
def name(self):
return self._name
@name.setter
def name(self, value):
self._name = value
@property
def terminal(self):
return self._terminal
@terminal.setter
def terminal(self, value):
self._terminal = value
@property
def level(self):
return self._level
@level.setter
def level(self, value):
self._level = value
@property
def children(self):
return self._children
@children.setter
def children(self, child):
self._children.append(child)
|
def get_all_includes(comp_args, dst_includes):
i = 0
while i < len(comp_args):
curr_arg = comp_args[i].strip()
if curr_arg == "-isystem":
curr_arg1 = "-I" + comp_args[i+1].strip()
if curr_arg1 not in dst_includes:
dst_includes.append(curr_arg1)
if curr_arg == "-include":
curr_arg1 = comp_args[i+1].strip()
if "dhd_sec_feature.h" not in curr_arg1:
final_arg = curr_arg + " " + curr_arg1
if final_arg not in dst_includes:
dst_includes.append(final_arg)
if curr_arg[0:2] == "-I":
if curr_arg not in dst_includes:
if 'drivers' not in curr_arg and 'sound' not in curr_arg:
dst_includes.append(curr_arg)
i += 1
|
def get_all_includes(comp_args, dst_includes):
i = 0
while i < len(comp_args):
curr_arg = comp_args[i].strip()
if curr_arg == '-isystem':
curr_arg1 = '-I' + comp_args[i + 1].strip()
if curr_arg1 not in dst_includes:
dst_includes.append(curr_arg1)
if curr_arg == '-include':
curr_arg1 = comp_args[i + 1].strip()
if 'dhd_sec_feature.h' not in curr_arg1:
final_arg = curr_arg + ' ' + curr_arg1
if final_arg not in dst_includes:
dst_includes.append(final_arg)
if curr_arg[0:2] == '-I':
if curr_arg not in dst_includes:
if 'drivers' not in curr_arg and 'sound' not in curr_arg:
dst_includes.append(curr_arg)
i += 1
|
def push(data_json):
# A user pushes 1 or more commits to a repository.
repository = data_json['repository']
# repository_scm = repository['scm']
repository_name = repository['name']
repository_link = repository['links']['html']['href']
actor = data_json['actor']
actor_name = actor['display_name']
actor_profile = actor['links']['html']['href']
pushh = data_json['push']['changes'][0]
push_forced = pushh['forced']
push_created = pushh['created']
push_truncated = pushh['truncated']
push_closed = pushh['closed']
push_commits_all = pushh['commits']
commits_str = ""
for commit in push_commits_all:
commit_hash = commit['hash']
if len(commit_hash) > 7:
commit_hash = commit_hash[:7]
commit_link = commit['links']['html']['href']
# commit_summary = commit['summary']['raw']
commit_message = commit['message']
# commit_author_name = commit['author']['user']['display_name']
# commit_author_link = commit['author']['user']['links']['html']['href']
commits_str += '\n\t#{} [{}]({}) \n=> _{}_'.format(push_commits_all.index(commit),
commit_hash, commit_link,
commit_message)
push_link = pushh['links']['html']['href']
push_new = pushh['new']
push_old = pushh['old']
message = "[{}]({}) pushed to [{}]({})" \
" \nCompare: [compare]({})" \
" \nCommits: \n{}".format(actor_name,
actor_profile,
repository_name,
repository_link,
push_link,
commits_str
)
return message
|
def push(data_json):
repository = data_json['repository']
repository_name = repository['name']
repository_link = repository['links']['html']['href']
actor = data_json['actor']
actor_name = actor['display_name']
actor_profile = actor['links']['html']['href']
pushh = data_json['push']['changes'][0]
push_forced = pushh['forced']
push_created = pushh['created']
push_truncated = pushh['truncated']
push_closed = pushh['closed']
push_commits_all = pushh['commits']
commits_str = ''
for commit in push_commits_all:
commit_hash = commit['hash']
if len(commit_hash) > 7:
commit_hash = commit_hash[:7]
commit_link = commit['links']['html']['href']
commit_message = commit['message']
commits_str += '\n\t#{} [{}]({}) \n=> _{}_'.format(push_commits_all.index(commit), commit_hash, commit_link, commit_message)
push_link = pushh['links']['html']['href']
push_new = pushh['new']
push_old = pushh['old']
message = '[{}]({}) pushed to [{}]({}) \nCompare: [compare]({}) \nCommits: \n{}'.format(actor_name, actor_profile, repository_name, repository_link, push_link, commits_str)
return message
|
"""
Messages for the :mod:`~django_dicom.models.managers` module.
"""
DATA_ELEMENT_CREATION_FAILURE = (
"Failed to create DataElement instance for:\n{data_element}\n{exception}"
)
HEADER_CREATION_FAILURE = "Failed to read header information!\n{exception}"
IMPORT_ERROR = (
"Failed to import {path}\nThe following exception was raised: {exception}"
)
PATIENT_UID_MISMATCH = "Patient UID mismatch! Image {image_uid} is associated with patient {db_value} in the database, but the provided header shows {patient_uid}"
SERVER_START = "Starting {n_servers} DICOM storage service class providers..."
# flake8: noqa: E501
|
"""
Messages for the :mod:`~django_dicom.models.managers` module.
"""
data_element_creation_failure = 'Failed to create DataElement instance for:\n{data_element}\n{exception}'
header_creation_failure = 'Failed to read header information!\n{exception}'
import_error = 'Failed to import {path}\nThe following exception was raised: {exception}'
patient_uid_mismatch = 'Patient UID mismatch! Image {image_uid} is associated with patient {db_value} in the database, but the provided header shows {patient_uid}'
server_start = 'Starting {n_servers} DICOM storage service class providers...'
|
class LifeCycle:
def __init__(self, id, label, composed_of):
self.id = id
self.label = label
self.composed_of = composed_of
|
class Lifecycle:
def __init__(self, id, label, composed_of):
self.id = id
self.label = label
self.composed_of = composed_of
|
a = []
maximum = 0
for _ in range(6):
tmp = [int(x) for x in str(input()).split(" ")]
a.append(tmp)
for i in range(6):
for j in range(6):
if (j + 2 < 6) and (i + 2 < 6):
result = a[i][j] + a[i][j+1] + a[i][j+2] + a[i+1][j+1] + a[i+2][j] + a[i+2][j+1] + a[i+2][j+2]
if(result > maximum):
maximum = result
print(maximum)
|
a = []
maximum = 0
for _ in range(6):
tmp = [int(x) for x in str(input()).split(' ')]
a.append(tmp)
for i in range(6):
for j in range(6):
if j + 2 < 6 and i + 2 < 6:
result = a[i][j] + a[i][j + 1] + a[i][j + 2] + a[i + 1][j + 1] + a[i + 2][j] + a[i + 2][j + 1] + a[i + 2][j + 2]
if result > maximum:
maximum = result
print(maximum)
|
def NumpyInList(array,l1):
for i in l1:
if i[0] == array[0] and i[1] == array[1]:
return True
return False
|
def numpy_in_list(array, l1):
for i in l1:
if i[0] == array[0] and i[1] == array[1]:
return True
return False
|
def create_matrix(size):
matrix = []
for _ in range(size):
matrix.append([int(x) for x in input().split()])
return matrix
def is_valid_cell(position, size):
row = position[0]
col = position[1]
return 0 <= row < size and 0 <= col < size
def print_matrix(matrix):
for row in matrix:
print(' '.join([str(x) for x in row]))
def count_alive_cells_and_sum_them(matrix, size):
alive_cells_count = 0
alive_cells_sum = 0
for r in range(size):
for c in range(size):
if matrix[r][c] > 0:
alive_cells_count += 1
alive_cells_sum += matrix[r][c]
return alive_cells_count, alive_cells_sum
size = int(input())
matrix = create_matrix(size)
base_matrix = matrix
bomb_coordinates = input().split()
target_rows = [-1, -1, -1, 0, 1, 1, 1, 0]
target_cols = [-1, 0, 1, 1, 1, 0, -1, -1]
for row_col in bomb_coordinates:
tokens = row_col.split(',')
row, col = int(tokens[0]), int(tokens[1])
current_bomb = base_matrix[row][col]
if base_matrix[row][col] > 0:
for i in range(8):
bombed_cell_position = [row + target_rows[i], col + target_cols[i]]
if is_valid_cell(bombed_cell_position, size):
cell_row = bombed_cell_position[0]
cell_col = bombed_cell_position[1]
if matrix[cell_row][cell_col] > 0:
matrix[cell_row][cell_col] -= current_bomb
matrix[row][col] = 0
base_matrix[row][col] = 0
alive_cells_count, alive_cells_sum = count_alive_cells_and_sum_them(matrix, size)
print(f"Alive cells: {alive_cells_count}")
print(f"Sum: {alive_cells_sum}")
print_matrix(matrix)
|
def create_matrix(size):
matrix = []
for _ in range(size):
matrix.append([int(x) for x in input().split()])
return matrix
def is_valid_cell(position, size):
row = position[0]
col = position[1]
return 0 <= row < size and 0 <= col < size
def print_matrix(matrix):
for row in matrix:
print(' '.join([str(x) for x in row]))
def count_alive_cells_and_sum_them(matrix, size):
alive_cells_count = 0
alive_cells_sum = 0
for r in range(size):
for c in range(size):
if matrix[r][c] > 0:
alive_cells_count += 1
alive_cells_sum += matrix[r][c]
return (alive_cells_count, alive_cells_sum)
size = int(input())
matrix = create_matrix(size)
base_matrix = matrix
bomb_coordinates = input().split()
target_rows = [-1, -1, -1, 0, 1, 1, 1, 0]
target_cols = [-1, 0, 1, 1, 1, 0, -1, -1]
for row_col in bomb_coordinates:
tokens = row_col.split(',')
(row, col) = (int(tokens[0]), int(tokens[1]))
current_bomb = base_matrix[row][col]
if base_matrix[row][col] > 0:
for i in range(8):
bombed_cell_position = [row + target_rows[i], col + target_cols[i]]
if is_valid_cell(bombed_cell_position, size):
cell_row = bombed_cell_position[0]
cell_col = bombed_cell_position[1]
if matrix[cell_row][cell_col] > 0:
matrix[cell_row][cell_col] -= current_bomb
matrix[row][col] = 0
base_matrix[row][col] = 0
(alive_cells_count, alive_cells_sum) = count_alive_cells_and_sum_them(matrix, size)
print(f'Alive cells: {alive_cells_count}')
print(f'Sum: {alive_cells_sum}')
print_matrix(matrix)
|
load(
"@io_bazel_rules_dotnet//dotnet/private:context.bzl",
"dotnet_context",
)
load(
"@io_bazel_rules_dotnet//dotnet/private:providers.bzl",
"DotnetLibrary",
)
load("@io_bazel_rules_dotnet//dotnet/private:rules/common.bzl", "collect_transitive_info")
def _libraryset_impl(ctx):
"""_libraryset_impl implements the set of libraries."""
dotnet = dotnet_context(ctx)
name = ctx.label.name
# Handle case of empty toolchain on linux and darwin
if dotnet.assembly == None:
library = dotnet.new_library(dotnet = dotnet)
return [library]
(transitive_refs, transitive_runfiles, transitive_deps) = collect_transitive_info(ctx.attr.deps)
library = dotnet.new_library(
dotnet = dotnet,
name = name,
deps = ctx.attr.deps,
transitive = transitive_deps,
runfiles = transitive_runfiles,
transitive_refs = transitive_refs,
)
return [
library,
DefaultInfo(
runfiles = ctx.runfiles(files = [], transitive_files = library.runfiles),
),
]
dotnet_libraryset = rule(
_libraryset_impl,
attrs = {
"deps": attr.label_list(providers = [DotnetLibrary]),
"dotnet_context_data": attr.label(default = Label("@io_bazel_rules_dotnet//:dotnet_context_data")),
},
toolchains = ["@io_bazel_rules_dotnet//dotnet:toolchain"],
executable = False,
)
core_libraryset = rule(
_libraryset_impl,
attrs = {
"deps": attr.label_list(providers = [DotnetLibrary]),
"dotnet_context_data": attr.label(default = Label("@io_bazel_rules_dotnet//:core_context_data")),
},
toolchains = ["@io_bazel_rules_dotnet//dotnet:toolchain_core"],
executable = False,
)
net_libraryset = rule(
_libraryset_impl,
attrs = {
"deps": attr.label_list(providers = [DotnetLibrary]),
"dotnet_context_data": attr.label(default = Label("@io_bazel_rules_dotnet//:net_context_data")),
},
toolchains = ["@io_bazel_rules_dotnet//dotnet:toolchain_net"],
executable = False,
)
|
load('@io_bazel_rules_dotnet//dotnet/private:context.bzl', 'dotnet_context')
load('@io_bazel_rules_dotnet//dotnet/private:providers.bzl', 'DotnetLibrary')
load('@io_bazel_rules_dotnet//dotnet/private:rules/common.bzl', 'collect_transitive_info')
def _libraryset_impl(ctx):
"""_libraryset_impl implements the set of libraries."""
dotnet = dotnet_context(ctx)
name = ctx.label.name
if dotnet.assembly == None:
library = dotnet.new_library(dotnet=dotnet)
return [library]
(transitive_refs, transitive_runfiles, transitive_deps) = collect_transitive_info(ctx.attr.deps)
library = dotnet.new_library(dotnet=dotnet, name=name, deps=ctx.attr.deps, transitive=transitive_deps, runfiles=transitive_runfiles, transitive_refs=transitive_refs)
return [library, default_info(runfiles=ctx.runfiles(files=[], transitive_files=library.runfiles))]
dotnet_libraryset = rule(_libraryset_impl, attrs={'deps': attr.label_list(providers=[DotnetLibrary]), 'dotnet_context_data': attr.label(default=label('@io_bazel_rules_dotnet//:dotnet_context_data'))}, toolchains=['@io_bazel_rules_dotnet//dotnet:toolchain'], executable=False)
core_libraryset = rule(_libraryset_impl, attrs={'deps': attr.label_list(providers=[DotnetLibrary]), 'dotnet_context_data': attr.label(default=label('@io_bazel_rules_dotnet//:core_context_data'))}, toolchains=['@io_bazel_rules_dotnet//dotnet:toolchain_core'], executable=False)
net_libraryset = rule(_libraryset_impl, attrs={'deps': attr.label_list(providers=[DotnetLibrary]), 'dotnet_context_data': attr.label(default=label('@io_bazel_rules_dotnet//:net_context_data'))}, toolchains=['@io_bazel_rules_dotnet//dotnet:toolchain_net'], executable=False)
|
# Basic syntax
#T# Table of contents
#C# Blocks of code
#C# Variables, constants, literals
#C# - Type hints
#C# Escape sequences and escaped chars
#C# Expressions
#C# Function calls
#C# Statements
#C# Multiline statements
#C# Multistatement lines
#C# Metadata
#T# Beginning of content
# |-------------------------------------------------------------
#T# run a Python file /path/to/file1.py in the operating system shell with
# SYNTAX python3 /path/to/file1.py
#T# output variables to stdout with the print function
# SYNTAX print(var1, var2, var3)
#T# the same can be done by simply typing the variable's name in the Python prompt
# SYNTAX var1
#T# get help about a symbol or name (function, attribute, etc.) with the help function, used in a script or in the Python prompt
# SYNTAX help(name1)
help(round)
# |-------------------------------------------------------------
#C# Blocks of code
# |-------------------------------------------------------------
#T# indentation acts as the delimiter (like braces)
if True:
int1 = 70
# |-------------------------------------------------------------
#C# Variables, constants, literals
# |-------------------------------------------------------------
#T# variables are dynamically typed. Literals are characters, numbers
str1 = 'str'
int1 = 5
#T# variable identifiers can only contain letters, numbers, and the underscore
var_aux1 = 0
#T# strings are created within quotation symbols, each quotation symbol type can be used inside the others as a normal character
str1 = 'sen1word1 sen1""""word2 sen1word3 sen1word4'
str1 = "sen2word1 sen2''''word2 sen2word3 sen2word4"
str1 = """sen3word1 sen3"'"'word2
sen3word3 sen3word4"""
#C# - Type hints
# |-----
#T# type hints are used when there is no autocompletion for an object that should have, this is because the type of a dynamic type can't be known at compile time
# SYNTAX obj1 = Constructor1() # type: Object_type1
#T# the type hint is written after the comment, the autocompletion of obj1 follows the type Object_type1
var1 = 8 # type: str
# var1. autocompletes as a string
# |-----
# |-------------------------------------------------------------
#C# Escape sequences and escaped chars
# |-------------------------------------------------------------
#T# an special kind of combination of literals are escape sequences and escaped chars, escape sequences mean something particular, e.g. the \n means newline, escaped chars make operators to become literals, e.g. the {{ makes a single curly brace to be taken literally
# SYNTAX \char1
#T# an escape starts with a backslash \ and is followed by char1 which is other character or characters, most commonly char1 is a single character
# SYNTAX {{
# SYNTAX }}
#T# in interpolated strings, duplicating the curly braces escapes them
str1 = f"Line1\n{{Line2}}"
#T# printing str1 gives the following
# Line1
# {Line2}
# |-------------------------------------------------------------
#C# Expressions
# |-------------------------------------------------------------
#T# expressions are evaluated and return a value
int1 = 5 + 3 - 7 # 1
# |-------------------------------------------------------------
#C# Function calls
# |-------------------------------------------------------------
#T# a function call is made with the function name followed by a pair of parentheses that contain the arguments separated by comma
#T# the function name can be separated by whitespace (but not a newline) from the arguments in parentheses
#T# basic output to stdout is done with the print function
print("Hello, Python!")
#T# basic input from stdin is done with the input function
var1 = input ("\nPlease enter var1 as input\n")
#T# the arguments to a function contain positional arguments and kwarg pairs
# SYNTAX func1(pos1, pos2, kwarg1 = value1, kwarg2 = value2)
# SYNTAX func1(pos1, pos2, kwargs1)
#T# pos1 and pos2 represent positional arguments so they must be written in that order of positions at the start of the parentheses
#T# kwarg1 = value1, and kwarg2 = value2 are kwarg value pairs that allow naming arguments, these can be written in any order
#T# kwargs1 are the kwarg value pairs, this is a shorthand notation to indicate the kwarg value pairs without writing them one by one
str1 = 'string to print'
print(str1, end = '\n') #| str1 is a positional argument, and the end kwarg is used to set the character at the end of the string
#T# a function signature is a short way to write how to use a function, commonly it contains the return value, the function name, and the arguments, which is the minimum needed
# SYNTAX value1 = func1(arg1, arg2, arg3)
# |-------------------------------------------------------------
#C# Statements
# |-------------------------------------------------------------
#T# a statement is a complete instruction
int1 = 5
#T# int1 = 5 is a statement, the variable int1 is made to point to the value 5
#T# the dot notation is used to access the namespace of an object
# SYNTAX obj1.name1.name2
#T# here the object obj1 has name1 in its namespace, and name1 has name2 in its namespace
int1 = 5
int1 = int1.bit_length() # 3
#T# the bit_length function is accessed using dot notation on an integer
#T# the pass keyword is used to create a no-op statement that does nothing, as a filler
pass
# |-------------------------------------------------------------
#C# Multiline statements
# |-------------------------------------------------------------
#T# a multiline statement is created with a backslash at the end of each line, a list can be continued without a comma at the end of the line
int1 = 5 + 6 + \
3 + 7 # 21
list1 = ['Mon', 'Wed'
'Fri', 'Sun']
# |-------------------------------------------------------------
#C# Multistatement lines
# |-------------------------------------------------------------
#T# multiple statements in the same line are separated with a semicolon
int1 = 9; int2 = 7; int3 = 0
# |-------------------------------------------------------------
#C# Metadata
# |-------------------------------------------------------------
#T# the character encoding of a python file can be declared with the `coding` metadata placed at the start of the file, for example:
# coding=utf-8
# |-------------------------------------------------------------
|
help(round)
if True:
int1 = 70
str1 = 'str'
int1 = 5
var_aux1 = 0
str1 = 'sen1word1 sen1""""word2 sen1word3 sen1word4'
str1 = "sen2word1 sen2''''word2 sen2word3 sen2word4"
str1 = 'sen3word1 sen3"\'"\'word2\n sen3word3 sen3word4'
var1 = 8
str1 = f'Line1\n{{Line2}}'
int1 = 5 + 3 - 7
print('Hello, Python!')
var1 = input('\nPlease enter var1 as input\n')
str1 = 'string to print'
print(str1, end='\n')
int1 = 5
int1 = 5
int1 = int1.bit_length()
pass
int1 = 5 + 6 + 3 + 7
list1 = ['Mon', 'WedFri', 'Sun']
int1 = 9
int2 = 7
int3 = 0
|
"""
Given a number, return a string with dash `'-'` marks before and after each odd integer, but do not begin or end the string with a dash mark.
"""
def dashatize(num):
if not num and not (num == 0):
return 'None'
result = '-'.join(str(abs(num)))
copy_result = result[:]
occurrences = 0
for index, value in enumerate(result):
if value == '-':
# Check if there is need to be a '-' here.
if int(result[index - 1]) % 2 == 0 and int(result[index + 1]) % 2 == 0:
copy_result = copy_result[:index - occurrences] + copy_result[index + 1 - occurrences:]
occurrences += 1
return copy_result
|
"""
Given a number, return a string with dash `'-'` marks before and after each odd integer, but do not begin or end the string with a dash mark.
"""
def dashatize(num):
if not num and (not num == 0):
return 'None'
result = '-'.join(str(abs(num)))
copy_result = result[:]
occurrences = 0
for (index, value) in enumerate(result):
if value == '-':
if int(result[index - 1]) % 2 == 0 and int(result[index + 1]) % 2 == 0:
copy_result = copy_result[:index - occurrences] + copy_result[index + 1 - occurrences:]
occurrences += 1
return copy_result
|
(rows_count, columns_count) = map(int, input().split())
matrix = []
new_matrix = []
player_position = []
player_wins = False
for i in range(rows_count):
row = [x for x in input()]
if "P" in row:
player_position = [i, row.index("P")]
row[row.index("P")] = "."
row2 = row.copy()
matrix.append(row)
new_matrix.append(row2)
commands = list(input())
for command in commands:
next_player_position = []
if command == "U":
next_player_position = [player_position[0] - 1, player_position[1]]
elif command == "D":
next_player_position = [player_position[0] + 1, player_position[1]]
elif command == "L":
next_player_position = [player_position[0], player_position[1] - 1]
elif command == "R":
next_player_position = [player_position[0], player_position[1] + 1]
for r in range(rows_count):
for ch in range(columns_count):
if matrix[r][ch] == "B":
if r - 1 >= 0:
new_matrix[r - 1][ch] = "B"
if ch - 1 >= 0:
new_matrix[r][ch - 1] = "B"
if ch + 1 < columns_count:
new_matrix[r][ch + 1] = "B"
if r + 1 < rows_count:
new_matrix[r + 1][ch] = "B"
matrix = [x.copy() for x in new_matrix]
if 0 <= next_player_position[0] <= rows_count - 1 and 0 <= next_player_position[1] <= columns_count - 1:
player_position = next_player_position
if matrix[player_position[0]][player_position[1]] == "B":
break
else:
player_wins = True
break
[print("".join(x)) for x in matrix]
if player_wins:
print(f"won: {player_position[0]} {player_position[1]}")
else:
print(f"dead: {player_position[0]} {player_position[1]}")
|
(rows_count, columns_count) = map(int, input().split())
matrix = []
new_matrix = []
player_position = []
player_wins = False
for i in range(rows_count):
row = [x for x in input()]
if 'P' in row:
player_position = [i, row.index('P')]
row[row.index('P')] = '.'
row2 = row.copy()
matrix.append(row)
new_matrix.append(row2)
commands = list(input())
for command in commands:
next_player_position = []
if command == 'U':
next_player_position = [player_position[0] - 1, player_position[1]]
elif command == 'D':
next_player_position = [player_position[0] + 1, player_position[1]]
elif command == 'L':
next_player_position = [player_position[0], player_position[1] - 1]
elif command == 'R':
next_player_position = [player_position[0], player_position[1] + 1]
for r in range(rows_count):
for ch in range(columns_count):
if matrix[r][ch] == 'B':
if r - 1 >= 0:
new_matrix[r - 1][ch] = 'B'
if ch - 1 >= 0:
new_matrix[r][ch - 1] = 'B'
if ch + 1 < columns_count:
new_matrix[r][ch + 1] = 'B'
if r + 1 < rows_count:
new_matrix[r + 1][ch] = 'B'
matrix = [x.copy() for x in new_matrix]
if 0 <= next_player_position[0] <= rows_count - 1 and 0 <= next_player_position[1] <= columns_count - 1:
player_position = next_player_position
if matrix[player_position[0]][player_position[1]] == 'B':
break
else:
player_wins = True
break
[print(''.join(x)) for x in matrix]
if player_wins:
print(f'won: {player_position[0]} {player_position[1]}')
else:
print(f'dead: {player_position[0]} {player_position[1]}')
|
"""django-dmarc-reporting"""
__author__ = "VirtualTam"
__title__ = "django-dmarc-reporting"
__version__ = '0.1'
default_app_config = 'dmarc_reporting.apps.DmarcReportingConfig'
|
"""django-dmarc-reporting"""
__author__ = 'VirtualTam'
__title__ = 'django-dmarc-reporting'
__version__ = '0.1'
default_app_config = 'dmarc_reporting.apps.DmarcReportingConfig'
|
coordinates_FFFFCC = ((149, 117),
(149, 118), (149, 119), (149, 120), (149, 121), (149, 122), (149, 123), (149, 124), (149, 125), (149, 126), (149, 127), (149, 128), (149, 129), (149, 130), (150, 111), (150, 112), (150, 113), (150, 114), (150, 115), (150, 116), (150, 131), (150, 133), (151, 107), (151, 108), (151, 109), (151, 110), (151, 117), (151, 118), (151, 119), (151, 120), (151, 121), (151, 122), (151, 123), (151, 124), (151, 125), (151, 126), (151, 127), (151, 128), (151, 129), (151, 130), (151, 135), (152, 104), (152, 106), (152, 111), (152, 112), (152, 113), (152, 114), (152, 115), (152, 116), (152, 117), (152, 118), (152, 119), (152, 120), (152, 121), (152, 122), (152, 123), (152, 124), (152, 125), (152, 126), (152, 127), (152, 128), (152, 129), (152, 130), (152, 131), (152, 132), (152, 133), (152, 137), (153, 102), (153, 103), (153, 107), (153, 108), (153, 109), (153, 110),
(153, 111), (153, 112), (153, 113), (153, 114), (153, 115), (153, 116), (153, 117), (153, 118), (153, 119), (153, 120), (153, 121), (153, 122), (153, 123), (153, 124), (153, 125), (153, 126), (153, 127), (153, 128), (153, 129), (153, 130), (153, 131), (153, 132), (153, 133), (153, 134), (153, 135), (153, 139), (154, 96), (154, 97), (154, 98), (154, 99), (154, 100), (154, 104), (154, 105), (154, 106), (154, 107), (154, 108), (154, 109), (154, 110), (154, 111), (154, 112), (154, 113), (154, 114), (154, 115), (154, 116), (154, 117), (154, 118), (154, 119), (154, 120), (154, 121), (154, 122), (154, 123), (154, 124), (154, 125), (154, 126), (154, 127), (154, 128), (154, 129), (154, 130), (154, 131), (154, 132), (154, 133), (154, 134), (154, 135), (154, 136), (154, 137), (154, 141), (155, 91), (155, 93), (155, 94), (155, 95), (155, 102), (155, 103),
(155, 104), (155, 105), (155, 106), (155, 107), (155, 108), (155, 109), (155, 110), (155, 111), (155, 112), (155, 113), (155, 114), (155, 115), (155, 116), (155, 117), (155, 118), (155, 119), (155, 120), (155, 121), (155, 122), (155, 123), (155, 124), (155, 125), (155, 126), (155, 127), (155, 128), (155, 129), (155, 130), (155, 131), (155, 132), (155, 133), (155, 134), (155, 135), (155, 136), (155, 137), (155, 138), (155, 139), (155, 143), (156, 90), (156, 96), (156, 97), (156, 98), (156, 99), (156, 100), (156, 101), (156, 102), (156, 103), (156, 104), (156, 105), (156, 106), (156, 107), (156, 108), (156, 109), (156, 110), (156, 111), (156, 112), (156, 113), (156, 114), (156, 115), (156, 116), (156, 117), (156, 118), (156, 119), (156, 120), (156, 121), (156, 122), (156, 123), (156, 124), (156, 125), (156, 126), (156, 127), (156, 128), (156, 129),
(156, 130), (156, 131), (156, 132), (156, 133), (156, 134), (156, 135), (156, 136), (156, 137), (156, 138), (156, 139), (156, 140), (156, 141), (156, 145), (157, 89), (157, 91), (157, 92), (157, 93), (157, 94), (157, 95), (157, 96), (157, 97), (157, 98), (157, 99), (157, 100), (157, 101), (157, 102), (157, 103), (157, 104), (157, 105), (157, 106), (157, 107), (157, 108), (157, 109), (157, 110), (157, 111), (157, 112), (157, 113), (157, 114), (157, 115), (157, 116), (157, 117), (157, 118), (157, 119), (157, 120), (157, 121), (157, 122), (157, 123), (157, 124), (157, 125), (157, 126), (157, 127), (157, 128), (157, 129), (157, 130), (157, 131), (157, 132), (157, 133), (157, 134), (157, 135), (157, 136), (157, 137), (157, 138), (157, 139), (157, 140), (157, 141), (157, 142), (157, 143), (157, 146), (158, 89), (158, 91), (158, 92), (158, 93),
(158, 94), (158, 95), (158, 96), (158, 97), (158, 98), (158, 99), (158, 100), (158, 101), (158, 102), (158, 103), (158, 104), (158, 105), (158, 106), (158, 107), (158, 108), (158, 109), (158, 110), (158, 111), (158, 112), (158, 113), (158, 114), (158, 115), (158, 116), (158, 117), (158, 118), (158, 119), (158, 120), (158, 121), (158, 122), (158, 123), (158, 124), (158, 125), (158, 126), (158, 127), (158, 128), (158, 129), (158, 130), (158, 131), (158, 132), (158, 133), (158, 134), (158, 135), (158, 136), (158, 137), (158, 138), (158, 139), (158, 140), (158, 141), (158, 142), (158, 143), (158, 144), (158, 146), (159, 89), (159, 91), (159, 92), (159, 93), (159, 94), (159, 95), (159, 96), (159, 97), (159, 98), (159, 99), (159, 100), (159, 101), (159, 102), (159, 103), (159, 104), (159, 105), (159, 106), (159, 107), (159, 108), (159, 109),
(159, 110), (159, 111), (159, 112), (159, 113), (159, 114), (159, 115), (159, 116), (159, 117), (159, 118), (159, 119), (159, 120), (159, 121), (159, 122), (159, 123), (159, 124), (159, 125), (159, 126), (159, 127), (159, 128), (159, 129), (159, 130), (159, 131), (159, 132), (159, 133), (159, 134), (159, 135), (159, 136), (159, 137), (159, 138), (159, 139), (159, 140), (159, 141), (159, 142), (159, 146), (160, 88), (160, 90), (160, 91), (160, 92), (160, 93), (160, 94), (160, 95), (160, 96), (160, 97), (160, 98), (160, 99), (160, 100), (160, 101), (160, 102), (160, 103), (160, 104), (160, 105), (160, 106), (160, 107), (160, 108), (160, 109), (160, 110), (160, 111), (160, 112), (160, 113), (160, 114), (160, 115), (160, 116), (160, 117), (160, 118), (160, 119), (160, 120), (160, 121), (160, 122), (160, 123), (160, 124), (160, 125), (160, 126),
(160, 127), (160, 128), (160, 129), (160, 130), (160, 131), (160, 132), (160, 133), (160, 134), (160, 135), (160, 136), (160, 137), (160, 138), (160, 139), (160, 140), (160, 141), (160, 145), (161, 86), (161, 89), (161, 90), (161, 91), (161, 92), (161, 93), (161, 94), (161, 95), (161, 96), (161, 97), (161, 98), (161, 99), (161, 100), (161, 101), (161, 102), (161, 103), (161, 104), (161, 105), (161, 106), (161, 107), (161, 108), (161, 109), (161, 110), (161, 111), (161, 112), (161, 113), (161, 114), (161, 115), (161, 116), (161, 117), (161, 118), (161, 119), (161, 120), (161, 121), (161, 122), (161, 123), (161, 124), (161, 125), (161, 126), (161, 127), (161, 128), (161, 129), (161, 130), (161, 131), (161, 132), (161, 133), (161, 134), (161, 135), (161, 136), (161, 137), (161, 138), (161, 139), (161, 140), (161, 142), (162, 84), (162, 85),
(162, 88), (162, 89), (162, 90), (162, 91), (162, 92), (162, 93), (162, 94), (162, 95), (162, 96), (162, 97), (162, 98), (162, 99), (162, 100), (162, 101), (162, 102), (162, 103), (162, 104), (162, 105), (162, 106), (162, 107), (162, 108), (162, 109), (162, 110), (162, 111), (162, 112), (162, 113), (162, 114), (162, 115), (162, 116), (162, 117), (162, 118), (162, 119), (162, 120), (162, 121), (162, 122), (162, 123), (162, 124), (162, 125), (162, 126), (162, 127), (162, 128), (162, 129), (162, 130), (162, 131), (162, 132), (162, 133), (162, 134), (162, 135), (162, 136), (162, 137), (162, 138), (162, 139), (162, 141), (163, 81), (163, 82), (163, 83), (163, 86), (163, 87), (163, 88), (163, 89), (163, 90), (163, 91), (163, 92), (163, 93), (163, 94), (163, 95), (163, 96), (163, 97), (163, 98), (163, 99), (163, 100), (163, 101),
(163, 102), (163, 103), (163, 104), (163, 105), (163, 106), (163, 107), (163, 108), (163, 109), (163, 110), (163, 111), (163, 112), (163, 113), (163, 114), (163, 115), (163, 116), (163, 117), (163, 118), (163, 119), (163, 120), (163, 121), (163, 122), (163, 123), (163, 124), (163, 125), (163, 126), (163, 127), (163, 128), (163, 129), (163, 130), (163, 131), (163, 132), (163, 133), (163, 134), (163, 135), (163, 136), (163, 137), (163, 138), (163, 140), (164, 76), (164, 77), (164, 78), (164, 79), (164, 84), (164, 85), (164, 86), (164, 87), (164, 88), (164, 89), (164, 90), (164, 91), (164, 92), (164, 93), (164, 94), (164, 95), (164, 96), (164, 97), (164, 98), (164, 99), (164, 100), (164, 101), (164, 102), (164, 103), (164, 104), (164, 105), (164, 106), (164, 107), (164, 108), (164, 109), (164, 110), (164, 111), (164, 112), (164, 113),
(164, 114), (164, 115), (164, 116), (164, 117), (164, 118), (164, 119), (164, 120), (164, 121), (164, 122), (164, 123), (164, 124), (164, 125), (164, 126), (164, 127), (164, 128), (164, 129), (164, 130), (164, 131), (164, 132), (164, 133), (164, 134), (164, 135), (164, 136), (164, 137), (164, 139), (165, 74), (165, 75), (165, 80), (165, 81), (165, 82), (165, 83), (165, 84), (165, 85), (165, 86), (165, 87), (165, 88), (165, 89), (165, 90), (165, 91), (165, 92), (165, 93), (165, 94), (165, 95), (165, 96), (165, 97), (165, 98), (165, 99), (165, 100), (165, 101), (165, 102), (165, 103), (165, 104), (165, 105), (165, 106), (165, 107), (165, 108), (165, 109), (165, 110), (165, 111), (165, 112), (165, 113), (165, 114), (165, 115), (165, 116), (165, 117), (165, 118), (165, 119), (165, 120), (165, 121), (165, 122), (165, 123), (165, 124),
(165, 125), (165, 126), (165, 127), (165, 128), (165, 129), (165, 130), (165, 131), (165, 132), (165, 133), (165, 134), (165, 135), (165, 136), (166, 72), (166, 76), (166, 77), (166, 78), (166, 79), (166, 80), (166, 81), (166, 82), (166, 83), (166, 84), (166, 85), (166, 86), (166, 87), (166, 88), (166, 89), (166, 90), (166, 91), (166, 92), (166, 93), (166, 94), (166, 95), (166, 96), (166, 97), (166, 98), (166, 99), (166, 100), (166, 101), (166, 102), (166, 103), (166, 104), (166, 105), (166, 106), (166, 107), (166, 108), (166, 109), (166, 110), (166, 111), (166, 112), (166, 113), (166, 114), (166, 115), (166, 116), (166, 117), (166, 118), (166, 119), (166, 120), (166, 121), (166, 122), (166, 123), (166, 124), (166, 125), (166, 126), (166, 127), (166, 128), (166, 129), (166, 130), (166, 131), (166, 132), (166, 133), (166, 134),
(166, 135), (166, 136), (166, 138), (167, 70), (167, 74), (167, 75), (167, 76), (167, 77), (167, 78), (167, 79), (167, 80), (167, 81), (167, 82), (167, 83), (167, 84), (167, 85), (167, 86), (167, 87), (167, 88), (167, 89), (167, 90), (167, 91), (167, 92), (167, 93), (167, 94), (167, 95), (167, 96), (167, 97), (167, 98), (167, 99), (167, 100), (167, 101), (167, 102), (167, 103), (167, 104), (167, 105), (167, 106), (167, 107), (167, 108), (167, 109), (167, 110), (167, 111), (167, 112), (167, 113), (167, 114), (167, 115), (167, 116), (167, 117), (167, 118), (167, 119), (167, 120), (167, 121), (167, 122), (167, 123), (167, 124), (167, 125), (167, 126), (167, 127), (167, 128), (167, 129), (167, 130), (167, 131), (167, 132), (167, 133), (167, 134), (167, 135), (167, 137), (168, 68), (168, 69), (168, 72), (168, 73), (168, 74),
(168, 75), (168, 76), (168, 77), (168, 78), (168, 79), (168, 80), (168, 81), (168, 82), (168, 83), (168, 84), (168, 85), (168, 86), (168, 87), (168, 88), (168, 89), (168, 90), (168, 91), (168, 92), (168, 93), (168, 94), (168, 95), (168, 96), (168, 97), (168, 98), (168, 99), (168, 100), (168, 101), (168, 102), (168, 103), (168, 104), (168, 105), (168, 106), (168, 107), (168, 108), (168, 109), (168, 110), (168, 111), (168, 112), (168, 113), (168, 114), (168, 115), (168, 116), (168, 117), (168, 118), (168, 119), (168, 120), (168, 121), (168, 122), (168, 123), (168, 124), (168, 125), (168, 126), (168, 127), (168, 128), (168, 129), (168, 130), (168, 131), (168, 132), (168, 133), (168, 134), (168, 136), (169, 67), (169, 70), (169, 71), (169, 72), (169, 73), (169, 74), (169, 75), (169, 76), (169, 77), (169, 78), (169, 79),
(169, 80), (169, 81), (169, 82), (169, 83), (169, 84), (169, 85), (169, 86), (169, 87), (169, 88), (169, 89), (169, 90), (169, 91), (169, 92), (169, 93), (169, 94), (169, 95), (169, 96), (169, 97), (169, 98), (169, 99), (169, 100), (169, 101), (169, 102), (169, 103), (169, 104), (169, 105), (169, 106), (169, 107), (169, 108), (169, 109), (169, 110), (169, 111), (169, 112), (169, 113), (169, 114), (169, 115), (169, 116), (169, 117), (169, 118), (169, 119), (169, 120), (169, 121), (169, 122), (169, 123), (169, 124), (169, 125), (169, 126), (169, 127), (169, 128), (169, 129), (169, 130), (169, 131), (169, 132), (169, 133), (169, 135), (170, 65), (170, 68), (170, 69), (170, 70), (170, 71), (170, 72), (170, 73), (170, 74), (170, 75), (170, 76), (170, 77), (170, 78), (170, 79), (170, 80), (170, 81), (170, 82), (170, 83),
(170, 84), (170, 85), (170, 86), (170, 87), (170, 88), (170, 89), (170, 90), (170, 91), (170, 92), (170, 93), (170, 94), (170, 95), (170, 96), (170, 97), (170, 98), (170, 99), (170, 100), (170, 101), (170, 102), (170, 103), (170, 104), (170, 105), (170, 106), (170, 107), (170, 108), (170, 109), (170, 110), (170, 111), (170, 112), (170, 113), (170, 114), (170, 115), (170, 116), (170, 117), (170, 118), (170, 119), (170, 120), (170, 121), (170, 122), (170, 123), (170, 124), (170, 125), (170, 126), (170, 127), (170, 128), (170, 129), (170, 130), (170, 131), (170, 132), (170, 133), (170, 135), (171, 64), (171, 67), (171, 68), (171, 69), (171, 70), (171, 71), (171, 72), (171, 73), (171, 74), (171, 75), (171, 76), (171, 77), (171, 78), (171, 79), (171, 80), (171, 81), (171, 82), (171, 83), (171, 84), (171, 85), (171, 86),
(171, 87), (171, 88), (171, 89), (171, 90), (171, 91), (171, 92), (171, 93), (171, 94), (171, 95), (171, 96), (171, 97), (171, 98), (171, 99), (171, 100), (171, 101), (171, 102), (171, 103), (171, 104), (171, 105), (171, 106), (171, 107), (171, 108), (171, 109), (171, 110), (171, 111), (171, 112), (171, 113), (171, 114), (171, 115), (171, 116), (171, 117), (171, 118), (171, 119), (171, 120), (171, 121), (171, 122), (171, 123), (171, 124), (171, 125), (171, 126), (171, 127), (171, 128), (171, 129), (171, 130), (171, 131), (171, 132), (171, 134), (172, 63), (172, 65), (172, 66), (172, 67), (172, 68), (172, 69), (172, 70), (172, 71), (172, 72), (172, 73), (172, 74), (172, 75), (172, 76), (172, 77), (172, 78), (172, 79), (172, 80), (172, 81), (172, 82), (172, 83), (172, 84), (172, 85), (172, 86), (172, 87), (172, 88),
(172, 89), (172, 90), (172, 91), (172, 92), (172, 93), (172, 94), (172, 95), (172, 96), (172, 97), (172, 98), (172, 99), (172, 100), (172, 101), (172, 102), (172, 103), (172, 104), (172, 105), (172, 106), (172, 107), (172, 108), (172, 109), (172, 110), (172, 111), (172, 112), (172, 113), (172, 114), (172, 115), (172, 116), (172, 117), (172, 118), (172, 119), (172, 120), (172, 121), (172, 122), (172, 123), (172, 124), (172, 125), (172, 126), (172, 127), (172, 128), (172, 129), (172, 130), (172, 131), (172, 133), (173, 61), (173, 64), (173, 65), (173, 66), (173, 67), (173, 68), (173, 69), (173, 70), (173, 71), (173, 72), (173, 73), (173, 74), (173, 75), (173, 76), (173, 77), (173, 78), (173, 79), (173, 80), (173, 81), (173, 82), (173, 83), (173, 84), (173, 85), (173, 86), (173, 87), (173, 88), (173, 89), (173, 90),
(173, 91), (173, 92), (173, 93), (173, 94), (173, 95), (173, 96), (173, 97), (173, 98), (173, 99), (173, 100), (173, 101), (173, 102), (173, 103), (173, 104), (173, 105), (173, 106), (173, 107), (173, 108), (173, 109), (173, 110), (173, 111), (173, 112), (173, 113), (173, 114), (173, 115), (173, 116), (173, 117), (173, 118), (173, 119), (173, 120), (173, 121), (173, 122), (173, 123), (173, 124), (173, 125), (173, 126), (173, 127), (173, 128), (173, 129), (173, 130), (173, 132), (174, 60), (174, 63), (174, 64), (174, 65), (174, 66), (174, 67), (174, 68), (174, 69), (174, 70), (174, 71), (174, 72), (174, 73), (174, 74), (174, 75), (174, 76), (174, 77), (174, 78), (174, 79), (174, 80), (174, 81), (174, 82), (174, 83), (174, 84), (174, 85), (174, 86), (174, 87), (174, 88), (174, 89), (174, 90), (174, 91), (174, 92),
(174, 93), (174, 94), (174, 95), (174, 96), (174, 97), (174, 100), (174, 101), (174, 102), (174, 103), (174, 104), (174, 105), (174, 106), (174, 107), (174, 108), (174, 109), (174, 110), (174, 111), (174, 112), (174, 113), (174, 114), (174, 115), (174, 116), (174, 117), (174, 118), (174, 119), (174, 120), (174, 121), (174, 122), (174, 123), (174, 124), (174, 125), (174, 126), (174, 127), (174, 128), (174, 129), (174, 130), (174, 132), (175, 59), (175, 61), (175, 62), (175, 63), (175, 64), (175, 65), (175, 66), (175, 67), (175, 68), (175, 69), (175, 70), (175, 71), (175, 72), (175, 73), (175, 74), (175, 75), (175, 76), (175, 77), (175, 78), (175, 79), (175, 80), (175, 81), (175, 82), (175, 83), (175, 84), (175, 85), (175, 86), (175, 87), (175, 88), (175, 89), (175, 90), (175, 91), (175, 92), (175, 97), (175, 98),
(175, 99), (175, 102), (175, 103), (175, 104), (175, 105), (175, 106), (175, 107), (175, 108), (175, 109), (175, 110), (175, 111), (175, 112), (175, 113), (175, 114), (175, 115), (175, 116), (175, 117), (175, 118), (175, 119), (175, 120), (175, 121), (175, 122), (175, 123), (175, 124), (175, 125), (175, 126), (175, 127), (175, 128), (175, 129), (175, 131), (176, 57), (176, 60), (176, 61), (176, 62), (176, 63), (176, 64), (176, 65), (176, 66), (176, 67), (176, 68), (176, 69), (176, 70), (176, 71), (176, 72), (176, 73), (176, 74), (176, 75), (176, 76), (176, 77), (176, 78), (176, 79), (176, 80), (176, 81), (176, 82), (176, 83), (176, 84), (176, 85), (176, 86), (176, 87), (176, 88), (176, 89), (176, 90), (176, 93), (176, 94), (176, 95), (176, 96), (176, 100), (176, 101), (176, 102), (176, 103), (176, 104), (176, 105),
(176, 106), (176, 107), (176, 108), (176, 109), (176, 110), (176, 111), (176, 112), (176, 113), (176, 114), (176, 115), (176, 116), (176, 117), (176, 118), (176, 119), (176, 120), (176, 121), (176, 122), (176, 123), (176, 124), (176, 125), (176, 126), (176, 127), (176, 128), (176, 130), (177, 56), (177, 59), (177, 60), (177, 61), (177, 62), (177, 63), (177, 64), (177, 65), (177, 66), (177, 67), (177, 68), (177, 69), (177, 70), (177, 71), (177, 72), (177, 73), (177, 74), (177, 75), (177, 76), (177, 77), (177, 78), (177, 79), (177, 80), (177, 81), (177, 82), (177, 83), (177, 84), (177, 85), (177, 86), (177, 87), (177, 91), (177, 92), (177, 102), (177, 104), (177, 105), (177, 106), (177, 107), (177, 108), (177, 109), (177, 110), (177, 111), (177, 112), (177, 113), (177, 114), (177, 115), (177, 116), (177, 117), (177, 118),
(177, 119), (177, 120), (177, 121), (177, 122), (177, 123), (177, 124), (177, 125), (177, 126), (177, 127), (177, 128), (177, 130), (178, 55), (178, 58), (178, 59), (178, 60), (178, 61), (178, 62), (178, 63), (178, 64), (178, 65), (178, 66), (178, 67), (178, 68), (178, 69), (178, 70), (178, 71), (178, 72), (178, 73), (178, 74), (178, 75), (178, 76), (178, 77), (178, 78), (178, 79), (178, 80), (178, 81), (178, 82), (178, 83), (178, 84), (178, 85), (178, 86), (178, 89), (178, 102), (178, 104), (178, 105), (178, 106), (178, 107), (178, 108), (178, 109), (178, 110), (178, 111), (178, 112), (178, 113), (178, 114), (178, 115), (178, 116), (178, 117), (178, 118), (178, 119), (178, 120), (178, 121), (178, 122), (178, 123), (178, 124), (178, 125), (178, 126), (178, 127), (178, 129), (179, 54), (179, 56), (179, 57), (179, 58),
(179, 59), (179, 60), (179, 61), (179, 62), (179, 63), (179, 64), (179, 65), (179, 66), (179, 67), (179, 68), (179, 69), (179, 70), (179, 71), (179, 72), (179, 73), (179, 74), (179, 75), (179, 76), (179, 77), (179, 78), (179, 79), (179, 80), (179, 81), (179, 82), (179, 83), (179, 84), (179, 87), (179, 102), (179, 104), (179, 105), (179, 106), (179, 107), (179, 108), (179, 109), (179, 110), (179, 111), (179, 112), (179, 113), (179, 114), (179, 115), (179, 116), (179, 117), (179, 118), (179, 119), (179, 120), (179, 121), (179, 122), (179, 123), (179, 124), (179, 125), (179, 126), (179, 128), (180, 53), (180, 55), (180, 56), (180, 57), (180, 58), (180, 59), (180, 60), (180, 61), (180, 62), (180, 63), (180, 64), (180, 65), (180, 66), (180, 67), (180, 68), (180, 69), (180, 70), (180, 71), (180, 72), (180, 73),
(180, 74), (180, 75), (180, 76), (180, 77), (180, 78), (180, 79), (180, 80), (180, 81), (180, 82), (180, 85), (180, 102), (180, 104), (180, 105), (180, 106), (180, 107), (180, 108), (180, 109), (180, 110), (180, 111), (180, 112), (180, 113), (180, 114), (180, 115), (180, 116), (180, 117), (180, 118), (180, 119), (180, 120), (180, 121), (180, 122), (180, 123), (180, 124), (180, 125), (180, 126), (180, 128), (181, 52), (181, 54), (181, 55), (181, 56), (181, 57), (181, 58), (181, 59), (181, 60), (181, 61), (181, 62), (181, 63), (181, 64), (181, 65), (181, 66), (181, 67), (181, 68), (181, 69), (181, 70), (181, 71), (181, 72), (181, 73), (181, 74), (181, 75), (181, 76), (181, 77), (181, 78), (181, 79), (181, 80), (181, 81), (181, 84), (181, 101), (181, 103), (181, 104), (181, 105), (181, 106), (181, 107), (181, 108),
(181, 109), (181, 110), (181, 111), (181, 112), (181, 113), (181, 114), (181, 115), (181, 116), (181, 117), (181, 118), (181, 119), (181, 120), (181, 121), (181, 122), (181, 123), (181, 124), (181, 125), (181, 127), (182, 51), (182, 53), (182, 54), (182, 55), (182, 56), (182, 57), (182, 58), (182, 59), (182, 60), (182, 61), (182, 62), (182, 63), (182, 64), (182, 65), (182, 66), (182, 67), (182, 68), (182, 69), (182, 70), (182, 71), (182, 72), (182, 73), (182, 74), (182, 75), (182, 76), (182, 77), (182, 78), (182, 79), (182, 82), (182, 100), (182, 102), (182, 103), (182, 104), (182, 105), (182, 106), (182, 107), (182, 108), (182, 109), (182, 110), (182, 111), (182, 112), (182, 113), (182, 114), (182, 115), (182, 116), (182, 117), (182, 118), (182, 119), (182, 120), (182, 121), (182, 122), (182, 123), (182, 124), (182, 125),
(182, 127), (183, 53), (183, 54), (183, 55), (183, 56), (183, 57), (183, 58), (183, 59), (183, 60), (183, 61), (183, 62), (183, 63), (183, 64), (183, 65), (183, 66), (183, 67), (183, 68), (183, 69), (183, 70), (183, 71), (183, 72), (183, 73), (183, 74), (183, 75), (183, 76), (183, 77), (183, 80), (183, 99), (183, 101), (183, 102), (183, 103), (183, 104), (183, 105), (183, 106), (183, 107), (183, 108), (183, 109), (183, 110), (183, 111), (183, 112), (183, 113), (183, 114), (183, 115), (183, 116), (183, 117), (183, 118), (183, 119), (183, 120), (183, 121), (183, 122), (183, 123), (183, 124), (183, 126), (184, 50), (184, 52), (184, 53), (184, 54), (184, 55), (184, 56), (184, 57), (184, 58), (184, 59), (184, 60), (184, 61), (184, 62), (184, 63), (184, 64), (184, 65), (184, 66), (184, 67), (184, 68), (184, 69),
(184, 70), (184, 71), (184, 72), (184, 73), (184, 74), (184, 75), (184, 76), (184, 79), (184, 97), (184, 100), (184, 101), (184, 102), (184, 103), (184, 104), (184, 105), (184, 106), (184, 107), (184, 108), (184, 109), (184, 110), (184, 111), (184, 112), (184, 113), (184, 114), (184, 115), (184, 116), (184, 117), (184, 118), (184, 119), (184, 120), (184, 121), (184, 122), (184, 123), (184, 125), (185, 49), (185, 51), (185, 52), (185, 53), (185, 54), (185, 55), (185, 56), (185, 57), (185, 58), (185, 59), (185, 60), (185, 61), (185, 62), (185, 63), (185, 64), (185, 65), (185, 66), (185, 67), (185, 68), (185, 69), (185, 70), (185, 71), (185, 72), (185, 73), (185, 74), (185, 77), (185, 94), (185, 95), (185, 96), (185, 99), (185, 100), (185, 101), (185, 102), (185, 103), (185, 104), (185, 105), (185, 106), (185, 107),
(185, 108), (185, 109), (185, 110), (185, 111), (185, 112), (185, 113), (185, 114), (185, 115), (185, 116), (185, 117), (185, 118), (185, 119), (185, 120), (185, 121), (185, 122), (185, 123), (185, 125), (186, 49), (186, 51), (186, 52), (186, 53), (186, 54), (186, 55), (186, 56), (186, 57), (186, 58), (186, 59), (186, 60), (186, 61), (186, 62), (186, 63), (186, 64), (186, 65), (186, 66), (186, 67), (186, 68), (186, 69), (186, 70), (186, 71), (186, 72), (186, 76), (186, 91), (186, 93), (186, 97), (186, 98), (186, 99), (186, 100), (186, 101), (186, 102), (186, 103), (186, 104), (186, 105), (186, 106), (186, 107), (186, 108), (186, 109), (186, 110), (186, 111), (186, 112), (186, 113), (186, 114), (186, 115), (186, 116), (186, 117), (186, 118), (186, 119), (187, 48), (187, 50), (187, 51), (187, 52), (187, 53), (187, 54),
(187, 55), (187, 56), (187, 57), (187, 58), (187, 59), (187, 60), (187, 61), (187, 62), (187, 63), (187, 64), (187, 65), (187, 66), (187, 67), (187, 68), (187, 69), (187, 70), (187, 71), (187, 74), (187, 88), (187, 89), (187, 90), (187, 94), (187, 95), (187, 96), (187, 97), (187, 98), (187, 99), (187, 100), (187, 101), (187, 102), (187, 103), (187, 104), (187, 105), (187, 106), (187, 107), (187, 108), (187, 109), (187, 110), (187, 111), (187, 112), (187, 113), (187, 114), (187, 115), (187, 116), (187, 117), (187, 118), (187, 121), (187, 122), (187, 124), (188, 48), (188, 50), (188, 51), (188, 52), (188, 53), (188, 54), (188, 55), (188, 56), (188, 57), (188, 58), (188, 59), (188, 60), (188, 61), (188, 62), (188, 63), (188, 64), (188, 65), (188, 66), (188, 67), (188, 68), (188, 69), (188, 72), (188, 85),
(188, 86), (188, 91), (188, 92), (188, 93), (188, 94), (188, 95), (188, 96), (188, 97), (188, 98), (188, 99), (188, 100), (188, 101), (188, 102), (188, 103), (188, 104), (188, 105), (188, 106), (188, 107), (188, 108), (188, 109), (188, 110), (188, 111), (188, 112), (188, 113), (188, 114), (188, 115), (188, 116), (188, 117), (188, 119), (189, 48), (189, 50), (189, 51), (189, 52), (189, 53), (189, 54), (189, 55), (189, 56), (189, 57), (189, 58), (189, 59), (189, 60), (189, 61), (189, 62), (189, 63), (189, 64), (189, 65), (189, 66), (189, 67), (189, 71), (189, 83), (189, 87), (189, 88), (189, 89), (189, 90), (189, 91), (189, 92), (189, 93), (189, 94), (189, 95), (189, 96), (189, 97), (189, 98), (189, 99), (189, 100), (189, 101), (189, 102), (189, 103), (189, 104), (189, 105), (189, 118), (190, 49), (190, 51),
(190, 52), (190, 53), (190, 54), (190, 55), (190, 56), (190, 57), (190, 58), (190, 59), (190, 60), (190, 61), (190, 62), (190, 63), (190, 64), (190, 65), (190, 66), (190, 69), (190, 81), (190, 85), (190, 86), (190, 87), (190, 88), (190, 89), (190, 90), (190, 91), (190, 92), (190, 93), (190, 94), (190, 95), (190, 96), (190, 106), (190, 107), (190, 108), (190, 109), (190, 110), (190, 111), (190, 112), (190, 113), (190, 114), (190, 115), (190, 116), (190, 118), (191, 49), (191, 51), (191, 52), (191, 53), (191, 54), (191, 55), (191, 56), (191, 57), (191, 58), (191, 59), (191, 60), (191, 61), (191, 62), (191, 63), (191, 64), (191, 67), (191, 80), (191, 83), (191, 84), (191, 85), (191, 86), (191, 97), (191, 98), (191, 99), (191, 100), (191, 101), (191, 102), (191, 103), (191, 104), (191, 105), (192, 49),
(192, 51), (192, 52), (192, 53), (192, 54), (192, 55), (192, 56), (192, 57), (192, 58), (192, 59), (192, 60), (192, 61), (192, 62), (192, 66), (192, 80), (192, 86), (192, 87), (192, 88), (192, 89), (192, 90), (192, 91), (192, 92), (192, 93), (192, 94), (192, 95), (192, 96), (193, 50), (193, 52), (193, 53), (193, 54), (193, 55), (193, 56), (193, 57), (193, 58), (193, 59), (193, 60), (193, 61), (193, 64), (193, 80), (193, 82), (193, 83), (193, 84), (193, 85), (193, 86), (194, 50), (194, 52), (194, 53), (194, 54), (194, 55), (194, 56), (194, 57), (194, 58), (194, 59), (194, 62), (195, 50), (195, 52), (195, 53), (195, 54), (195, 55), (195, 56), (195, 57), (195, 60), (196, 51), (196, 53), (196, 54), (196, 58), (196, 59), (197, 51), (197, 56), (197, 57), (198, 51), (198, 53), (198, 54),
(199, 51), (246, 54), (246, 57), (247, 54), (247, 58), (247, 59), (248, 54), (248, 56), (248, 57), (248, 61), (249, 54), (249, 56), (249, 57), (249, 58), (249, 59), (249, 63), (250, 53), (250, 55), (250, 56), (250, 57), (250, 58), (250, 59), (250, 60), (250, 61), (250, 62), (250, 65), (251, 53), (251, 55), (251, 56), (251, 57), (251, 58), (251, 59), (251, 60), (251, 61), (251, 62), (251, 63), (251, 67), (252, 53), (252, 55), (252, 56), (252, 57), (252, 58), (252, 59), (252, 60), (252, 61), (252, 62), (252, 63), (252, 64), (252, 65), (252, 68), (252, 69), (252, 84), (252, 86), (252, 87), (252, 88), (252, 89), (252, 90), (252, 91), (252, 92), (252, 93), (252, 94), (252, 95), (252, 96), (252, 97), (252, 98), (252, 99), (252, 100), (252, 101), (252, 102), (252, 103), (252, 104), (252, 105),
(252, 106), (252, 107), (252, 108), (252, 109), (252, 110), (252, 111), (252, 112), (252, 113), (252, 114), (252, 115), (252, 116), (252, 118), (253, 52), (253, 54), (253, 55), (253, 56), (253, 57), (253, 58), (253, 59), (253, 60), (253, 61), (253, 62), (253, 63), (253, 64), (253, 65), (253, 66), (253, 67), (253, 70), (253, 86), (253, 119), (254, 52), (254, 59), (254, 60), (254, 61), (254, 62), (254, 63), (254, 64), (254, 65), (254, 66), (254, 67), (254, 68), (254, 69), (254, 72), (254, 88), (254, 91), (254, 92), (254, 93), (254, 94), (254, 95), (254, 96), (254, 97), (254, 98), (254, 99), (254, 100), (254, 101), (254, 102), (254, 103), (254, 104), (254, 105), (254, 106), (254, 107), (254, 108), (254, 109), (254, 110), (254, 111), (254, 112), (254, 113), (254, 114), (254, 115), (254, 116), (254, 117), (254, 118),
(254, 121), (255, 52), (255, 54), (255, 55), (255, 56), (255, 57), (255, 60), (255, 61), (255, 62), (255, 63), (255, 64), (255, 65), (255, 66), (255, 67), (255, 68), (255, 69), (255, 70), (255, 73), (255, 89), (255, 93), (255, 94), (255, 95), (255, 96), (255, 97), (255, 98), (255, 99), (255, 100), (255, 101), (255, 102), (255, 103), (255, 104), (255, 105), (255, 106), (255, 107), (255, 108), (255, 109), (255, 110), (255, 111), (255, 112), (255, 113), (255, 114), (255, 115), (255, 116), (255, 117), (255, 118), (255, 119), (255, 121), (256, 51), (256, 59), (256, 62), (256, 63), (256, 64), (256, 65), (256, 66), (256, 67), (256, 68), (256, 69), (256, 70), (256, 71), (256, 72), (256, 75), (256, 91), (256, 95), (256, 96), (256, 97), (256, 98), (256, 99), (256, 100), (256, 101), (256, 102), (256, 103), (256, 104),
(256, 105), (256, 106), (256, 107), (256, 108), (256, 109), (256, 110), (256, 111), (256, 112), (256, 113), (256, 114), (256, 115), (256, 116), (256, 117), (256, 118), (256, 119), (256, 120), (256, 122), (257, 60), (257, 63), (257, 64), (257, 65), (257, 66), (257, 67), (257, 68), (257, 69), (257, 70), (257, 71), (257, 72), (257, 73), (257, 76), (257, 93), (257, 97), (257, 98), (257, 99), (257, 100), (257, 101), (257, 102), (257, 103), (257, 104), (257, 105), (257, 106), (257, 107), (257, 108), (257, 109), (257, 110), (257, 111), (257, 112), (257, 113), (257, 114), (257, 115), (257, 116), (257, 117), (257, 118), (257, 119), (257, 120), (257, 122), (258, 62), (258, 64), (258, 65), (258, 66), (258, 67), (258, 68), (258, 69), (258, 70), (258, 71), (258, 72), (258, 73), (258, 74), (258, 75), (258, 78), (258, 95), (258, 99),
(258, 100), (258, 101), (258, 102), (258, 103), (258, 104), (258, 105), (258, 106), (258, 107), (258, 108), (258, 109), (258, 110), (258, 111), (258, 112), (258, 113), (258, 114), (258, 115), (258, 116), (258, 117), (258, 118), (258, 119), (258, 120), (258, 121), (258, 123), (259, 63), (259, 65), (259, 66), (259, 67), (259, 68), (259, 69), (259, 70), (259, 71), (259, 72), (259, 73), (259, 74), (259, 75), (259, 76), (259, 79), (259, 97), (259, 101), (259, 102), (259, 103), (259, 104), (259, 105), (259, 106), (259, 107), (259, 108), (259, 109), (259, 110), (259, 111), (259, 112), (259, 113), (259, 114), (259, 115), (259, 116), (259, 117), (259, 118), (259, 119), (259, 120), (259, 121), (259, 122), (259, 123), (260, 64), (260, 67), (260, 68), (260, 69), (260, 70), (260, 71), (260, 72), (260, 73), (260, 74), (260, 75), (260, 76),
(260, 77), (260, 78), (260, 81), (260, 99), (260, 103), (260, 104), (260, 105), (260, 106), (260, 107), (260, 108), (260, 109), (260, 110), (260, 111), (260, 112), (260, 113), (260, 114), (260, 115), (260, 116), (260, 117), (260, 118), (260, 119), (260, 120), (260, 121), (260, 122), (260, 124), (261, 65), (261, 68), (261, 69), (261, 70), (261, 71), (261, 72), (261, 73), (261, 74), (261, 75), (261, 76), (261, 77), (261, 78), (261, 79), (261, 82), (261, 101), (261, 104), (261, 105), (261, 106), (261, 107), (261, 108), (261, 109), (261, 110), (261, 111), (261, 112), (261, 113), (261, 114), (261, 115), (261, 116), (261, 117), (261, 118), (261, 119), (261, 120), (261, 121), (261, 122), (261, 123), (261, 125), (262, 67), (262, 69), (262, 70), (262, 71), (262, 72), (262, 73), (262, 74), (262, 75), (262, 76), (262, 77), (262, 78),
(262, 79), (262, 80), (262, 81), (262, 83), (262, 103), (262, 106), (262, 107), (262, 108), (262, 109), (262, 110), (262, 111), (262, 112), (262, 113), (262, 114), (262, 115), (262, 116), (262, 117), (262, 118), (262, 119), (262, 120), (262, 121), (262, 122), (262, 123), (262, 124), (262, 126), (263, 68), (263, 70), (263, 71), (263, 72), (263, 73), (263, 74), (263, 75), (263, 76), (263, 77), (263, 78), (263, 79), (263, 80), (263, 81), (263, 82), (263, 85), (263, 105), (263, 108), (263, 109), (263, 110), (263, 111), (263, 112), (263, 113), (263, 114), (263, 115), (263, 116), (263, 117), (263, 118), (263, 119), (263, 120), (263, 121), (263, 122), (263, 123), (263, 124), (263, 126), (264, 69), (264, 72), (264, 73), (264, 74), (264, 75), (264, 76), (264, 77), (264, 78), (264, 79), (264, 80), (264, 81), (264, 82), (264, 83),
(264, 86), (264, 106), (264, 107), (264, 110), (264, 111), (264, 112), (264, 113), (264, 114), (264, 115), (264, 116), (264, 117), (264, 118), (264, 119), (264, 120), (264, 121), (264, 122), (264, 123), (264, 124), (264, 125), (264, 127), (265, 70), (265, 73), (265, 74), (265, 75), (265, 76), (265, 77), (265, 78), (265, 79), (265, 80), (265, 81), (265, 82), (265, 83), (265, 84), (265, 85), (265, 88), (265, 108), (265, 110), (265, 111), (265, 112), (265, 113), (265, 114), (265, 115), (265, 116), (265, 117), (265, 118), (265, 119), (265, 120), (265, 121), (265, 122), (265, 123), (265, 124), (265, 125), (265, 126), (265, 128), (266, 71), (266, 74), (266, 75), (266, 76), (266, 77), (266, 78), (266, 79), (266, 80), (266, 81), (266, 82), (266, 83), (266, 84), (266, 85), (266, 86), (266, 89), (266, 110), (266, 112), (266, 113),
(266, 114), (266, 115), (266, 116), (266, 117), (266, 118), (266, 119), (266, 120), (266, 121), (266, 122), (266, 123), (266, 124), (266, 125), (266, 126), (266, 127), (266, 129), (267, 73), (267, 75), (267, 76), (267, 77), (267, 78), (267, 79), (267, 80), (267, 81), (267, 82), (267, 83), (267, 84), (267, 85), (267, 86), (267, 87), (267, 88), (267, 91), (267, 110), (267, 112), (267, 113), (267, 114), (267, 115), (267, 116), (267, 117), (267, 118), (267, 119), (267, 120), (267, 121), (267, 122), (267, 123), (267, 124), (267, 125), (267, 126), (267, 127), (267, 128), (267, 130), (268, 74), (268, 76), (268, 77), (268, 78), (268, 79), (268, 80), (268, 81), (268, 82), (268, 83), (268, 84), (268, 85), (268, 86), (268, 87), (268, 88), (268, 89), (268, 93), (268, 107), (268, 108), (268, 109), (268, 110), (268, 111), (268, 112),
(268, 113), (268, 114), (268, 115), (268, 116), (268, 117), (268, 118), (268, 119), (268, 120), (268, 121), (268, 122), (268, 123), (268, 124), (268, 125), (268, 126), (268, 127), (268, 128), (268, 130), (269, 75), (269, 78), (269, 79), (269, 80), (269, 81), (269, 82), (269, 83), (269, 84), (269, 85), (269, 86), (269, 87), (269, 88), (269, 89), (269, 90), (269, 91), (269, 94), (269, 97), (269, 98), (269, 99), (269, 100), (269, 101), (269, 102), (269, 103), (269, 104), (269, 105), (269, 106), (269, 110), (269, 111), (269, 112), (269, 113), (269, 114), (269, 115), (269, 116), (269, 117), (269, 118), (269, 119), (269, 120), (269, 121), (269, 122), (269, 123), (269, 124), (269, 125), (269, 126), (269, 127), (269, 128), (269, 129), (269, 131), (270, 76), (270, 79), (270, 80), (270, 81), (270, 82), (270, 83), (270, 84), (270, 85),
(270, 86), (270, 87), (270, 88), (270, 89), (270, 90), (270, 91), (270, 92), (270, 93), (270, 96), (270, 106), (270, 107), (270, 108), (270, 109), (270, 110), (270, 111), (270, 112), (270, 113), (270, 114), (270, 115), (270, 116), (270, 117), (270, 118), (270, 119), (270, 120), (270, 121), (270, 122), (270, 123), (270, 124), (270, 125), (270, 126), (270, 127), (270, 128), (270, 129), (270, 130), (270, 132), (271, 77), (271, 80), (271, 81), (271, 82), (271, 83), (271, 84), (271, 85), (271, 86), (271, 87), (271, 88), (271, 89), (271, 90), (271, 91), (271, 92), (271, 93), (271, 94), (271, 95), (271, 97), (271, 98), (271, 99), (271, 100), (271, 101), (271, 102), (271, 103), (271, 104), (271, 105), (271, 106), (271, 107), (271, 108), (271, 109), (271, 110), (271, 111), (271, 112), (271, 113), (271, 114), (271, 115), (271, 116),
(271, 117), (271, 118), (271, 119), (271, 120), (271, 121), (271, 122), (271, 123), (271, 124), (271, 125), (271, 126), (271, 127), (271, 128), (271, 129), (271, 130), (271, 131), (271, 133), (272, 79), (272, 81), (272, 82), (272, 83), (272, 84), (272, 85), (272, 86), (272, 87), (272, 88), (272, 89), (272, 90), (272, 91), (272, 92), (272, 93), (272, 94), (272, 95), (272, 96), (272, 97), (272, 98), (272, 99), (272, 100), (272, 101), (272, 102), (272, 103), (272, 104), (272, 105), (272, 106), (272, 107), (272, 108), (272, 109), (272, 110), (272, 111), (272, 112), (272, 113), (272, 114), (272, 115), (272, 116), (272, 117), (272, 118), (272, 119), (272, 120), (272, 121), (272, 122), (272, 123), (272, 124), (272, 125), (272, 126), (272, 127), (272, 128), (272, 129), (272, 130), (272, 131), (272, 132), (272, 134), (273, 80), (273, 82),
(273, 83), (273, 84), (273, 85), (273, 86), (273, 87), (273, 88), (273, 89), (273, 90), (273, 91), (273, 92), (273, 93), (273, 94), (273, 95), (273, 96), (273, 97), (273, 98), (273, 99), (273, 100), (273, 101), (273, 102), (273, 103), (273, 104), (273, 105), (273, 106), (273, 107), (273, 108), (273, 109), (273, 110), (273, 111), (273, 112), (273, 113), (273, 114), (273, 115), (273, 116), (273, 117), (273, 118), (273, 119), (273, 120), (273, 121), (273, 122), (273, 123), (273, 124), (273, 125), (273, 126), (273, 127), (273, 128), (273, 129), (273, 130), (273, 131), (273, 132), (273, 133), (273, 135), (274, 81), (274, 83), (274, 84), (274, 85), (274, 86), (274, 87), (274, 88), (274, 89), (274, 90), (274, 91), (274, 92), (274, 93), (274, 94), (274, 95), (274, 96), (274, 97), (274, 98), (274, 99), (274, 100), (274, 101),
(274, 102), (274, 103), (274, 104), (274, 105), (274, 106), (274, 107), (274, 108), (274, 109), (274, 110), (274, 111), (274, 112), (274, 113), (274, 114), (274, 115), (274, 116), (274, 117), (274, 118), (274, 119), (274, 120), (274, 121), (274, 122), (274, 123), (274, 124), (274, 125), (274, 126), (274, 127), (274, 128), (274, 129), (274, 130), (274, 131), (274, 132), (274, 133), (274, 136), (275, 82), (275, 85), (275, 86), (275, 87), (275, 88), (275, 89), (275, 90), (275, 91), (275, 92), (275, 93), (275, 94), (275, 95), (275, 96), (275, 97), (275, 98), (275, 99), (275, 100), (275, 101), (275, 102), (275, 103), (275, 104), (275, 105), (275, 106), (275, 107), (275, 108), (275, 109), (275, 110), (275, 111), (275, 112), (275, 113), (275, 114), (275, 115), (275, 116), (275, 117), (275, 118), (275, 119), (275, 120), (275, 121), (275, 122),
(275, 123), (275, 124), (275, 125), (275, 126), (275, 127), (275, 128), (275, 129), (275, 130), (275, 131), (275, 132), (275, 133), (275, 134), (276, 83), (276, 86), (276, 87), (276, 88), (276, 89), (276, 90), (276, 91), (276, 92), (276, 93), (276, 94), (276, 95), (276, 96), (276, 97), (276, 98), (276, 99), (276, 100), (276, 101), (276, 102), (276, 103), (276, 104), (276, 105), (276, 106), (276, 107), (276, 108), (276, 109), (276, 110), (276, 111), (276, 112), (276, 113), (276, 114), (276, 115), (276, 116), (276, 117), (276, 118), (276, 119), (276, 120), (276, 121), (276, 122), (276, 123), (276, 124), (276, 125), (276, 126), (276, 127), (276, 128), (276, 129), (276, 130), (276, 131), (276, 132), (276, 133), (276, 134), (276, 135), (276, 137), (277, 84), (277, 87), (277, 88), (277, 89), (277, 90), (277, 91), (277, 92), (277, 93),
(277, 94), (277, 95), (277, 96), (277, 97), (277, 98), (277, 99), (277, 100), (277, 101), (277, 102), (277, 103), (277, 104), (277, 105), (277, 106), (277, 107), (277, 108), (277, 109), (277, 110), (277, 111), (277, 112), (277, 113), (277, 114), (277, 115), (277, 116), (277, 117), (277, 118), (277, 119), (277, 120), (277, 121), (277, 122), (277, 123), (277, 124), (277, 125), (277, 126), (277, 127), (277, 128), (277, 129), (277, 130), (277, 131), (277, 132), (277, 133), (277, 134), (277, 135), (277, 136), (277, 138), (278, 86), (278, 88), (278, 89), (278, 90), (278, 91), (278, 92), (278, 93), (278, 94), (278, 95), (278, 96), (278, 97), (278, 98), (278, 99), (278, 100), (278, 101), (278, 102), (278, 103), (278, 104), (278, 105), (278, 106), (278, 107), (278, 108), (278, 109), (278, 110), (278, 111), (278, 112), (278, 113), (278, 114),
(278, 115), (278, 116), (278, 117), (278, 118), (278, 119), (278, 120), (278, 121), (278, 122), (278, 123), (278, 124), (278, 125), (278, 126), (278, 127), (278, 128), (278, 129), (278, 130), (278, 131), (278, 132), (278, 133), (278, 134), (278, 135), (278, 136), (278, 137), (278, 139), (279, 87), (279, 89), (279, 90), (279, 91), (279, 92), (279, 93), (279, 94), (279, 95), (279, 96), (279, 97), (279, 98), (279, 99), (279, 100), (279, 101), (279, 102), (279, 103), (279, 104), (279, 105), (279, 106), (279, 107), (279, 108), (279, 109), (279, 110), (279, 111), (279, 112), (279, 113), (279, 114), (279, 115), (279, 116), (279, 117), (279, 118), (279, 119), (279, 120), (279, 121), (279, 122), (279, 123), (279, 124), (279, 125), (279, 126), (279, 127), (279, 128), (279, 129), (279, 130), (279, 131), (279, 132), (279, 133), (279, 134), (279, 135),
(279, 136), (279, 137), (279, 138), (279, 140), (280, 88), (280, 90), (280, 91), (280, 92), (280, 93), (280, 94), (280, 95), (280, 96), (280, 97), (280, 98), (280, 99), (280, 100), (280, 101), (280, 102), (280, 103), (280, 104), (280, 105), (280, 106), (280, 107), (280, 108), (280, 109), (280, 110), (280, 111), (280, 112), (280, 113), (280, 114), (280, 115), (280, 116), (280, 117), (280, 118), (280, 119), (280, 120), (280, 121), (280, 122), (280, 123), (280, 124), (280, 125), (280, 126), (280, 127), (280, 128), (280, 129), (280, 130), (280, 131), (280, 132), (280, 133), (280, 134), (280, 135), (280, 136), (280, 137), (280, 138), (280, 139), (280, 141), (281, 89), (281, 92), (281, 93), (281, 94), (281, 95), (281, 96), (281, 97), (281, 98), (281, 99), (281, 100), (281, 101), (281, 102), (281, 103), (281, 104), (281, 105), (281, 106),
(281, 107), (281, 108), (281, 109), (281, 110), (281, 111), (281, 112), (281, 113), (281, 114), (281, 115), (281, 116), (281, 117), (281, 118), (281, 119), (281, 120), (281, 121), (281, 122), (281, 123), (281, 124), (281, 125), (281, 126), (281, 127), (281, 128), (281, 129), (281, 130), (281, 131), (281, 132), (281, 133), (281, 134), (281, 135), (281, 136), (281, 137), (281, 138), (281, 139), (281, 140), (281, 142), (282, 90), (282, 93), (282, 94), (282, 95), (282, 96), (282, 97), (282, 98), (282, 99), (282, 100), (282, 101), (282, 102), (282, 103), (282, 104), (282, 105), (282, 106), (282, 107), (282, 108), (282, 109), (282, 110), (282, 111), (282, 112), (282, 113), (282, 114), (282, 115), (282, 116), (282, 117), (282, 118), (282, 119), (282, 120), (282, 121), (282, 122), (282, 123), (282, 124), (282, 125), (282, 126), (282, 127), (282, 128),
(282, 129), (282, 130), (282, 131), (282, 132), (282, 133), (282, 134), (282, 135), (282, 136), (282, 137), (282, 138), (282, 139), (282, 140), (282, 141), (282, 143), (283, 91), (283, 94), (283, 95), (283, 96), (283, 97), (283, 98), (283, 99), (283, 100), (283, 101), (283, 102), (283, 103), (283, 104), (283, 105), (283, 106), (283, 107), (283, 108), (283, 109), (283, 110), (283, 111), (283, 112), (283, 113), (283, 114), (283, 115), (283, 116), (283, 117), (283, 118), (283, 119), (283, 120), (283, 121), (283, 122), (283, 123), (283, 124), (283, 125), (283, 126), (283, 127), (283, 128), (283, 129), (283, 130), (283, 131), (283, 132), (283, 133), (283, 134), (283, 135), (283, 136), (283, 137), (283, 138), (283, 139), (283, 140), (283, 141), (283, 142), (283, 145), (284, 95), (284, 96), (284, 97), (284, 98), (284, 99), (284, 100), (284, 101),
(284, 102), (284, 103), (284, 104), (284, 105), (284, 106), (284, 107), (284, 108), (284, 109), (284, 110), (284, 111), (284, 112), (284, 113), (284, 114), (284, 115), (284, 116), (284, 117), (284, 118), (284, 119), (284, 120), (284, 121), (284, 122), (284, 123), (284, 124), (284, 125), (284, 126), (284, 127), (284, 128), (284, 129), (284, 130), (284, 131), (284, 132), (284, 133), (284, 134), (284, 135), (284, 136), (284, 137), (284, 138), (284, 139), (284, 140), (284, 141), (284, 142), (284, 143), (284, 146), (285, 94), (285, 96), (285, 97), (285, 98), (285, 99), (285, 100), (285, 101), (285, 102), (285, 103), (285, 104), (285, 105), (285, 106), (285, 107), (285, 108), (285, 109), (285, 110), (285, 111), (285, 112), (285, 113), (285, 114), (285, 115), (285, 116), (285, 117), (285, 118), (285, 119), (285, 120), (285, 121), (285, 122), (285, 123),
(285, 124), (285, 125), (285, 126), (285, 127), (285, 128), (285, 129), (285, 130), (285, 131), (285, 132), (285, 133), (285, 134), (285, 135), (285, 136), (285, 137), (285, 138), (285, 139), (285, 140), (285, 141), (285, 142), (285, 143), (285, 144), (285, 146), (286, 95), (286, 97), (286, 98), (286, 99), (286, 100), (286, 101), (286, 102), (286, 103), (286, 104), (286, 105), (286, 106), (286, 107), (286, 108), (286, 109), (286, 110), (286, 111), (286, 112), (286, 113), (286, 114), (286, 115), (286, 116), (286, 117), (286, 118), (286, 119), (286, 120), (286, 121), (286, 122), (286, 123), (286, 124), (286, 125), (286, 126), (286, 127), (286, 128), (286, 129), (286, 130), (286, 131), (286, 132), (286, 133), (286, 134), (286, 135), (286, 136), (286, 137), (286, 138), (286, 139), (286, 140), (286, 141), (286, 142), (286, 143), (286, 145), (287, 96),
(287, 98), (287, 99), (287, 100), (287, 101), (287, 102), (287, 103), (287, 104), (287, 105), (287, 106), (287, 107), (287, 108), (287, 109), (287, 110), (287, 111), (287, 112), (287, 113), (287, 114), (287, 115), (287, 116), (287, 117), (287, 118), (287, 119), (287, 120), (287, 121), (287, 122), (287, 123), (287, 124), (287, 125), (287, 126), (287, 127), (287, 128), (287, 129), (287, 130), (287, 131), (287, 132), (287, 133), (287, 134), (287, 135), (287, 136), (287, 137), (287, 138), (287, 139), (287, 140), (287, 141), (287, 142), (287, 143), (287, 145), (288, 97), (288, 99), (288, 100), (288, 101), (288, 102), (288, 103), (288, 104), (288, 105), (288, 106), (288, 107), (288, 108), (288, 109), (288, 110), (288, 111), (288, 112), (288, 113), (288, 114), (288, 115), (288, 116), (288, 117), (288, 118), (288, 119), (288, 120), (288, 121), (288, 122),
(288, 123), (288, 124), (288, 125), (288, 126), (288, 127), (288, 128), (288, 129), (288, 130), (288, 131), (288, 132), (288, 133), (288, 134), (288, 135), (288, 136), (288, 137), (288, 138), (288, 139), (288, 140), (288, 141), (288, 142), (288, 144), (289, 98), (289, 100), (289, 101), (289, 102), (289, 103), (289, 104), (289, 105), (289, 106), (289, 107), (289, 108), (289, 109), (289, 110), (289, 111), (289, 112), (289, 113), (289, 114), (289, 115), (289, 116), (289, 117), (289, 118), (289, 119), (289, 120), (289, 121), (289, 122), (289, 123), (289, 124), (289, 125), (289, 126), (289, 127), (289, 128), (289, 129), (289, 130), (289, 131), (289, 132), (289, 133), (289, 134), (289, 135), (289, 136), (289, 137), (289, 138), (289, 139), (289, 140), (289, 141), (290, 99), (290, 102), (290, 103), (290, 104), (290, 105), (290, 106), (290, 107), (290, 108),
(290, 109), (290, 110), (290, 111), (290, 112), (290, 113), (290, 114), (290, 115), (290, 116), (290, 117), (290, 118), (290, 119), (290, 120), (290, 121), (290, 122), (290, 123), (290, 124), (290, 125), (290, 126), (290, 127), (290, 128), (290, 129), (290, 130), (290, 131), (290, 132), (290, 133), (290, 134), (290, 135), (290, 136), (290, 137), (290, 138), (290, 139), (290, 140), (290, 143), (291, 100), (291, 103), (291, 104), (291, 105), (291, 106), (291, 107), (291, 108), (291, 109), (291, 110), (291, 111), (291, 112), (291, 113), (291, 114), (291, 115), (291, 116), (291, 117), (291, 118), (291, 119), (291, 120), (291, 121), (291, 122), (291, 123), (291, 124), (291, 125), (291, 126), (291, 127), (291, 128), (291, 129), (291, 130), (291, 131), (291, 132), (291, 133), (291, 134), (291, 135), (291, 136), (291, 137), (291, 138), (291, 139), (291, 141),
(292, 102), (292, 104), (292, 105), (292, 106), (292, 107), (292, 108), (292, 109), (292, 110), (292, 111), (292, 112), (292, 113), (292, 114), (292, 115), (292, 116), (292, 117), (292, 118), (292, 119), (292, 120), (292, 121), (292, 122), (292, 123), (292, 124), (292, 125), (292, 126), (292, 127), (292, 128), (292, 129), (292, 130), (292, 131), (292, 132), (292, 133), (292, 134), (292, 135), (292, 136), (292, 137), (292, 140), (293, 103), (293, 105), (293, 106), (293, 107), (293, 108), (293, 109), (293, 110), (293, 111), (293, 112), (293, 113), (293, 114), (293, 115), (293, 116), (293, 117), (293, 118), (293, 119), (293, 120), (293, 121), (293, 122), (293, 123), (293, 124), (293, 125), (293, 126), (293, 127), (293, 128), (293, 129), (293, 130), (293, 131), (293, 132), (293, 133), (293, 134), (293, 135), (293, 138), (293, 139), (294, 104), (294, 107),
(294, 108), (294, 109), (294, 110), (294, 111), (294, 112), (294, 113), (294, 114), (294, 115), (294, 116), (294, 117), (294, 118), (294, 119), (294, 120), (294, 121), (294, 122), (294, 123), (294, 124), (294, 125), (294, 126), (294, 127), (294, 128), (294, 129), (294, 130), (294, 131), (294, 132), (294, 133), (294, 137), (295, 105), (295, 108), (295, 109), (295, 110), (295, 111), (295, 112), (295, 113), (295, 114), (295, 115), (295, 116), (295, 117), (295, 118), (295, 119), (295, 120), (295, 121), (295, 122), (295, 123), (295, 124), (295, 125), (295, 126), (295, 127), (295, 128), (295, 129), (295, 130), (295, 135), (296, 106), (296, 109), (296, 110), (296, 111), (296, 112), (296, 113), (296, 114), (296, 115), (296, 116), (296, 117), (296, 118), (296, 119), (296, 120), (296, 121), (296, 122), (296, 123), (296, 124), (296, 125), (296, 126), (296, 131),
(296, 132), (297, 108), (297, 113), (297, 114), (297, 115), (297, 116), (297, 117), (297, 118), (297, 119), (297, 120), (297, 121), (297, 127), (297, 128), (297, 129), (297, 130), (298, 109), (298, 111), (298, 112), (298, 122), (298, 123), (298, 124), (298, 125), (298, 126), (299, 113), (299, 114), (299, 115), (299, 116), (299, 117), (299, 118), (299, 119), (299, 120), (299, 121), )
coordinates_993300 = ((222, 20),
(222, 22), (222, 23), (222, 24), (222, 25), (222, 26), (222, 27), (222, 28), (222, 29), (222, 30), (222, 31), (222, 32), (222, 33), (222, 34), (222, 35), (222, 36), (222, 37), (222, 38), (222, 39), (222, 40), (222, 41), (222, 42), (222, 43), (222, 44), (222, 45), (222, 46), (222, 47), (222, 48), (222, 49), (222, 50), (222, 51), (222, 52), (222, 53), (222, 55), (222, 73), (222, 75), (222, 76), (222, 77), (222, 78), (222, 79), (222, 80), (222, 81), (222, 82), (222, 83), (222, 84), (222, 85), (222, 86), (222, 87), (222, 88), (222, 89), (222, 90), (222, 91), (222, 92), (222, 93), (222, 94), (222, 95), (222, 96), (222, 97), (222, 98), (222, 99), (222, 100), (222, 101), (222, 102), (222, 103), (222, 104), (222, 105), (222, 106), (222, 107), (222, 108), (222, 109), (222, 110), (222, 111), (222, 112),
(222, 113), (222, 114), (222, 115), (222, 116), (222, 117), (222, 118), (222, 119), (222, 120), (222, 121), (222, 122), (222, 123), (222, 124), (222, 125), (222, 126), (222, 127), (222, 128), (222, 129), (222, 130), (222, 131), (222, 132), (222, 133), (222, 134), (222, 135), (222, 136), (222, 137), (222, 138), (222, 139), (222, 140), (222, 141), (222, 142), (222, 143), (222, 144), (222, 145), (222, 146), (222, 147), (222, 148), (222, 149), (222, 150), (222, 151), (222, 152), (222, 153), (222, 154), (222, 155), (222, 156), (222, 158), (223, 20), (223, 22), (223, 23), (223, 24), (223, 25), (223, 26), (223, 27), (223, 28), (223, 29), (223, 30), (223, 31), (223, 32), (223, 33), (223, 34), (223, 35), (223, 36), (223, 37), (223, 38), (223, 39), (223, 40), (223, 41), (223, 42), (223, 43), (223, 44), (223, 45), (223, 46), (223, 47),
(223, 48), (223, 49), (223, 50), (223, 51), (223, 52), (223, 53), (223, 55), (223, 73), (223, 75), (223, 76), (223, 77), (223, 78), (223, 79), (223, 80), (223, 81), (223, 82), (223, 83), (223, 84), (223, 85), (223, 86), (223, 87), (223, 88), (223, 89), (223, 90), (223, 91), (223, 92), (223, 93), (223, 94), (223, 95), (223, 96), (223, 97), (223, 98), (223, 99), (223, 100), (223, 101), (223, 102), (223, 103), (223, 104), (223, 105), (223, 106), (223, 107), (223, 108), (223, 109), (223, 110), (223, 111), (223, 112), (223, 113), (223, 114), (223, 115), (223, 116), (223, 117), (223, 118), (223, 119), (223, 120), (223, 121), (223, 122), (223, 123), (223, 124), (223, 125), (223, 126), (223, 127), (223, 128), (223, 129), (223, 130), (223, 131), (223, 132), (223, 133), (223, 134), (223, 135), (223, 136), (223, 137), (223, 138),
(223, 139), (223, 140), (223, 141), (223, 142), (223, 143), (223, 144), (223, 145), (223, 146), (223, 147), (223, 148), (223, 149), (223, 150), (223, 151), (223, 152), (223, 153), (223, 154), (223, 155), (223, 156), (223, 158), )
coordinates_FFFF7F = ((192, 109),
(192, 110), (192, 111), (192, 112), (192, 113), (192, 114), (192, 115), (192, 116), (192, 117), (192, 118), (192, 119), (192, 120), (192, 121), (193, 99), (193, 100), (193, 101), (193, 102), (193, 103), (193, 104), (193, 105), (193, 106), (193, 107), (193, 108), (193, 122), (193, 123), (193, 124), (193, 125), (194, 90), (194, 91), (194, 92), (194, 93), (194, 94), (194, 95), (194, 96), (194, 97), (194, 98), (194, 99), (194, 109), (194, 110), (194, 111), (194, 112), (194, 113), (194, 114), (194, 115), (194, 116), (194, 117), (194, 118), (194, 119), (194, 120), (194, 121), (194, 126), (194, 128), (195, 80), (195, 82), (195, 83), (195, 84), (195, 85), (195, 86), (195, 87), (195, 88), (195, 89), (195, 99), (195, 100), (195, 101), (195, 102), (195, 103), (195, 104), (195, 105), (195, 106), (195, 107), (195, 108), (195, 109), (195, 110),
(195, 111), (195, 112), (195, 113), (195, 114), (195, 115), (195, 116), (195, 117), (195, 118), (195, 119), (195, 120), (195, 121), (195, 122), (195, 123), (195, 124), (195, 125), (195, 129), (195, 130), (195, 131), (196, 80), (196, 90), (196, 91), (196, 92), (196, 93), (196, 94), (196, 95), (196, 96), (196, 97), (196, 98), (196, 99), (196, 100), (196, 101), (196, 102), (196, 103), (196, 104), (196, 105), (196, 106), (196, 107), (196, 108), (196, 109), (196, 110), (196, 111), (196, 112), (196, 113), (196, 114), (196, 115), (196, 116), (196, 117), (196, 118), (196, 119), (196, 120), (196, 121), (196, 122), (196, 123), (196, 124), (196, 125), (196, 126), (196, 127), (196, 128), (196, 132), (196, 133), (196, 134), (197, 80), (197, 82), (197, 83), (197, 84), (197, 85), (197, 86), (197, 87), (197, 88), (197, 89), (197, 90), (197, 91),
(197, 92), (197, 93), (197, 94), (197, 95), (197, 96), (197, 97), (197, 98), (197, 99), (197, 100), (197, 101), (197, 102), (197, 103), (197, 104), (197, 105), (197, 106), (197, 107), (197, 108), (197, 109), (197, 110), (197, 111), (197, 112), (197, 113), (197, 114), (197, 115), (197, 116), (197, 117), (197, 118), (197, 119), (197, 120), (197, 121), (197, 122), (197, 123), (197, 124), (197, 125), (197, 126), (197, 127), (197, 128), (197, 129), (197, 130), (197, 131), (197, 136), (197, 137), (198, 81), (198, 84), (198, 85), (198, 86), (198, 87), (198, 88), (198, 89), (198, 90), (198, 91), (198, 92), (198, 93), (198, 94), (198, 95), (198, 96), (198, 97), (198, 98), (198, 99), (198, 100), (198, 101), (198, 102), (198, 103), (198, 104), (198, 105), (198, 106), (198, 107), (198, 108), (198, 109), (198, 110), (198, 111), (198, 112),
(198, 113), (198, 114), (198, 115), (198, 116), (198, 117), (198, 118), (198, 119), (198, 120), (198, 121), (198, 122), (198, 123), (198, 124), (198, 125), (198, 126), (198, 127), (198, 128), (198, 129), (198, 130), (198, 131), (198, 132), (198, 133), (198, 134), (198, 135), (198, 139), (198, 140), (199, 82), (199, 86), (199, 87), (199, 88), (199, 89), (199, 90), (199, 91), (199, 92), (199, 93), (199, 94), (199, 95), (199, 96), (199, 97), (199, 98), (199, 99), (199, 100), (199, 101), (199, 102), (199, 103), (199, 104), (199, 105), (199, 106), (199, 107), (199, 108), (199, 109), (199, 110), (199, 111), (199, 112), (199, 113), (199, 114), (199, 115), (199, 116), (199, 117), (199, 118), (199, 119), (199, 120), (199, 121), (199, 122), (199, 123), (199, 124), (199, 125), (199, 126), (199, 127), (199, 128), (199, 129), (199, 130), (199, 131),
(199, 132), (199, 133), (199, 134), (199, 135), (199, 136), (199, 137), (199, 138), (199, 143), (200, 84), (200, 91), (200, 92), (200, 93), (200, 94), (200, 95), (200, 96), (200, 97), (200, 98), (200, 99), (200, 100), (200, 101), (200, 102), (200, 103), (200, 104), (200, 105), (200, 106), (200, 107), (200, 108), (200, 109), (200, 110), (200, 111), (200, 112), (200, 113), (200, 114), (200, 115), (200, 116), (200, 117), (200, 118), (200, 119), (200, 120), (200, 121), (200, 122), (200, 123), (200, 124), (200, 125), (200, 126), (200, 127), (200, 128), (200, 129), (200, 130), (200, 131), (200, 132), (200, 133), (200, 134), (200, 135), (200, 136), (200, 137), (200, 138), (200, 139), (200, 140), (200, 144), (200, 145), (200, 146), (201, 87), (201, 88), (201, 89), (201, 90), (201, 99), (201, 100), (201, 101), (201, 102), (201, 103), (201, 104),
(201, 105), (201, 106), (201, 107), (201, 108), (201, 109), (201, 110), (201, 111), (201, 112), (201, 113), (201, 114), (201, 115), (201, 116), (201, 117), (201, 118), (201, 119), (201, 120), (201, 121), (201, 122), (201, 123), (201, 124), (201, 125), (201, 126), (201, 127), (201, 128), (201, 129), (201, 130), (201, 131), (201, 132), (201, 133), (201, 134), (201, 135), (201, 136), (201, 137), (201, 138), (201, 139), (201, 140), (201, 141), (201, 142), (201, 143), (201, 148), (202, 91), (202, 92), (202, 93), (202, 94), (202, 95), (202, 96), (202, 97), (202, 98), (202, 104), (202, 105), (202, 106), (202, 107), (202, 108), (202, 109), (202, 110), (202, 111), (202, 112), (202, 113), (202, 114), (202, 115), (202, 116), (202, 117), (202, 118), (202, 119), (202, 120), (202, 121), (202, 122), (202, 123), (202, 124), (202, 125), (202, 126), (202, 127),
(202, 128), (202, 129), (202, 130), (202, 131), (202, 132), (202, 133), (202, 134), (202, 135), (202, 136), (202, 137), (202, 138), (202, 139), (202, 140), (202, 141), (202, 142), (202, 143), (202, 144), (202, 145), (202, 146), (202, 149), (203, 99), (203, 100), (203, 101), (203, 102), (203, 103), (203, 104), (203, 105), (203, 106), (203, 107), (203, 108), (203, 109), (203, 110), (203, 111), (203, 112), (203, 113), (203, 114), (203, 115), (203, 116), (203, 117), (203, 118), (203, 119), (203, 120), (203, 121), (203, 122), (203, 123), (203, 124), (203, 125), (203, 126), (203, 127), (203, 128), (203, 129), (203, 130), (203, 131), (203, 132), (203, 133), (203, 134), (203, 135), (203, 136), (203, 137), (203, 138), (203, 139), (203, 140), (203, 141), (203, 142), (203, 143), (203, 144), (203, 145), (203, 146), (203, 147), (203, 148), (203, 150), (204, 51),
(204, 53), (204, 54), (204, 55), (204, 56), (204, 57), (204, 58), (204, 59), (204, 104), (204, 105), (204, 106), (204, 107), (204, 108), (204, 109), (204, 110), (204, 111), (204, 112), (204, 113), (204, 114), (204, 115), (204, 116), (204, 117), (204, 118), (204, 119), (204, 120), (204, 121), (204, 122), (204, 123), (204, 124), (204, 125), (204, 126), (204, 127), (204, 128), (204, 129), (204, 130), (204, 131), (204, 132), (204, 133), (204, 134), (204, 135), (204, 136), (204, 137), (204, 138), (204, 139), (204, 140), (204, 141), (204, 142), (204, 143), (204, 144), (204, 145), (204, 146), (204, 147), (204, 148), (204, 150), (205, 51), (205, 59), (205, 60), (205, 61), (205, 62), (205, 63), (205, 64), (205, 65), (205, 66), (205, 67), (205, 68), (205, 69), (205, 70), (205, 71), (205, 104), (205, 106), (205, 107), (205, 108), (205, 109),
(205, 110), (205, 111), (205, 112), (205, 113), (205, 114), (205, 115), (205, 116), (205, 117), (205, 118), (205, 119), (205, 120), (205, 121), (205, 122), (205, 123), (205, 124), (205, 125), (205, 126), (205, 127), (205, 128), (205, 129), (205, 130), (205, 131), (205, 132), (205, 133), (205, 134), (205, 135), (205, 136), (205, 137), (205, 138), (205, 139), (205, 140), (205, 141), (205, 142), (205, 143), (205, 144), (205, 145), (205, 146), (205, 147), (205, 148), (205, 150), (206, 51), (206, 53), (206, 54), (206, 55), (206, 56), (206, 57), (206, 58), (206, 59), (206, 72), (206, 73), (206, 74), (206, 75), (206, 76), (206, 77), (206, 78), (206, 79), (206, 80), (206, 104), (206, 106), (206, 107), (206, 108), (206, 109), (206, 110), (206, 111), (206, 112), (206, 113), (206, 114), (206, 115), (206, 116), (206, 117), (206, 118), (206, 119),
(206, 120), (206, 121), (206, 122), (206, 123), (206, 124), (206, 125), (206, 126), (206, 127), (206, 128), (206, 129), (206, 130), (206, 131), (206, 132), (206, 133), (206, 134), (206, 135), (206, 136), (206, 137), (206, 138), (206, 139), (206, 140), (206, 141), (206, 142), (206, 143), (206, 144), (206, 145), (206, 146), (206, 147), (206, 148), (206, 149), (206, 151), (207, 50), (207, 52), (207, 53), (207, 54), (207, 55), (207, 56), (207, 57), (207, 58), (207, 59), (207, 60), (207, 61), (207, 62), (207, 63), (207, 64), (207, 65), (207, 66), (207, 67), (207, 68), (207, 69), (207, 70), (207, 71), (207, 81), (207, 82), (207, 83), (207, 103), (207, 105), (207, 106), (207, 107), (207, 108), (207, 109), (207, 110), (207, 111), (207, 112), (207, 113), (207, 114), (207, 115), (207, 116), (207, 117), (207, 118), (207, 119), (207, 120),
(207, 121), (207, 122), (207, 123), (207, 124), (207, 125), (207, 126), (207, 127), (207, 128), (207, 129), (207, 130), (207, 131), (207, 132), (207, 133), (207, 134), (207, 135), (207, 136), (207, 137), (207, 138), (207, 139), (207, 140), (207, 141), (207, 142), (207, 143), (207, 144), (207, 145), (207, 146), (207, 147), (207, 148), (207, 149), (207, 151), (208, 50), (208, 52), (208, 53), (208, 54), (208, 55), (208, 56), (208, 57), (208, 58), (208, 59), (208, 60), (208, 61), (208, 62), (208, 63), (208, 64), (208, 65), (208, 66), (208, 67), (208, 68), (208, 69), (208, 70), (208, 71), (208, 72), (208, 73), (208, 74), (208, 75), (208, 76), (208, 77), (208, 78), (208, 79), (208, 80), (208, 85), (208, 86), (208, 102), (208, 104), (208, 105), (208, 106), (208, 107), (208, 108), (208, 109), (208, 110), (208, 111), (208, 112),
(208, 113), (208, 114), (208, 115), (208, 116), (208, 117), (208, 118), (208, 119), (208, 120), (208, 121), (208, 122), (208, 123), (208, 124), (208, 125), (208, 126), (208, 127), (208, 128), (208, 129), (208, 130), (208, 131), (208, 132), (208, 133), (208, 134), (208, 135), (208, 136), (208, 137), (208, 138), (208, 139), (208, 140), (208, 141), (208, 142), (208, 143), (208, 144), (208, 145), (208, 146), (208, 147), (208, 148), (208, 149), (208, 151), (209, 49), (209, 51), (209, 52), (209, 53), (209, 54), (209, 55), (209, 56), (209, 57), (209, 58), (209, 59), (209, 60), (209, 61), (209, 62), (209, 63), (209, 64), (209, 65), (209, 66), (209, 67), (209, 68), (209, 69), (209, 70), (209, 71), (209, 72), (209, 73), (209, 74), (209, 75), (209, 76), (209, 77), (209, 78), (209, 79), (209, 80), (209, 81), (209, 82), (209, 83),
(209, 84), (209, 87), (209, 88), (209, 100), (209, 101), (209, 103), (209, 104), (209, 105), (209, 106), (209, 107), (209, 108), (209, 109), (209, 110), (209, 111), (209, 112), (209, 113), (209, 114), (209, 115), (209, 116), (209, 117), (209, 118), (209, 119), (209, 120), (209, 121), (209, 122), (209, 123), (209, 124), (209, 125), (209, 126), (209, 127), (209, 128), (209, 129), (209, 130), (209, 131), (209, 132), (209, 133), (209, 134), (209, 135), (209, 136), (209, 137), (209, 138), (209, 139), (209, 140), (209, 141), (209, 142), (209, 143), (209, 144), (209, 145), (209, 146), (209, 147), (209, 148), (209, 149), (209, 150), (209, 152), (210, 48), (210, 50), (210, 51), (210, 52), (210, 53), (210, 54), (210, 55), (210, 56), (210, 57), (210, 58), (210, 59), (210, 60), (210, 61), (210, 62), (210, 63), (210, 64), (210, 65), (210, 66),
(210, 67), (210, 68), (210, 69), (210, 70), (210, 71), (210, 72), (210, 73), (210, 74), (210, 75), (210, 76), (210, 77), (210, 78), (210, 79), (210, 80), (210, 81), (210, 82), (210, 83), (210, 84), (210, 85), (210, 86), (210, 89), (210, 90), (210, 91), (210, 92), (210, 93), (210, 94), (210, 95), (210, 96), (210, 97), (210, 98), (210, 99), (210, 102), (210, 103), (210, 104), (210, 105), (210, 106), (210, 107), (210, 108), (210, 109), (210, 110), (210, 111), (210, 112), (210, 113), (210, 114), (210, 115), (210, 116), (210, 117), (210, 118), (210, 119), (210, 120), (210, 121), (210, 122), (210, 123), (210, 124), (210, 125), (210, 126), (210, 127), (210, 128), (210, 129), (210, 130), (210, 131), (210, 132), (210, 133), (210, 134), (210, 135), (210, 136), (210, 137), (210, 138), (210, 139), (210, 140), (210, 141), (210, 142),
(210, 143), (210, 144), (210, 145), (210, 146), (210, 147), (210, 148), (210, 149), (210, 150), (210, 152), (211, 47), (211, 49), (211, 50), (211, 51), (211, 52), (211, 53), (211, 54), (211, 55), (211, 56), (211, 57), (211, 58), (211, 59), (211, 60), (211, 61), (211, 62), (211, 63), (211, 64), (211, 65), (211, 66), (211, 67), (211, 68), (211, 69), (211, 70), (211, 71), (211, 72), (211, 73), (211, 74), (211, 75), (211, 76), (211, 77), (211, 78), (211, 79), (211, 80), (211, 81), (211, 82), (211, 83), (211, 84), (211, 85), (211, 86), (211, 87), (211, 88), (211, 99), (211, 100), (211, 101), (211, 102), (211, 103), (211, 104), (211, 105), (211, 106), (211, 107), (211, 108), (211, 109), (211, 110), (211, 111), (211, 112), (211, 113), (211, 114), (211, 115), (211, 116), (211, 117), (211, 118), (211, 119), (211, 120),
(211, 121), (211, 122), (211, 123), (211, 124), (211, 125), (211, 126), (211, 127), (211, 128), (211, 129), (211, 130), (211, 131), (211, 132), (211, 133), (211, 134), (211, 135), (211, 136), (211, 137), (211, 138), (211, 139), (211, 140), (211, 141), (211, 142), (211, 143), (211, 144), (211, 145), (211, 146), (211, 147), (211, 148), (211, 149), (211, 150), (211, 151), (211, 153), (212, 46), (212, 48), (212, 49), (212, 50), (212, 51), (212, 52), (212, 53), (212, 54), (212, 55), (212, 56), (212, 57), (212, 58), (212, 59), (212, 60), (212, 61), (212, 62), (212, 63), (212, 64), (212, 65), (212, 66), (212, 67), (212, 68), (212, 69), (212, 70), (212, 71), (212, 72), (212, 73), (212, 74), (212, 75), (212, 76), (212, 77), (212, 78), (212, 79), (212, 80), (212, 81), (212, 82), (212, 83), (212, 84), (212, 85), (212, 86),
(212, 87), (212, 88), (212, 89), (212, 90), (212, 91), (212, 92), (212, 93), (212, 94), (212, 95), (212, 96), (212, 97), (212, 98), (212, 99), (212, 100), (212, 101), (212, 102), (212, 103), (212, 104), (212, 105), (212, 106), (212, 107), (212, 108), (212, 109), (212, 110), (212, 111), (212, 112), (212, 113), (212, 114), (212, 115), (212, 116), (212, 117), (212, 118), (212, 119), (212, 120), (212, 121), (212, 122), (212, 123), (212, 124), (212, 125), (212, 126), (212, 127), (212, 128), (212, 129), (212, 130), (212, 131), (212, 132), (212, 133), (212, 134), (212, 135), (212, 136), (212, 137), (212, 138), (212, 139), (212, 140), (212, 141), (212, 142), (212, 143), (212, 144), (212, 145), (212, 146), (212, 147), (212, 148), (212, 149), (212, 150), (212, 151), (212, 153), (213, 45), (213, 47), (213, 48), (213, 49), (213, 50), (213, 51),
(213, 52), (213, 53), (213, 54), (213, 55), (213, 56), (213, 57), (213, 58), (213, 59), (213, 60), (213, 61), (213, 62), (213, 63), (213, 64), (213, 65), (213, 66), (213, 67), (213, 68), (213, 69), (213, 70), (213, 71), (213, 72), (213, 73), (213, 74), (213, 75), (213, 76), (213, 77), (213, 78), (213, 79), (213, 80), (213, 81), (213, 82), (213, 83), (213, 84), (213, 85), (213, 86), (213, 87), (213, 88), (213, 89), (213, 90), (213, 91), (213, 92), (213, 93), (213, 94), (213, 95), (213, 96), (213, 97), (213, 98), (213, 99), (213, 100), (213, 101), (213, 102), (213, 103), (213, 104), (213, 105), (213, 106), (213, 107), (213, 108), (213, 109), (213, 110), (213, 111), (213, 112), (213, 113), (213, 114), (213, 115), (213, 116), (213, 117), (213, 118), (213, 119), (213, 120), (213, 121), (213, 122), (213, 123),
(213, 124), (213, 125), (213, 126), (213, 127), (213, 128), (213, 129), (213, 130), (213, 131), (213, 132), (213, 133), (213, 134), (213, 135), (213, 136), (213, 137), (213, 138), (213, 139), (213, 140), (213, 141), (213, 142), (213, 143), (213, 144), (213, 145), (213, 146), (213, 147), (213, 148), (213, 149), (213, 150), (213, 151), (213, 152), (213, 154), (214, 43), (214, 46), (214, 47), (214, 48), (214, 49), (214, 50), (214, 51), (214, 52), (214, 53), (214, 54), (214, 55), (214, 56), (214, 57), (214, 58), (214, 59), (214, 60), (214, 61), (214, 62), (214, 63), (214, 64), (214, 65), (214, 66), (214, 67), (214, 68), (214, 69), (214, 70), (214, 71), (214, 72), (214, 73), (214, 74), (214, 75), (214, 76), (214, 77), (214, 78), (214, 79), (214, 80), (214, 81), (214, 82), (214, 83), (214, 84), (214, 85), (214, 86),
(214, 87), (214, 88), (214, 89), (214, 90), (214, 91), (214, 92), (214, 93), (214, 94), (214, 95), (214, 96), (214, 97), (214, 98), (214, 99), (214, 100), (214, 101), (214, 102), (214, 103), (214, 104), (214, 105), (214, 106), (214, 107), (214, 108), (214, 109), (214, 110), (214, 111), (214, 112), (214, 113), (214, 114), (214, 115), (214, 116), (214, 117), (214, 118), (214, 119), (214, 120), (214, 121), (214, 122), (214, 123), (214, 124), (214, 125), (214, 126), (214, 127), (214, 128), (214, 129), (214, 130), (214, 131), (214, 132), (214, 133), (214, 134), (214, 135), (214, 136), (214, 137), (214, 138), (214, 139), (214, 140), (214, 141), (214, 142), (214, 143), (214, 144), (214, 145), (214, 146), (214, 147), (214, 148), (214, 149), (214, 150), (214, 151), (214, 152), (214, 154), (215, 42), (215, 45), (215, 46), (215, 47), (215, 48),
(215, 49), (215, 50), (215, 51), (215, 52), (215, 53), (215, 54), (215, 55), (215, 56), (215, 57), (215, 58), (215, 59), (215, 60), (215, 61), (215, 62), (215, 63), (215, 64), (215, 65), (215, 66), (215, 67), (215, 68), (215, 69), (215, 70), (215, 71), (215, 72), (215, 73), (215, 74), (215, 75), (215, 76), (215, 77), (215, 78), (215, 79), (215, 80), (215, 81), (215, 82), (215, 83), (215, 84), (215, 85), (215, 86), (215, 87), (215, 88), (215, 89), (215, 90), (215, 91), (215, 92), (215, 93), (215, 94), (215, 95), (215, 96), (215, 97), (215, 98), (215, 99), (215, 100), (215, 101), (215, 102), (215, 103), (215, 104), (215, 105), (215, 106), (215, 107), (215, 108), (215, 109), (215, 110), (215, 111), (215, 112), (215, 113), (215, 114), (215, 115), (215, 116), (215, 117), (215, 118), (215, 119), (215, 120),
(215, 121), (215, 122), (215, 123), (215, 124), (215, 125), (215, 126), (215, 127), (215, 128), (215, 129), (215, 130), (215, 131), (215, 132), (215, 133), (215, 134), (215, 135), (215, 136), (215, 137), (215, 138), (215, 139), (215, 140), (215, 141), (215, 142), (215, 143), (215, 144), (215, 145), (215, 146), (215, 147), (215, 148), (215, 149), (215, 150), (215, 151), (215, 152), (215, 153), (215, 155), (216, 41), (216, 44), (216, 45), (216, 46), (216, 47), (216, 48), (216, 49), (216, 50), (216, 51), (216, 52), (216, 53), (216, 54), (216, 55), (216, 56), (216, 57), (216, 58), (216, 59), (216, 60), (216, 61), (216, 62), (216, 63), (216, 69), (216, 72), (216, 73), (216, 74), (216, 75), (216, 76), (216, 77), (216, 78), (216, 79), (216, 80), (216, 81), (216, 82), (216, 83), (216, 84), (216, 85), (216, 86), (216, 87),
(216, 88), (216, 89), (216, 90), (216, 91), (216, 92), (216, 93), (216, 94), (216, 95), (216, 96), (216, 97), (216, 98), (216, 99), (216, 100), (216, 101), (216, 102), (216, 103), (216, 104), (216, 105), (216, 106), (216, 107), (216, 108), (216, 109), (216, 110), (216, 111), (216, 112), (216, 113), (216, 114), (216, 115), (216, 116), (216, 117), (216, 118), (216, 119), (216, 120), (216, 121), (216, 122), (216, 123), (216, 124), (216, 125), (216, 126), (216, 127), (216, 128), (216, 129), (216, 130), (216, 131), (216, 132), (216, 133), (216, 134), (216, 135), (216, 136), (216, 137), (216, 138), (216, 139), (216, 140), (216, 141), (216, 142), (216, 143), (216, 144), (216, 145), (216, 146), (216, 147), (216, 148), (216, 149), (216, 150), (216, 151), (216, 152), (216, 153), (216, 155), (217, 40), (217, 42), (217, 43), (217, 44), (217, 45),
(217, 46), (217, 47), (217, 48), (217, 49), (217, 50), (217, 51), (217, 52), (217, 53), (217, 54), (217, 55), (217, 56), (217, 57), (217, 58), (217, 59), (217, 60), (217, 64), (217, 65), (217, 66), (217, 67), (217, 68), (217, 69), (217, 70), (217, 71), (217, 73), (217, 74), (217, 75), (217, 76), (217, 77), (217, 78), (217, 79), (217, 80), (217, 81), (217, 82), (217, 83), (217, 84), (217, 85), (217, 86), (217, 87), (217, 88), (217, 89), (217, 90), (217, 91), (217, 92), (217, 93), (217, 94), (217, 95), (217, 96), (217, 97), (217, 98), (217, 99), (217, 100), (217, 101), (217, 102), (217, 103), (217, 104), (217, 105), (217, 106), (217, 107), (217, 108), (217, 109), (217, 110), (217, 111), (217, 112), (217, 113), (217, 114), (217, 115), (217, 116), (217, 117), (217, 118), (217, 119), (217, 120), (217, 121),
(217, 122), (217, 123), (217, 124), (217, 125), (217, 126), (217, 127), (217, 128), (217, 129), (217, 130), (217, 131), (217, 132), (217, 133), (217, 134), (217, 135), (217, 136), (217, 137), (217, 138), (217, 139), (217, 140), (217, 141), (217, 142), (217, 143), (217, 144), (217, 145), (217, 146), (217, 147), (217, 148), (217, 149), (217, 150), (217, 151), (217, 152), (217, 153), (217, 154), (217, 156), (218, 40), (218, 42), (218, 43), (218, 44), (218, 45), (218, 46), (218, 47), (218, 48), (218, 49), (218, 50), (218, 51), (218, 52), (218, 53), (218, 54), (218, 55), (218, 56), (218, 57), (218, 61), (218, 62), (218, 63), (218, 72), (218, 74), (218, 75), (218, 76), (218, 77), (218, 78), (218, 79), (218, 80), (218, 81), (218, 82), (218, 83), (218, 84), (218, 85), (218, 86), (218, 87), (218, 88), (218, 89), (218, 90),
(218, 91), (218, 92), (218, 93), (218, 94), (218, 95), (218, 96), (218, 97), (218, 98), (218, 99), (218, 100), (218, 101), (218, 102), (218, 103), (218, 104), (218, 105), (218, 106), (218, 107), (218, 108), (218, 109), (218, 110), (218, 111), (218, 112), (218, 113), (218, 114), (218, 115), (218, 116), (218, 117), (218, 118), (218, 119), (218, 120), (218, 121), (218, 122), (218, 123), (218, 124), (218, 125), (218, 126), (218, 127), (218, 128), (218, 129), (218, 130), (218, 131), (218, 132), (218, 133), (218, 134), (218, 135), (218, 136), (218, 137), (218, 138), (218, 139), (218, 140), (218, 141), (218, 142), (218, 143), (218, 144), (218, 145), (218, 146), (218, 147), (218, 148), (218, 149), (218, 150), (218, 151), (218, 152), (218, 153), (218, 154), (218, 155), (219, 39), (219, 58), (219, 60), (219, 73), (219, 158), (220, 39), (220, 41),
(220, 42), (220, 43), (220, 44), (220, 45), (220, 46), (220, 47), (220, 48), (220, 49), (220, 50), (220, 51), (220, 52), (220, 53), (220, 54), (220, 55), (220, 56), (220, 57), (220, 73), (220, 75), (220, 76), (220, 77), (220, 78), (220, 79), (220, 80), (220, 81), (220, 82), (220, 83), (220, 84), (220, 85), (220, 86), (220, 87), (220, 88), (220, 89), (220, 90), (220, 91), (220, 92), (220, 93), (220, 94), (220, 95), (220, 96), (220, 97), (220, 98), (220, 99), (220, 100), (220, 101), (220, 102), (220, 103), (220, 104), (220, 105), (220, 106), (220, 107), (220, 108), (220, 109), (220, 110), (220, 111), (220, 112), (220, 113), (220, 114), (220, 115), (220, 116), (220, 117), (220, 118), (220, 119), (220, 120), (220, 121), (220, 122), (220, 123), (220, 124), (220, 125), (220, 126), (220, 127), (220, 128), (220, 129),
(220, 130), (220, 131), (220, 132), (220, 133), (220, 134), (220, 135), (220, 136), (220, 137), (220, 138), (220, 139), (220, 140), (220, 141), (220, 142), (220, 143), (220, 144), (220, 145), (220, 146), (220, 147), (220, 148), (220, 149), (220, 150), (220, 151), (220, 152), (220, 153), (220, 154), (220, 155), (220, 156), (220, 158), (225, 43), (225, 45), (225, 46), (225, 47), (225, 48), (225, 49), (225, 50), (225, 51), (225, 52), (225, 53), (225, 54), (225, 55), (225, 56), (225, 58), (225, 72), (225, 74), (225, 75), (225, 76), (225, 77), (225, 78), (225, 79), (225, 80), (225, 81), (225, 82), (225, 83), (225, 84), (225, 85), (225, 86), (225, 87), (225, 88), (225, 89), (225, 90), (225, 91), (225, 92), (225, 93), (225, 94), (225, 95), (225, 96), (225, 97), (225, 98), (225, 99), (225, 100), (225, 101), (225, 102),
(225, 103), (225, 104), (225, 105), (225, 106), (225, 107), (225, 108), (225, 109), (225, 110), (225, 111), (225, 112), (225, 113), (225, 114), (225, 115), (225, 116), (225, 117), (225, 118), (225, 119), (225, 120), (225, 121), (225, 122), (225, 123), (225, 124), (225, 125), (225, 126), (225, 127), (225, 128), (225, 129), (225, 130), (225, 131), (225, 132), (225, 133), (225, 134), (225, 135), (225, 136), (225, 137), (225, 138), (225, 139), (225, 140), (225, 141), (225, 142), (225, 143), (225, 144), (225, 145), (225, 146), (225, 147), (225, 148), (225, 149), (225, 150), (225, 151), (225, 152), (225, 153), (225, 154), (225, 155), (225, 156), (225, 158), (226, 44), (226, 60), (226, 70), (226, 158), (227, 45), (227, 48), (227, 49), (227, 50), (227, 51), (227, 52), (227, 53), (227, 54), (227, 55), (227, 56), (227, 57), (227, 58), (227, 61),
(227, 69), (227, 72), (227, 73), (227, 74), (227, 75), (227, 76), (227, 77), (227, 78), (227, 79), (227, 80), (227, 81), (227, 82), (227, 83), (227, 84), (227, 85), (227, 86), (227, 87), (227, 88), (227, 89), (227, 90), (227, 91), (227, 92), (227, 93), (227, 94), (227, 95), (227, 96), (227, 97), (227, 98), (227, 99), (227, 100), (227, 101), (227, 102), (227, 103), (227, 104), (227, 105), (227, 106), (227, 107), (227, 108), (227, 109), (227, 110), (227, 111), (227, 112), (227, 113), (227, 114), (227, 115), (227, 116), (227, 117), (227, 118), (227, 119), (227, 120), (227, 121), (227, 122), (227, 123), (227, 124), (227, 125), (227, 126), (227, 127), (227, 128), (227, 129), (227, 130), (227, 131), (227, 132), (227, 133), (227, 134), (227, 135), (227, 136), (227, 137), (227, 138), (227, 139), (227, 140), (227, 141), (227, 142),
(227, 143), (227, 144), (227, 145), (227, 146), (227, 147), (227, 148), (227, 149), (227, 150), (227, 151), (227, 152), (227, 153), (227, 154), (227, 155), (227, 157), (228, 47), (228, 49), (228, 50), (228, 51), (228, 52), (228, 53), (228, 54), (228, 55), (228, 56), (228, 57), (228, 58), (228, 59), (228, 60), (228, 63), (228, 64), (228, 65), (228, 66), (228, 67), (228, 70), (228, 71), (228, 72), (228, 73), (228, 74), (228, 75), (228, 76), (228, 77), (228, 78), (228, 79), (228, 80), (228, 81), (228, 82), (228, 83), (228, 84), (228, 85), (228, 86), (228, 87), (228, 88), (228, 89), (228, 90), (228, 91), (228, 92), (228, 93), (228, 94), (228, 95), (228, 96), (228, 97), (228, 98), (228, 99), (228, 100), (228, 101), (228, 102), (228, 103), (228, 104), (228, 105), (228, 106), (228, 107), (228, 108), (228, 109),
(228, 110), (228, 111), (228, 112), (228, 113), (228, 114), (228, 115), (228, 116), (228, 117), (228, 118), (228, 119), (228, 120), (228, 121), (228, 122), (228, 123), (228, 124), (228, 125), (228, 126), (228, 127), (228, 128), (228, 129), (228, 130), (228, 131), (228, 132), (228, 133), (228, 134), (228, 135), (228, 136), (228, 137), (228, 138), (228, 139), (228, 140), (228, 141), (228, 142), (228, 143), (228, 144), (228, 145), (228, 146), (228, 147), (228, 148), (228, 149), (228, 150), (228, 151), (228, 152), (228, 153), (228, 154), (228, 155), (228, 157), (229, 48), (229, 50), (229, 51), (229, 52), (229, 53), (229, 54), (229, 55), (229, 56), (229, 57), (229, 58), (229, 59), (229, 60), (229, 61), (229, 62), (229, 69), (229, 70), (229, 71), (229, 72), (229, 73), (229, 74), (229, 75), (229, 76), (229, 77), (229, 78), (229, 79),
(229, 80), (229, 81), (229, 82), (229, 83), (229, 84), (229, 85), (229, 86), (229, 87), (229, 88), (229, 89), (229, 90), (229, 91), (229, 92), (229, 93), (229, 94), (229, 95), (229, 96), (229, 97), (229, 98), (229, 99), (229, 100), (229, 101), (229, 102), (229, 103), (229, 104), (229, 105), (229, 106), (229, 107), (229, 108), (229, 109), (229, 110), (229, 111), (229, 112), (229, 113), (229, 114), (229, 115), (229, 116), (229, 117), (229, 118), (229, 119), (229, 120), (229, 121), (229, 122), (229, 123), (229, 124), (229, 125), (229, 126), (229, 127), (229, 128), (229, 129), (229, 130), (229, 131), (229, 132), (229, 133), (229, 134), (229, 135), (229, 136), (229, 137), (229, 138), (229, 139), (229, 140), (229, 141), (229, 142), (229, 143), (229, 144), (229, 145), (229, 146), (229, 147), (229, 148), (229, 149), (229, 150), (229, 151),
(229, 152), (229, 153), (229, 154), (229, 155), (229, 157), (230, 49), (230, 51), (230, 52), (230, 53), (230, 54), (230, 55), (230, 56), (230, 57), (230, 58), (230, 59), (230, 60), (230, 61), (230, 62), (230, 63), (230, 64), (230, 65), (230, 66), (230, 67), (230, 68), (230, 69), (230, 70), (230, 71), (230, 72), (230, 73), (230, 74), (230, 75), (230, 76), (230, 77), (230, 78), (230, 79), (230, 80), (230, 81), (230, 82), (230, 83), (230, 84), (230, 85), (230, 86), (230, 87), (230, 88), (230, 89), (230, 90), (230, 91), (230, 92), (230, 93), (230, 94), (230, 95), (230, 96), (230, 97), (230, 98), (230, 99), (230, 100), (230, 101), (230, 102), (230, 103), (230, 104), (230, 105), (230, 106), (230, 107), (230, 108), (230, 109), (230, 110), (230, 111), (230, 112), (230, 113), (230, 114), (230, 115), (230, 116),
(230, 117), (230, 118), (230, 119), (230, 120), (230, 121), (230, 122), (230, 123), (230, 124), (230, 125), (230, 126), (230, 127), (230, 128), (230, 129), (230, 130), (230, 131), (230, 132), (230, 133), (230, 134), (230, 135), (230, 136), (230, 137), (230, 138), (230, 139), (230, 140), (230, 141), (230, 142), (230, 143), (230, 144), (230, 145), (230, 146), (230, 147), (230, 148), (230, 149), (230, 150), (230, 151), (230, 152), (230, 153), (230, 154), (230, 155), (230, 157), (231, 50), (231, 52), (231, 53), (231, 54), (231, 55), (231, 56), (231, 57), (231, 58), (231, 59), (231, 60), (231, 61), (231, 62), (231, 63), (231, 64), (231, 65), (231, 66), (231, 67), (231, 68), (231, 69), (231, 70), (231, 71), (231, 72), (231, 73), (231, 74), (231, 75), (231, 76), (231, 77), (231, 78), (231, 79), (231, 80), (231, 81), (231, 82),
(231, 83), (231, 84), (231, 85), (231, 86), (231, 87), (231, 88), (231, 89), (231, 90), (231, 91), (231, 92), (231, 93), (231, 94), (231, 95), (231, 96), (231, 97), (231, 98), (231, 99), (231, 100), (231, 101), (231, 102), (231, 103), (231, 104), (231, 105), (231, 106), (231, 107), (231, 108), (231, 109), (231, 110), (231, 111), (231, 112), (231, 113), (231, 114), (231, 115), (231, 116), (231, 117), (231, 118), (231, 119), (231, 120), (231, 121), (231, 122), (231, 123), (231, 124), (231, 125), (231, 126), (231, 127), (231, 128), (231, 129), (231, 130), (231, 131), (231, 132), (231, 133), (231, 134), (231, 135), (231, 136), (231, 137), (231, 138), (231, 139), (231, 140), (231, 141), (231, 142), (231, 143), (231, 144), (231, 145), (231, 146), (231, 147), (231, 148), (231, 149), (231, 150), (231, 151), (231, 152), (231, 153), (231, 154),
(231, 156), (232, 51), (232, 53), (232, 54), (232, 55), (232, 56), (232, 57), (232, 58), (232, 59), (232, 60), (232, 61), (232, 62), (232, 63), (232, 64), (232, 65), (232, 66), (232, 67), (232, 68), (232, 69), (232, 70), (232, 71), (232, 72), (232, 73), (232, 74), (232, 75), (232, 76), (232, 77), (232, 78), (232, 79), (232, 80), (232, 81), (232, 82), (232, 83), (232, 84), (232, 85), (232, 86), (232, 87), (232, 88), (232, 89), (232, 90), (232, 91), (232, 92), (232, 93), (232, 94), (232, 95), (232, 96), (232, 97), (232, 98), (232, 99), (232, 100), (232, 101), (232, 102), (232, 103), (232, 104), (232, 105), (232, 106), (232, 107), (232, 108), (232, 109), (232, 110), (232, 111), (232, 112), (232, 113), (232, 114), (232, 115), (232, 116), (232, 117), (232, 118), (232, 119), (232, 120), (232, 121), (232, 122),
(232, 123), (232, 124), (232, 125), (232, 126), (232, 127), (232, 128), (232, 129), (232, 130), (232, 131), (232, 132), (232, 133), (232, 134), (232, 135), (232, 136), (232, 137), (232, 138), (232, 139), (232, 140), (232, 141), (232, 142), (232, 143), (232, 144), (232, 145), (232, 146), (232, 147), (232, 148), (232, 149), (232, 150), (232, 151), (232, 152), (232, 153), (232, 154), (232, 156), (233, 52), (233, 54), (233, 55), (233, 56), (233, 57), (233, 58), (233, 59), (233, 60), (233, 61), (233, 62), (233, 63), (233, 64), (233, 65), (233, 66), (233, 67), (233, 68), (233, 69), (233, 70), (233, 71), (233, 72), (233, 73), (233, 74), (233, 75), (233, 76), (233, 77), (233, 78), (233, 79), (233, 80), (233, 81), (233, 82), (233, 83), (233, 84), (233, 85), (233, 86), (233, 87), (233, 88), (233, 89), (233, 90), (233, 91),
(233, 92), (233, 93), (233, 94), (233, 95), (233, 96), (233, 97), (233, 98), (233, 99), (233, 100), (233, 101), (233, 102), (233, 103), (233, 104), (233, 105), (233, 106), (233, 107), (233, 108), (233, 109), (233, 110), (233, 111), (233, 112), (233, 113), (233, 114), (233, 115), (233, 116), (233, 117), (233, 118), (233, 119), (233, 120), (233, 121), (233, 122), (233, 123), (233, 124), (233, 125), (233, 126), (233, 127), (233, 128), (233, 129), (233, 130), (233, 131), (233, 132), (233, 133), (233, 134), (233, 135), (233, 136), (233, 137), (233, 138), (233, 139), (233, 140), (233, 141), (233, 142), (233, 143), (233, 144), (233, 145), (233, 146), (233, 147), (233, 148), (233, 149), (233, 150), (233, 151), (233, 152), (233, 153), (233, 154), (233, 156), (234, 52), (234, 54), (234, 55), (234, 56), (234, 57), (234, 58), (234, 59), (234, 60),
(234, 61), (234, 62), (234, 63), (234, 64), (234, 65), (234, 66), (234, 67), (234, 68), (234, 69), (234, 70), (234, 71), (234, 72), (234, 73), (234, 74), (234, 75), (234, 76), (234, 77), (234, 78), (234, 79), (234, 80), (234, 81), (234, 85), (234, 86), (234, 101), (234, 102), (234, 103), (234, 104), (234, 105), (234, 106), (234, 107), (234, 108), (234, 109), (234, 110), (234, 111), (234, 112), (234, 113), (234, 114), (234, 115), (234, 116), (234, 117), (234, 118), (234, 119), (234, 120), (234, 121), (234, 122), (234, 123), (234, 124), (234, 125), (234, 126), (234, 127), (234, 128), (234, 129), (234, 130), (234, 131), (234, 132), (234, 133), (234, 134), (234, 135), (234, 136), (234, 137), (234, 138), (234, 139), (234, 140), (234, 141), (234, 142), (234, 143), (234, 144), (234, 145), (234, 146), (234, 147), (234, 148), (234, 149),
(234, 150), (234, 151), (234, 152), (234, 156), (235, 53), (235, 55), (235, 56), (235, 57), (235, 58), (235, 59), (235, 60), (235, 61), (235, 62), (235, 63), (235, 64), (235, 65), (235, 66), (235, 67), (235, 68), (235, 69), (235, 70), (235, 71), (235, 72), (235, 73), (235, 74), (235, 75), (235, 76), (235, 77), (235, 78), (235, 79), (235, 80), (235, 81), (235, 83), (235, 84), (235, 85), (235, 86), (235, 87), (235, 88), (235, 89), (235, 90), (235, 91), (235, 92), (235, 93), (235, 94), (235, 95), (235, 96), (235, 97), (235, 98), (235, 99), (235, 102), (235, 103), (235, 104), (235, 105), (235, 106), (235, 107), (235, 108), (235, 109), (235, 110), (235, 111), (235, 112), (235, 113), (235, 114), (235, 115), (235, 116), (235, 117), (235, 118), (235, 119), (235, 120), (235, 121), (235, 122), (235, 123), (235, 124),
(235, 125), (235, 126), (235, 127), (235, 128), (235, 129), (235, 130), (235, 131), (235, 132), (235, 133), (235, 134), (235, 135), (235, 136), (235, 137), (235, 138), (235, 139), (235, 140), (235, 141), (235, 142), (235, 143), (235, 144), (235, 145), (235, 146), (235, 147), (235, 148), (235, 149), (235, 150), (235, 153), (235, 155), (236, 53), (236, 55), (236, 56), (236, 57), (236, 58), (236, 59), (236, 60), (236, 61), (236, 62), (236, 63), (236, 64), (236, 65), (236, 66), (236, 67), (236, 68), (236, 69), (236, 70), (236, 71), (236, 72), (236, 73), (236, 74), (236, 75), (236, 76), (236, 77), (236, 78), (236, 79), (236, 81), (236, 101), (236, 103), (236, 104), (236, 105), (236, 106), (236, 107), (236, 108), (236, 109), (236, 110), (236, 111), (236, 112), (236, 113), (236, 114), (236, 115), (236, 116), (236, 117), (236, 118),
(236, 119), (236, 120), (236, 121), (236, 122), (236, 123), (236, 124), (236, 125), (236, 126), (236, 127), (236, 128), (236, 129), (236, 130), (236, 131), (236, 132), (236, 133), (236, 134), (236, 135), (236, 136), (236, 137), (236, 138), (236, 139), (236, 140), (236, 141), (236, 142), (236, 143), (236, 144), (236, 145), (236, 146), (236, 147), (236, 148), (236, 149), (236, 152), (237, 54), (237, 56), (237, 57), (237, 58), (237, 59), (237, 60), (237, 61), (237, 62), (237, 63), (237, 64), (237, 65), (237, 66), (237, 67), (237, 68), (237, 69), (237, 70), (237, 81), (237, 102), (237, 104), (237, 105), (237, 106), (237, 107), (237, 108), (237, 109), (237, 110), (237, 111), (237, 112), (237, 113), (237, 114), (237, 115), (237, 116), (237, 117), (237, 118), (237, 119), (237, 120), (237, 121), (237, 122), (237, 123), (237, 124), (237, 125),
(237, 126), (237, 127), (237, 128), (237, 129), (237, 130), (237, 131), (237, 132), (237, 133), (237, 134), (237, 135), (237, 136), (237, 137), (237, 138), (237, 139), (237, 140), (237, 141), (237, 142), (237, 143), (237, 144), (237, 145), (237, 146), (237, 147), (237, 150), (238, 54), (238, 56), (238, 57), (238, 58), (238, 59), (238, 60), (238, 61), (238, 62), (238, 63), (238, 64), (238, 71), (238, 72), (238, 73), (238, 74), (238, 75), (238, 76), (238, 77), (238, 78), (238, 80), (238, 103), (238, 105), (238, 106), (238, 107), (238, 108), (238, 109), (238, 110), (238, 111), (238, 112), (238, 113), (238, 114), (238, 115), (238, 116), (238, 117), (238, 118), (238, 119), (238, 120), (238, 121), (238, 122), (238, 123), (238, 124), (238, 125), (238, 126), (238, 127), (238, 128), (238, 129), (238, 130), (238, 131), (238, 132), (238, 133),
(238, 134), (238, 135), (238, 136), (238, 137), (238, 138), (238, 139), (238, 140), (238, 141), (238, 142), (238, 143), (238, 144), (238, 145), (238, 146), (238, 149), (239, 54), (239, 65), (239, 66), (239, 67), (239, 68), (239, 69), (239, 70), (239, 104), (239, 106), (239, 107), (239, 108), (239, 109), (239, 110), (239, 111), (239, 112), (239, 113), (239, 114), (239, 115), (239, 116), (239, 117), (239, 118), (239, 119), (239, 120), (239, 121), (239, 122), (239, 123), (239, 124), (239, 125), (239, 126), (239, 127), (239, 128), (239, 129), (239, 130), (239, 131), (239, 132), (239, 133), (239, 134), (239, 135), (239, 136), (239, 137), (239, 138), (239, 139), (239, 140), (239, 141), (239, 142), (239, 143), (239, 144), (239, 145), (240, 54), (240, 56), (240, 57), (240, 58), (240, 59), (240, 60), (240, 61), (240, 62), (240, 63), (240, 64),
(240, 104), (240, 106), (240, 107), (240, 108), (240, 109), (240, 110), (240, 111), (240, 112), (240, 113), (240, 114), (240, 115), (240, 116), (240, 117), (240, 118), (240, 119), (240, 120), (240, 121), (240, 122), (240, 123), (240, 124), (240, 125), (240, 126), (240, 127), (240, 128), (240, 129), (240, 130), (240, 131), (240, 132), (240, 133), (240, 134), (240, 135), (240, 136), (240, 137), (240, 138), (240, 139), (240, 140), (240, 141), (240, 142), (240, 143), (240, 144), (240, 146), (241, 54), (241, 55), (241, 104), (241, 106), (241, 107), (241, 108), (241, 109), (241, 110), (241, 111), (241, 112), (241, 113), (241, 114), (241, 115), (241, 116), (241, 117), (241, 118), (241, 119), (241, 120), (241, 121), (241, 122), (241, 123), (241, 124), (241, 125), (241, 126), (241, 127), (241, 128), (241, 129), (241, 130), (241, 131), (241, 132), (241, 133),
(241, 134), (241, 135), (241, 136), (241, 137), (241, 138), (241, 139), (241, 140), (241, 141), (241, 142), (241, 143), (241, 145), (242, 103), (242, 105), (242, 106), (242, 107), (242, 108), (242, 109), (242, 110), (242, 111), (242, 112), (242, 113), (242, 114), (242, 115), (242, 116), (242, 117), (242, 118), (242, 119), (242, 120), (242, 121), (242, 122), (242, 123), (242, 124), (242, 125), (242, 126), (242, 127), (242, 128), (242, 129), (242, 130), (242, 131), (242, 132), (242, 133), (242, 134), (242, 135), (242, 136), (242, 137), (242, 138), (242, 139), (242, 140), (242, 141), (242, 142), (243, 100), (243, 101), (243, 104), (243, 105), (243, 106), (243, 107), (243, 108), (243, 109), (243, 110), (243, 111), (243, 112), (243, 113), (243, 114), (243, 115), (243, 116), (243, 117), (243, 118), (243, 119), (243, 120), (243, 121), (243, 122), (243, 123),
(243, 124), (243, 125), (243, 126), (243, 127), (243, 128), (243, 129), (243, 130), (243, 131), (243, 132), (243, 133), (243, 134), (243, 135), (243, 136), (243, 137), (243, 138), (243, 139), (243, 140), (243, 141), (243, 142), (243, 144), (244, 90), (244, 91), (244, 92), (244, 93), (244, 94), (244, 95), (244, 96), (244, 97), (244, 98), (244, 99), (244, 103), (244, 104), (244, 105), (244, 106), (244, 107), (244, 108), (244, 109), (244, 110), (244, 111), (244, 112), (244, 113), (244, 114), (244, 115), (244, 116), (244, 117), (244, 118), (244, 119), (244, 120), (244, 121), (244, 122), (244, 123), (244, 124), (244, 125), (244, 126), (244, 127), (244, 128), (244, 129), (244, 130), (244, 131), (244, 132), (244, 133), (244, 134), (244, 135), (244, 136), (244, 137), (244, 138), (244, 139), (244, 140), (244, 141), (244, 143), (245, 86), (245, 88),
(245, 89), (245, 100), (245, 101), (245, 102), (245, 103), (245, 104), (245, 105), (245, 106), (245, 107), (245, 108), (245, 109), (245, 110), (245, 111), (245, 112), (245, 113), (245, 114), (245, 115), (245, 116), (245, 117), (245, 118), (245, 119), (245, 120), (245, 121), (245, 122), (245, 123), (245, 124), (245, 125), (245, 126), (245, 127), (245, 128), (245, 129), (245, 130), (245, 131), (245, 132), (245, 133), (245, 134), (245, 135), (245, 136), (245, 137), (245, 138), (245, 139), (245, 140), (245, 142), (246, 84), (246, 90), (246, 91), (246, 92), (246, 93), (246, 94), (246, 95), (246, 96), (246, 97), (246, 98), (246, 99), (246, 100), (246, 101), (246, 102), (246, 103), (246, 104), (246, 105), (246, 106), (246, 107), (246, 108), (246, 109), (246, 110), (246, 111), (246, 112), (246, 113), (246, 114), (246, 115), (246, 116), (246, 117),
(246, 118), (246, 119), (246, 120), (246, 121), (246, 122), (246, 123), (246, 124), (246, 125), (246, 126), (246, 127), (246, 128), (246, 129), (246, 130), (246, 131), (246, 132), (246, 133), (246, 134), (246, 135), (246, 136), (246, 137), (246, 138), (246, 139), (246, 141), (247, 83), (247, 86), (247, 87), (247, 88), (247, 89), (247, 90), (247, 91), (247, 92), (247, 93), (247, 94), (247, 95), (247, 96), (247, 97), (247, 98), (247, 99), (247, 100), (247, 101), (247, 102), (247, 103), (247, 104), (247, 105), (247, 106), (247, 107), (247, 108), (247, 109), (247, 110), (247, 111), (247, 112), (247, 113), (247, 114), (247, 115), (247, 116), (247, 117), (247, 118), (247, 119), (247, 120), (247, 121), (247, 122), (247, 123), (247, 124), (247, 125), (247, 126), (247, 127), (247, 128), (247, 129), (247, 130), (247, 131), (247, 132), (247, 133),
(247, 134), (247, 135), (247, 136), (247, 137), (247, 138), (247, 140), (248, 83), (248, 118), (248, 119), (248, 120), (248, 121), (248, 122), (248, 123), (248, 125), (248, 126), (248, 127), (248, 128), (248, 129), (248, 130), (248, 131), (248, 132), (248, 133), (248, 134), (248, 135), (248, 136), (248, 137), (248, 139), (249, 83), (249, 85), (249, 86), (249, 87), (249, 88), (249, 89), (249, 90), (249, 91), (249, 92), (249, 93), (249, 94), (249, 95), (249, 96), (249, 97), (249, 98), (249, 99), (249, 100), (249, 101), (249, 102), (249, 103), (249, 104), (249, 105), (249, 106), (249, 107), (249, 108), (249, 109), (249, 110), (249, 111), (249, 112), (249, 113), (249, 114), (249, 115), (249, 116), (249, 117), (249, 120), (249, 121), (249, 124), (249, 128), (249, 129), (249, 130), (249, 131), (249, 132), (249, 133), (249, 134), (249, 135),
(249, 136), (249, 138), (250, 83), (250, 118), (250, 121), (250, 122), (250, 126), (250, 130), (250, 131), (250, 132), (250, 133), (250, 134), (250, 137), (251, 128), (251, 136), (252, 121), (252, 130), (252, 132), (252, 134), )
coordinates_F8F8FF = ((164, 154),
(164, 155), (164, 156), (164, 157), (164, 158), (164, 159), (165, 151), (165, 153), (165, 161), (166, 151), (166, 154), (166, 155), (166, 156), (166, 157), (166, 158), (166, 159), (166, 161), (167, 150), (167, 152), (167, 153), (167, 154), (167, 155), (167, 156), (167, 157), (167, 158), (167, 160), (168, 150), (168, 152), (168, 153), (168, 154), (168, 155), (168, 156), (168, 157), (168, 159), (169, 149), (169, 151), (169, 152), (169, 153), (169, 154), (169, 155), (169, 156), (169, 158), (170, 148), (170, 150), (170, 151), (170, 152), (170, 153), (170, 154), (170, 155), (170, 156), (170, 158), (171, 147), (171, 149), (171, 150), (171, 151), (171, 152), (171, 153), (171, 154), (171, 155), (171, 156), (171, 158), (172, 146), (172, 148), (172, 149), (172, 150), (172, 151), (172, 152), (172, 153), (172, 154), (172, 155), (172, 156), (172, 158), (173, 146),
(173, 148), (173, 149), (173, 150), (173, 151), (173, 152), (173, 153), (173, 154), (173, 155), (173, 156), (173, 158), (174, 145), (174, 148), (174, 149), (174, 150), (174, 151), (174, 152), (174, 153), (174, 154), (174, 155), (174, 156), (174, 157), (174, 159), (175, 145), (175, 147), (175, 150), (175, 151), (175, 152), (175, 153), (175, 154), (175, 155), (175, 156), (175, 157), (175, 159), (176, 148), (176, 149), (176, 152), (176, 153), (176, 154), (176, 155), (176, 156), (176, 157), (176, 159), (177, 150), (177, 153), (177, 154), (177, 155), (177, 156), (177, 157), (177, 158), (177, 160), (178, 154), (178, 155), (178, 156), (178, 157), (178, 158), (178, 160), (179, 153), (179, 155), (179, 156), (179, 157), (179, 158), (179, 159), (179, 161), (180, 153), (180, 155), (180, 156), (180, 157), (180, 158), (180, 159), (180, 160), (180, 162), (181, 139),
(181, 154), (181, 156), (181, 157), (181, 158), (181, 159), (181, 160), (181, 162), (182, 139), (182, 155), (182, 157), (182, 158), (182, 159), (182, 160), (182, 161), (183, 138), (183, 155), (183, 157), (183, 158), (183, 159), (183, 160), (183, 161), (183, 162), (183, 165), (184, 137), (184, 156), (184, 158), (184, 159), (184, 160), (184, 161), (184, 162), (184, 163), (184, 164), (184, 166), (185, 136), (185, 137), (185, 156), (185, 158), (185, 159), (185, 160), (185, 161), (185, 162), (185, 163), (185, 164), (185, 165), (186, 135), (186, 137), (186, 157), (186, 159), (186, 160), (186, 161), (186, 162), (186, 163), (186, 164), (186, 165), (186, 166), (186, 169), (187, 134), (187, 136), (187, 137), (187, 157), (187, 159), (187, 160), (187, 161), (187, 162), (187, 163), (187, 164), (187, 165), (187, 166), (187, 167), (187, 170), (188, 133), (188, 135),
(188, 137), (188, 158), (188, 160), (188, 161), (188, 162), (188, 163), (188, 164), (188, 165), (188, 166), (188, 167), (188, 168), (189, 121), (189, 124), (189, 132), (189, 134), (189, 135), (189, 136), (189, 138), (189, 158), (189, 160), (189, 161), (189, 162), (189, 163), (189, 164), (189, 165), (189, 166), (189, 167), (189, 168), (189, 169), (189, 172), (189, 174), (190, 120), (190, 133), (190, 134), (190, 135), (190, 136), (190, 137), (190, 139), (190, 158), (190, 160), (190, 161), (190, 162), (190, 163), (190, 164), (190, 165), (190, 166), (190, 167), (190, 168), (190, 169), (190, 170), (190, 171), (190, 174), (191, 123), (191, 125), (191, 129), (191, 132), (191, 133), (191, 134), (191, 135), (191, 136), (191, 137), (191, 138), (191, 140), (191, 159), (191, 161), (191, 162), (191, 163), (191, 164), (191, 165), (191, 166), (191, 167), (191, 168),
(191, 169), (191, 170), (191, 171), (191, 172), (191, 174), (192, 127), (192, 128), (192, 133), (192, 134), (192, 135), (192, 136), (192, 137), (192, 138), (192, 139), (192, 142), (192, 159), (192, 161), (192, 162), (192, 163), (192, 164), (192, 165), (192, 166), (192, 167), (192, 168), (192, 169), (192, 170), (192, 171), (192, 172), (192, 174), (193, 130), (193, 132), (193, 136), (193, 137), (193, 138), (193, 139), (193, 140), (193, 144), (193, 159), (193, 161), (193, 162), (193, 163), (193, 164), (193, 165), (193, 166), (193, 167), (193, 168), (193, 169), (193, 170), (193, 171), (193, 173), (194, 133), (194, 134), (194, 135), (194, 139), (194, 140), (194, 141), (194, 142), (194, 145), (194, 146), (194, 147), (194, 160), (194, 162), (194, 163), (194, 164), (194, 165), (194, 166), (194, 167), (194, 168), (194, 169), (194, 170), (194, 171), (194, 173),
(195, 136), (195, 137), (195, 138), (195, 142), (195, 143), (195, 144), (195, 148), (195, 160), (195, 164), (195, 165), (195, 166), (195, 167), (195, 168), (195, 169), (195, 170), (195, 171), (195, 173), (196, 139), (196, 140), (196, 141), (196, 145), (196, 146), (196, 148), (196, 161), (196, 162), (196, 163), (196, 166), (196, 167), (196, 168), (196, 169), (196, 170), (196, 172), (197, 142), (197, 144), (197, 148), (197, 164), (197, 165), (197, 168), (197, 169), (197, 171), (198, 145), (198, 146), (198, 149), (198, 166), (198, 167), (198, 169), (198, 171), (199, 147), (199, 149), (199, 168), (199, 170), (200, 150), (200, 169), (200, 170), (201, 151), (201, 170), (202, 152), (202, 170), (203, 152), (204, 152), (204, 155), (205, 153), (205, 156), (205, 169), (206, 153), (206, 155), (206, 158), (206, 169), (207, 153), (207, 155), (207, 156), (207, 160),
(207, 161), (207, 167), (207, 169), (208, 154), (208, 156), (208, 157), (208, 158), (208, 162), (208, 163), (208, 164), (208, 165), (208, 166), (208, 169), (209, 154), (209, 156), (209, 157), (209, 158), (209, 159), (209, 160), (209, 161), (209, 167), (209, 169), (210, 155), (210, 156), (210, 157), (210, 158), (210, 159), (210, 160), (210, 161), (210, 162), (210, 163), (210, 164), (210, 165), (210, 166), (210, 167), (210, 169), (211, 155), (211, 157), (211, 158), (211, 159), (211, 160), (211, 161), (211, 162), (211, 163), (211, 164), (211, 165), (211, 166), (211, 167), (211, 169), (212, 155), (212, 157), (212, 158), (212, 159), (212, 160), (212, 161), (212, 162), (212, 163), (212, 164), (212, 165), (212, 166), (212, 167), (212, 169), (213, 156), (213, 158), (213, 159), (213, 160), (213, 161), (213, 162), (213, 163), (213, 164), (213, 165), (213, 166),
(213, 167), (214, 156), (214, 158), (214, 159), (214, 160), (214, 161), (214, 162), (214, 163), (214, 164), (214, 165), (214, 166), (214, 168), (215, 157), (215, 159), (215, 160), (215, 161), (215, 162), (215, 167), (216, 158), (216, 163), (216, 164), (216, 166), (217, 159), (217, 161), (217, 162), (225, 160), (225, 162), (226, 160), (226, 164), (226, 166), (227, 160), (227, 162), (227, 163), (227, 167), (227, 169), (228, 159), (228, 161), (228, 162), (228, 163), (228, 164), (228, 165), (228, 166), (228, 171), (229, 159), (229, 161), (229, 162), (229, 163), (229, 164), (229, 165), (229, 166), (229, 167), (229, 168), (229, 170), (230, 159), (230, 161), (230, 162), (230, 163), (230, 164), (230, 165), (230, 166), (230, 167), (230, 169), (231, 159), (231, 161), (231, 162), (231, 163), (231, 164), (231, 165), (231, 166), (231, 168), (232, 158), (232, 160),
(232, 161), (232, 162), (232, 163), (232, 164), (232, 165), (232, 166), (232, 168), (233, 158), (233, 160), (233, 161), (233, 162), (233, 163), (233, 164), (233, 165), (233, 166), (233, 167), (233, 168), (233, 169), (234, 158), (234, 167), (234, 169), (235, 158), (235, 160), (235, 161), (235, 162), (235, 163), (235, 164), (235, 165), (235, 166), (235, 170), (236, 167), (236, 170), (237, 155), (237, 169), (237, 171), (238, 152), (238, 155), (238, 170), (238, 171), (239, 150), (239, 154), (239, 170), (239, 172), (240, 149), (240, 152), (240, 154), (240, 170), (240, 172), (241, 148), (241, 150), (241, 151), (241, 153), (241, 170), (241, 173), (242, 147), (242, 149), (242, 150), (242, 169), (242, 171), (242, 173), (243, 146), (243, 148), (243, 149), (243, 152), (243, 169), (243, 171), (243, 172), (243, 174), (244, 145), (244, 147), (244, 148), (244, 151),
(244, 168), (244, 170), (244, 171), (244, 172), (244, 174), (245, 144), (245, 146), (245, 147), (245, 150), (245, 167), (245, 169), (245, 170), (245, 171), (245, 172), (245, 174), (246, 143), (246, 146), (246, 149), (246, 166), (246, 168), (246, 169), (246, 170), (246, 171), (246, 172), (246, 174), (247, 143), (247, 145), (247, 148), (247, 165), (247, 167), (247, 168), (247, 169), (247, 170), (247, 171), (247, 172), (247, 174), (248, 142), (248, 144), (248, 164), (248, 166), (248, 167), (248, 168), (248, 169), (248, 170), (248, 171), (248, 172), (248, 174), (249, 141), (249, 143), (249, 145), (249, 163), (249, 165), (249, 166), (249, 167), (249, 168), (249, 169), (249, 170), (249, 171), (249, 172), (249, 174), (250, 140), (250, 142), (250, 144), (250, 162), (250, 164), (250, 165), (250, 166), (250, 167), (250, 168), (250, 169), (250, 170), (250, 171),
(250, 172), (250, 174), (251, 139), (251, 141), (251, 143), (251, 161), (251, 163), (251, 164), (251, 165), (251, 166), (251, 167), (251, 168), (251, 169), (251, 170), (251, 171), (251, 172), (251, 174), (252, 140), (252, 141), (252, 161), (252, 163), (252, 164), (252, 165), (252, 166), (252, 167), (252, 168), (252, 169), (252, 170), (252, 171), (252, 172), (252, 174), (253, 136), (253, 139), (253, 140), (253, 142), (253, 160), (253, 162), (253, 163), (253, 164), (253, 165), (253, 166), (253, 167), (253, 168), (253, 169), (253, 170), (253, 171), (253, 172), (253, 174), (254, 133), (254, 135), (254, 138), (254, 139), (254, 141), (254, 160), (254, 162), (254, 163), (254, 164), (254, 165), (254, 166), (254, 167), (254, 168), (254, 169), (254, 170), (254, 171), (254, 172), (254, 174), (255, 136), (255, 137), (255, 138), (255, 140), (255, 159), (255, 161),
(255, 162), (255, 163), (255, 164), (255, 165), (255, 166), (255, 167), (255, 168), (255, 169), (255, 170), (255, 174), (256, 134), (256, 136), (256, 137), (256, 138), (256, 140), (256, 159), (256, 161), (256, 162), (256, 163), (256, 164), (256, 165), (256, 166), (256, 167), (256, 168), (256, 169), (256, 172), (256, 174), (257, 135), (257, 137), (257, 138), (257, 140), (257, 159), (257, 161), (257, 162), (257, 163), (257, 164), (257, 165), (257, 166), (257, 167), (257, 170), (258, 136), (258, 138), (258, 140), (258, 158), (258, 160), (258, 161), (258, 162), (258, 163), (258, 164), (258, 165), (258, 166), (258, 169), (259, 136), (259, 138), (259, 140), (259, 158), (259, 160), (259, 161), (259, 162), (259, 163), (259, 164), (259, 165), (259, 167), (260, 137), (260, 140), (260, 157), (260, 159), (260, 160), (260, 161), (260, 162), (260, 163), (260, 164),
(260, 166), (261, 138), (261, 140), (261, 157), (261, 159), (261, 160), (261, 161), (261, 162), (261, 163), (261, 165), (262, 138), (262, 141), (262, 156), (262, 158), (262, 159), (262, 160), (262, 161), (262, 162), (262, 163), (262, 165), (263, 139), (263, 142), (263, 156), (263, 158), (263, 159), (263, 160), (263, 161), (263, 162), (263, 164), (264, 140), (264, 155), (264, 157), (264, 158), (264, 159), (264, 160), (264, 161), (264, 163), (265, 142), (265, 144), (265, 155), (265, 157), (265, 158), (265, 159), (265, 160), (265, 161), (265, 163), (266, 144), (266, 145), (266, 154), (266, 156), (266, 157), (266, 158), (266, 159), (266, 160), (266, 162), (267, 145), (267, 146), (267, 153), (267, 155), (267, 156), (267, 157), (267, 158), (267, 159), (267, 160), (267, 162), (268, 146), (268, 147), (268, 152), (268, 154), (268, 155), (268, 156), (268, 157),
(268, 158), (268, 159), (268, 160), (268, 162), (269, 147), (269, 150), (269, 153), (269, 154), (269, 155), (269, 156), (269, 157), (269, 158), (269, 159), (269, 161), (270, 148), (270, 152), (270, 153), (270, 154), (270, 155), (270, 156), (270, 157), (270, 158), (270, 159), (270, 161), (271, 151), (271, 152), (271, 153), (271, 154), (271, 155), (271, 156), (271, 157), (271, 158), (271, 159), (271, 161), (272, 149), (272, 151), (272, 152), (272, 153), (272, 154), (272, 155), (272, 156), (272, 157), (272, 158), (272, 159), (272, 161), (273, 150), (273, 152), (273, 153), (273, 154), (273, 155), (273, 156), (273, 157), (273, 158), (273, 159), (273, 160), (273, 162), (274, 151), (274, 153), (274, 154), (274, 155), (274, 156), (274, 157), (274, 158), (274, 159), (274, 160), (274, 162), (275, 152), (275, 154), (275, 155), (275, 156), (275, 157), (275, 158),
(275, 159), (275, 160), (275, 161), (275, 162), (275, 164), (276, 152), (276, 154), (276, 155), (276, 156), (276, 157), (276, 158), (276, 159), (276, 160), (276, 161), (276, 162), (276, 164), (277, 153), (277, 155), (277, 156), (277, 157), (277, 158), (277, 159), (277, 160), (277, 161), (277, 163), (278, 153), (278, 155), (278, 156), (278, 157), (278, 158), (278, 159), (278, 160), (278, 163), (279, 154), (279, 156), (279, 157), (279, 158), (279, 159), (279, 162), (280, 154), (280, 156), (280, 157), (280, 160), (281, 154), (281, 159), (282, 155), (282, 157), )
coordinates_F45DF4 = ((177, 144),
(177, 146), (178, 94), (178, 95), (178, 96), (178, 97), (178, 98), (178, 100), (178, 143), (178, 147), (178, 149), (179, 91), (179, 93), (179, 100), (179, 142), (179, 144), (179, 145), (179, 146), (179, 150), (180, 89), (180, 94), (180, 95), (180, 96), (180, 97), (180, 99), (180, 142), (180, 144), (180, 145), (180, 146), (180, 147), (180, 148), (180, 149), (180, 151), (181, 87), (181, 91), (181, 92), (181, 93), (181, 94), (181, 95), (181, 99), (181, 141), (181, 143), (181, 144), (181, 145), (181, 146), (181, 147), (181, 148), (181, 149), (181, 150), (181, 152), (182, 85), (182, 86), (182, 89), (182, 90), (182, 91), (182, 92), (182, 97), (182, 141), (182, 143), (182, 144), (182, 145), (182, 146), (182, 147), (182, 148), (182, 149), (182, 150), (183, 84), (183, 87), (183, 88), (183, 89), (183, 93), (183, 94), (183, 95),
(183, 140), (183, 142), (183, 143), (183, 144), (183, 145), (183, 146), (183, 147), (183, 148), (183, 149), (183, 150), (183, 151), (183, 153), (184, 82), (184, 85), (184, 86), (184, 90), (184, 91), (184, 92), (184, 140), (184, 142), (184, 143), (184, 144), (184, 145), (184, 146), (184, 147), (184, 148), (184, 149), (184, 150), (184, 151), (184, 152), (184, 154), (185, 81), (185, 87), (185, 88), (185, 89), (185, 139), (185, 141), (185, 142), (185, 143), (185, 144), (185, 145), (185, 146), (185, 147), (185, 148), (185, 149), (185, 150), (185, 151), (185, 152), (185, 154), (186, 79), (186, 84), (186, 85), (186, 86), (186, 139), (186, 141), (186, 142), (186, 143), (186, 144), (186, 145), (186, 146), (186, 147), (186, 148), (186, 149), (186, 150), (186, 151), (186, 152), (186, 154), (187, 77), (187, 83), (187, 139), (187, 141), (187, 142),
(187, 143), (187, 144), (187, 145), (187, 146), (187, 147), (187, 148), (187, 149), (187, 150), (187, 151), (187, 152), (187, 153), (187, 155), (188, 76), (188, 79), (188, 81), (188, 139), (188, 142), (188, 143), (188, 144), (188, 145), (188, 146), (188, 147), (188, 148), (188, 149), (188, 150), (188, 151), (188, 152), (188, 153), (188, 155), (189, 74), (189, 77), (189, 78), (189, 80), (189, 140), (189, 144), (189, 145), (189, 146), (189, 147), (189, 148), (189, 149), (189, 150), (189, 151), (189, 152), (189, 153), (189, 154), (189, 156), (190, 72), (190, 76), (190, 77), (190, 79), (190, 142), (190, 146), (190, 147), (190, 148), (190, 149), (190, 150), (190, 151), (190, 152), (190, 153), (190, 154), (190, 156), (191, 71), (191, 74), (191, 75), (191, 76), (191, 78), (191, 144), (191, 148), (191, 149), (191, 150), (191, 151), (191, 152),
(191, 153), (191, 154), (191, 156), (192, 69), (192, 72), (192, 73), (192, 74), (192, 75), (192, 76), (192, 78), (192, 146), (192, 147), (192, 150), (192, 151), (192, 152), (192, 153), (192, 154), (192, 155), (192, 157), (193, 67), (193, 68), (193, 71), (193, 72), (193, 73), (193, 74), (193, 75), (193, 77), (193, 148), (193, 150), (193, 151), (193, 152), (193, 153), (193, 154), (193, 155), (193, 157), (194, 66), (194, 69), (194, 70), (194, 71), (194, 72), (194, 73), (194, 74), (194, 75), (194, 77), (194, 150), (194, 152), (194, 153), (194, 154), (194, 155), (194, 156), (194, 158), (195, 64), (195, 67), (195, 68), (195, 69), (195, 70), (195, 71), (195, 72), (195, 73), (195, 74), (195, 75), (195, 77), (195, 150), (195, 152), (195, 153), (195, 154), (195, 155), (195, 156), (195, 158), (196, 62), (196, 66), (196, 67),
(196, 68), (196, 69), (196, 70), (196, 71), (196, 72), (196, 73), (196, 74), (196, 75), (196, 76), (196, 78), (196, 150), (196, 152), (196, 153), (196, 154), (196, 155), (196, 156), (196, 157), (196, 159), (197, 60), (197, 64), (197, 65), (197, 66), (197, 67), (197, 68), (197, 69), (197, 70), (197, 71), (197, 72), (197, 73), (197, 74), (197, 75), (197, 76), (197, 78), (197, 151), (197, 153), (197, 154), (197, 155), (197, 156), (197, 157), (197, 158), (197, 160), (198, 58), (198, 59), (198, 62), (198, 63), (198, 64), (198, 65), (198, 66), (198, 67), (198, 68), (198, 69), (198, 70), (198, 71), (198, 72), (198, 73), (198, 74), (198, 75), (198, 76), (198, 77), (198, 79), (198, 151), (198, 153), (198, 154), (198, 155), (198, 156), (198, 157), (198, 158), (198, 159), (198, 162), (199, 56), (199, 57), (199, 60),
(199, 61), (199, 62), (199, 63), (199, 64), (199, 65), (199, 66), (199, 67), (199, 68), (199, 69), (199, 70), (199, 71), (199, 72), (199, 73), (199, 74), (199, 75), (199, 76), (199, 77), (199, 78), (199, 80), (199, 152), (199, 154), (199, 155), (199, 156), (199, 157), (199, 158), (199, 159), (199, 160), (199, 163), (199, 165), (200, 53), (200, 54), (200, 55), (200, 58), (200, 59), (200, 60), (200, 61), (200, 62), (200, 63), (200, 64), (200, 65), (200, 66), (200, 67), (200, 68), (200, 69), (200, 70), (200, 71), (200, 72), (200, 73), (200, 74), (200, 75), (200, 76), (200, 77), (200, 78), (200, 81), (200, 155), (200, 156), (200, 157), (200, 158), (200, 159), (200, 160), (200, 161), (200, 162), (200, 167), (201, 51), (201, 63), (201, 64), (201, 65), (201, 66), (201, 67), (201, 68), (201, 69), (201, 70),
(201, 71), (201, 72), (201, 73), (201, 74), (201, 75), (201, 76), (201, 77), (201, 78), (201, 79), (201, 82), (201, 154), (201, 156), (201, 157), (201, 158), (201, 159), (201, 160), (201, 161), (201, 162), (201, 163), (201, 164), (201, 165), (201, 168), (202, 51), (202, 53), (202, 54), (202, 55), (202, 56), (202, 57), (202, 58), (202, 59), (202, 60), (202, 61), (202, 62), (202, 63), (202, 75), (202, 76), (202, 77), (202, 78), (202, 79), (202, 80), (202, 81), (202, 84), (202, 85), (202, 155), (202, 158), (202, 159), (202, 160), (202, 161), (202, 162), (202, 163), (202, 164), (202, 165), (202, 166), (202, 168), (203, 64), (203, 65), (203, 66), (203, 67), (203, 68), (203, 69), (203, 70), (203, 71), (203, 72), (203, 73), (203, 74), (203, 86), (203, 87), (203, 88), (203, 156), (203, 160), (203, 161), (203, 162),
(203, 163), (203, 164), (203, 165), (203, 166), (203, 168), (204, 75), (204, 76), (204, 77), (204, 78), (204, 79), (204, 80), (204, 81), (204, 82), (204, 85), (204, 89), (204, 90), (204, 91), (204, 92), (204, 93), (204, 94), (204, 95), (204, 96), (204, 97), (204, 158), (204, 163), (204, 164), (204, 165), (204, 166), (204, 168), (205, 83), (205, 84), (205, 87), (205, 88), (205, 89), (205, 98), (205, 99), (205, 100), (205, 102), (205, 160), (205, 162), (205, 167), (206, 85), (206, 86), (206, 89), (206, 90), (206, 91), (206, 92), (206, 93), (206, 94), (206, 95), (206, 96), (206, 102), (206, 163), (206, 165), (206, 166), (207, 87), (207, 88), (207, 98), (207, 99), (207, 101), (208, 89), (208, 90), (208, 91), (208, 92), (208, 93), (208, 94), (208, 95), (208, 96), (208, 97), (237, 89), (237, 91), (237, 92),
(237, 93), (237, 94), (237, 95), (237, 96), (237, 97), (237, 99), (237, 157), (237, 159), (237, 160), (237, 161), (237, 162), (237, 163), (237, 164), (237, 165), (238, 88), (238, 100), (238, 157), (238, 166), (238, 167), (238, 168), (239, 87), (239, 89), (239, 90), (239, 91), (239, 92), (239, 93), (239, 94), (239, 95), (239, 96), (239, 97), (239, 98), (239, 99), (239, 101), (239, 157), (239, 159), (239, 160), (239, 161), (239, 162), (239, 163), (239, 164), (239, 165), (239, 168), (240, 73), (240, 74), (240, 75), (240, 76), (240, 77), (240, 78), (240, 79), (240, 80), (240, 81), (240, 82), (240, 83), (240, 84), (240, 85), (240, 88), (240, 89), (240, 90), (240, 91), (240, 92), (240, 93), (240, 94), (240, 95), (240, 96), (240, 97), (240, 98), (240, 102), (240, 156), (240, 158), (240, 159), (240, 160), (240, 161),
(240, 162), (240, 163), (240, 164), (240, 165), (240, 166), (240, 168), (241, 67), (241, 68), (241, 69), (241, 70), (241, 71), (241, 72), (241, 87), (241, 99), (241, 101), (241, 156), (241, 158), (241, 159), (241, 160), (241, 161), (241, 162), (241, 163), (241, 164), (241, 165), (241, 166), (241, 168), (242, 60), (242, 61), (242, 62), (242, 63), (242, 64), (242, 65), (242, 66), (242, 73), (242, 74), (242, 75), (242, 76), (242, 77), (242, 78), (242, 79), (242, 80), (242, 81), (242, 82), (242, 83), (242, 84), (242, 88), (242, 89), (242, 90), (242, 91), (242, 92), (242, 93), (242, 94), (242, 95), (242, 96), (242, 97), (242, 98), (242, 155), (242, 157), (242, 158), (242, 159), (242, 160), (242, 161), (242, 162), (242, 163), (242, 164), (242, 165), (242, 167), (243, 54), (243, 55), (243, 56), (243, 57), (243, 58),
(243, 59), (243, 67), (243, 68), (243, 69), (243, 70), (243, 71), (243, 72), (243, 73), (243, 74), (243, 75), (243, 76), (243, 77), (243, 78), (243, 79), (243, 80), (243, 81), (243, 82), (243, 85), (243, 86), (243, 87), (243, 154), (243, 156), (243, 157), (243, 158), (243, 159), (243, 160), (243, 161), (243, 162), (243, 163), (243, 164), (243, 166), (244, 54), (244, 55), (244, 57), (244, 61), (244, 62), (244, 63), (244, 64), (244, 65), (244, 66), (244, 67), (244, 68), (244, 69), (244, 70), (244, 71), (244, 72), (244, 73), (244, 74), (244, 75), (244, 76), (244, 77), (244, 78), (244, 79), (244, 80), (244, 81), (244, 84), (244, 153), (244, 155), (244, 156), (244, 157), (244, 158), (244, 159), (244, 160), (244, 161), (244, 162), (244, 163), (244, 165), (245, 59), (245, 60), (245, 63), (245, 64), (245, 65),
(245, 66), (245, 67), (245, 68), (245, 69), (245, 70), (245, 71), (245, 72), (245, 73), (245, 74), (245, 75), (245, 76), (245, 77), (245, 78), (245, 79), (245, 80), (245, 81), (245, 152), (245, 154), (245, 155), (245, 156), (245, 157), (245, 158), (245, 159), (245, 160), (245, 161), (245, 162), (245, 164), (246, 61), (246, 65), (246, 66), (246, 67), (246, 68), (246, 69), (246, 70), (246, 71), (246, 72), (246, 73), (246, 74), (246, 75), (246, 76), (246, 77), (246, 78), (246, 79), (246, 80), (246, 82), (246, 151), (246, 153), (246, 154), (246, 155), (246, 156), (246, 157), (246, 158), (246, 159), (246, 160), (246, 161), (246, 163), (247, 63), (247, 67), (247, 68), (247, 69), (247, 70), (247, 71), (247, 72), (247, 73), (247, 74), (247, 75), (247, 76), (247, 77), (247, 78), (247, 79), (247, 81), (247, 150),
(247, 152), (247, 153), (247, 154), (247, 155), (247, 156), (247, 157), (247, 158), (247, 159), (247, 160), (247, 162), (248, 65), (248, 69), (248, 70), (248, 71), (248, 72), (248, 73), (248, 74), (248, 75), (248, 76), (248, 77), (248, 78), (248, 79), (248, 81), (248, 149), (248, 151), (248, 152), (248, 153), (248, 154), (248, 155), (248, 156), (248, 157), (248, 158), (248, 159), (248, 161), (249, 67), (249, 70), (249, 71), (249, 72), (249, 73), (249, 74), (249, 75), (249, 76), (249, 77), (249, 78), (249, 80), (249, 148), (249, 150), (249, 151), (249, 152), (249, 153), (249, 154), (249, 155), (249, 156), (249, 157), (249, 158), (249, 160), (250, 69), (250, 72), (250, 73), (250, 74), (250, 75), (250, 76), (250, 77), (250, 78), (250, 80), (250, 147), (250, 149), (250, 150), (250, 151), (250, 152), (250, 153), (250, 154),
(250, 155), (250, 156), (250, 157), (250, 158), (250, 160), (251, 70), (251, 73), (251, 74), (251, 75), (251, 76), (251, 77), (251, 78), (251, 80), (251, 146), (251, 148), (251, 149), (251, 150), (251, 151), (251, 152), (251, 153), (251, 154), (251, 155), (251, 156), (251, 157), (251, 159), (252, 72), (252, 75), (252, 76), (252, 77), (252, 78), (252, 79), (252, 81), (252, 145), (252, 147), (252, 148), (252, 149), (252, 150), (252, 151), (252, 152), (252, 153), (252, 154), (252, 155), (252, 156), (252, 158), (253, 73), (253, 76), (253, 77), (253, 78), (253, 79), (253, 80), (253, 83), (253, 144), (253, 146), (253, 147), (253, 148), (253, 149), (253, 150), (253, 151), (253, 152), (253, 153), (253, 154), (253, 155), (253, 156), (253, 158), (254, 75), (254, 78), (254, 79), (254, 80), (254, 81), (254, 84), (254, 143), (254, 145),
(254, 146), (254, 147), (254, 148), (254, 149), (254, 150), (254, 151), (254, 152), (254, 153), (254, 154), (254, 155), (254, 157), (255, 76), (255, 79), (255, 80), (255, 81), (255, 82), (255, 83), (255, 86), (255, 143), (255, 145), (255, 146), (255, 147), (255, 148), (255, 149), (255, 150), (255, 151), (255, 152), (255, 153), (255, 154), (255, 155), (255, 157), (256, 78), (256, 81), (256, 82), (256, 83), (256, 84), (256, 88), (256, 142), (256, 144), (256, 145), (256, 146), (256, 147), (256, 148), (256, 149), (256, 150), (256, 151), (256, 152), (256, 153), (256, 154), (256, 155), (256, 157), (257, 79), (257, 82), (257, 83), (257, 84), (257, 85), (257, 86), (257, 89), (257, 142), (257, 144), (257, 145), (257, 146), (257, 147), (257, 148), (257, 149), (257, 150), (257, 151), (257, 152), (257, 153), (257, 154), (257, 156), (258, 81),
(258, 84), (258, 85), (258, 86), (258, 87), (258, 88), (258, 91), (258, 142), (258, 144), (258, 145), (258, 146), (258, 147), (258, 148), (258, 149), (258, 150), (258, 151), (258, 152), (258, 153), (258, 154), (258, 156), (259, 82), (259, 85), (259, 86), (259, 87), (259, 88), (259, 89), (259, 90), (259, 93), (259, 142), (259, 144), (259, 145), (259, 146), (259, 147), (259, 148), (259, 149), (259, 150), (259, 151), (259, 152), (259, 153), (259, 154), (259, 155), (259, 156), (260, 84), (260, 87), (260, 88), (260, 89), (260, 90), (260, 91), (260, 95), (260, 142), (260, 144), (260, 145), (260, 146), (260, 147), (260, 148), (260, 149), (260, 150), (260, 151), (260, 152), (260, 153), (260, 155), (261, 85), (261, 88), (261, 89), (261, 90), (261, 91), (261, 92), (261, 93), (261, 97), (261, 143), (261, 145), (261, 146), (261, 147),
(261, 148), (261, 149), (261, 150), (261, 151), (261, 152), (261, 153), (261, 155), (262, 87), (262, 90), (262, 91), (262, 92), (262, 93), (262, 94), (262, 95), (262, 99), (262, 143), (262, 145), (262, 146), (262, 147), (262, 148), (262, 149), (262, 150), (262, 151), (262, 152), (262, 154), (263, 88), (263, 91), (263, 92), (263, 93), (263, 94), (263, 95), (263, 96), (263, 97), (263, 101), (263, 144), (263, 146), (263, 147), (263, 148), (263, 149), (263, 150), (263, 151), (263, 152), (263, 154), (264, 90), (264, 93), (264, 94), (264, 95), (264, 96), (264, 97), (264, 98), (264, 99), (264, 103), (264, 145), (264, 147), (264, 148), (264, 149), (264, 150), (264, 151), (264, 153), (265, 91), (265, 94), (265, 95), (265, 96), (265, 97), (265, 98), (265, 99), (265, 100), (265, 101), (265, 105), (265, 146), (265, 148), (265, 149),
(265, 150), (265, 152), (266, 93), (266, 105), (266, 107), (266, 147), (266, 152), (267, 94), (267, 96), (267, 97), (267, 98), (267, 99), (267, 100), (267, 101), (267, 102), (267, 103), (267, 148), (267, 150), )
coordinates_FF5500 = ((168, 161),
(169, 161), (169, 165), (170, 160), (170, 162), (170, 163), (170, 166), (171, 160), (171, 162), (171, 163), (171, 164), (171, 165), (171, 167), (172, 160), (172, 161), (172, 162), (172, 163), (172, 164), (172, 165), (172, 166), (172, 168), (173, 161), (173, 163), (173, 164), (173, 165), (173, 166), (173, 168), (174, 161), (174, 163), (174, 164), (174, 165), (174, 166), (174, 167), (174, 169), (175, 161), (175, 163), (175, 164), (175, 165), (175, 166), (175, 167), (175, 168), (175, 169), (176, 162), (176, 164), (176, 165), (176, 166), (176, 167), (176, 168), (176, 170), (177, 162), (177, 164), (177, 165), (177, 166), (177, 167), (177, 168), (177, 169), (177, 170), (178, 163), (178, 165), (178, 166), (178, 167), (178, 168), (178, 169), (178, 171), (179, 163), (179, 165), (179, 166), (179, 167), (179, 168), (179, 169), (179, 171), (180, 164), (180, 167),
(180, 168), (180, 169), (180, 170), (180, 172), (181, 165), (181, 168), (181, 169), (181, 170), (181, 172), (182, 167), (182, 169), (182, 170), (182, 171), (182, 172), (182, 173), (183, 168), (183, 170), (183, 171), (183, 173), (184, 169), (184, 171), (184, 173), (185, 170), (185, 173), (186, 171), (186, 174), (187, 172), (187, 174), (258, 172), (258, 174), (259, 170), (260, 169), (260, 173), (261, 168), (261, 170), (261, 171), (261, 173), (262, 167), (262, 169), (262, 170), (262, 171), (262, 173), (263, 166), (263, 168), (263, 169), (263, 170), (263, 172), (264, 166), (264, 168), (264, 169), (264, 170), (264, 172), (265, 165), (265, 167), (265, 168), (265, 169), (265, 170), (265, 171), (265, 172), (266, 165), (266, 167), (266, 168), (266, 169), (266, 171), (267, 164), (267, 166), (267, 167), (267, 168), (267, 169), (267, 171), (268, 164), (268, 166),
(268, 167), (268, 168), (268, 170), (269, 164), (269, 166), (269, 167), (269, 168), (269, 170), (270, 163), (270, 164), (270, 165), (270, 166), (270, 167), (270, 169), (271, 163), (271, 165), (271, 166), (272, 168), (273, 164), (273, 167), )
coordinates_CC3300 = ((163, 143),
(164, 142), (164, 144), (165, 141), (165, 143), (165, 146), (165, 147), (165, 149), (166, 140), (166, 142), (166, 143), (166, 144), (167, 139), (167, 141), (167, 142), (167, 143), (167, 144), (167, 145), (167, 146), (167, 148), (168, 141), (168, 142), (168, 143), (168, 144), (168, 145), (168, 147), (169, 138), (169, 140), (169, 141), (169, 142), (169, 143), (169, 144), (169, 146), (170, 137), (170, 139), (170, 140), (170, 141), (170, 142), (170, 143), (170, 145), (171, 136), (171, 138), (171, 139), (171, 140), (171, 141), (171, 142), (171, 143), (171, 145), (172, 138), (172, 139), (172, 140), (172, 141), (172, 142), (172, 144), (173, 135), (173, 137), (173, 138), (173, 139), (173, 140), (173, 141), (173, 143), (174, 134), (174, 136), (174, 137), (174, 138), (174, 139), (174, 140), (174, 141), (174, 143), (175, 133), (175, 135), (175, 136), (175, 137),
(175, 138), (175, 139), (175, 140), (175, 141), (175, 143), (176, 133), (176, 135), (176, 136), (176, 137), (176, 138), (176, 139), (176, 140), (176, 143), (177, 132), (177, 134), (177, 135), (177, 136), (177, 137), (177, 138), (177, 139), (178, 131), (178, 133), (178, 134), (178, 135), (178, 136), (178, 137), (178, 138), (178, 140), (179, 131), (179, 133), (179, 134), (179, 135), (179, 136), (179, 137), (179, 139), (180, 130), (180, 132), (180, 133), (180, 134), (180, 135), (180, 136), (180, 138), (181, 131), (181, 132), (181, 133), (181, 134), (181, 135), (181, 137), (182, 129), (182, 131), (182, 132), (182, 133), (182, 134), (182, 136), (183, 128), (183, 130), (183, 131), (183, 132), (183, 133), (183, 135), (184, 128), (184, 130), (184, 131), (184, 132), (184, 134), (185, 127), (185, 129), (185, 130), (185, 131), (185, 133), (186, 127), (186, 129),
(186, 130), (186, 132), (187, 126), (187, 128), (187, 129), (187, 131), (188, 126), (188, 130), (189, 126), (189, 129), (190, 127), (252, 123), (252, 126), (253, 123), (253, 128), (254, 123), (254, 125), (254, 126), (254, 130), (255, 124), (255, 125), (255, 126), (255, 127), (255, 128), (255, 131), (256, 124), (256, 126), (256, 127), (256, 128), (256, 129), (256, 130), (256, 132), (257, 125), (257, 127), (257, 128), (257, 129), (257, 130), (257, 131), (257, 133), (258, 125), (258, 127), (258, 128), (258, 129), (258, 130), (258, 131), (258, 133), (259, 126), (259, 128), (259, 129), (259, 130), (259, 131), (259, 132), (259, 134), (260, 127), (260, 129), (260, 130), (260, 131), (260, 132), (260, 133), (260, 135), (261, 127), (261, 129), (261, 130), (261, 131), (261, 132), (261, 133), (261, 135), (262, 128), (262, 130), (262, 131), (262, 132), (262, 133),
(262, 134), (262, 136), (263, 129), (263, 131), (263, 132), (263, 133), (263, 134), (263, 135), (263, 137), (264, 130), (264, 132), (264, 133), (264, 134), (264, 135), (264, 136), (264, 138), (265, 130), (265, 132), (265, 133), (265, 134), (265, 135), (265, 136), (265, 137), (265, 139), (266, 131), (266, 133), (266, 134), (266, 135), (266, 136), (266, 137), (266, 138), (266, 140), (267, 132), (267, 134), (267, 135), (267, 136), (267, 137), (267, 138), (267, 139), (267, 142), (268, 133), (268, 135), (268, 136), (268, 137), (268, 138), (268, 139), (268, 140), (268, 143), (269, 134), (269, 136), (269, 137), (269, 138), (269, 139), (269, 140), (269, 141), (269, 142), (269, 144), (270, 137), (270, 138), (270, 139), (270, 140), (270, 141), (270, 142), (270, 143), (270, 145), (271, 135), (271, 137), (271, 138), (271, 139), (271, 140), (271, 141), (271, 142),
(271, 143), (271, 144), (271, 146), (272, 136), (272, 138), (272, 139), (272, 140), (272, 141), (272, 142), (272, 143), (272, 144), (272, 145), (272, 147), (273, 137), (273, 139), (273, 140), (273, 141), (273, 142), (273, 143), (273, 144), (273, 145), (273, 146), (273, 148), (274, 138), (274, 140), (274, 141), (274, 142), (274, 143), (274, 144), (274, 145), (274, 146), (275, 139), (275, 141), (275, 142), (275, 143), (275, 144), (275, 145), (275, 146), (275, 147), (275, 149), (276, 140), (276, 142), (276, 143), (276, 144), (276, 145), (276, 146), (276, 147), (276, 148), (276, 150), (277, 141), (277, 143), (277, 144), (277, 145), (277, 146), (277, 147), (277, 148), (277, 149), (278, 142), (278, 144), (278, 145), (278, 146), (278, 147), (278, 148), (278, 151), (279, 143), (279, 145), (279, 146), (279, 147), (279, 149), (279, 150), (279, 152), (280, 144),
(280, 146), (280, 148), (281, 145), (281, 147), (282, 146), )
coordinates_FFCCCC = ((159, 58),
(159, 59), (160, 58), (161, 58), (161, 59), (163, 58), (163, 59), (183, 29), (183, 31), (184, 27), (184, 34), (185, 25), (185, 28), (185, 29), (185, 30), (185, 31), (185, 32), (185, 35), (185, 36), (185, 37), (186, 24), (186, 27), (186, 28), (186, 29), (186, 30), (186, 31), (186, 32), (186, 33), (186, 34), (186, 38), (186, 40), (187, 23), (187, 25), (187, 26), (187, 27), (187, 28), (187, 29), (187, 30), (187, 31), (187, 32), (187, 33), (187, 34), (187, 35), (187, 36), (187, 37), (187, 40), (188, 22), (188, 24), (188, 25), (188, 26), (188, 27), (188, 28), (188, 29), (188, 30), (188, 31), (188, 32), (188, 33), (188, 34), (188, 35), (188, 36), (188, 37), (188, 38), (188, 39), (188, 41), (189, 24), (189, 25), (189, 26), (189, 27), (189, 28), (189, 29), (189, 30), (189, 31), (189, 32),
(189, 33), (189, 34), (189, 35), (189, 36), (189, 37), (189, 38), (189, 39), (189, 40), (189, 43), (189, 44), (189, 46), (190, 21), (190, 23), (190, 24), (190, 25), (190, 26), (190, 27), (190, 28), (190, 29), (190, 30), (190, 31), (190, 32), (190, 33), (190, 34), (190, 35), (190, 36), (190, 37), (190, 38), (190, 39), (190, 40), (190, 41), (190, 46), (191, 20), (191, 22), (191, 23), (191, 24), (191, 25), (191, 26), (191, 27), (191, 28), (191, 29), (191, 30), (191, 31), (191, 32), (191, 33), (191, 34), (191, 35), (191, 36), (191, 37), (191, 38), (191, 39), (191, 40), (191, 41), (191, 42), (191, 43), (191, 44), (191, 45), (191, 47), (192, 19), (192, 21), (192, 22), (192, 23), (192, 24), (192, 25), (192, 26), (192, 27), (192, 28), (192, 29), (192, 30), (192, 31), (192, 32), (192, 33),
(192, 34), (192, 35), (192, 36), (192, 37), (192, 38), (192, 39), (192, 40), (192, 41), (192, 42), (192, 43), (192, 44), (192, 45), (192, 47), (193, 19), (193, 21), (193, 22), (193, 23), (193, 24), (193, 25), (193, 26), (193, 27), (193, 28), (193, 29), (193, 30), (193, 31), (193, 32), (193, 33), (193, 34), (193, 35), (193, 36), (193, 37), (193, 38), (193, 39), (193, 40), (193, 41), (193, 42), (193, 43), (193, 44), (193, 45), (193, 47), (194, 18), (194, 20), (194, 21), (194, 22), (194, 23), (194, 24), (194, 25), (194, 26), (194, 27), (194, 28), (194, 29), (194, 30), (194, 31), (194, 32), (194, 33), (194, 34), (194, 35), (194, 36), (194, 37), (194, 38), (194, 39), (194, 40), (194, 41), (194, 42), (194, 43), (194, 44), (194, 45), (194, 46), (194, 48), (195, 18), (195, 20), (195, 21),
(195, 22), (195, 23), (195, 24), (195, 25), (195, 26), (195, 27), (195, 28), (195, 29), (195, 30), (195, 31), (195, 32), (195, 33), (195, 34), (195, 35), (195, 36), (195, 37), (195, 38), (195, 39), (195, 40), (195, 41), (195, 42), (195, 43), (195, 44), (195, 45), (195, 46), (195, 48), (196, 17), (196, 19), (196, 20), (196, 21), (196, 22), (196, 23), (196, 24), (196, 25), (196, 26), (196, 27), (196, 28), (196, 29), (196, 30), (196, 31), (196, 32), (196, 33), (196, 34), (196, 35), (196, 36), (196, 37), (196, 38), (196, 39), (196, 40), (196, 41), (196, 42), (196, 43), (196, 44), (196, 45), (196, 46), (196, 47), (196, 49), (197, 17), (197, 19), (197, 20), (197, 21), (197, 22), (197, 23), (197, 24), (197, 25), (197, 26), (197, 27), (197, 28), (197, 29), (197, 30), (197, 31), (197, 32),
(197, 33), (197, 34), (197, 35), (197, 36), (197, 37), (197, 38), (197, 39), (197, 40), (197, 41), (197, 42), (197, 43), (197, 44), (197, 45), (197, 46), (197, 47), (197, 49), (198, 16), (198, 18), (198, 19), (198, 20), (198, 21), (198, 22), (198, 23), (198, 24), (198, 25), (198, 26), (198, 27), (198, 28), (198, 29), (198, 30), (198, 31), (198, 32), (198, 33), (198, 34), (198, 35), (198, 36), (198, 37), (198, 38), (198, 39), (198, 40), (198, 41), (198, 42), (198, 43), (198, 44), (198, 45), (198, 46), (198, 47), (198, 49), (199, 16), (199, 18), (199, 19), (199, 20), (199, 21), (199, 22), (199, 23), (199, 24), (199, 25), (199, 26), (199, 27), (199, 28), (199, 29), (199, 30), (199, 31), (199, 32), (199, 33), (199, 34), (199, 35), (199, 36), (199, 37), (199, 38), (199, 39), (199, 40),
(199, 41), (199, 42), (199, 43), (199, 44), (199, 45), (199, 46), (199, 47), (199, 49), (200, 15), (200, 17), (200, 18), (200, 19), (200, 20), (200, 21), (200, 22), (200, 23), (200, 24), (200, 25), (200, 26), (200, 27), (200, 28), (200, 29), (200, 30), (200, 31), (200, 32), (200, 33), (200, 34), (200, 35), (200, 36), (200, 37), (200, 38), (200, 39), (200, 40), (200, 41), (200, 42), (200, 43), (200, 44), (200, 45), (200, 46), (200, 47), (200, 49), (201, 15), (201, 17), (201, 18), (201, 19), (201, 20), (201, 21), (201, 22), (201, 23), (201, 24), (201, 25), (201, 26), (201, 27), (201, 28), (201, 29), (201, 30), (201, 31), (201, 32), (201, 33), (201, 34), (201, 35), (201, 36), (201, 37), (201, 38), (201, 39), (201, 40), (201, 41), (201, 42), (201, 43), (201, 44), (201, 45), (201, 46),
(201, 47), (201, 49), (202, 15), (202, 17), (202, 18), (202, 19), (202, 20), (202, 21), (202, 22), (202, 23), (202, 24), (202, 25), (202, 26), (202, 27), (202, 28), (202, 29), (202, 30), (202, 31), (202, 32), (202, 33), (202, 34), (202, 35), (202, 36), (202, 37), (202, 38), (202, 39), (202, 40), (202, 41), (202, 42), (202, 43), (202, 44), (202, 45), (202, 46), (202, 47), (202, 49), (203, 14), (203, 16), (203, 17), (203, 18), (203, 19), (203, 20), (203, 21), (203, 22), (203, 23), (203, 24), (203, 25), (203, 26), (203, 27), (203, 28), (203, 29), (203, 30), (203, 31), (203, 32), (203, 33), (203, 34), (203, 35), (203, 36), (203, 37), (203, 38), (203, 39), (203, 40), (203, 41), (203, 42), (203, 43), (203, 44), (203, 45), (203, 46), (203, 47), (203, 49), (204, 14), (204, 16), (204, 17),
(204, 18), (204, 19), (204, 20), (204, 21), (204, 22), (204, 23), (204, 24), (204, 25), (204, 26), (204, 27), (204, 28), (204, 29), (204, 30), (204, 31), (204, 32), (204, 33), (204, 34), (204, 35), (204, 36), (204, 37), (204, 38), (204, 39), (204, 40), (204, 41), (204, 42), (204, 43), (204, 44), (204, 45), (204, 46), (204, 47), (204, 49), (205, 14), (205, 16), (205, 17), (205, 18), (205, 19), (205, 20), (205, 21), (205, 22), (205, 23), (205, 24), (205, 25), (205, 26), (205, 27), (205, 28), (205, 29), (205, 30), (205, 31), (205, 32), (205, 33), (205, 34), (205, 35), (205, 36), (205, 37), (205, 38), (205, 39), (205, 40), (205, 41), (205, 42), (205, 43), (205, 44), (205, 45), (205, 46), (205, 47), (205, 49), (206, 13), (206, 14), (206, 15), (206, 16), (206, 17), (206, 18), (206, 19),
(206, 20), (206, 21), (206, 22), (206, 23), (206, 24), (206, 25), (206, 26), (206, 27), (206, 28), (206, 29), (206, 30), (206, 31), (206, 32), (206, 33), (206, 34), (206, 35), (206, 36), (206, 37), (206, 38), (206, 39), (206, 40), (206, 41), (206, 42), (206, 43), (206, 44), (206, 45), (206, 46), (206, 47), (206, 48), (207, 13), (207, 15), (207, 16), (207, 17), (207, 18), (207, 19), (207, 20), (207, 21), (207, 22), (207, 23), (207, 24), (207, 25), (207, 26), (207, 27), (207, 28), (207, 29), (207, 30), (207, 31), (207, 32), (207, 33), (207, 34), (207, 35), (207, 36), (207, 37), (207, 38), (207, 39), (207, 40), (207, 41), (207, 42), (207, 43), (207, 44), (207, 45), (207, 46), (207, 48), (208, 13), (208, 15), (208, 16), (208, 17), (208, 18), (208, 19), (208, 20), (208, 21), (208, 22),
(208, 23), (208, 24), (208, 25), (208, 26), (208, 27), (208, 28), (208, 29), (208, 30), (208, 31), (208, 32), (208, 33), (208, 34), (208, 35), (208, 36), (208, 37), (208, 38), (208, 39), (208, 40), (208, 41), (208, 42), (208, 43), (208, 44), (208, 45), (208, 47), (209, 13), (209, 15), (209, 16), (209, 17), (209, 18), (209, 19), (209, 20), (209, 21), (209, 22), (209, 23), (209, 24), (209, 25), (209, 26), (209, 27), (209, 28), (209, 29), (209, 30), (209, 31), (209, 32), (209, 33), (209, 34), (209, 35), (209, 36), (209, 37), (209, 38), (209, 39), (209, 40), (209, 41), (209, 42), (209, 43), (209, 44), (209, 46), (210, 13), (210, 15), (210, 16), (210, 17), (210, 18), (210, 19), (210, 20), (210, 21), (210, 22), (210, 23), (210, 24), (210, 25), (210, 26), (210, 27), (210, 28), (210, 29),
(210, 30), (210, 31), (210, 32), (210, 33), (210, 34), (210, 35), (210, 36), (210, 37), (210, 38), (210, 39), (210, 40), (210, 41), (210, 42), (210, 43), (210, 45), (211, 13), (211, 15), (211, 16), (211, 17), (211, 18), (211, 19), (211, 20), (211, 21), (211, 22), (211, 23), (211, 24), (211, 25), (211, 26), (211, 27), (211, 28), (211, 29), (211, 30), (211, 31), (211, 32), (211, 33), (211, 34), (211, 35), (211, 36), (211, 37), (211, 38), (211, 39), (211, 40), (211, 41), (211, 42), (211, 44), (212, 15), (212, 16), (212, 17), (212, 18), (212, 19), (212, 20), (212, 21), (212, 22), (212, 23), (212, 24), (212, 25), (212, 26), (212, 27), (212, 28), (212, 29), (212, 30), (212, 31), (212, 32), (212, 33), (212, 34), (212, 35), (212, 36), (212, 37), (212, 38), (212, 39), (212, 40), (212, 41),
(212, 43), (213, 14), (213, 16), (213, 17), (213, 18), (213, 19), (213, 20), (213, 21), (213, 22), (213, 23), (213, 24), (213, 25), (213, 26), (213, 27), (213, 28), (213, 29), (213, 30), (213, 31), (213, 32), (213, 33), (213, 34), (213, 35), (213, 36), (213, 37), (213, 38), (213, 39), (213, 42), (214, 15), (214, 17), (214, 18), (214, 19), (214, 20), (214, 21), (214, 22), (214, 23), (214, 24), (214, 25), (214, 26), (214, 27), (214, 28), (214, 29), (214, 30), (214, 31), (214, 32), (214, 33), (214, 34), (214, 35), (214, 36), (214, 37), (214, 38), (214, 41), (215, 18), (215, 19), (215, 20), (215, 21), (215, 22), (215, 23), (215, 24), (215, 25), (215, 26), (215, 27), (215, 28), (215, 29), (215, 30), (215, 31), (215, 32), (215, 33), (215, 34), (215, 35), (215, 36), (215, 37), (215, 38),
(215, 40), (216, 16), (216, 18), (216, 19), (216, 20), (216, 21), (216, 22), (216, 23), (216, 24), (216, 25), (216, 26), (216, 27), (216, 28), (216, 29), (216, 30), (216, 31), (216, 32), (216, 33), (216, 34), (216, 35), (216, 36), (216, 37), (216, 39), (217, 17), (217, 19), (217, 20), (217, 21), (217, 22), (217, 23), (217, 24), (217, 25), (217, 26), (217, 27), (217, 28), (217, 29), (217, 30), (217, 31), (217, 32), (217, 33), (217, 34), (217, 35), (217, 36), (217, 38), (218, 18), (218, 20), (218, 21), (218, 22), (218, 23), (218, 24), (218, 25), (218, 26), (218, 27), (218, 28), (218, 29), (218, 30), (218, 31), (218, 32), (218, 33), (218, 34), (218, 35), (218, 37), (219, 19), (219, 37), (220, 20), (220, 22), (220, 23), (220, 24), (220, 25), (220, 26), (220, 27), (220, 28), (220, 29),
(220, 30), (220, 31), (220, 32), (220, 33), (220, 34), (220, 35), (220, 37), (225, 19), (225, 21), (225, 22), (225, 23), (225, 24), (225, 25), (225, 26), (225, 27), (225, 28), (225, 29), (225, 30), (225, 31), (225, 32), (225, 33), (225, 34), (225, 35), (225, 36), (225, 37), (225, 38), (225, 40), (226, 18), (226, 41), (227, 18), (227, 20), (227, 21), (227, 22), (227, 23), (227, 24), (227, 25), (227, 26), (227, 27), (227, 28), (227, 29), (227, 30), (227, 31), (227, 32), (227, 33), (227, 34), (227, 35), (227, 36), (227, 37), (227, 38), (227, 39), (227, 40), (228, 17), (228, 19), (228, 20), (228, 21), (228, 22), (228, 23), (228, 24), (228, 25), (228, 26), (228, 27), (228, 28), (228, 29), (228, 30), (228, 31), (228, 32), (228, 33), (228, 34), (228, 35), (228, 36), (228, 37), (228, 38),
(228, 39), (228, 40), (228, 41), (228, 44), (229, 16), (229, 18), (229, 19), (229, 20), (229, 21), (229, 22), (229, 23), (229, 24), (229, 25), (229, 26), (229, 27), (229, 28), (229, 29), (229, 30), (229, 31), (229, 32), (229, 33), (229, 34), (229, 35), (229, 36), (229, 37), (229, 38), (229, 39), (229, 40), (229, 41), (229, 42), (229, 45), (230, 15), (230, 17), (230, 18), (230, 19), (230, 20), (230, 21), (230, 22), (230, 23), (230, 24), (230, 25), (230, 26), (230, 27), (230, 28), (230, 29), (230, 30), (230, 31), (230, 32), (230, 33), (230, 34), (230, 35), (230, 36), (230, 37), (230, 38), (230, 39), (230, 40), (230, 41), (230, 42), (230, 43), (230, 44), (230, 46), (231, 14), (231, 16), (231, 17), (231, 18), (231, 19), (231, 20), (231, 21), (231, 22), (231, 23), (231, 24), (231, 25),
(231, 26), (231, 27), (231, 28), (231, 29), (231, 30), (231, 31), (231, 32), (231, 33), (231, 34), (231, 35), (231, 36), (231, 37), (231, 38), (231, 39), (231, 40), (231, 41), (231, 42), (231, 43), (231, 44), (231, 45), (232, 14), (232, 16), (232, 17), (232, 18), (232, 19), (232, 20), (232, 21), (232, 22), (232, 23), (232, 24), (232, 25), (232, 26), (232, 27), (232, 28), (232, 29), (232, 30), (232, 31), (232, 32), (232, 33), (232, 34), (232, 35), (232, 36), (232, 37), (232, 38), (232, 39), (232, 40), (232, 41), (232, 42), (232, 43), (232, 44), (232, 45), (232, 46), (232, 48), (233, 13), (233, 15), (233, 16), (233, 17), (233, 18), (233, 19), (233, 20), (233, 21), (233, 22), (233, 23), (233, 24), (233, 25), (233, 26), (233, 27), (233, 28), (233, 29), (233, 30), (233, 31), (233, 32),
(233, 33), (233, 34), (233, 35), (233, 36), (233, 37), (233, 38), (233, 39), (233, 40), (233, 41), (233, 42), (233, 43), (233, 44), (233, 45), (233, 46), (233, 47), (233, 49), (234, 13), (234, 15), (234, 16), (234, 17), (234, 18), (234, 19), (234, 20), (234, 21), (234, 22), (234, 23), (234, 24), (234, 25), (234, 26), (234, 27), (234, 28), (234, 29), (234, 30), (234, 31), (234, 32), (234, 33), (234, 34), (234, 35), (234, 36), (234, 37), (234, 38), (234, 39), (234, 40), (234, 41), (234, 42), (234, 43), (234, 44), (234, 45), (234, 46), (234, 47), (234, 48), (234, 50), (235, 13), (235, 15), (235, 16), (235, 17), (235, 18), (235, 19), (235, 20), (235, 21), (235, 22), (235, 23), (235, 24), (235, 25), (235, 26), (235, 27), (235, 28), (235, 29), (235, 30), (235, 31), (235, 32), (235, 33),
(235, 34), (235, 35), (235, 36), (235, 37), (235, 38), (235, 39), (235, 40), (235, 41), (235, 42), (235, 43), (235, 44), (235, 45), (235, 46), (235, 47), (235, 48), (235, 49), (235, 51), (236, 13), (236, 15), (236, 16), (236, 17), (236, 18), (236, 19), (236, 20), (236, 21), (236, 22), (236, 23), (236, 24), (236, 25), (236, 26), (236, 27), (236, 28), (236, 29), (236, 30), (236, 31), (236, 32), (236, 33), (236, 34), (236, 35), (236, 36), (236, 37), (236, 38), (236, 39), (236, 40), (236, 41), (236, 42), (236, 43), (236, 44), (236, 45), (236, 46), (236, 47), (236, 48), (236, 49), (236, 51), (237, 13), (237, 15), (237, 16), (237, 17), (237, 18), (237, 19), (237, 20), (237, 21), (237, 22), (237, 23), (237, 24), (237, 25), (237, 26), (237, 27), (237, 28), (237, 29), (237, 30), (237, 31),
(237, 32), (237, 33), (237, 34), (237, 35), (237, 36), (237, 37), (237, 38), (237, 39), (237, 40), (237, 41), (237, 42), (237, 43), (237, 44), (237, 45), (237, 46), (237, 47), (237, 48), (237, 49), (237, 51), (238, 12), (238, 13), (238, 14), (238, 15), (238, 16), (238, 17), (238, 18), (238, 19), (238, 20), (238, 21), (238, 22), (238, 23), (238, 24), (238, 25), (238, 26), (238, 27), (238, 28), (238, 29), (238, 30), (238, 31), (238, 32), (238, 33), (238, 34), (238, 35), (238, 36), (238, 37), (238, 38), (238, 39), (238, 40), (238, 41), (238, 42), (238, 43), (238, 44), (238, 45), (238, 46), (238, 47), (238, 48), (238, 49), (238, 50), (238, 52), (239, 13), (239, 15), (239, 16), (239, 17), (239, 18), (239, 19), (239, 20), (239, 21), (239, 22), (239, 23), (239, 24), (239, 25), (239, 26),
(239, 27), (239, 28), (239, 29), (239, 30), (239, 31), (239, 32), (239, 33), (239, 34), (239, 35), (239, 36), (239, 37), (239, 38), (239, 39), (239, 40), (239, 41), (239, 42), (239, 43), (239, 44), (239, 45), (239, 46), (239, 47), (239, 48), (239, 49), (239, 50), (239, 52), (240, 13), (240, 15), (240, 16), (240, 17), (240, 18), (240, 19), (240, 20), (240, 21), (240, 22), (240, 23), (240, 24), (240, 25), (240, 26), (240, 27), (240, 28), (240, 29), (240, 30), (240, 31), (240, 32), (240, 33), (240, 34), (240, 35), (240, 36), (240, 37), (240, 38), (240, 39), (240, 40), (240, 41), (240, 42), (240, 43), (240, 44), (240, 45), (240, 46), (240, 47), (240, 48), (240, 49), (240, 50), (240, 52), (241, 13), (241, 15), (241, 16), (241, 17), (241, 18), (241, 19), (241, 20), (241, 21), (241, 22),
(241, 23), (241, 24), (241, 25), (241, 26), (241, 27), (241, 28), (241, 29), (241, 30), (241, 31), (241, 32), (241, 33), (241, 34), (241, 35), (241, 36), (241, 37), (241, 38), (241, 39), (241, 40), (241, 41), (241, 42), (241, 43), (241, 44), (241, 45), (241, 46), (241, 47), (241, 48), (241, 49), (241, 50), (241, 52), (242, 13), (242, 15), (242, 16), (242, 17), (242, 18), (242, 19), (242, 20), (242, 21), (242, 22), (242, 23), (242, 24), (242, 25), (242, 26), (242, 27), (242, 28), (242, 29), (242, 30), (242, 31), (242, 32), (242, 33), (242, 34), (242, 35), (242, 36), (242, 37), (242, 38), (242, 39), (242, 40), (242, 41), (242, 42), (242, 43), (242, 44), (242, 45), (242, 46), (242, 47), (242, 48), (242, 49), (242, 50), (242, 52), (243, 13), (243, 15), (243, 16), (243, 17), (243, 18),
(243, 19), (243, 20), (243, 21), (243, 22), (243, 23), (243, 24), (243, 25), (243, 26), (243, 27), (243, 28), (243, 29), (243, 30), (243, 31), (243, 32), (243, 33), (243, 34), (243, 35), (243, 36), (243, 37), (243, 38), (243, 39), (243, 40), (243, 41), (243, 42), (243, 43), (243, 44), (243, 45), (243, 46), (243, 47), (243, 48), (243, 49), (243, 50), (243, 52), (244, 13), (244, 15), (244, 16), (244, 17), (244, 18), (244, 19), (244, 20), (244, 21), (244, 22), (244, 23), (244, 24), (244, 25), (244, 26), (244, 27), (244, 28), (244, 29), (244, 30), (244, 31), (244, 32), (244, 33), (244, 34), (244, 35), (244, 36), (244, 37), (244, 38), (244, 39), (244, 40), (244, 41), (244, 42), (244, 43), (244, 44), (244, 45), (244, 46), (244, 47), (244, 48), (244, 49), (244, 50), (244, 52), (245, 13),
(245, 15), (245, 16), (245, 17), (245, 18), (245, 19), (245, 20), (245, 21), (245, 22), (245, 23), (245, 24), (245, 25), (245, 26), (245, 27), (245, 28), (245, 29), (245, 30), (245, 31), (245, 32), (245, 33), (245, 34), (245, 35), (245, 36), (245, 37), (245, 38), (245, 39), (245, 40), (245, 41), (245, 42), (245, 43), (245, 44), (245, 45), (245, 46), (245, 47), (245, 48), (245, 49), (245, 50), (245, 52), (246, 14), (246, 16), (246, 17), (246, 18), (246, 19), (246, 20), (246, 21), (246, 22), (246, 23), (246, 24), (246, 25), (246, 26), (246, 27), (246, 28), (246, 29), (246, 30), (246, 31), (246, 32), (246, 33), (246, 34), (246, 35), (246, 36), (246, 37), (246, 38), (246, 39), (246, 40), (246, 41), (246, 42), (246, 43), (246, 44), (246, 45), (246, 46), (246, 47), (246, 48), (246, 49),
(246, 50), (246, 52), (247, 14), (247, 16), (247, 17), (247, 18), (247, 19), (247, 20), (247, 21), (247, 22), (247, 23), (247, 24), (247, 25), (247, 26), (247, 27), (247, 28), (247, 29), (247, 30), (247, 31), (247, 32), (247, 33), (247, 34), (247, 35), (247, 36), (247, 37), (247, 38), (247, 39), (247, 40), (247, 41), (247, 42), (247, 43), (247, 44), (247, 45), (247, 46), (247, 47), (247, 48), (247, 49), (247, 50), (247, 52), (248, 14), (248, 16), (248, 17), (248, 18), (248, 19), (248, 20), (248, 21), (248, 22), (248, 23), (248, 24), (248, 25), (248, 26), (248, 27), (248, 28), (248, 29), (248, 30), (248, 31), (248, 32), (248, 33), (248, 34), (248, 35), (248, 36), (248, 37), (248, 38), (248, 39), (248, 40), (248, 41), (248, 42), (248, 43), (248, 44), (248, 45), (248, 46), (248, 47),
(248, 48), (248, 49), (248, 50), (248, 52), (249, 15), (249, 17), (249, 18), (249, 19), (249, 20), (249, 21), (249, 22), (249, 23), (249, 24), (249, 25), (249, 26), (249, 27), (249, 28), (249, 29), (249, 30), (249, 31), (249, 32), (249, 33), (249, 34), (249, 35), (249, 36), (249, 37), (249, 38), (249, 39), (249, 40), (249, 41), (249, 42), (249, 43), (249, 44), (249, 45), (249, 46), (249, 47), (249, 48), (249, 49), (249, 51), (250, 15), (250, 17), (250, 18), (250, 19), (250, 20), (250, 21), (250, 22), (250, 23), (250, 24), (250, 25), (250, 26), (250, 27), (250, 28), (250, 29), (250, 30), (250, 31), (250, 32), (250, 33), (250, 34), (250, 35), (250, 36), (250, 37), (250, 38), (250, 39), (250, 40), (250, 41), (250, 42), (250, 43), (250, 44), (250, 45), (250, 46), (250, 47), (250, 48),
(250, 49), (250, 51), (251, 15), (251, 17), (251, 18), (251, 19), (251, 20), (251, 21), (251, 22), (251, 23), (251, 24), (251, 25), (251, 26), (251, 27), (251, 28), (251, 29), (251, 30), (251, 31), (251, 32), (251, 33), (251, 34), (251, 35), (251, 36), (251, 37), (251, 38), (251, 39), (251, 40), (251, 41), (251, 42), (251, 43), (251, 44), (251, 45), (251, 46), (251, 47), (251, 48), (251, 49), (251, 51), (252, 16), (252, 18), (252, 19), (252, 20), (252, 21), (252, 22), (252, 23), (252, 24), (252, 25), (252, 26), (252, 27), (252, 28), (252, 29), (252, 30), (252, 31), (252, 32), (252, 33), (252, 34), (252, 35), (252, 36), (252, 37), (252, 38), (252, 39), (252, 40), (252, 41), (252, 42), (252, 43), (252, 44), (252, 45), (252, 46), (252, 47), (252, 48), (252, 50), (253, 16), (253, 18),
(253, 19), (253, 20), (253, 21), (253, 22), (253, 23), (253, 24), (253, 25), (253, 26), (253, 27), (253, 28), (253, 29), (253, 30), (253, 31), (253, 32), (253, 33), (253, 34), (253, 35), (253, 36), (253, 37), (253, 38), (253, 39), (253, 40), (253, 41), (253, 42), (253, 43), (253, 44), (253, 45), (253, 46), (253, 47), (253, 48), (253, 50), (254, 17), (254, 19), (254, 20), (254, 21), (254, 22), (254, 23), (254, 24), (254, 25), (254, 26), (254, 27), (254, 28), (254, 29), (254, 30), (254, 31), (254, 32), (254, 33), (254, 34), (254, 35), (254, 36), (254, 37), (254, 38), (254, 39), (254, 40), (254, 41), (254, 42), (254, 43), (254, 44), (254, 45), (254, 46), (254, 50), (255, 18), (255, 20), (255, 21), (255, 22), (255, 23), (255, 24), (255, 25), (255, 26), (255, 27), (255, 28), (255, 29),
(255, 30), (255, 31), (255, 32), (255, 33), (255, 34), (255, 35), (255, 36), (255, 37), (255, 38), (255, 39), (255, 40), (255, 41), (255, 42), (255, 43), (255, 44), (255, 47), (255, 49), (256, 18), (256, 20), (256, 21), (256, 22), (256, 23), (256, 24), (256, 25), (256, 26), (256, 27), (256, 28), (256, 29), (256, 30), (256, 31), (256, 32), (256, 33), (256, 34), (256, 35), (256, 36), (256, 37), (256, 38), (256, 39), (256, 40), (256, 41), (256, 42), (256, 43), (256, 45), (256, 46), (256, 49), (257, 19), (257, 21), (257, 22), (257, 23), (257, 24), (257, 25), (257, 26), (257, 27), (257, 28), (257, 29), (257, 30), (257, 31), (257, 32), (257, 33), (257, 34), (257, 35), (257, 36), (257, 37), (257, 38), (257, 39), (257, 40), (257, 41), (257, 42), (257, 44), (258, 20), (258, 22), (258, 23),
(258, 24), (258, 25), (258, 26), (258, 27), (258, 28), (258, 29), (258, 30), (258, 31), (258, 32), (258, 33), (258, 34), (258, 35), (258, 36), (258, 37), (258, 38), (258, 43), (259, 23), (259, 24), (259, 25), (259, 26), (259, 27), (259, 28), (259, 29), (259, 30), (259, 31), (259, 32), (259, 33), (259, 34), (259, 35), (259, 39), (259, 40), (259, 41), (259, 43), (260, 22), (260, 25), (260, 26), (260, 27), (260, 28), (260, 29), (260, 30), (260, 31), (260, 32), (260, 36), (260, 37), (260, 38), (261, 23), (261, 33), (261, 34), (261, 35), (262, 25), (262, 26), (262, 27), (262, 28), (262, 29), (262, 30), (262, 31), (264, 48), (264, 50), (265, 52), (265, 53), (266, 49), (266, 51), (266, 54), (267, 50), (267, 53), (267, 56), (268, 51), (268, 54), (268, 57), (269, 53), (269, 55), (269, 56),
(270, 54), (270, 56), (270, 57), (271, 54), (271, 56), (271, 57), (271, 58), (271, 60), (272, 54), (272, 56), (272, 57), (272, 58), (272, 59), (272, 61), (273, 54), (273, 56), (273, 57), (273, 58), (273, 59), (273, 61), (274, 53), (274, 55), (274, 56), (274, 57), (274, 58), (274, 59), (274, 60), (274, 62), (275, 53), (275, 55), (275, 56), (275, 57), (275, 58), (275, 59), (275, 60), (275, 62), (276, 53), (276, 55), (276, 56), (276, 57), (276, 58), (276, 59), (276, 60), (276, 62), (277, 53), (277, 55), (277, 56), (277, 57), (277, 58), (277, 59), (277, 61), (278, 52), (278, 54), (278, 55), (278, 56), (278, 57), (278, 58), (278, 59), (278, 61), (279, 52), (279, 54), (279, 55), (279, 56), (279, 57), (279, 58), (279, 59), (279, 61), (280, 53), (280, 54), (280, 55), (280, 56), (280, 57),
(280, 58), (281, 53), (281, 60), (282, 54), (282, 56), (282, 57), (282, 59), )
coordinates_FF6600 = ((157, 76),
(157, 78), (158, 74), (158, 78), (158, 79), (159, 68), (159, 73), (159, 76), (159, 77), (159, 78), (159, 80), (159, 81), (159, 82), (159, 83), (159, 84), (159, 86), (160, 66), (160, 68), (160, 73), (160, 75), (160, 76), (160, 77), (160, 78), (160, 83), (160, 85), (161, 64), (161, 69), (161, 72), (161, 74), (161, 79), (161, 80), (161, 82), (162, 61), (162, 65), (162, 66), (162, 67), (162, 68), (162, 75), (162, 76), (162, 77), (162, 78), (163, 61), (163, 63), (163, 64), (163, 65), (163, 66), (163, 67), (163, 68), (163, 69), (163, 73), (163, 74), (164, 61), (164, 63), (164, 64), (164, 65), (164, 66), (164, 67), (164, 68), (164, 72), (165, 58), (165, 60), (165, 61), (165, 62), (165, 63), (165, 64), (165, 65), (165, 66), (165, 67), (165, 70), (166, 59), (166, 61), (166, 62), (166, 63),
(166, 64), (166, 65), (166, 68), (167, 60), (167, 62), (167, 63), (167, 64), (167, 67), (168, 60), (168, 61), (168, 62), (168, 65), (169, 61), (169, 64), (170, 60), (170, 62), (171, 61), (172, 57), (172, 60), (173, 55), (173, 58), (174, 54), (174, 57), (175, 52), (175, 56), (176, 50), (176, 55), (177, 49), (177, 54), (178, 47), (178, 50), (178, 53), (179, 46), (179, 49), (179, 52), (180, 45), (180, 47), (180, 48), (180, 49), (180, 51), (181, 44), (181, 46), (181, 47), (181, 48), (181, 50), (182, 43), (182, 45), (182, 46), (182, 47), (182, 49), (183, 42), (183, 44), (183, 45), (183, 46), (183, 48), (184, 42), (184, 44), (184, 45), (184, 47), (185, 42), (185, 44), (185, 45), (185, 47), (186, 42), (187, 43), (187, 46), (258, 46), (258, 48), (258, 49), (258, 50), (258, 51), (258, 52),
(258, 53), (258, 54), (258, 55), (258, 56), (258, 57), (258, 59), (259, 45), (259, 60), (260, 46), (260, 48), (260, 49), (260, 50), (260, 51), (260, 52), (260, 53), (260, 54), (260, 55), (260, 56), (260, 57), (260, 58), (260, 59), (260, 61), (261, 47), (261, 52), (261, 53), (261, 54), (261, 55), (261, 56), (261, 57), (261, 58), (261, 59), (261, 60), (261, 63), (262, 48), (262, 50), (262, 51), (262, 54), (262, 55), (262, 56), (262, 57), (262, 58), (262, 59), (262, 60), (262, 61), (262, 64), (263, 52), (263, 53), (263, 56), (263, 57), (263, 58), (263, 59), (263, 60), (263, 61), (263, 62), (263, 63), (263, 65), (264, 54), (264, 58), (264, 59), (264, 60), (264, 61), (264, 62), (264, 63), (264, 64), (264, 66), (265, 56), (265, 59), (265, 60), (265, 61), (265, 62), (265, 63), (265, 64),
(265, 65), (265, 68), (266, 58), (266, 60), (266, 61), (266, 62), (266, 63), (266, 64), (266, 65), (266, 66), (266, 69), (267, 59), (267, 61), (267, 62), (267, 63), (267, 64), (267, 65), (267, 66), (267, 67), (267, 70), (268, 60), (268, 62), (268, 63), (268, 64), (268, 65), (268, 66), (268, 67), (268, 68), (268, 69), (268, 71), (269, 61), (269, 63), (269, 64), (269, 65), (269, 66), (269, 67), (269, 68), (269, 69), (269, 70), (269, 72), (270, 62), (270, 64), (270, 65), (270, 66), (270, 67), (270, 68), (270, 69), (270, 70), (270, 71), (270, 74), (271, 63), (271, 65), (271, 66), (271, 67), (271, 68), (271, 69), (271, 70), (271, 71), (271, 72), (271, 75), (272, 63), (272, 65), (272, 66), (272, 67), (272, 68), (272, 69), (272, 70), (272, 71), (272, 72), (272, 73), (272, 76), (273, 64),
(273, 67), (273, 68), (273, 69), (273, 70), (273, 71), (273, 72), (273, 73), (273, 74), (273, 75), (273, 77), (274, 64), (274, 66), (274, 69), (274, 70), (274, 71), (274, 72), (274, 73), (274, 74), (274, 75), (274, 76), (274, 78), (275, 68), (275, 71), (275, 72), (275, 73), (275, 74), (275, 75), (275, 76), (275, 77), (275, 79), (276, 69), (276, 72), (276, 73), (276, 74), (276, 75), (276, 76), (276, 77), (276, 78), (276, 81), (277, 71), (277, 74), (277, 75), (277, 76), (277, 77), (277, 78), (277, 79), (277, 82), (278, 72), (278, 75), (278, 76), (278, 77), (278, 78), (278, 79), (278, 80), (278, 83), (279, 74), (279, 76), (279, 77), (279, 78), (279, 79), (279, 80), (279, 81), (279, 82), (279, 84), (280, 75), (280, 77), (280, 78), (280, 79), (280, 80), (280, 81), (280, 82), (280, 83),
(280, 85), (281, 76), (281, 79), (281, 80), (281, 81), (281, 82), (281, 83), (281, 84), (281, 86), (282, 77), (282, 80), (282, 81), (282, 82), (282, 83), (282, 84), (282, 85), (282, 88), (283, 81), (283, 82), (283, 83), (283, 84), (283, 85), (283, 86), (283, 89), (284, 80), (284, 82), (284, 83), (284, 84), (284, 85), (284, 86), (284, 87), (284, 90), (285, 81), (285, 83), (285, 84), (285, 85), (285, 86), (285, 87), (285, 88), (285, 89), (285, 91), (286, 82), (286, 85), (286, 86), (286, 87), (286, 88), (286, 89), (286, 90), (286, 92), (287, 83), (287, 86), (287, 87), (287, 88), (287, 89), (287, 90), (287, 91), (287, 93), (288, 84), (288, 87), (288, 88), (288, 89), (288, 90), (288, 94), (289, 86), (289, 89), (289, 90), (289, 92), (290, 87), (291, 90), )
coordinates_FF9966 = ((152, 74),
(152, 76), (153, 71), (153, 73), (153, 77), (154, 69), (154, 74), (154, 75), (154, 77), (155, 67), (155, 71), (155, 72), (155, 73), (155, 77), (156, 65), (156, 74), (156, 75), (157, 63), (157, 64), (157, 67), (157, 68), (157, 69), (157, 70), (157, 71), (157, 72), (158, 62), (158, 65), (158, 66), (159, 61), (159, 64), (160, 61), (160, 62), (276, 64), (276, 66), (277, 64), (277, 68), (278, 63), (278, 64), (278, 65), (278, 66), (278, 69), (279, 63), (279, 65), (279, 66), (279, 67), (279, 68), (279, 71), (280, 63), (280, 65), (280, 66), (280, 67), (280, 68), (280, 69), (280, 72), (281, 62), (281, 64), (281, 65), (281, 66), (281, 67), (281, 68), (281, 69), (281, 70), (281, 71), (281, 73), (282, 62), (282, 63), (282, 64), (282, 65), (282, 66), (282, 67), (282, 68), (282, 69), (282, 70),
(282, 71), (282, 72), (282, 75), (283, 63), (283, 64), (283, 65), (283, 66), (283, 67), (283, 68), (283, 69), (283, 70), (283, 71), (283, 72), (283, 73), (283, 76), (284, 58), (284, 62), (284, 63), (284, 64), (284, 65), (284, 66), (284, 67), (284, 68), (284, 69), (284, 70), (284, 71), (284, 72), (284, 73), (284, 74), (284, 77), (285, 58), (285, 60), (285, 61), (285, 62), (285, 63), (285, 64), (285, 65), (285, 66), (285, 67), (285, 68), (285, 69), (285, 70), (285, 71), (285, 72), (285, 73), (285, 74), (285, 75), (285, 76), (285, 78), (286, 59), (286, 61), (286, 62), (286, 63), (286, 64), (286, 65), (286, 66), (286, 67), (286, 68), (286, 69), (286, 70), (286, 71), (286, 72), (286, 73), (286, 74), (286, 75), (286, 76), (286, 77), (286, 79), (287, 60), (287, 62), (287, 63), (287, 64),
(287, 65), (287, 66), (287, 67), (287, 68), (287, 69), (287, 70), (287, 71), (287, 72), (287, 73), (287, 74), (287, 75), (287, 76), (287, 77), (287, 78), (288, 61), (288, 63), (288, 64), (288, 65), (288, 66), (288, 67), (288, 68), (288, 69), (288, 70), (288, 71), (288, 72), (288, 73), (288, 74), (288, 75), (288, 76), (288, 77), (288, 78), (288, 79), (288, 82), (289, 62), (289, 65), (289, 66), (289, 67), (289, 68), (289, 69), (289, 70), (289, 71), (289, 72), (289, 73), (289, 74), (289, 75), (289, 76), (289, 77), (289, 78), (289, 79), (289, 80), (289, 83), (290, 63), (290, 66), (290, 67), (290, 68), (290, 69), (290, 70), (290, 71), (290, 72), (290, 73), (290, 74), (290, 75), (290, 76), (290, 77), (290, 78), (290, 79), (290, 80), (290, 81), (290, 82), (290, 84), (291, 65), (291, 68),
(291, 69), (291, 70), (291, 71), (291, 72), (291, 73), (291, 74), (291, 75), (291, 76), (291, 77), (291, 78), (291, 79), (291, 80), (291, 81), (291, 82), (291, 83), (291, 86), (292, 66), (292, 69), (292, 70), (292, 71), (292, 72), (292, 73), (292, 74), (292, 75), (292, 76), (292, 77), (292, 78), (292, 79), (292, 80), (292, 81), (292, 82), (292, 83), (292, 84), (292, 87), (293, 68), (293, 71), (293, 72), (293, 73), (293, 74), (293, 75), (293, 76), (293, 77), (293, 78), (293, 79), (293, 80), (293, 81), (293, 82), (293, 83), (293, 84), (293, 85), (293, 89), (293, 90), (294, 69), (294, 73), (294, 74), (294, 75), (294, 76), (294, 77), (294, 78), (294, 79), (294, 80), (294, 81), (294, 82), (294, 83), (294, 89), (295, 71), (295, 75), (295, 76), (295, 77), (295, 78), (295, 79), (295, 80),
(295, 81), (295, 84), (295, 85), (295, 89), (296, 73), (296, 83), (296, 88), (296, 89), (297, 76), (297, 77), (297, 78), (297, 79), (297, 81), (297, 89), )
coordinates_CCFF33 = ((237, 83),
(237, 86), (238, 83), (238, 85), )
|
coordinates_ffffcc = ((149, 117), (149, 118), (149, 119), (149, 120), (149, 121), (149, 122), (149, 123), (149, 124), (149, 125), (149, 126), (149, 127), (149, 128), (149, 129), (149, 130), (150, 111), (150, 112), (150, 113), (150, 114), (150, 115), (150, 116), (150, 131), (150, 133), (151, 107), (151, 108), (151, 109), (151, 110), (151, 117), (151, 118), (151, 119), (151, 120), (151, 121), (151, 122), (151, 123), (151, 124), (151, 125), (151, 126), (151, 127), (151, 128), (151, 129), (151, 130), (151, 135), (152, 104), (152, 106), (152, 111), (152, 112), (152, 113), (152, 114), (152, 115), (152, 116), (152, 117), (152, 118), (152, 119), (152, 120), (152, 121), (152, 122), (152, 123), (152, 124), (152, 125), (152, 126), (152, 127), (152, 128), (152, 129), (152, 130), (152, 131), (152, 132), (152, 133), (152, 137), (153, 102), (153, 103), (153, 107), (153, 108), (153, 109), (153, 110), (153, 111), (153, 112), (153, 113), (153, 114), (153, 115), (153, 116), (153, 117), (153, 118), (153, 119), (153, 120), (153, 121), (153, 122), (153, 123), (153, 124), (153, 125), (153, 126), (153, 127), (153, 128), (153, 129), (153, 130), (153, 131), (153, 132), (153, 133), (153, 134), (153, 135), (153, 139), (154, 96), (154, 97), (154, 98), (154, 99), (154, 100), (154, 104), (154, 105), (154, 106), (154, 107), (154, 108), (154, 109), (154, 110), (154, 111), (154, 112), (154, 113), (154, 114), (154, 115), (154, 116), (154, 117), (154, 118), (154, 119), (154, 120), (154, 121), (154, 122), (154, 123), (154, 124), (154, 125), (154, 126), (154, 127), (154, 128), (154, 129), (154, 130), (154, 131), (154, 132), (154, 133), (154, 134), (154, 135), (154, 136), (154, 137), (154, 141), (155, 91), (155, 93), (155, 94), (155, 95), (155, 102), (155, 103), (155, 104), (155, 105), (155, 106), (155, 107), (155, 108), (155, 109), (155, 110), (155, 111), (155, 112), (155, 113), (155, 114), (155, 115), (155, 116), (155, 117), (155, 118), (155, 119), (155, 120), (155, 121), (155, 122), (155, 123), (155, 124), (155, 125), (155, 126), (155, 127), (155, 128), (155, 129), (155, 130), (155, 131), (155, 132), (155, 133), (155, 134), (155, 135), (155, 136), (155, 137), (155, 138), (155, 139), (155, 143), (156, 90), (156, 96), (156, 97), (156, 98), (156, 99), (156, 100), (156, 101), (156, 102), (156, 103), (156, 104), (156, 105), (156, 106), (156, 107), (156, 108), (156, 109), (156, 110), (156, 111), (156, 112), (156, 113), (156, 114), (156, 115), (156, 116), (156, 117), (156, 118), (156, 119), (156, 120), (156, 121), (156, 122), (156, 123), (156, 124), (156, 125), (156, 126), (156, 127), (156, 128), (156, 129), (156, 130), (156, 131), (156, 132), (156, 133), (156, 134), (156, 135), (156, 136), (156, 137), (156, 138), (156, 139), (156, 140), (156, 141), (156, 145), (157, 89), (157, 91), (157, 92), (157, 93), (157, 94), (157, 95), (157, 96), (157, 97), (157, 98), (157, 99), (157, 100), (157, 101), (157, 102), (157, 103), (157, 104), (157, 105), (157, 106), (157, 107), (157, 108), (157, 109), (157, 110), (157, 111), (157, 112), (157, 113), (157, 114), (157, 115), (157, 116), (157, 117), (157, 118), (157, 119), (157, 120), (157, 121), (157, 122), (157, 123), (157, 124), (157, 125), (157, 126), (157, 127), (157, 128), (157, 129), (157, 130), (157, 131), (157, 132), (157, 133), (157, 134), (157, 135), (157, 136), (157, 137), (157, 138), (157, 139), (157, 140), (157, 141), (157, 142), (157, 143), (157, 146), (158, 89), (158, 91), (158, 92), (158, 93), (158, 94), (158, 95), (158, 96), (158, 97), (158, 98), (158, 99), (158, 100), (158, 101), (158, 102), (158, 103), (158, 104), (158, 105), (158, 106), (158, 107), (158, 108), (158, 109), (158, 110), (158, 111), (158, 112), (158, 113), (158, 114), (158, 115), (158, 116), (158, 117), (158, 118), (158, 119), (158, 120), (158, 121), (158, 122), (158, 123), (158, 124), (158, 125), (158, 126), (158, 127), (158, 128), (158, 129), (158, 130), (158, 131), (158, 132), (158, 133), (158, 134), (158, 135), (158, 136), (158, 137), (158, 138), (158, 139), (158, 140), (158, 141), (158, 142), (158, 143), (158, 144), (158, 146), (159, 89), (159, 91), (159, 92), (159, 93), (159, 94), (159, 95), (159, 96), (159, 97), (159, 98), (159, 99), (159, 100), (159, 101), (159, 102), (159, 103), (159, 104), (159, 105), (159, 106), (159, 107), (159, 108), (159, 109), (159, 110), (159, 111), (159, 112), (159, 113), (159, 114), (159, 115), (159, 116), (159, 117), (159, 118), (159, 119), (159, 120), (159, 121), (159, 122), (159, 123), (159, 124), (159, 125), (159, 126), (159, 127), (159, 128), (159, 129), (159, 130), (159, 131), (159, 132), (159, 133), (159, 134), (159, 135), (159, 136), (159, 137), (159, 138), (159, 139), (159, 140), (159, 141), (159, 142), (159, 146), (160, 88), (160, 90), (160, 91), (160, 92), (160, 93), (160, 94), (160, 95), (160, 96), (160, 97), (160, 98), (160, 99), (160, 100), (160, 101), (160, 102), (160, 103), (160, 104), (160, 105), (160, 106), (160, 107), (160, 108), (160, 109), (160, 110), (160, 111), (160, 112), (160, 113), (160, 114), (160, 115), (160, 116), (160, 117), (160, 118), (160, 119), (160, 120), (160, 121), (160, 122), (160, 123), (160, 124), (160, 125), (160, 126), (160, 127), (160, 128), (160, 129), (160, 130), (160, 131), (160, 132), (160, 133), (160, 134), (160, 135), (160, 136), (160, 137), (160, 138), (160, 139), (160, 140), (160, 141), (160, 145), (161, 86), (161, 89), (161, 90), (161, 91), (161, 92), (161, 93), (161, 94), (161, 95), (161, 96), (161, 97), (161, 98), (161, 99), (161, 100), (161, 101), (161, 102), (161, 103), (161, 104), (161, 105), (161, 106), (161, 107), (161, 108), (161, 109), (161, 110), (161, 111), (161, 112), (161, 113), (161, 114), (161, 115), (161, 116), (161, 117), (161, 118), (161, 119), (161, 120), (161, 121), (161, 122), (161, 123), (161, 124), (161, 125), (161, 126), (161, 127), (161, 128), (161, 129), (161, 130), (161, 131), (161, 132), (161, 133), (161, 134), (161, 135), (161, 136), (161, 137), (161, 138), (161, 139), (161, 140), (161, 142), (162, 84), (162, 85), (162, 88), (162, 89), (162, 90), (162, 91), (162, 92), (162, 93), (162, 94), (162, 95), (162, 96), (162, 97), (162, 98), (162, 99), (162, 100), (162, 101), (162, 102), (162, 103), (162, 104), (162, 105), (162, 106), (162, 107), (162, 108), (162, 109), (162, 110), (162, 111), (162, 112), (162, 113), (162, 114), (162, 115), (162, 116), (162, 117), (162, 118), (162, 119), (162, 120), (162, 121), (162, 122), (162, 123), (162, 124), (162, 125), (162, 126), (162, 127), (162, 128), (162, 129), (162, 130), (162, 131), (162, 132), (162, 133), (162, 134), (162, 135), (162, 136), (162, 137), (162, 138), (162, 139), (162, 141), (163, 81), (163, 82), (163, 83), (163, 86), (163, 87), (163, 88), (163, 89), (163, 90), (163, 91), (163, 92), (163, 93), (163, 94), (163, 95), (163, 96), (163, 97), (163, 98), (163, 99), (163, 100), (163, 101), (163, 102), (163, 103), (163, 104), (163, 105), (163, 106), (163, 107), (163, 108), (163, 109), (163, 110), (163, 111), (163, 112), (163, 113), (163, 114), (163, 115), (163, 116), (163, 117), (163, 118), (163, 119), (163, 120), (163, 121), (163, 122), (163, 123), (163, 124), (163, 125), (163, 126), (163, 127), (163, 128), (163, 129), (163, 130), (163, 131), (163, 132), (163, 133), (163, 134), (163, 135), (163, 136), (163, 137), (163, 138), (163, 140), (164, 76), (164, 77), (164, 78), (164, 79), (164, 84), (164, 85), (164, 86), (164, 87), (164, 88), (164, 89), (164, 90), (164, 91), (164, 92), (164, 93), (164, 94), (164, 95), (164, 96), (164, 97), (164, 98), (164, 99), (164, 100), (164, 101), (164, 102), (164, 103), (164, 104), (164, 105), (164, 106), (164, 107), (164, 108), (164, 109), (164, 110), (164, 111), (164, 112), (164, 113), (164, 114), (164, 115), (164, 116), (164, 117), (164, 118), (164, 119), (164, 120), (164, 121), (164, 122), (164, 123), (164, 124), (164, 125), (164, 126), (164, 127), (164, 128), (164, 129), (164, 130), (164, 131), (164, 132), (164, 133), (164, 134), (164, 135), (164, 136), (164, 137), (164, 139), (165, 74), (165, 75), (165, 80), (165, 81), (165, 82), (165, 83), (165, 84), (165, 85), (165, 86), (165, 87), (165, 88), (165, 89), (165, 90), (165, 91), (165, 92), (165, 93), (165, 94), (165, 95), (165, 96), (165, 97), (165, 98), (165, 99), (165, 100), (165, 101), (165, 102), (165, 103), (165, 104), (165, 105), (165, 106), (165, 107), (165, 108), (165, 109), (165, 110), (165, 111), (165, 112), (165, 113), (165, 114), (165, 115), (165, 116), (165, 117), (165, 118), (165, 119), (165, 120), (165, 121), (165, 122), (165, 123), (165, 124), (165, 125), (165, 126), (165, 127), (165, 128), (165, 129), (165, 130), (165, 131), (165, 132), (165, 133), (165, 134), (165, 135), (165, 136), (166, 72), (166, 76), (166, 77), (166, 78), (166, 79), (166, 80), (166, 81), (166, 82), (166, 83), (166, 84), (166, 85), (166, 86), (166, 87), (166, 88), (166, 89), (166, 90), (166, 91), (166, 92), (166, 93), (166, 94), (166, 95), (166, 96), (166, 97), (166, 98), (166, 99), (166, 100), (166, 101), (166, 102), (166, 103), (166, 104), (166, 105), (166, 106), (166, 107), (166, 108), (166, 109), (166, 110), (166, 111), (166, 112), (166, 113), (166, 114), (166, 115), (166, 116), (166, 117), (166, 118), (166, 119), (166, 120), (166, 121), (166, 122), (166, 123), (166, 124), (166, 125), (166, 126), (166, 127), (166, 128), (166, 129), (166, 130), (166, 131), (166, 132), (166, 133), (166, 134), (166, 135), (166, 136), (166, 138), (167, 70), (167, 74), (167, 75), (167, 76), (167, 77), (167, 78), (167, 79), (167, 80), (167, 81), (167, 82), (167, 83), (167, 84), (167, 85), (167, 86), (167, 87), (167, 88), (167, 89), (167, 90), (167, 91), (167, 92), (167, 93), (167, 94), (167, 95), (167, 96), (167, 97), (167, 98), (167, 99), (167, 100), (167, 101), (167, 102), (167, 103), (167, 104), (167, 105), (167, 106), (167, 107), (167, 108), (167, 109), (167, 110), (167, 111), (167, 112), (167, 113), (167, 114), (167, 115), (167, 116), (167, 117), (167, 118), (167, 119), (167, 120), (167, 121), (167, 122), (167, 123), (167, 124), (167, 125), (167, 126), (167, 127), (167, 128), (167, 129), (167, 130), (167, 131), (167, 132), (167, 133), (167, 134), (167, 135), (167, 137), (168, 68), (168, 69), (168, 72), (168, 73), (168, 74), (168, 75), (168, 76), (168, 77), (168, 78), (168, 79), (168, 80), (168, 81), (168, 82), (168, 83), (168, 84), (168, 85), (168, 86), (168, 87), (168, 88), (168, 89), (168, 90), (168, 91), (168, 92), (168, 93), (168, 94), (168, 95), (168, 96), (168, 97), (168, 98), (168, 99), (168, 100), (168, 101), (168, 102), (168, 103), (168, 104), (168, 105), (168, 106), (168, 107), (168, 108), (168, 109), (168, 110), (168, 111), (168, 112), (168, 113), (168, 114), (168, 115), (168, 116), (168, 117), (168, 118), (168, 119), (168, 120), (168, 121), (168, 122), (168, 123), (168, 124), (168, 125), (168, 126), (168, 127), (168, 128), (168, 129), (168, 130), (168, 131), (168, 132), (168, 133), (168, 134), (168, 136), (169, 67), (169, 70), (169, 71), (169, 72), (169, 73), (169, 74), (169, 75), (169, 76), (169, 77), (169, 78), (169, 79), (169, 80), (169, 81), (169, 82), (169, 83), (169, 84), (169, 85), (169, 86), (169, 87), (169, 88), (169, 89), (169, 90), (169, 91), (169, 92), (169, 93), (169, 94), (169, 95), (169, 96), (169, 97), (169, 98), (169, 99), (169, 100), (169, 101), (169, 102), (169, 103), (169, 104), (169, 105), (169, 106), (169, 107), (169, 108), (169, 109), (169, 110), (169, 111), (169, 112), (169, 113), (169, 114), (169, 115), (169, 116), (169, 117), (169, 118), (169, 119), (169, 120), (169, 121), (169, 122), (169, 123), (169, 124), (169, 125), (169, 126), (169, 127), (169, 128), (169, 129), (169, 130), (169, 131), (169, 132), (169, 133), (169, 135), (170, 65), (170, 68), (170, 69), (170, 70), (170, 71), (170, 72), (170, 73), (170, 74), (170, 75), (170, 76), (170, 77), (170, 78), (170, 79), (170, 80), (170, 81), (170, 82), (170, 83), (170, 84), (170, 85), (170, 86), (170, 87), (170, 88), (170, 89), (170, 90), (170, 91), (170, 92), (170, 93), (170, 94), (170, 95), (170, 96), (170, 97), (170, 98), (170, 99), (170, 100), (170, 101), (170, 102), (170, 103), (170, 104), (170, 105), (170, 106), (170, 107), (170, 108), (170, 109), (170, 110), (170, 111), (170, 112), (170, 113), (170, 114), (170, 115), (170, 116), (170, 117), (170, 118), (170, 119), (170, 120), (170, 121), (170, 122), (170, 123), (170, 124), (170, 125), (170, 126), (170, 127), (170, 128), (170, 129), (170, 130), (170, 131), (170, 132), (170, 133), (170, 135), (171, 64), (171, 67), (171, 68), (171, 69), (171, 70), (171, 71), (171, 72), (171, 73), (171, 74), (171, 75), (171, 76), (171, 77), (171, 78), (171, 79), (171, 80), (171, 81), (171, 82), (171, 83), (171, 84), (171, 85), (171, 86), (171, 87), (171, 88), (171, 89), (171, 90), (171, 91), (171, 92), (171, 93), (171, 94), (171, 95), (171, 96), (171, 97), (171, 98), (171, 99), (171, 100), (171, 101), (171, 102), (171, 103), (171, 104), (171, 105), (171, 106), (171, 107), (171, 108), (171, 109), (171, 110), (171, 111), (171, 112), (171, 113), (171, 114), (171, 115), (171, 116), (171, 117), (171, 118), (171, 119), (171, 120), (171, 121), (171, 122), (171, 123), (171, 124), (171, 125), (171, 126), (171, 127), (171, 128), (171, 129), (171, 130), (171, 131), (171, 132), (171, 134), (172, 63), (172, 65), (172, 66), (172, 67), (172, 68), (172, 69), (172, 70), (172, 71), (172, 72), (172, 73), (172, 74), (172, 75), (172, 76), (172, 77), (172, 78), (172, 79), (172, 80), (172, 81), (172, 82), (172, 83), (172, 84), (172, 85), (172, 86), (172, 87), (172, 88), (172, 89), (172, 90), (172, 91), (172, 92), (172, 93), (172, 94), (172, 95), (172, 96), (172, 97), (172, 98), (172, 99), (172, 100), (172, 101), (172, 102), (172, 103), (172, 104), (172, 105), (172, 106), (172, 107), (172, 108), (172, 109), (172, 110), (172, 111), (172, 112), (172, 113), (172, 114), (172, 115), (172, 116), (172, 117), (172, 118), (172, 119), (172, 120), (172, 121), (172, 122), (172, 123), (172, 124), (172, 125), (172, 126), (172, 127), (172, 128), (172, 129), (172, 130), (172, 131), (172, 133), (173, 61), (173, 64), (173, 65), (173, 66), (173, 67), (173, 68), (173, 69), (173, 70), (173, 71), (173, 72), (173, 73), (173, 74), (173, 75), (173, 76), (173, 77), (173, 78), (173, 79), (173, 80), (173, 81), (173, 82), (173, 83), (173, 84), (173, 85), (173, 86), (173, 87), (173, 88), (173, 89), (173, 90), (173, 91), (173, 92), (173, 93), (173, 94), (173, 95), (173, 96), (173, 97), (173, 98), (173, 99), (173, 100), (173, 101), (173, 102), (173, 103), (173, 104), (173, 105), (173, 106), (173, 107), (173, 108), (173, 109), (173, 110), (173, 111), (173, 112), (173, 113), (173, 114), (173, 115), (173, 116), (173, 117), (173, 118), (173, 119), (173, 120), (173, 121), (173, 122), (173, 123), (173, 124), (173, 125), (173, 126), (173, 127), (173, 128), (173, 129), (173, 130), (173, 132), (174, 60), (174, 63), (174, 64), (174, 65), (174, 66), (174, 67), (174, 68), (174, 69), (174, 70), (174, 71), (174, 72), (174, 73), (174, 74), (174, 75), (174, 76), (174, 77), (174, 78), (174, 79), (174, 80), (174, 81), (174, 82), (174, 83), (174, 84), (174, 85), (174, 86), (174, 87), (174, 88), (174, 89), (174, 90), (174, 91), (174, 92), (174, 93), (174, 94), (174, 95), (174, 96), (174, 97), (174, 100), (174, 101), (174, 102), (174, 103), (174, 104), (174, 105), (174, 106), (174, 107), (174, 108), (174, 109), (174, 110), (174, 111), (174, 112), (174, 113), (174, 114), (174, 115), (174, 116), (174, 117), (174, 118), (174, 119), (174, 120), (174, 121), (174, 122), (174, 123), (174, 124), (174, 125), (174, 126), (174, 127), (174, 128), (174, 129), (174, 130), (174, 132), (175, 59), (175, 61), (175, 62), (175, 63), (175, 64), (175, 65), (175, 66), (175, 67), (175, 68), (175, 69), (175, 70), (175, 71), (175, 72), (175, 73), (175, 74), (175, 75), (175, 76), (175, 77), (175, 78), (175, 79), (175, 80), (175, 81), (175, 82), (175, 83), (175, 84), (175, 85), (175, 86), (175, 87), (175, 88), (175, 89), (175, 90), (175, 91), (175, 92), (175, 97), (175, 98), (175, 99), (175, 102), (175, 103), (175, 104), (175, 105), (175, 106), (175, 107), (175, 108), (175, 109), (175, 110), (175, 111), (175, 112), (175, 113), (175, 114), (175, 115), (175, 116), (175, 117), (175, 118), (175, 119), (175, 120), (175, 121), (175, 122), (175, 123), (175, 124), (175, 125), (175, 126), (175, 127), (175, 128), (175, 129), (175, 131), (176, 57), (176, 60), (176, 61), (176, 62), (176, 63), (176, 64), (176, 65), (176, 66), (176, 67), (176, 68), (176, 69), (176, 70), (176, 71), (176, 72), (176, 73), (176, 74), (176, 75), (176, 76), (176, 77), (176, 78), (176, 79), (176, 80), (176, 81), (176, 82), (176, 83), (176, 84), (176, 85), (176, 86), (176, 87), (176, 88), (176, 89), (176, 90), (176, 93), (176, 94), (176, 95), (176, 96), (176, 100), (176, 101), (176, 102), (176, 103), (176, 104), (176, 105), (176, 106), (176, 107), (176, 108), (176, 109), (176, 110), (176, 111), (176, 112), (176, 113), (176, 114), (176, 115), (176, 116), (176, 117), (176, 118), (176, 119), (176, 120), (176, 121), (176, 122), (176, 123), (176, 124), (176, 125), (176, 126), (176, 127), (176, 128), (176, 130), (177, 56), (177, 59), (177, 60), (177, 61), (177, 62), (177, 63), (177, 64), (177, 65), (177, 66), (177, 67), (177, 68), (177, 69), (177, 70), (177, 71), (177, 72), (177, 73), (177, 74), (177, 75), (177, 76), (177, 77), (177, 78), (177, 79), (177, 80), (177, 81), (177, 82), (177, 83), (177, 84), (177, 85), (177, 86), (177, 87), (177, 91), (177, 92), (177, 102), (177, 104), (177, 105), (177, 106), (177, 107), (177, 108), (177, 109), (177, 110), (177, 111), (177, 112), (177, 113), (177, 114), (177, 115), (177, 116), (177, 117), (177, 118), (177, 119), (177, 120), (177, 121), (177, 122), (177, 123), (177, 124), (177, 125), (177, 126), (177, 127), (177, 128), (177, 130), (178, 55), (178, 58), (178, 59), (178, 60), (178, 61), (178, 62), (178, 63), (178, 64), (178, 65), (178, 66), (178, 67), (178, 68), (178, 69), (178, 70), (178, 71), (178, 72), (178, 73), (178, 74), (178, 75), (178, 76), (178, 77), (178, 78), (178, 79), (178, 80), (178, 81), (178, 82), (178, 83), (178, 84), (178, 85), (178, 86), (178, 89), (178, 102), (178, 104), (178, 105), (178, 106), (178, 107), (178, 108), (178, 109), (178, 110), (178, 111), (178, 112), (178, 113), (178, 114), (178, 115), (178, 116), (178, 117), (178, 118), (178, 119), (178, 120), (178, 121), (178, 122), (178, 123), (178, 124), (178, 125), (178, 126), (178, 127), (178, 129), (179, 54), (179, 56), (179, 57), (179, 58), (179, 59), (179, 60), (179, 61), (179, 62), (179, 63), (179, 64), (179, 65), (179, 66), (179, 67), (179, 68), (179, 69), (179, 70), (179, 71), (179, 72), (179, 73), (179, 74), (179, 75), (179, 76), (179, 77), (179, 78), (179, 79), (179, 80), (179, 81), (179, 82), (179, 83), (179, 84), (179, 87), (179, 102), (179, 104), (179, 105), (179, 106), (179, 107), (179, 108), (179, 109), (179, 110), (179, 111), (179, 112), (179, 113), (179, 114), (179, 115), (179, 116), (179, 117), (179, 118), (179, 119), (179, 120), (179, 121), (179, 122), (179, 123), (179, 124), (179, 125), (179, 126), (179, 128), (180, 53), (180, 55), (180, 56), (180, 57), (180, 58), (180, 59), (180, 60), (180, 61), (180, 62), (180, 63), (180, 64), (180, 65), (180, 66), (180, 67), (180, 68), (180, 69), (180, 70), (180, 71), (180, 72), (180, 73), (180, 74), (180, 75), (180, 76), (180, 77), (180, 78), (180, 79), (180, 80), (180, 81), (180, 82), (180, 85), (180, 102), (180, 104), (180, 105), (180, 106), (180, 107), (180, 108), (180, 109), (180, 110), (180, 111), (180, 112), (180, 113), (180, 114), (180, 115), (180, 116), (180, 117), (180, 118), (180, 119), (180, 120), (180, 121), (180, 122), (180, 123), (180, 124), (180, 125), (180, 126), (180, 128), (181, 52), (181, 54), (181, 55), (181, 56), (181, 57), (181, 58), (181, 59), (181, 60), (181, 61), (181, 62), (181, 63), (181, 64), (181, 65), (181, 66), (181, 67), (181, 68), (181, 69), (181, 70), (181, 71), (181, 72), (181, 73), (181, 74), (181, 75), (181, 76), (181, 77), (181, 78), (181, 79), (181, 80), (181, 81), (181, 84), (181, 101), (181, 103), (181, 104), (181, 105), (181, 106), (181, 107), (181, 108), (181, 109), (181, 110), (181, 111), (181, 112), (181, 113), (181, 114), (181, 115), (181, 116), (181, 117), (181, 118), (181, 119), (181, 120), (181, 121), (181, 122), (181, 123), (181, 124), (181, 125), (181, 127), (182, 51), (182, 53), (182, 54), (182, 55), (182, 56), (182, 57), (182, 58), (182, 59), (182, 60), (182, 61), (182, 62), (182, 63), (182, 64), (182, 65), (182, 66), (182, 67), (182, 68), (182, 69), (182, 70), (182, 71), (182, 72), (182, 73), (182, 74), (182, 75), (182, 76), (182, 77), (182, 78), (182, 79), (182, 82), (182, 100), (182, 102), (182, 103), (182, 104), (182, 105), (182, 106), (182, 107), (182, 108), (182, 109), (182, 110), (182, 111), (182, 112), (182, 113), (182, 114), (182, 115), (182, 116), (182, 117), (182, 118), (182, 119), (182, 120), (182, 121), (182, 122), (182, 123), (182, 124), (182, 125), (182, 127), (183, 53), (183, 54), (183, 55), (183, 56), (183, 57), (183, 58), (183, 59), (183, 60), (183, 61), (183, 62), (183, 63), (183, 64), (183, 65), (183, 66), (183, 67), (183, 68), (183, 69), (183, 70), (183, 71), (183, 72), (183, 73), (183, 74), (183, 75), (183, 76), (183, 77), (183, 80), (183, 99), (183, 101), (183, 102), (183, 103), (183, 104), (183, 105), (183, 106), (183, 107), (183, 108), (183, 109), (183, 110), (183, 111), (183, 112), (183, 113), (183, 114), (183, 115), (183, 116), (183, 117), (183, 118), (183, 119), (183, 120), (183, 121), (183, 122), (183, 123), (183, 124), (183, 126), (184, 50), (184, 52), (184, 53), (184, 54), (184, 55), (184, 56), (184, 57), (184, 58), (184, 59), (184, 60), (184, 61), (184, 62), (184, 63), (184, 64), (184, 65), (184, 66), (184, 67), (184, 68), (184, 69), (184, 70), (184, 71), (184, 72), (184, 73), (184, 74), (184, 75), (184, 76), (184, 79), (184, 97), (184, 100), (184, 101), (184, 102), (184, 103), (184, 104), (184, 105), (184, 106), (184, 107), (184, 108), (184, 109), (184, 110), (184, 111), (184, 112), (184, 113), (184, 114), (184, 115), (184, 116), (184, 117), (184, 118), (184, 119), (184, 120), (184, 121), (184, 122), (184, 123), (184, 125), (185, 49), (185, 51), (185, 52), (185, 53), (185, 54), (185, 55), (185, 56), (185, 57), (185, 58), (185, 59), (185, 60), (185, 61), (185, 62), (185, 63), (185, 64), (185, 65), (185, 66), (185, 67), (185, 68), (185, 69), (185, 70), (185, 71), (185, 72), (185, 73), (185, 74), (185, 77), (185, 94), (185, 95), (185, 96), (185, 99), (185, 100), (185, 101), (185, 102), (185, 103), (185, 104), (185, 105), (185, 106), (185, 107), (185, 108), (185, 109), (185, 110), (185, 111), (185, 112), (185, 113), (185, 114), (185, 115), (185, 116), (185, 117), (185, 118), (185, 119), (185, 120), (185, 121), (185, 122), (185, 123), (185, 125), (186, 49), (186, 51), (186, 52), (186, 53), (186, 54), (186, 55), (186, 56), (186, 57), (186, 58), (186, 59), (186, 60), (186, 61), (186, 62), (186, 63), (186, 64), (186, 65), (186, 66), (186, 67), (186, 68), (186, 69), (186, 70), (186, 71), (186, 72), (186, 76), (186, 91), (186, 93), (186, 97), (186, 98), (186, 99), (186, 100), (186, 101), (186, 102), (186, 103), (186, 104), (186, 105), (186, 106), (186, 107), (186, 108), (186, 109), (186, 110), (186, 111), (186, 112), (186, 113), (186, 114), (186, 115), (186, 116), (186, 117), (186, 118), (186, 119), (187, 48), (187, 50), (187, 51), (187, 52), (187, 53), (187, 54), (187, 55), (187, 56), (187, 57), (187, 58), (187, 59), (187, 60), (187, 61), (187, 62), (187, 63), (187, 64), (187, 65), (187, 66), (187, 67), (187, 68), (187, 69), (187, 70), (187, 71), (187, 74), (187, 88), (187, 89), (187, 90), (187, 94), (187, 95), (187, 96), (187, 97), (187, 98), (187, 99), (187, 100), (187, 101), (187, 102), (187, 103), (187, 104), (187, 105), (187, 106), (187, 107), (187, 108), (187, 109), (187, 110), (187, 111), (187, 112), (187, 113), (187, 114), (187, 115), (187, 116), (187, 117), (187, 118), (187, 121), (187, 122), (187, 124), (188, 48), (188, 50), (188, 51), (188, 52), (188, 53), (188, 54), (188, 55), (188, 56), (188, 57), (188, 58), (188, 59), (188, 60), (188, 61), (188, 62), (188, 63), (188, 64), (188, 65), (188, 66), (188, 67), (188, 68), (188, 69), (188, 72), (188, 85), (188, 86), (188, 91), (188, 92), (188, 93), (188, 94), (188, 95), (188, 96), (188, 97), (188, 98), (188, 99), (188, 100), (188, 101), (188, 102), (188, 103), (188, 104), (188, 105), (188, 106), (188, 107), (188, 108), (188, 109), (188, 110), (188, 111), (188, 112), (188, 113), (188, 114), (188, 115), (188, 116), (188, 117), (188, 119), (189, 48), (189, 50), (189, 51), (189, 52), (189, 53), (189, 54), (189, 55), (189, 56), (189, 57), (189, 58), (189, 59), (189, 60), (189, 61), (189, 62), (189, 63), (189, 64), (189, 65), (189, 66), (189, 67), (189, 71), (189, 83), (189, 87), (189, 88), (189, 89), (189, 90), (189, 91), (189, 92), (189, 93), (189, 94), (189, 95), (189, 96), (189, 97), (189, 98), (189, 99), (189, 100), (189, 101), (189, 102), (189, 103), (189, 104), (189, 105), (189, 118), (190, 49), (190, 51), (190, 52), (190, 53), (190, 54), (190, 55), (190, 56), (190, 57), (190, 58), (190, 59), (190, 60), (190, 61), (190, 62), (190, 63), (190, 64), (190, 65), (190, 66), (190, 69), (190, 81), (190, 85), (190, 86), (190, 87), (190, 88), (190, 89), (190, 90), (190, 91), (190, 92), (190, 93), (190, 94), (190, 95), (190, 96), (190, 106), (190, 107), (190, 108), (190, 109), (190, 110), (190, 111), (190, 112), (190, 113), (190, 114), (190, 115), (190, 116), (190, 118), (191, 49), (191, 51), (191, 52), (191, 53), (191, 54), (191, 55), (191, 56), (191, 57), (191, 58), (191, 59), (191, 60), (191, 61), (191, 62), (191, 63), (191, 64), (191, 67), (191, 80), (191, 83), (191, 84), (191, 85), (191, 86), (191, 97), (191, 98), (191, 99), (191, 100), (191, 101), (191, 102), (191, 103), (191, 104), (191, 105), (192, 49), (192, 51), (192, 52), (192, 53), (192, 54), (192, 55), (192, 56), (192, 57), (192, 58), (192, 59), (192, 60), (192, 61), (192, 62), (192, 66), (192, 80), (192, 86), (192, 87), (192, 88), (192, 89), (192, 90), (192, 91), (192, 92), (192, 93), (192, 94), (192, 95), (192, 96), (193, 50), (193, 52), (193, 53), (193, 54), (193, 55), (193, 56), (193, 57), (193, 58), (193, 59), (193, 60), (193, 61), (193, 64), (193, 80), (193, 82), (193, 83), (193, 84), (193, 85), (193, 86), (194, 50), (194, 52), (194, 53), (194, 54), (194, 55), (194, 56), (194, 57), (194, 58), (194, 59), (194, 62), (195, 50), (195, 52), (195, 53), (195, 54), (195, 55), (195, 56), (195, 57), (195, 60), (196, 51), (196, 53), (196, 54), (196, 58), (196, 59), (197, 51), (197, 56), (197, 57), (198, 51), (198, 53), (198, 54), (199, 51), (246, 54), (246, 57), (247, 54), (247, 58), (247, 59), (248, 54), (248, 56), (248, 57), (248, 61), (249, 54), (249, 56), (249, 57), (249, 58), (249, 59), (249, 63), (250, 53), (250, 55), (250, 56), (250, 57), (250, 58), (250, 59), (250, 60), (250, 61), (250, 62), (250, 65), (251, 53), (251, 55), (251, 56), (251, 57), (251, 58), (251, 59), (251, 60), (251, 61), (251, 62), (251, 63), (251, 67), (252, 53), (252, 55), (252, 56), (252, 57), (252, 58), (252, 59), (252, 60), (252, 61), (252, 62), (252, 63), (252, 64), (252, 65), (252, 68), (252, 69), (252, 84), (252, 86), (252, 87), (252, 88), (252, 89), (252, 90), (252, 91), (252, 92), (252, 93), (252, 94), (252, 95), (252, 96), (252, 97), (252, 98), (252, 99), (252, 100), (252, 101), (252, 102), (252, 103), (252, 104), (252, 105), (252, 106), (252, 107), (252, 108), (252, 109), (252, 110), (252, 111), (252, 112), (252, 113), (252, 114), (252, 115), (252, 116), (252, 118), (253, 52), (253, 54), (253, 55), (253, 56), (253, 57), (253, 58), (253, 59), (253, 60), (253, 61), (253, 62), (253, 63), (253, 64), (253, 65), (253, 66), (253, 67), (253, 70), (253, 86), (253, 119), (254, 52), (254, 59), (254, 60), (254, 61), (254, 62), (254, 63), (254, 64), (254, 65), (254, 66), (254, 67), (254, 68), (254, 69), (254, 72), (254, 88), (254, 91), (254, 92), (254, 93), (254, 94), (254, 95), (254, 96), (254, 97), (254, 98), (254, 99), (254, 100), (254, 101), (254, 102), (254, 103), (254, 104), (254, 105), (254, 106), (254, 107), (254, 108), (254, 109), (254, 110), (254, 111), (254, 112), (254, 113), (254, 114), (254, 115), (254, 116), (254, 117), (254, 118), (254, 121), (255, 52), (255, 54), (255, 55), (255, 56), (255, 57), (255, 60), (255, 61), (255, 62), (255, 63), (255, 64), (255, 65), (255, 66), (255, 67), (255, 68), (255, 69), (255, 70), (255, 73), (255, 89), (255, 93), (255, 94), (255, 95), (255, 96), (255, 97), (255, 98), (255, 99), (255, 100), (255, 101), (255, 102), (255, 103), (255, 104), (255, 105), (255, 106), (255, 107), (255, 108), (255, 109), (255, 110), (255, 111), (255, 112), (255, 113), (255, 114), (255, 115), (255, 116), (255, 117), (255, 118), (255, 119), (255, 121), (256, 51), (256, 59), (256, 62), (256, 63), (256, 64), (256, 65), (256, 66), (256, 67), (256, 68), (256, 69), (256, 70), (256, 71), (256, 72), (256, 75), (256, 91), (256, 95), (256, 96), (256, 97), (256, 98), (256, 99), (256, 100), (256, 101), (256, 102), (256, 103), (256, 104), (256, 105), (256, 106), (256, 107), (256, 108), (256, 109), (256, 110), (256, 111), (256, 112), (256, 113), (256, 114), (256, 115), (256, 116), (256, 117), (256, 118), (256, 119), (256, 120), (256, 122), (257, 60), (257, 63), (257, 64), (257, 65), (257, 66), (257, 67), (257, 68), (257, 69), (257, 70), (257, 71), (257, 72), (257, 73), (257, 76), (257, 93), (257, 97), (257, 98), (257, 99), (257, 100), (257, 101), (257, 102), (257, 103), (257, 104), (257, 105), (257, 106), (257, 107), (257, 108), (257, 109), (257, 110), (257, 111), (257, 112), (257, 113), (257, 114), (257, 115), (257, 116), (257, 117), (257, 118), (257, 119), (257, 120), (257, 122), (258, 62), (258, 64), (258, 65), (258, 66), (258, 67), (258, 68), (258, 69), (258, 70), (258, 71), (258, 72), (258, 73), (258, 74), (258, 75), (258, 78), (258, 95), (258, 99), (258, 100), (258, 101), (258, 102), (258, 103), (258, 104), (258, 105), (258, 106), (258, 107), (258, 108), (258, 109), (258, 110), (258, 111), (258, 112), (258, 113), (258, 114), (258, 115), (258, 116), (258, 117), (258, 118), (258, 119), (258, 120), (258, 121), (258, 123), (259, 63), (259, 65), (259, 66), (259, 67), (259, 68), (259, 69), (259, 70), (259, 71), (259, 72), (259, 73), (259, 74), (259, 75), (259, 76), (259, 79), (259, 97), (259, 101), (259, 102), (259, 103), (259, 104), (259, 105), (259, 106), (259, 107), (259, 108), (259, 109), (259, 110), (259, 111), (259, 112), (259, 113), (259, 114), (259, 115), (259, 116), (259, 117), (259, 118), (259, 119), (259, 120), (259, 121), (259, 122), (259, 123), (260, 64), (260, 67), (260, 68), (260, 69), (260, 70), (260, 71), (260, 72), (260, 73), (260, 74), (260, 75), (260, 76), (260, 77), (260, 78), (260, 81), (260, 99), (260, 103), (260, 104), (260, 105), (260, 106), (260, 107), (260, 108), (260, 109), (260, 110), (260, 111), (260, 112), (260, 113), (260, 114), (260, 115), (260, 116), (260, 117), (260, 118), (260, 119), (260, 120), (260, 121), (260, 122), (260, 124), (261, 65), (261, 68), (261, 69), (261, 70), (261, 71), (261, 72), (261, 73), (261, 74), (261, 75), (261, 76), (261, 77), (261, 78), (261, 79), (261, 82), (261, 101), (261, 104), (261, 105), (261, 106), (261, 107), (261, 108), (261, 109), (261, 110), (261, 111), (261, 112), (261, 113), (261, 114), (261, 115), (261, 116), (261, 117), (261, 118), (261, 119), (261, 120), (261, 121), (261, 122), (261, 123), (261, 125), (262, 67), (262, 69), (262, 70), (262, 71), (262, 72), (262, 73), (262, 74), (262, 75), (262, 76), (262, 77), (262, 78), (262, 79), (262, 80), (262, 81), (262, 83), (262, 103), (262, 106), (262, 107), (262, 108), (262, 109), (262, 110), (262, 111), (262, 112), (262, 113), (262, 114), (262, 115), (262, 116), (262, 117), (262, 118), (262, 119), (262, 120), (262, 121), (262, 122), (262, 123), (262, 124), (262, 126), (263, 68), (263, 70), (263, 71), (263, 72), (263, 73), (263, 74), (263, 75), (263, 76), (263, 77), (263, 78), (263, 79), (263, 80), (263, 81), (263, 82), (263, 85), (263, 105), (263, 108), (263, 109), (263, 110), (263, 111), (263, 112), (263, 113), (263, 114), (263, 115), (263, 116), (263, 117), (263, 118), (263, 119), (263, 120), (263, 121), (263, 122), (263, 123), (263, 124), (263, 126), (264, 69), (264, 72), (264, 73), (264, 74), (264, 75), (264, 76), (264, 77), (264, 78), (264, 79), (264, 80), (264, 81), (264, 82), (264, 83), (264, 86), (264, 106), (264, 107), (264, 110), (264, 111), (264, 112), (264, 113), (264, 114), (264, 115), (264, 116), (264, 117), (264, 118), (264, 119), (264, 120), (264, 121), (264, 122), (264, 123), (264, 124), (264, 125), (264, 127), (265, 70), (265, 73), (265, 74), (265, 75), (265, 76), (265, 77), (265, 78), (265, 79), (265, 80), (265, 81), (265, 82), (265, 83), (265, 84), (265, 85), (265, 88), (265, 108), (265, 110), (265, 111), (265, 112), (265, 113), (265, 114), (265, 115), (265, 116), (265, 117), (265, 118), (265, 119), (265, 120), (265, 121), (265, 122), (265, 123), (265, 124), (265, 125), (265, 126), (265, 128), (266, 71), (266, 74), (266, 75), (266, 76), (266, 77), (266, 78), (266, 79), (266, 80), (266, 81), (266, 82), (266, 83), (266, 84), (266, 85), (266, 86), (266, 89), (266, 110), (266, 112), (266, 113), (266, 114), (266, 115), (266, 116), (266, 117), (266, 118), (266, 119), (266, 120), (266, 121), (266, 122), (266, 123), (266, 124), (266, 125), (266, 126), (266, 127), (266, 129), (267, 73), (267, 75), (267, 76), (267, 77), (267, 78), (267, 79), (267, 80), (267, 81), (267, 82), (267, 83), (267, 84), (267, 85), (267, 86), (267, 87), (267, 88), (267, 91), (267, 110), (267, 112), (267, 113), (267, 114), (267, 115), (267, 116), (267, 117), (267, 118), (267, 119), (267, 120), (267, 121), (267, 122), (267, 123), (267, 124), (267, 125), (267, 126), (267, 127), (267, 128), (267, 130), (268, 74), (268, 76), (268, 77), (268, 78), (268, 79), (268, 80), (268, 81), (268, 82), (268, 83), (268, 84), (268, 85), (268, 86), (268, 87), (268, 88), (268, 89), (268, 93), (268, 107), (268, 108), (268, 109), (268, 110), (268, 111), (268, 112), (268, 113), (268, 114), (268, 115), (268, 116), (268, 117), (268, 118), (268, 119), (268, 120), (268, 121), (268, 122), (268, 123), (268, 124), (268, 125), (268, 126), (268, 127), (268, 128), (268, 130), (269, 75), (269, 78), (269, 79), (269, 80), (269, 81), (269, 82), (269, 83), (269, 84), (269, 85), (269, 86), (269, 87), (269, 88), (269, 89), (269, 90), (269, 91), (269, 94), (269, 97), (269, 98), (269, 99), (269, 100), (269, 101), (269, 102), (269, 103), (269, 104), (269, 105), (269, 106), (269, 110), (269, 111), (269, 112), (269, 113), (269, 114), (269, 115), (269, 116), (269, 117), (269, 118), (269, 119), (269, 120), (269, 121), (269, 122), (269, 123), (269, 124), (269, 125), (269, 126), (269, 127), (269, 128), (269, 129), (269, 131), (270, 76), (270, 79), (270, 80), (270, 81), (270, 82), (270, 83), (270, 84), (270, 85), (270, 86), (270, 87), (270, 88), (270, 89), (270, 90), (270, 91), (270, 92), (270, 93), (270, 96), (270, 106), (270, 107), (270, 108), (270, 109), (270, 110), (270, 111), (270, 112), (270, 113), (270, 114), (270, 115), (270, 116), (270, 117), (270, 118), (270, 119), (270, 120), (270, 121), (270, 122), (270, 123), (270, 124), (270, 125), (270, 126), (270, 127), (270, 128), (270, 129), (270, 130), (270, 132), (271, 77), (271, 80), (271, 81), (271, 82), (271, 83), (271, 84), (271, 85), (271, 86), (271, 87), (271, 88), (271, 89), (271, 90), (271, 91), (271, 92), (271, 93), (271, 94), (271, 95), (271, 97), (271, 98), (271, 99), (271, 100), (271, 101), (271, 102), (271, 103), (271, 104), (271, 105), (271, 106), (271, 107), (271, 108), (271, 109), (271, 110), (271, 111), (271, 112), (271, 113), (271, 114), (271, 115), (271, 116), (271, 117), (271, 118), (271, 119), (271, 120), (271, 121), (271, 122), (271, 123), (271, 124), (271, 125), (271, 126), (271, 127), (271, 128), (271, 129), (271, 130), (271, 131), (271, 133), (272, 79), (272, 81), (272, 82), (272, 83), (272, 84), (272, 85), (272, 86), (272, 87), (272, 88), (272, 89), (272, 90), (272, 91), (272, 92), (272, 93), (272, 94), (272, 95), (272, 96), (272, 97), (272, 98), (272, 99), (272, 100), (272, 101), (272, 102), (272, 103), (272, 104), (272, 105), (272, 106), (272, 107), (272, 108), (272, 109), (272, 110), (272, 111), (272, 112), (272, 113), (272, 114), (272, 115), (272, 116), (272, 117), (272, 118), (272, 119), (272, 120), (272, 121), (272, 122), (272, 123), (272, 124), (272, 125), (272, 126), (272, 127), (272, 128), (272, 129), (272, 130), (272, 131), (272, 132), (272, 134), (273, 80), (273, 82), (273, 83), (273, 84), (273, 85), (273, 86), (273, 87), (273, 88), (273, 89), (273, 90), (273, 91), (273, 92), (273, 93), (273, 94), (273, 95), (273, 96), (273, 97), (273, 98), (273, 99), (273, 100), (273, 101), (273, 102), (273, 103), (273, 104), (273, 105), (273, 106), (273, 107), (273, 108), (273, 109), (273, 110), (273, 111), (273, 112), (273, 113), (273, 114), (273, 115), (273, 116), (273, 117), (273, 118), (273, 119), (273, 120), (273, 121), (273, 122), (273, 123), (273, 124), (273, 125), (273, 126), (273, 127), (273, 128), (273, 129), (273, 130), (273, 131), (273, 132), (273, 133), (273, 135), (274, 81), (274, 83), (274, 84), (274, 85), (274, 86), (274, 87), (274, 88), (274, 89), (274, 90), (274, 91), (274, 92), (274, 93), (274, 94), (274, 95), (274, 96), (274, 97), (274, 98), (274, 99), (274, 100), (274, 101), (274, 102), (274, 103), (274, 104), (274, 105), (274, 106), (274, 107), (274, 108), (274, 109), (274, 110), (274, 111), (274, 112), (274, 113), (274, 114), (274, 115), (274, 116), (274, 117), (274, 118), (274, 119), (274, 120), (274, 121), (274, 122), (274, 123), (274, 124), (274, 125), (274, 126), (274, 127), (274, 128), (274, 129), (274, 130), (274, 131), (274, 132), (274, 133), (274, 136), (275, 82), (275, 85), (275, 86), (275, 87), (275, 88), (275, 89), (275, 90), (275, 91), (275, 92), (275, 93), (275, 94), (275, 95), (275, 96), (275, 97), (275, 98), (275, 99), (275, 100), (275, 101), (275, 102), (275, 103), (275, 104), (275, 105), (275, 106), (275, 107), (275, 108), (275, 109), (275, 110), (275, 111), (275, 112), (275, 113), (275, 114), (275, 115), (275, 116), (275, 117), (275, 118), (275, 119), (275, 120), (275, 121), (275, 122), (275, 123), (275, 124), (275, 125), (275, 126), (275, 127), (275, 128), (275, 129), (275, 130), (275, 131), (275, 132), (275, 133), (275, 134), (276, 83), (276, 86), (276, 87), (276, 88), (276, 89), (276, 90), (276, 91), (276, 92), (276, 93), (276, 94), (276, 95), (276, 96), (276, 97), (276, 98), (276, 99), (276, 100), (276, 101), (276, 102), (276, 103), (276, 104), (276, 105), (276, 106), (276, 107), (276, 108), (276, 109), (276, 110), (276, 111), (276, 112), (276, 113), (276, 114), (276, 115), (276, 116), (276, 117), (276, 118), (276, 119), (276, 120), (276, 121), (276, 122), (276, 123), (276, 124), (276, 125), (276, 126), (276, 127), (276, 128), (276, 129), (276, 130), (276, 131), (276, 132), (276, 133), (276, 134), (276, 135), (276, 137), (277, 84), (277, 87), (277, 88), (277, 89), (277, 90), (277, 91), (277, 92), (277, 93), (277, 94), (277, 95), (277, 96), (277, 97), (277, 98), (277, 99), (277, 100), (277, 101), (277, 102), (277, 103), (277, 104), (277, 105), (277, 106), (277, 107), (277, 108), (277, 109), (277, 110), (277, 111), (277, 112), (277, 113), (277, 114), (277, 115), (277, 116), (277, 117), (277, 118), (277, 119), (277, 120), (277, 121), (277, 122), (277, 123), (277, 124), (277, 125), (277, 126), (277, 127), (277, 128), (277, 129), (277, 130), (277, 131), (277, 132), (277, 133), (277, 134), (277, 135), (277, 136), (277, 138), (278, 86), (278, 88), (278, 89), (278, 90), (278, 91), (278, 92), (278, 93), (278, 94), (278, 95), (278, 96), (278, 97), (278, 98), (278, 99), (278, 100), (278, 101), (278, 102), (278, 103), (278, 104), (278, 105), (278, 106), (278, 107), (278, 108), (278, 109), (278, 110), (278, 111), (278, 112), (278, 113), (278, 114), (278, 115), (278, 116), (278, 117), (278, 118), (278, 119), (278, 120), (278, 121), (278, 122), (278, 123), (278, 124), (278, 125), (278, 126), (278, 127), (278, 128), (278, 129), (278, 130), (278, 131), (278, 132), (278, 133), (278, 134), (278, 135), (278, 136), (278, 137), (278, 139), (279, 87), (279, 89), (279, 90), (279, 91), (279, 92), (279, 93), (279, 94), (279, 95), (279, 96), (279, 97), (279, 98), (279, 99), (279, 100), (279, 101), (279, 102), (279, 103), (279, 104), (279, 105), (279, 106), (279, 107), (279, 108), (279, 109), (279, 110), (279, 111), (279, 112), (279, 113), (279, 114), (279, 115), (279, 116), (279, 117), (279, 118), (279, 119), (279, 120), (279, 121), (279, 122), (279, 123), (279, 124), (279, 125), (279, 126), (279, 127), (279, 128), (279, 129), (279, 130), (279, 131), (279, 132), (279, 133), (279, 134), (279, 135), (279, 136), (279, 137), (279, 138), (279, 140), (280, 88), (280, 90), (280, 91), (280, 92), (280, 93), (280, 94), (280, 95), (280, 96), (280, 97), (280, 98), (280, 99), (280, 100), (280, 101), (280, 102), (280, 103), (280, 104), (280, 105), (280, 106), (280, 107), (280, 108), (280, 109), (280, 110), (280, 111), (280, 112), (280, 113), (280, 114), (280, 115), (280, 116), (280, 117), (280, 118), (280, 119), (280, 120), (280, 121), (280, 122), (280, 123), (280, 124), (280, 125), (280, 126), (280, 127), (280, 128), (280, 129), (280, 130), (280, 131), (280, 132), (280, 133), (280, 134), (280, 135), (280, 136), (280, 137), (280, 138), (280, 139), (280, 141), (281, 89), (281, 92), (281, 93), (281, 94), (281, 95), (281, 96), (281, 97), (281, 98), (281, 99), (281, 100), (281, 101), (281, 102), (281, 103), (281, 104), (281, 105), (281, 106), (281, 107), (281, 108), (281, 109), (281, 110), (281, 111), (281, 112), (281, 113), (281, 114), (281, 115), (281, 116), (281, 117), (281, 118), (281, 119), (281, 120), (281, 121), (281, 122), (281, 123), (281, 124), (281, 125), (281, 126), (281, 127), (281, 128), (281, 129), (281, 130), (281, 131), (281, 132), (281, 133), (281, 134), (281, 135), (281, 136), (281, 137), (281, 138), (281, 139), (281, 140), (281, 142), (282, 90), (282, 93), (282, 94), (282, 95), (282, 96), (282, 97), (282, 98), (282, 99), (282, 100), (282, 101), (282, 102), (282, 103), (282, 104), (282, 105), (282, 106), (282, 107), (282, 108), (282, 109), (282, 110), (282, 111), (282, 112), (282, 113), (282, 114), (282, 115), (282, 116), (282, 117), (282, 118), (282, 119), (282, 120), (282, 121), (282, 122), (282, 123), (282, 124), (282, 125), (282, 126), (282, 127), (282, 128), (282, 129), (282, 130), (282, 131), (282, 132), (282, 133), (282, 134), (282, 135), (282, 136), (282, 137), (282, 138), (282, 139), (282, 140), (282, 141), (282, 143), (283, 91), (283, 94), (283, 95), (283, 96), (283, 97), (283, 98), (283, 99), (283, 100), (283, 101), (283, 102), (283, 103), (283, 104), (283, 105), (283, 106), (283, 107), (283, 108), (283, 109), (283, 110), (283, 111), (283, 112), (283, 113), (283, 114), (283, 115), (283, 116), (283, 117), (283, 118), (283, 119), (283, 120), (283, 121), (283, 122), (283, 123), (283, 124), (283, 125), (283, 126), (283, 127), (283, 128), (283, 129), (283, 130), (283, 131), (283, 132), (283, 133), (283, 134), (283, 135), (283, 136), (283, 137), (283, 138), (283, 139), (283, 140), (283, 141), (283, 142), (283, 145), (284, 95), (284, 96), (284, 97), (284, 98), (284, 99), (284, 100), (284, 101), (284, 102), (284, 103), (284, 104), (284, 105), (284, 106), (284, 107), (284, 108), (284, 109), (284, 110), (284, 111), (284, 112), (284, 113), (284, 114), (284, 115), (284, 116), (284, 117), (284, 118), (284, 119), (284, 120), (284, 121), (284, 122), (284, 123), (284, 124), (284, 125), (284, 126), (284, 127), (284, 128), (284, 129), (284, 130), (284, 131), (284, 132), (284, 133), (284, 134), (284, 135), (284, 136), (284, 137), (284, 138), (284, 139), (284, 140), (284, 141), (284, 142), (284, 143), (284, 146), (285, 94), (285, 96), (285, 97), (285, 98), (285, 99), (285, 100), (285, 101), (285, 102), (285, 103), (285, 104), (285, 105), (285, 106), (285, 107), (285, 108), (285, 109), (285, 110), (285, 111), (285, 112), (285, 113), (285, 114), (285, 115), (285, 116), (285, 117), (285, 118), (285, 119), (285, 120), (285, 121), (285, 122), (285, 123), (285, 124), (285, 125), (285, 126), (285, 127), (285, 128), (285, 129), (285, 130), (285, 131), (285, 132), (285, 133), (285, 134), (285, 135), (285, 136), (285, 137), (285, 138), (285, 139), (285, 140), (285, 141), (285, 142), (285, 143), (285, 144), (285, 146), (286, 95), (286, 97), (286, 98), (286, 99), (286, 100), (286, 101), (286, 102), (286, 103), (286, 104), (286, 105), (286, 106), (286, 107), (286, 108), (286, 109), (286, 110), (286, 111), (286, 112), (286, 113), (286, 114), (286, 115), (286, 116), (286, 117), (286, 118), (286, 119), (286, 120), (286, 121), (286, 122), (286, 123), (286, 124), (286, 125), (286, 126), (286, 127), (286, 128), (286, 129), (286, 130), (286, 131), (286, 132), (286, 133), (286, 134), (286, 135), (286, 136), (286, 137), (286, 138), (286, 139), (286, 140), (286, 141), (286, 142), (286, 143), (286, 145), (287, 96), (287, 98), (287, 99), (287, 100), (287, 101), (287, 102), (287, 103), (287, 104), (287, 105), (287, 106), (287, 107), (287, 108), (287, 109), (287, 110), (287, 111), (287, 112), (287, 113), (287, 114), (287, 115), (287, 116), (287, 117), (287, 118), (287, 119), (287, 120), (287, 121), (287, 122), (287, 123), (287, 124), (287, 125), (287, 126), (287, 127), (287, 128), (287, 129), (287, 130), (287, 131), (287, 132), (287, 133), (287, 134), (287, 135), (287, 136), (287, 137), (287, 138), (287, 139), (287, 140), (287, 141), (287, 142), (287, 143), (287, 145), (288, 97), (288, 99), (288, 100), (288, 101), (288, 102), (288, 103), (288, 104), (288, 105), (288, 106), (288, 107), (288, 108), (288, 109), (288, 110), (288, 111), (288, 112), (288, 113), (288, 114), (288, 115), (288, 116), (288, 117), (288, 118), (288, 119), (288, 120), (288, 121), (288, 122), (288, 123), (288, 124), (288, 125), (288, 126), (288, 127), (288, 128), (288, 129), (288, 130), (288, 131), (288, 132), (288, 133), (288, 134), (288, 135), (288, 136), (288, 137), (288, 138), (288, 139), (288, 140), (288, 141), (288, 142), (288, 144), (289, 98), (289, 100), (289, 101), (289, 102), (289, 103), (289, 104), (289, 105), (289, 106), (289, 107), (289, 108), (289, 109), (289, 110), (289, 111), (289, 112), (289, 113), (289, 114), (289, 115), (289, 116), (289, 117), (289, 118), (289, 119), (289, 120), (289, 121), (289, 122), (289, 123), (289, 124), (289, 125), (289, 126), (289, 127), (289, 128), (289, 129), (289, 130), (289, 131), (289, 132), (289, 133), (289, 134), (289, 135), (289, 136), (289, 137), (289, 138), (289, 139), (289, 140), (289, 141), (290, 99), (290, 102), (290, 103), (290, 104), (290, 105), (290, 106), (290, 107), (290, 108), (290, 109), (290, 110), (290, 111), (290, 112), (290, 113), (290, 114), (290, 115), (290, 116), (290, 117), (290, 118), (290, 119), (290, 120), (290, 121), (290, 122), (290, 123), (290, 124), (290, 125), (290, 126), (290, 127), (290, 128), (290, 129), (290, 130), (290, 131), (290, 132), (290, 133), (290, 134), (290, 135), (290, 136), (290, 137), (290, 138), (290, 139), (290, 140), (290, 143), (291, 100), (291, 103), (291, 104), (291, 105), (291, 106), (291, 107), (291, 108), (291, 109), (291, 110), (291, 111), (291, 112), (291, 113), (291, 114), (291, 115), (291, 116), (291, 117), (291, 118), (291, 119), (291, 120), (291, 121), (291, 122), (291, 123), (291, 124), (291, 125), (291, 126), (291, 127), (291, 128), (291, 129), (291, 130), (291, 131), (291, 132), (291, 133), (291, 134), (291, 135), (291, 136), (291, 137), (291, 138), (291, 139), (291, 141), (292, 102), (292, 104), (292, 105), (292, 106), (292, 107), (292, 108), (292, 109), (292, 110), (292, 111), (292, 112), (292, 113), (292, 114), (292, 115), (292, 116), (292, 117), (292, 118), (292, 119), (292, 120), (292, 121), (292, 122), (292, 123), (292, 124), (292, 125), (292, 126), (292, 127), (292, 128), (292, 129), (292, 130), (292, 131), (292, 132), (292, 133), (292, 134), (292, 135), (292, 136), (292, 137), (292, 140), (293, 103), (293, 105), (293, 106), (293, 107), (293, 108), (293, 109), (293, 110), (293, 111), (293, 112), (293, 113), (293, 114), (293, 115), (293, 116), (293, 117), (293, 118), (293, 119), (293, 120), (293, 121), (293, 122), (293, 123), (293, 124), (293, 125), (293, 126), (293, 127), (293, 128), (293, 129), (293, 130), (293, 131), (293, 132), (293, 133), (293, 134), (293, 135), (293, 138), (293, 139), (294, 104), (294, 107), (294, 108), (294, 109), (294, 110), (294, 111), (294, 112), (294, 113), (294, 114), (294, 115), (294, 116), (294, 117), (294, 118), (294, 119), (294, 120), (294, 121), (294, 122), (294, 123), (294, 124), (294, 125), (294, 126), (294, 127), (294, 128), (294, 129), (294, 130), (294, 131), (294, 132), (294, 133), (294, 137), (295, 105), (295, 108), (295, 109), (295, 110), (295, 111), (295, 112), (295, 113), (295, 114), (295, 115), (295, 116), (295, 117), (295, 118), (295, 119), (295, 120), (295, 121), (295, 122), (295, 123), (295, 124), (295, 125), (295, 126), (295, 127), (295, 128), (295, 129), (295, 130), (295, 135), (296, 106), (296, 109), (296, 110), (296, 111), (296, 112), (296, 113), (296, 114), (296, 115), (296, 116), (296, 117), (296, 118), (296, 119), (296, 120), (296, 121), (296, 122), (296, 123), (296, 124), (296, 125), (296, 126), (296, 131), (296, 132), (297, 108), (297, 113), (297, 114), (297, 115), (297, 116), (297, 117), (297, 118), (297, 119), (297, 120), (297, 121), (297, 127), (297, 128), (297, 129), (297, 130), (298, 109), (298, 111), (298, 112), (298, 122), (298, 123), (298, 124), (298, 125), (298, 126), (299, 113), (299, 114), (299, 115), (299, 116), (299, 117), (299, 118), (299, 119), (299, 120), (299, 121))
coordinates_993300 = ((222, 20), (222, 22), (222, 23), (222, 24), (222, 25), (222, 26), (222, 27), (222, 28), (222, 29), (222, 30), (222, 31), (222, 32), (222, 33), (222, 34), (222, 35), (222, 36), (222, 37), (222, 38), (222, 39), (222, 40), (222, 41), (222, 42), (222, 43), (222, 44), (222, 45), (222, 46), (222, 47), (222, 48), (222, 49), (222, 50), (222, 51), (222, 52), (222, 53), (222, 55), (222, 73), (222, 75), (222, 76), (222, 77), (222, 78), (222, 79), (222, 80), (222, 81), (222, 82), (222, 83), (222, 84), (222, 85), (222, 86), (222, 87), (222, 88), (222, 89), (222, 90), (222, 91), (222, 92), (222, 93), (222, 94), (222, 95), (222, 96), (222, 97), (222, 98), (222, 99), (222, 100), (222, 101), (222, 102), (222, 103), (222, 104), (222, 105), (222, 106), (222, 107), (222, 108), (222, 109), (222, 110), (222, 111), (222, 112), (222, 113), (222, 114), (222, 115), (222, 116), (222, 117), (222, 118), (222, 119), (222, 120), (222, 121), (222, 122), (222, 123), (222, 124), (222, 125), (222, 126), (222, 127), (222, 128), (222, 129), (222, 130), (222, 131), (222, 132), (222, 133), (222, 134), (222, 135), (222, 136), (222, 137), (222, 138), (222, 139), (222, 140), (222, 141), (222, 142), (222, 143), (222, 144), (222, 145), (222, 146), (222, 147), (222, 148), (222, 149), (222, 150), (222, 151), (222, 152), (222, 153), (222, 154), (222, 155), (222, 156), (222, 158), (223, 20), (223, 22), (223, 23), (223, 24), (223, 25), (223, 26), (223, 27), (223, 28), (223, 29), (223, 30), (223, 31), (223, 32), (223, 33), (223, 34), (223, 35), (223, 36), (223, 37), (223, 38), (223, 39), (223, 40), (223, 41), (223, 42), (223, 43), (223, 44), (223, 45), (223, 46), (223, 47), (223, 48), (223, 49), (223, 50), (223, 51), (223, 52), (223, 53), (223, 55), (223, 73), (223, 75), (223, 76), (223, 77), (223, 78), (223, 79), (223, 80), (223, 81), (223, 82), (223, 83), (223, 84), (223, 85), (223, 86), (223, 87), (223, 88), (223, 89), (223, 90), (223, 91), (223, 92), (223, 93), (223, 94), (223, 95), (223, 96), (223, 97), (223, 98), (223, 99), (223, 100), (223, 101), (223, 102), (223, 103), (223, 104), (223, 105), (223, 106), (223, 107), (223, 108), (223, 109), (223, 110), (223, 111), (223, 112), (223, 113), (223, 114), (223, 115), (223, 116), (223, 117), (223, 118), (223, 119), (223, 120), (223, 121), (223, 122), (223, 123), (223, 124), (223, 125), (223, 126), (223, 127), (223, 128), (223, 129), (223, 130), (223, 131), (223, 132), (223, 133), (223, 134), (223, 135), (223, 136), (223, 137), (223, 138), (223, 139), (223, 140), (223, 141), (223, 142), (223, 143), (223, 144), (223, 145), (223, 146), (223, 147), (223, 148), (223, 149), (223, 150), (223, 151), (223, 152), (223, 153), (223, 154), (223, 155), (223, 156), (223, 158))
coordinates_ffff7_f = ((192, 109), (192, 110), (192, 111), (192, 112), (192, 113), (192, 114), (192, 115), (192, 116), (192, 117), (192, 118), (192, 119), (192, 120), (192, 121), (193, 99), (193, 100), (193, 101), (193, 102), (193, 103), (193, 104), (193, 105), (193, 106), (193, 107), (193, 108), (193, 122), (193, 123), (193, 124), (193, 125), (194, 90), (194, 91), (194, 92), (194, 93), (194, 94), (194, 95), (194, 96), (194, 97), (194, 98), (194, 99), (194, 109), (194, 110), (194, 111), (194, 112), (194, 113), (194, 114), (194, 115), (194, 116), (194, 117), (194, 118), (194, 119), (194, 120), (194, 121), (194, 126), (194, 128), (195, 80), (195, 82), (195, 83), (195, 84), (195, 85), (195, 86), (195, 87), (195, 88), (195, 89), (195, 99), (195, 100), (195, 101), (195, 102), (195, 103), (195, 104), (195, 105), (195, 106), (195, 107), (195, 108), (195, 109), (195, 110), (195, 111), (195, 112), (195, 113), (195, 114), (195, 115), (195, 116), (195, 117), (195, 118), (195, 119), (195, 120), (195, 121), (195, 122), (195, 123), (195, 124), (195, 125), (195, 129), (195, 130), (195, 131), (196, 80), (196, 90), (196, 91), (196, 92), (196, 93), (196, 94), (196, 95), (196, 96), (196, 97), (196, 98), (196, 99), (196, 100), (196, 101), (196, 102), (196, 103), (196, 104), (196, 105), (196, 106), (196, 107), (196, 108), (196, 109), (196, 110), (196, 111), (196, 112), (196, 113), (196, 114), (196, 115), (196, 116), (196, 117), (196, 118), (196, 119), (196, 120), (196, 121), (196, 122), (196, 123), (196, 124), (196, 125), (196, 126), (196, 127), (196, 128), (196, 132), (196, 133), (196, 134), (197, 80), (197, 82), (197, 83), (197, 84), (197, 85), (197, 86), (197, 87), (197, 88), (197, 89), (197, 90), (197, 91), (197, 92), (197, 93), (197, 94), (197, 95), (197, 96), (197, 97), (197, 98), (197, 99), (197, 100), (197, 101), (197, 102), (197, 103), (197, 104), (197, 105), (197, 106), (197, 107), (197, 108), (197, 109), (197, 110), (197, 111), (197, 112), (197, 113), (197, 114), (197, 115), (197, 116), (197, 117), (197, 118), (197, 119), (197, 120), (197, 121), (197, 122), (197, 123), (197, 124), (197, 125), (197, 126), (197, 127), (197, 128), (197, 129), (197, 130), (197, 131), (197, 136), (197, 137), (198, 81), (198, 84), (198, 85), (198, 86), (198, 87), (198, 88), (198, 89), (198, 90), (198, 91), (198, 92), (198, 93), (198, 94), (198, 95), (198, 96), (198, 97), (198, 98), (198, 99), (198, 100), (198, 101), (198, 102), (198, 103), (198, 104), (198, 105), (198, 106), (198, 107), (198, 108), (198, 109), (198, 110), (198, 111), (198, 112), (198, 113), (198, 114), (198, 115), (198, 116), (198, 117), (198, 118), (198, 119), (198, 120), (198, 121), (198, 122), (198, 123), (198, 124), (198, 125), (198, 126), (198, 127), (198, 128), (198, 129), (198, 130), (198, 131), (198, 132), (198, 133), (198, 134), (198, 135), (198, 139), (198, 140), (199, 82), (199, 86), (199, 87), (199, 88), (199, 89), (199, 90), (199, 91), (199, 92), (199, 93), (199, 94), (199, 95), (199, 96), (199, 97), (199, 98), (199, 99), (199, 100), (199, 101), (199, 102), (199, 103), (199, 104), (199, 105), (199, 106), (199, 107), (199, 108), (199, 109), (199, 110), (199, 111), (199, 112), (199, 113), (199, 114), (199, 115), (199, 116), (199, 117), (199, 118), (199, 119), (199, 120), (199, 121), (199, 122), (199, 123), (199, 124), (199, 125), (199, 126), (199, 127), (199, 128), (199, 129), (199, 130), (199, 131), (199, 132), (199, 133), (199, 134), (199, 135), (199, 136), (199, 137), (199, 138), (199, 143), (200, 84), (200, 91), (200, 92), (200, 93), (200, 94), (200, 95), (200, 96), (200, 97), (200, 98), (200, 99), (200, 100), (200, 101), (200, 102), (200, 103), (200, 104), (200, 105), (200, 106), (200, 107), (200, 108), (200, 109), (200, 110), (200, 111), (200, 112), (200, 113), (200, 114), (200, 115), (200, 116), (200, 117), (200, 118), (200, 119), (200, 120), (200, 121), (200, 122), (200, 123), (200, 124), (200, 125), (200, 126), (200, 127), (200, 128), (200, 129), (200, 130), (200, 131), (200, 132), (200, 133), (200, 134), (200, 135), (200, 136), (200, 137), (200, 138), (200, 139), (200, 140), (200, 144), (200, 145), (200, 146), (201, 87), (201, 88), (201, 89), (201, 90), (201, 99), (201, 100), (201, 101), (201, 102), (201, 103), (201, 104), (201, 105), (201, 106), (201, 107), (201, 108), (201, 109), (201, 110), (201, 111), (201, 112), (201, 113), (201, 114), (201, 115), (201, 116), (201, 117), (201, 118), (201, 119), (201, 120), (201, 121), (201, 122), (201, 123), (201, 124), (201, 125), (201, 126), (201, 127), (201, 128), (201, 129), (201, 130), (201, 131), (201, 132), (201, 133), (201, 134), (201, 135), (201, 136), (201, 137), (201, 138), (201, 139), (201, 140), (201, 141), (201, 142), (201, 143), (201, 148), (202, 91), (202, 92), (202, 93), (202, 94), (202, 95), (202, 96), (202, 97), (202, 98), (202, 104), (202, 105), (202, 106), (202, 107), (202, 108), (202, 109), (202, 110), (202, 111), (202, 112), (202, 113), (202, 114), (202, 115), (202, 116), (202, 117), (202, 118), (202, 119), (202, 120), (202, 121), (202, 122), (202, 123), (202, 124), (202, 125), (202, 126), (202, 127), (202, 128), (202, 129), (202, 130), (202, 131), (202, 132), (202, 133), (202, 134), (202, 135), (202, 136), (202, 137), (202, 138), (202, 139), (202, 140), (202, 141), (202, 142), (202, 143), (202, 144), (202, 145), (202, 146), (202, 149), (203, 99), (203, 100), (203, 101), (203, 102), (203, 103), (203, 104), (203, 105), (203, 106), (203, 107), (203, 108), (203, 109), (203, 110), (203, 111), (203, 112), (203, 113), (203, 114), (203, 115), (203, 116), (203, 117), (203, 118), (203, 119), (203, 120), (203, 121), (203, 122), (203, 123), (203, 124), (203, 125), (203, 126), (203, 127), (203, 128), (203, 129), (203, 130), (203, 131), (203, 132), (203, 133), (203, 134), (203, 135), (203, 136), (203, 137), (203, 138), (203, 139), (203, 140), (203, 141), (203, 142), (203, 143), (203, 144), (203, 145), (203, 146), (203, 147), (203, 148), (203, 150), (204, 51), (204, 53), (204, 54), (204, 55), (204, 56), (204, 57), (204, 58), (204, 59), (204, 104), (204, 105), (204, 106), (204, 107), (204, 108), (204, 109), (204, 110), (204, 111), (204, 112), (204, 113), (204, 114), (204, 115), (204, 116), (204, 117), (204, 118), (204, 119), (204, 120), (204, 121), (204, 122), (204, 123), (204, 124), (204, 125), (204, 126), (204, 127), (204, 128), (204, 129), (204, 130), (204, 131), (204, 132), (204, 133), (204, 134), (204, 135), (204, 136), (204, 137), (204, 138), (204, 139), (204, 140), (204, 141), (204, 142), (204, 143), (204, 144), (204, 145), (204, 146), (204, 147), (204, 148), (204, 150), (205, 51), (205, 59), (205, 60), (205, 61), (205, 62), (205, 63), (205, 64), (205, 65), (205, 66), (205, 67), (205, 68), (205, 69), (205, 70), (205, 71), (205, 104), (205, 106), (205, 107), (205, 108), (205, 109), (205, 110), (205, 111), (205, 112), (205, 113), (205, 114), (205, 115), (205, 116), (205, 117), (205, 118), (205, 119), (205, 120), (205, 121), (205, 122), (205, 123), (205, 124), (205, 125), (205, 126), (205, 127), (205, 128), (205, 129), (205, 130), (205, 131), (205, 132), (205, 133), (205, 134), (205, 135), (205, 136), (205, 137), (205, 138), (205, 139), (205, 140), (205, 141), (205, 142), (205, 143), (205, 144), (205, 145), (205, 146), (205, 147), (205, 148), (205, 150), (206, 51), (206, 53), (206, 54), (206, 55), (206, 56), (206, 57), (206, 58), (206, 59), (206, 72), (206, 73), (206, 74), (206, 75), (206, 76), (206, 77), (206, 78), (206, 79), (206, 80), (206, 104), (206, 106), (206, 107), (206, 108), (206, 109), (206, 110), (206, 111), (206, 112), (206, 113), (206, 114), (206, 115), (206, 116), (206, 117), (206, 118), (206, 119), (206, 120), (206, 121), (206, 122), (206, 123), (206, 124), (206, 125), (206, 126), (206, 127), (206, 128), (206, 129), (206, 130), (206, 131), (206, 132), (206, 133), (206, 134), (206, 135), (206, 136), (206, 137), (206, 138), (206, 139), (206, 140), (206, 141), (206, 142), (206, 143), (206, 144), (206, 145), (206, 146), (206, 147), (206, 148), (206, 149), (206, 151), (207, 50), (207, 52), (207, 53), (207, 54), (207, 55), (207, 56), (207, 57), (207, 58), (207, 59), (207, 60), (207, 61), (207, 62), (207, 63), (207, 64), (207, 65), (207, 66), (207, 67), (207, 68), (207, 69), (207, 70), (207, 71), (207, 81), (207, 82), (207, 83), (207, 103), (207, 105), (207, 106), (207, 107), (207, 108), (207, 109), (207, 110), (207, 111), (207, 112), (207, 113), (207, 114), (207, 115), (207, 116), (207, 117), (207, 118), (207, 119), (207, 120), (207, 121), (207, 122), (207, 123), (207, 124), (207, 125), (207, 126), (207, 127), (207, 128), (207, 129), (207, 130), (207, 131), (207, 132), (207, 133), (207, 134), (207, 135), (207, 136), (207, 137), (207, 138), (207, 139), (207, 140), (207, 141), (207, 142), (207, 143), (207, 144), (207, 145), (207, 146), (207, 147), (207, 148), (207, 149), (207, 151), (208, 50), (208, 52), (208, 53), (208, 54), (208, 55), (208, 56), (208, 57), (208, 58), (208, 59), (208, 60), (208, 61), (208, 62), (208, 63), (208, 64), (208, 65), (208, 66), (208, 67), (208, 68), (208, 69), (208, 70), (208, 71), (208, 72), (208, 73), (208, 74), (208, 75), (208, 76), (208, 77), (208, 78), (208, 79), (208, 80), (208, 85), (208, 86), (208, 102), (208, 104), (208, 105), (208, 106), (208, 107), (208, 108), (208, 109), (208, 110), (208, 111), (208, 112), (208, 113), (208, 114), (208, 115), (208, 116), (208, 117), (208, 118), (208, 119), (208, 120), (208, 121), (208, 122), (208, 123), (208, 124), (208, 125), (208, 126), (208, 127), (208, 128), (208, 129), (208, 130), (208, 131), (208, 132), (208, 133), (208, 134), (208, 135), (208, 136), (208, 137), (208, 138), (208, 139), (208, 140), (208, 141), (208, 142), (208, 143), (208, 144), (208, 145), (208, 146), (208, 147), (208, 148), (208, 149), (208, 151), (209, 49), (209, 51), (209, 52), (209, 53), (209, 54), (209, 55), (209, 56), (209, 57), (209, 58), (209, 59), (209, 60), (209, 61), (209, 62), (209, 63), (209, 64), (209, 65), (209, 66), (209, 67), (209, 68), (209, 69), (209, 70), (209, 71), (209, 72), (209, 73), (209, 74), (209, 75), (209, 76), (209, 77), (209, 78), (209, 79), (209, 80), (209, 81), (209, 82), (209, 83), (209, 84), (209, 87), (209, 88), (209, 100), (209, 101), (209, 103), (209, 104), (209, 105), (209, 106), (209, 107), (209, 108), (209, 109), (209, 110), (209, 111), (209, 112), (209, 113), (209, 114), (209, 115), (209, 116), (209, 117), (209, 118), (209, 119), (209, 120), (209, 121), (209, 122), (209, 123), (209, 124), (209, 125), (209, 126), (209, 127), (209, 128), (209, 129), (209, 130), (209, 131), (209, 132), (209, 133), (209, 134), (209, 135), (209, 136), (209, 137), (209, 138), (209, 139), (209, 140), (209, 141), (209, 142), (209, 143), (209, 144), (209, 145), (209, 146), (209, 147), (209, 148), (209, 149), (209, 150), (209, 152), (210, 48), (210, 50), (210, 51), (210, 52), (210, 53), (210, 54), (210, 55), (210, 56), (210, 57), (210, 58), (210, 59), (210, 60), (210, 61), (210, 62), (210, 63), (210, 64), (210, 65), (210, 66), (210, 67), (210, 68), (210, 69), (210, 70), (210, 71), (210, 72), (210, 73), (210, 74), (210, 75), (210, 76), (210, 77), (210, 78), (210, 79), (210, 80), (210, 81), (210, 82), (210, 83), (210, 84), (210, 85), (210, 86), (210, 89), (210, 90), (210, 91), (210, 92), (210, 93), (210, 94), (210, 95), (210, 96), (210, 97), (210, 98), (210, 99), (210, 102), (210, 103), (210, 104), (210, 105), (210, 106), (210, 107), (210, 108), (210, 109), (210, 110), (210, 111), (210, 112), (210, 113), (210, 114), (210, 115), (210, 116), (210, 117), (210, 118), (210, 119), (210, 120), (210, 121), (210, 122), (210, 123), (210, 124), (210, 125), (210, 126), (210, 127), (210, 128), (210, 129), (210, 130), (210, 131), (210, 132), (210, 133), (210, 134), (210, 135), (210, 136), (210, 137), (210, 138), (210, 139), (210, 140), (210, 141), (210, 142), (210, 143), (210, 144), (210, 145), (210, 146), (210, 147), (210, 148), (210, 149), (210, 150), (210, 152), (211, 47), (211, 49), (211, 50), (211, 51), (211, 52), (211, 53), (211, 54), (211, 55), (211, 56), (211, 57), (211, 58), (211, 59), (211, 60), (211, 61), (211, 62), (211, 63), (211, 64), (211, 65), (211, 66), (211, 67), (211, 68), (211, 69), (211, 70), (211, 71), (211, 72), (211, 73), (211, 74), (211, 75), (211, 76), (211, 77), (211, 78), (211, 79), (211, 80), (211, 81), (211, 82), (211, 83), (211, 84), (211, 85), (211, 86), (211, 87), (211, 88), (211, 99), (211, 100), (211, 101), (211, 102), (211, 103), (211, 104), (211, 105), (211, 106), (211, 107), (211, 108), (211, 109), (211, 110), (211, 111), (211, 112), (211, 113), (211, 114), (211, 115), (211, 116), (211, 117), (211, 118), (211, 119), (211, 120), (211, 121), (211, 122), (211, 123), (211, 124), (211, 125), (211, 126), (211, 127), (211, 128), (211, 129), (211, 130), (211, 131), (211, 132), (211, 133), (211, 134), (211, 135), (211, 136), (211, 137), (211, 138), (211, 139), (211, 140), (211, 141), (211, 142), (211, 143), (211, 144), (211, 145), (211, 146), (211, 147), (211, 148), (211, 149), (211, 150), (211, 151), (211, 153), (212, 46), (212, 48), (212, 49), (212, 50), (212, 51), (212, 52), (212, 53), (212, 54), (212, 55), (212, 56), (212, 57), (212, 58), (212, 59), (212, 60), (212, 61), (212, 62), (212, 63), (212, 64), (212, 65), (212, 66), (212, 67), (212, 68), (212, 69), (212, 70), (212, 71), (212, 72), (212, 73), (212, 74), (212, 75), (212, 76), (212, 77), (212, 78), (212, 79), (212, 80), (212, 81), (212, 82), (212, 83), (212, 84), (212, 85), (212, 86), (212, 87), (212, 88), (212, 89), (212, 90), (212, 91), (212, 92), (212, 93), (212, 94), (212, 95), (212, 96), (212, 97), (212, 98), (212, 99), (212, 100), (212, 101), (212, 102), (212, 103), (212, 104), (212, 105), (212, 106), (212, 107), (212, 108), (212, 109), (212, 110), (212, 111), (212, 112), (212, 113), (212, 114), (212, 115), (212, 116), (212, 117), (212, 118), (212, 119), (212, 120), (212, 121), (212, 122), (212, 123), (212, 124), (212, 125), (212, 126), (212, 127), (212, 128), (212, 129), (212, 130), (212, 131), (212, 132), (212, 133), (212, 134), (212, 135), (212, 136), (212, 137), (212, 138), (212, 139), (212, 140), (212, 141), (212, 142), (212, 143), (212, 144), (212, 145), (212, 146), (212, 147), (212, 148), (212, 149), (212, 150), (212, 151), (212, 153), (213, 45), (213, 47), (213, 48), (213, 49), (213, 50), (213, 51), (213, 52), (213, 53), (213, 54), (213, 55), (213, 56), (213, 57), (213, 58), (213, 59), (213, 60), (213, 61), (213, 62), (213, 63), (213, 64), (213, 65), (213, 66), (213, 67), (213, 68), (213, 69), (213, 70), (213, 71), (213, 72), (213, 73), (213, 74), (213, 75), (213, 76), (213, 77), (213, 78), (213, 79), (213, 80), (213, 81), (213, 82), (213, 83), (213, 84), (213, 85), (213, 86), (213, 87), (213, 88), (213, 89), (213, 90), (213, 91), (213, 92), (213, 93), (213, 94), (213, 95), (213, 96), (213, 97), (213, 98), (213, 99), (213, 100), (213, 101), (213, 102), (213, 103), (213, 104), (213, 105), (213, 106), (213, 107), (213, 108), (213, 109), (213, 110), (213, 111), (213, 112), (213, 113), (213, 114), (213, 115), (213, 116), (213, 117), (213, 118), (213, 119), (213, 120), (213, 121), (213, 122), (213, 123), (213, 124), (213, 125), (213, 126), (213, 127), (213, 128), (213, 129), (213, 130), (213, 131), (213, 132), (213, 133), (213, 134), (213, 135), (213, 136), (213, 137), (213, 138), (213, 139), (213, 140), (213, 141), (213, 142), (213, 143), (213, 144), (213, 145), (213, 146), (213, 147), (213, 148), (213, 149), (213, 150), (213, 151), (213, 152), (213, 154), (214, 43), (214, 46), (214, 47), (214, 48), (214, 49), (214, 50), (214, 51), (214, 52), (214, 53), (214, 54), (214, 55), (214, 56), (214, 57), (214, 58), (214, 59), (214, 60), (214, 61), (214, 62), (214, 63), (214, 64), (214, 65), (214, 66), (214, 67), (214, 68), (214, 69), (214, 70), (214, 71), (214, 72), (214, 73), (214, 74), (214, 75), (214, 76), (214, 77), (214, 78), (214, 79), (214, 80), (214, 81), (214, 82), (214, 83), (214, 84), (214, 85), (214, 86), (214, 87), (214, 88), (214, 89), (214, 90), (214, 91), (214, 92), (214, 93), (214, 94), (214, 95), (214, 96), (214, 97), (214, 98), (214, 99), (214, 100), (214, 101), (214, 102), (214, 103), (214, 104), (214, 105), (214, 106), (214, 107), (214, 108), (214, 109), (214, 110), (214, 111), (214, 112), (214, 113), (214, 114), (214, 115), (214, 116), (214, 117), (214, 118), (214, 119), (214, 120), (214, 121), (214, 122), (214, 123), (214, 124), (214, 125), (214, 126), (214, 127), (214, 128), (214, 129), (214, 130), (214, 131), (214, 132), (214, 133), (214, 134), (214, 135), (214, 136), (214, 137), (214, 138), (214, 139), (214, 140), (214, 141), (214, 142), (214, 143), (214, 144), (214, 145), (214, 146), (214, 147), (214, 148), (214, 149), (214, 150), (214, 151), (214, 152), (214, 154), (215, 42), (215, 45), (215, 46), (215, 47), (215, 48), (215, 49), (215, 50), (215, 51), (215, 52), (215, 53), (215, 54), (215, 55), (215, 56), (215, 57), (215, 58), (215, 59), (215, 60), (215, 61), (215, 62), (215, 63), (215, 64), (215, 65), (215, 66), (215, 67), (215, 68), (215, 69), (215, 70), (215, 71), (215, 72), (215, 73), (215, 74), (215, 75), (215, 76), (215, 77), (215, 78), (215, 79), (215, 80), (215, 81), (215, 82), (215, 83), (215, 84), (215, 85), (215, 86), (215, 87), (215, 88), (215, 89), (215, 90), (215, 91), (215, 92), (215, 93), (215, 94), (215, 95), (215, 96), (215, 97), (215, 98), (215, 99), (215, 100), (215, 101), (215, 102), (215, 103), (215, 104), (215, 105), (215, 106), (215, 107), (215, 108), (215, 109), (215, 110), (215, 111), (215, 112), (215, 113), (215, 114), (215, 115), (215, 116), (215, 117), (215, 118), (215, 119), (215, 120), (215, 121), (215, 122), (215, 123), (215, 124), (215, 125), (215, 126), (215, 127), (215, 128), (215, 129), (215, 130), (215, 131), (215, 132), (215, 133), (215, 134), (215, 135), (215, 136), (215, 137), (215, 138), (215, 139), (215, 140), (215, 141), (215, 142), (215, 143), (215, 144), (215, 145), (215, 146), (215, 147), (215, 148), (215, 149), (215, 150), (215, 151), (215, 152), (215, 153), (215, 155), (216, 41), (216, 44), (216, 45), (216, 46), (216, 47), (216, 48), (216, 49), (216, 50), (216, 51), (216, 52), (216, 53), (216, 54), (216, 55), (216, 56), (216, 57), (216, 58), (216, 59), (216, 60), (216, 61), (216, 62), (216, 63), (216, 69), (216, 72), (216, 73), (216, 74), (216, 75), (216, 76), (216, 77), (216, 78), (216, 79), (216, 80), (216, 81), (216, 82), (216, 83), (216, 84), (216, 85), (216, 86), (216, 87), (216, 88), (216, 89), (216, 90), (216, 91), (216, 92), (216, 93), (216, 94), (216, 95), (216, 96), (216, 97), (216, 98), (216, 99), (216, 100), (216, 101), (216, 102), (216, 103), (216, 104), (216, 105), (216, 106), (216, 107), (216, 108), (216, 109), (216, 110), (216, 111), (216, 112), (216, 113), (216, 114), (216, 115), (216, 116), (216, 117), (216, 118), (216, 119), (216, 120), (216, 121), (216, 122), (216, 123), (216, 124), (216, 125), (216, 126), (216, 127), (216, 128), (216, 129), (216, 130), (216, 131), (216, 132), (216, 133), (216, 134), (216, 135), (216, 136), (216, 137), (216, 138), (216, 139), (216, 140), (216, 141), (216, 142), (216, 143), (216, 144), (216, 145), (216, 146), (216, 147), (216, 148), (216, 149), (216, 150), (216, 151), (216, 152), (216, 153), (216, 155), (217, 40), (217, 42), (217, 43), (217, 44), (217, 45), (217, 46), (217, 47), (217, 48), (217, 49), (217, 50), (217, 51), (217, 52), (217, 53), (217, 54), (217, 55), (217, 56), (217, 57), (217, 58), (217, 59), (217, 60), (217, 64), (217, 65), (217, 66), (217, 67), (217, 68), (217, 69), (217, 70), (217, 71), (217, 73), (217, 74), (217, 75), (217, 76), (217, 77), (217, 78), (217, 79), (217, 80), (217, 81), (217, 82), (217, 83), (217, 84), (217, 85), (217, 86), (217, 87), (217, 88), (217, 89), (217, 90), (217, 91), (217, 92), (217, 93), (217, 94), (217, 95), (217, 96), (217, 97), (217, 98), (217, 99), (217, 100), (217, 101), (217, 102), (217, 103), (217, 104), (217, 105), (217, 106), (217, 107), (217, 108), (217, 109), (217, 110), (217, 111), (217, 112), (217, 113), (217, 114), (217, 115), (217, 116), (217, 117), (217, 118), (217, 119), (217, 120), (217, 121), (217, 122), (217, 123), (217, 124), (217, 125), (217, 126), (217, 127), (217, 128), (217, 129), (217, 130), (217, 131), (217, 132), (217, 133), (217, 134), (217, 135), (217, 136), (217, 137), (217, 138), (217, 139), (217, 140), (217, 141), (217, 142), (217, 143), (217, 144), (217, 145), (217, 146), (217, 147), (217, 148), (217, 149), (217, 150), (217, 151), (217, 152), (217, 153), (217, 154), (217, 156), (218, 40), (218, 42), (218, 43), (218, 44), (218, 45), (218, 46), (218, 47), (218, 48), (218, 49), (218, 50), (218, 51), (218, 52), (218, 53), (218, 54), (218, 55), (218, 56), (218, 57), (218, 61), (218, 62), (218, 63), (218, 72), (218, 74), (218, 75), (218, 76), (218, 77), (218, 78), (218, 79), (218, 80), (218, 81), (218, 82), (218, 83), (218, 84), (218, 85), (218, 86), (218, 87), (218, 88), (218, 89), (218, 90), (218, 91), (218, 92), (218, 93), (218, 94), (218, 95), (218, 96), (218, 97), (218, 98), (218, 99), (218, 100), (218, 101), (218, 102), (218, 103), (218, 104), (218, 105), (218, 106), (218, 107), (218, 108), (218, 109), (218, 110), (218, 111), (218, 112), (218, 113), (218, 114), (218, 115), (218, 116), (218, 117), (218, 118), (218, 119), (218, 120), (218, 121), (218, 122), (218, 123), (218, 124), (218, 125), (218, 126), (218, 127), (218, 128), (218, 129), (218, 130), (218, 131), (218, 132), (218, 133), (218, 134), (218, 135), (218, 136), (218, 137), (218, 138), (218, 139), (218, 140), (218, 141), (218, 142), (218, 143), (218, 144), (218, 145), (218, 146), (218, 147), (218, 148), (218, 149), (218, 150), (218, 151), (218, 152), (218, 153), (218, 154), (218, 155), (219, 39), (219, 58), (219, 60), (219, 73), (219, 158), (220, 39), (220, 41), (220, 42), (220, 43), (220, 44), (220, 45), (220, 46), (220, 47), (220, 48), (220, 49), (220, 50), (220, 51), (220, 52), (220, 53), (220, 54), (220, 55), (220, 56), (220, 57), (220, 73), (220, 75), (220, 76), (220, 77), (220, 78), (220, 79), (220, 80), (220, 81), (220, 82), (220, 83), (220, 84), (220, 85), (220, 86), (220, 87), (220, 88), (220, 89), (220, 90), (220, 91), (220, 92), (220, 93), (220, 94), (220, 95), (220, 96), (220, 97), (220, 98), (220, 99), (220, 100), (220, 101), (220, 102), (220, 103), (220, 104), (220, 105), (220, 106), (220, 107), (220, 108), (220, 109), (220, 110), (220, 111), (220, 112), (220, 113), (220, 114), (220, 115), (220, 116), (220, 117), (220, 118), (220, 119), (220, 120), (220, 121), (220, 122), (220, 123), (220, 124), (220, 125), (220, 126), (220, 127), (220, 128), (220, 129), (220, 130), (220, 131), (220, 132), (220, 133), (220, 134), (220, 135), (220, 136), (220, 137), (220, 138), (220, 139), (220, 140), (220, 141), (220, 142), (220, 143), (220, 144), (220, 145), (220, 146), (220, 147), (220, 148), (220, 149), (220, 150), (220, 151), (220, 152), (220, 153), (220, 154), (220, 155), (220, 156), (220, 158), (225, 43), (225, 45), (225, 46), (225, 47), (225, 48), (225, 49), (225, 50), (225, 51), (225, 52), (225, 53), (225, 54), (225, 55), (225, 56), (225, 58), (225, 72), (225, 74), (225, 75), (225, 76), (225, 77), (225, 78), (225, 79), (225, 80), (225, 81), (225, 82), (225, 83), (225, 84), (225, 85), (225, 86), (225, 87), (225, 88), (225, 89), (225, 90), (225, 91), (225, 92), (225, 93), (225, 94), (225, 95), (225, 96), (225, 97), (225, 98), (225, 99), (225, 100), (225, 101), (225, 102), (225, 103), (225, 104), (225, 105), (225, 106), (225, 107), (225, 108), (225, 109), (225, 110), (225, 111), (225, 112), (225, 113), (225, 114), (225, 115), (225, 116), (225, 117), (225, 118), (225, 119), (225, 120), (225, 121), (225, 122), (225, 123), (225, 124), (225, 125), (225, 126), (225, 127), (225, 128), (225, 129), (225, 130), (225, 131), (225, 132), (225, 133), (225, 134), (225, 135), (225, 136), (225, 137), (225, 138), (225, 139), (225, 140), (225, 141), (225, 142), (225, 143), (225, 144), (225, 145), (225, 146), (225, 147), (225, 148), (225, 149), (225, 150), (225, 151), (225, 152), (225, 153), (225, 154), (225, 155), (225, 156), (225, 158), (226, 44), (226, 60), (226, 70), (226, 158), (227, 45), (227, 48), (227, 49), (227, 50), (227, 51), (227, 52), (227, 53), (227, 54), (227, 55), (227, 56), (227, 57), (227, 58), (227, 61), (227, 69), (227, 72), (227, 73), (227, 74), (227, 75), (227, 76), (227, 77), (227, 78), (227, 79), (227, 80), (227, 81), (227, 82), (227, 83), (227, 84), (227, 85), (227, 86), (227, 87), (227, 88), (227, 89), (227, 90), (227, 91), (227, 92), (227, 93), (227, 94), (227, 95), (227, 96), (227, 97), (227, 98), (227, 99), (227, 100), (227, 101), (227, 102), (227, 103), (227, 104), (227, 105), (227, 106), (227, 107), (227, 108), (227, 109), (227, 110), (227, 111), (227, 112), (227, 113), (227, 114), (227, 115), (227, 116), (227, 117), (227, 118), (227, 119), (227, 120), (227, 121), (227, 122), (227, 123), (227, 124), (227, 125), (227, 126), (227, 127), (227, 128), (227, 129), (227, 130), (227, 131), (227, 132), (227, 133), (227, 134), (227, 135), (227, 136), (227, 137), (227, 138), (227, 139), (227, 140), (227, 141), (227, 142), (227, 143), (227, 144), (227, 145), (227, 146), (227, 147), (227, 148), (227, 149), (227, 150), (227, 151), (227, 152), (227, 153), (227, 154), (227, 155), (227, 157), (228, 47), (228, 49), (228, 50), (228, 51), (228, 52), (228, 53), (228, 54), (228, 55), (228, 56), (228, 57), (228, 58), (228, 59), (228, 60), (228, 63), (228, 64), (228, 65), (228, 66), (228, 67), (228, 70), (228, 71), (228, 72), (228, 73), (228, 74), (228, 75), (228, 76), (228, 77), (228, 78), (228, 79), (228, 80), (228, 81), (228, 82), (228, 83), (228, 84), (228, 85), (228, 86), (228, 87), (228, 88), (228, 89), (228, 90), (228, 91), (228, 92), (228, 93), (228, 94), (228, 95), (228, 96), (228, 97), (228, 98), (228, 99), (228, 100), (228, 101), (228, 102), (228, 103), (228, 104), (228, 105), (228, 106), (228, 107), (228, 108), (228, 109), (228, 110), (228, 111), (228, 112), (228, 113), (228, 114), (228, 115), (228, 116), (228, 117), (228, 118), (228, 119), (228, 120), (228, 121), (228, 122), (228, 123), (228, 124), (228, 125), (228, 126), (228, 127), (228, 128), (228, 129), (228, 130), (228, 131), (228, 132), (228, 133), (228, 134), (228, 135), (228, 136), (228, 137), (228, 138), (228, 139), (228, 140), (228, 141), (228, 142), (228, 143), (228, 144), (228, 145), (228, 146), (228, 147), (228, 148), (228, 149), (228, 150), (228, 151), (228, 152), (228, 153), (228, 154), (228, 155), (228, 157), (229, 48), (229, 50), (229, 51), (229, 52), (229, 53), (229, 54), (229, 55), (229, 56), (229, 57), (229, 58), (229, 59), (229, 60), (229, 61), (229, 62), (229, 69), (229, 70), (229, 71), (229, 72), (229, 73), (229, 74), (229, 75), (229, 76), (229, 77), (229, 78), (229, 79), (229, 80), (229, 81), (229, 82), (229, 83), (229, 84), (229, 85), (229, 86), (229, 87), (229, 88), (229, 89), (229, 90), (229, 91), (229, 92), (229, 93), (229, 94), (229, 95), (229, 96), (229, 97), (229, 98), (229, 99), (229, 100), (229, 101), (229, 102), (229, 103), (229, 104), (229, 105), (229, 106), (229, 107), (229, 108), (229, 109), (229, 110), (229, 111), (229, 112), (229, 113), (229, 114), (229, 115), (229, 116), (229, 117), (229, 118), (229, 119), (229, 120), (229, 121), (229, 122), (229, 123), (229, 124), (229, 125), (229, 126), (229, 127), (229, 128), (229, 129), (229, 130), (229, 131), (229, 132), (229, 133), (229, 134), (229, 135), (229, 136), (229, 137), (229, 138), (229, 139), (229, 140), (229, 141), (229, 142), (229, 143), (229, 144), (229, 145), (229, 146), (229, 147), (229, 148), (229, 149), (229, 150), (229, 151), (229, 152), (229, 153), (229, 154), (229, 155), (229, 157), (230, 49), (230, 51), (230, 52), (230, 53), (230, 54), (230, 55), (230, 56), (230, 57), (230, 58), (230, 59), (230, 60), (230, 61), (230, 62), (230, 63), (230, 64), (230, 65), (230, 66), (230, 67), (230, 68), (230, 69), (230, 70), (230, 71), (230, 72), (230, 73), (230, 74), (230, 75), (230, 76), (230, 77), (230, 78), (230, 79), (230, 80), (230, 81), (230, 82), (230, 83), (230, 84), (230, 85), (230, 86), (230, 87), (230, 88), (230, 89), (230, 90), (230, 91), (230, 92), (230, 93), (230, 94), (230, 95), (230, 96), (230, 97), (230, 98), (230, 99), (230, 100), (230, 101), (230, 102), (230, 103), (230, 104), (230, 105), (230, 106), (230, 107), (230, 108), (230, 109), (230, 110), (230, 111), (230, 112), (230, 113), (230, 114), (230, 115), (230, 116), (230, 117), (230, 118), (230, 119), (230, 120), (230, 121), (230, 122), (230, 123), (230, 124), (230, 125), (230, 126), (230, 127), (230, 128), (230, 129), (230, 130), (230, 131), (230, 132), (230, 133), (230, 134), (230, 135), (230, 136), (230, 137), (230, 138), (230, 139), (230, 140), (230, 141), (230, 142), (230, 143), (230, 144), (230, 145), (230, 146), (230, 147), (230, 148), (230, 149), (230, 150), (230, 151), (230, 152), (230, 153), (230, 154), (230, 155), (230, 157), (231, 50), (231, 52), (231, 53), (231, 54), (231, 55), (231, 56), (231, 57), (231, 58), (231, 59), (231, 60), (231, 61), (231, 62), (231, 63), (231, 64), (231, 65), (231, 66), (231, 67), (231, 68), (231, 69), (231, 70), (231, 71), (231, 72), (231, 73), (231, 74), (231, 75), (231, 76), (231, 77), (231, 78), (231, 79), (231, 80), (231, 81), (231, 82), (231, 83), (231, 84), (231, 85), (231, 86), (231, 87), (231, 88), (231, 89), (231, 90), (231, 91), (231, 92), (231, 93), (231, 94), (231, 95), (231, 96), (231, 97), (231, 98), (231, 99), (231, 100), (231, 101), (231, 102), (231, 103), (231, 104), (231, 105), (231, 106), (231, 107), (231, 108), (231, 109), (231, 110), (231, 111), (231, 112), (231, 113), (231, 114), (231, 115), (231, 116), (231, 117), (231, 118), (231, 119), (231, 120), (231, 121), (231, 122), (231, 123), (231, 124), (231, 125), (231, 126), (231, 127), (231, 128), (231, 129), (231, 130), (231, 131), (231, 132), (231, 133), (231, 134), (231, 135), (231, 136), (231, 137), (231, 138), (231, 139), (231, 140), (231, 141), (231, 142), (231, 143), (231, 144), (231, 145), (231, 146), (231, 147), (231, 148), (231, 149), (231, 150), (231, 151), (231, 152), (231, 153), (231, 154), (231, 156), (232, 51), (232, 53), (232, 54), (232, 55), (232, 56), (232, 57), (232, 58), (232, 59), (232, 60), (232, 61), (232, 62), (232, 63), (232, 64), (232, 65), (232, 66), (232, 67), (232, 68), (232, 69), (232, 70), (232, 71), (232, 72), (232, 73), (232, 74), (232, 75), (232, 76), (232, 77), (232, 78), (232, 79), (232, 80), (232, 81), (232, 82), (232, 83), (232, 84), (232, 85), (232, 86), (232, 87), (232, 88), (232, 89), (232, 90), (232, 91), (232, 92), (232, 93), (232, 94), (232, 95), (232, 96), (232, 97), (232, 98), (232, 99), (232, 100), (232, 101), (232, 102), (232, 103), (232, 104), (232, 105), (232, 106), (232, 107), (232, 108), (232, 109), (232, 110), (232, 111), (232, 112), (232, 113), (232, 114), (232, 115), (232, 116), (232, 117), (232, 118), (232, 119), (232, 120), (232, 121), (232, 122), (232, 123), (232, 124), (232, 125), (232, 126), (232, 127), (232, 128), (232, 129), (232, 130), (232, 131), (232, 132), (232, 133), (232, 134), (232, 135), (232, 136), (232, 137), (232, 138), (232, 139), (232, 140), (232, 141), (232, 142), (232, 143), (232, 144), (232, 145), (232, 146), (232, 147), (232, 148), (232, 149), (232, 150), (232, 151), (232, 152), (232, 153), (232, 154), (232, 156), (233, 52), (233, 54), (233, 55), (233, 56), (233, 57), (233, 58), (233, 59), (233, 60), (233, 61), (233, 62), (233, 63), (233, 64), (233, 65), (233, 66), (233, 67), (233, 68), (233, 69), (233, 70), (233, 71), (233, 72), (233, 73), (233, 74), (233, 75), (233, 76), (233, 77), (233, 78), (233, 79), (233, 80), (233, 81), (233, 82), (233, 83), (233, 84), (233, 85), (233, 86), (233, 87), (233, 88), (233, 89), (233, 90), (233, 91), (233, 92), (233, 93), (233, 94), (233, 95), (233, 96), (233, 97), (233, 98), (233, 99), (233, 100), (233, 101), (233, 102), (233, 103), (233, 104), (233, 105), (233, 106), (233, 107), (233, 108), (233, 109), (233, 110), (233, 111), (233, 112), (233, 113), (233, 114), (233, 115), (233, 116), (233, 117), (233, 118), (233, 119), (233, 120), (233, 121), (233, 122), (233, 123), (233, 124), (233, 125), (233, 126), (233, 127), (233, 128), (233, 129), (233, 130), (233, 131), (233, 132), (233, 133), (233, 134), (233, 135), (233, 136), (233, 137), (233, 138), (233, 139), (233, 140), (233, 141), (233, 142), (233, 143), (233, 144), (233, 145), (233, 146), (233, 147), (233, 148), (233, 149), (233, 150), (233, 151), (233, 152), (233, 153), (233, 154), (233, 156), (234, 52), (234, 54), (234, 55), (234, 56), (234, 57), (234, 58), (234, 59), (234, 60), (234, 61), (234, 62), (234, 63), (234, 64), (234, 65), (234, 66), (234, 67), (234, 68), (234, 69), (234, 70), (234, 71), (234, 72), (234, 73), (234, 74), (234, 75), (234, 76), (234, 77), (234, 78), (234, 79), (234, 80), (234, 81), (234, 85), (234, 86), (234, 101), (234, 102), (234, 103), (234, 104), (234, 105), (234, 106), (234, 107), (234, 108), (234, 109), (234, 110), (234, 111), (234, 112), (234, 113), (234, 114), (234, 115), (234, 116), (234, 117), (234, 118), (234, 119), (234, 120), (234, 121), (234, 122), (234, 123), (234, 124), (234, 125), (234, 126), (234, 127), (234, 128), (234, 129), (234, 130), (234, 131), (234, 132), (234, 133), (234, 134), (234, 135), (234, 136), (234, 137), (234, 138), (234, 139), (234, 140), (234, 141), (234, 142), (234, 143), (234, 144), (234, 145), (234, 146), (234, 147), (234, 148), (234, 149), (234, 150), (234, 151), (234, 152), (234, 156), (235, 53), (235, 55), (235, 56), (235, 57), (235, 58), (235, 59), (235, 60), (235, 61), (235, 62), (235, 63), (235, 64), (235, 65), (235, 66), (235, 67), (235, 68), (235, 69), (235, 70), (235, 71), (235, 72), (235, 73), (235, 74), (235, 75), (235, 76), (235, 77), (235, 78), (235, 79), (235, 80), (235, 81), (235, 83), (235, 84), (235, 85), (235, 86), (235, 87), (235, 88), (235, 89), (235, 90), (235, 91), (235, 92), (235, 93), (235, 94), (235, 95), (235, 96), (235, 97), (235, 98), (235, 99), (235, 102), (235, 103), (235, 104), (235, 105), (235, 106), (235, 107), (235, 108), (235, 109), (235, 110), (235, 111), (235, 112), (235, 113), (235, 114), (235, 115), (235, 116), (235, 117), (235, 118), (235, 119), (235, 120), (235, 121), (235, 122), (235, 123), (235, 124), (235, 125), (235, 126), (235, 127), (235, 128), (235, 129), (235, 130), (235, 131), (235, 132), (235, 133), (235, 134), (235, 135), (235, 136), (235, 137), (235, 138), (235, 139), (235, 140), (235, 141), (235, 142), (235, 143), (235, 144), (235, 145), (235, 146), (235, 147), (235, 148), (235, 149), (235, 150), (235, 153), (235, 155), (236, 53), (236, 55), (236, 56), (236, 57), (236, 58), (236, 59), (236, 60), (236, 61), (236, 62), (236, 63), (236, 64), (236, 65), (236, 66), (236, 67), (236, 68), (236, 69), (236, 70), (236, 71), (236, 72), (236, 73), (236, 74), (236, 75), (236, 76), (236, 77), (236, 78), (236, 79), (236, 81), (236, 101), (236, 103), (236, 104), (236, 105), (236, 106), (236, 107), (236, 108), (236, 109), (236, 110), (236, 111), (236, 112), (236, 113), (236, 114), (236, 115), (236, 116), (236, 117), (236, 118), (236, 119), (236, 120), (236, 121), (236, 122), (236, 123), (236, 124), (236, 125), (236, 126), (236, 127), (236, 128), (236, 129), (236, 130), (236, 131), (236, 132), (236, 133), (236, 134), (236, 135), (236, 136), (236, 137), (236, 138), (236, 139), (236, 140), (236, 141), (236, 142), (236, 143), (236, 144), (236, 145), (236, 146), (236, 147), (236, 148), (236, 149), (236, 152), (237, 54), (237, 56), (237, 57), (237, 58), (237, 59), (237, 60), (237, 61), (237, 62), (237, 63), (237, 64), (237, 65), (237, 66), (237, 67), (237, 68), (237, 69), (237, 70), (237, 81), (237, 102), (237, 104), (237, 105), (237, 106), (237, 107), (237, 108), (237, 109), (237, 110), (237, 111), (237, 112), (237, 113), (237, 114), (237, 115), (237, 116), (237, 117), (237, 118), (237, 119), (237, 120), (237, 121), (237, 122), (237, 123), (237, 124), (237, 125), (237, 126), (237, 127), (237, 128), (237, 129), (237, 130), (237, 131), (237, 132), (237, 133), (237, 134), (237, 135), (237, 136), (237, 137), (237, 138), (237, 139), (237, 140), (237, 141), (237, 142), (237, 143), (237, 144), (237, 145), (237, 146), (237, 147), (237, 150), (238, 54), (238, 56), (238, 57), (238, 58), (238, 59), (238, 60), (238, 61), (238, 62), (238, 63), (238, 64), (238, 71), (238, 72), (238, 73), (238, 74), (238, 75), (238, 76), (238, 77), (238, 78), (238, 80), (238, 103), (238, 105), (238, 106), (238, 107), (238, 108), (238, 109), (238, 110), (238, 111), (238, 112), (238, 113), (238, 114), (238, 115), (238, 116), (238, 117), (238, 118), (238, 119), (238, 120), (238, 121), (238, 122), (238, 123), (238, 124), (238, 125), (238, 126), (238, 127), (238, 128), (238, 129), (238, 130), (238, 131), (238, 132), (238, 133), (238, 134), (238, 135), (238, 136), (238, 137), (238, 138), (238, 139), (238, 140), (238, 141), (238, 142), (238, 143), (238, 144), (238, 145), (238, 146), (238, 149), (239, 54), (239, 65), (239, 66), (239, 67), (239, 68), (239, 69), (239, 70), (239, 104), (239, 106), (239, 107), (239, 108), (239, 109), (239, 110), (239, 111), (239, 112), (239, 113), (239, 114), (239, 115), (239, 116), (239, 117), (239, 118), (239, 119), (239, 120), (239, 121), (239, 122), (239, 123), (239, 124), (239, 125), (239, 126), (239, 127), (239, 128), (239, 129), (239, 130), (239, 131), (239, 132), (239, 133), (239, 134), (239, 135), (239, 136), (239, 137), (239, 138), (239, 139), (239, 140), (239, 141), (239, 142), (239, 143), (239, 144), (239, 145), (240, 54), (240, 56), (240, 57), (240, 58), (240, 59), (240, 60), (240, 61), (240, 62), (240, 63), (240, 64), (240, 104), (240, 106), (240, 107), (240, 108), (240, 109), (240, 110), (240, 111), (240, 112), (240, 113), (240, 114), (240, 115), (240, 116), (240, 117), (240, 118), (240, 119), (240, 120), (240, 121), (240, 122), (240, 123), (240, 124), (240, 125), (240, 126), (240, 127), (240, 128), (240, 129), (240, 130), (240, 131), (240, 132), (240, 133), (240, 134), (240, 135), (240, 136), (240, 137), (240, 138), (240, 139), (240, 140), (240, 141), (240, 142), (240, 143), (240, 144), (240, 146), (241, 54), (241, 55), (241, 104), (241, 106), (241, 107), (241, 108), (241, 109), (241, 110), (241, 111), (241, 112), (241, 113), (241, 114), (241, 115), (241, 116), (241, 117), (241, 118), (241, 119), (241, 120), (241, 121), (241, 122), (241, 123), (241, 124), (241, 125), (241, 126), (241, 127), (241, 128), (241, 129), (241, 130), (241, 131), (241, 132), (241, 133), (241, 134), (241, 135), (241, 136), (241, 137), (241, 138), (241, 139), (241, 140), (241, 141), (241, 142), (241, 143), (241, 145), (242, 103), (242, 105), (242, 106), (242, 107), (242, 108), (242, 109), (242, 110), (242, 111), (242, 112), (242, 113), (242, 114), (242, 115), (242, 116), (242, 117), (242, 118), (242, 119), (242, 120), (242, 121), (242, 122), (242, 123), (242, 124), (242, 125), (242, 126), (242, 127), (242, 128), (242, 129), (242, 130), (242, 131), (242, 132), (242, 133), (242, 134), (242, 135), (242, 136), (242, 137), (242, 138), (242, 139), (242, 140), (242, 141), (242, 142), (243, 100), (243, 101), (243, 104), (243, 105), (243, 106), (243, 107), (243, 108), (243, 109), (243, 110), (243, 111), (243, 112), (243, 113), (243, 114), (243, 115), (243, 116), (243, 117), (243, 118), (243, 119), (243, 120), (243, 121), (243, 122), (243, 123), (243, 124), (243, 125), (243, 126), (243, 127), (243, 128), (243, 129), (243, 130), (243, 131), (243, 132), (243, 133), (243, 134), (243, 135), (243, 136), (243, 137), (243, 138), (243, 139), (243, 140), (243, 141), (243, 142), (243, 144), (244, 90), (244, 91), (244, 92), (244, 93), (244, 94), (244, 95), (244, 96), (244, 97), (244, 98), (244, 99), (244, 103), (244, 104), (244, 105), (244, 106), (244, 107), (244, 108), (244, 109), (244, 110), (244, 111), (244, 112), (244, 113), (244, 114), (244, 115), (244, 116), (244, 117), (244, 118), (244, 119), (244, 120), (244, 121), (244, 122), (244, 123), (244, 124), (244, 125), (244, 126), (244, 127), (244, 128), (244, 129), (244, 130), (244, 131), (244, 132), (244, 133), (244, 134), (244, 135), (244, 136), (244, 137), (244, 138), (244, 139), (244, 140), (244, 141), (244, 143), (245, 86), (245, 88), (245, 89), (245, 100), (245, 101), (245, 102), (245, 103), (245, 104), (245, 105), (245, 106), (245, 107), (245, 108), (245, 109), (245, 110), (245, 111), (245, 112), (245, 113), (245, 114), (245, 115), (245, 116), (245, 117), (245, 118), (245, 119), (245, 120), (245, 121), (245, 122), (245, 123), (245, 124), (245, 125), (245, 126), (245, 127), (245, 128), (245, 129), (245, 130), (245, 131), (245, 132), (245, 133), (245, 134), (245, 135), (245, 136), (245, 137), (245, 138), (245, 139), (245, 140), (245, 142), (246, 84), (246, 90), (246, 91), (246, 92), (246, 93), (246, 94), (246, 95), (246, 96), (246, 97), (246, 98), (246, 99), (246, 100), (246, 101), (246, 102), (246, 103), (246, 104), (246, 105), (246, 106), (246, 107), (246, 108), (246, 109), (246, 110), (246, 111), (246, 112), (246, 113), (246, 114), (246, 115), (246, 116), (246, 117), (246, 118), (246, 119), (246, 120), (246, 121), (246, 122), (246, 123), (246, 124), (246, 125), (246, 126), (246, 127), (246, 128), (246, 129), (246, 130), (246, 131), (246, 132), (246, 133), (246, 134), (246, 135), (246, 136), (246, 137), (246, 138), (246, 139), (246, 141), (247, 83), (247, 86), (247, 87), (247, 88), (247, 89), (247, 90), (247, 91), (247, 92), (247, 93), (247, 94), (247, 95), (247, 96), (247, 97), (247, 98), (247, 99), (247, 100), (247, 101), (247, 102), (247, 103), (247, 104), (247, 105), (247, 106), (247, 107), (247, 108), (247, 109), (247, 110), (247, 111), (247, 112), (247, 113), (247, 114), (247, 115), (247, 116), (247, 117), (247, 118), (247, 119), (247, 120), (247, 121), (247, 122), (247, 123), (247, 124), (247, 125), (247, 126), (247, 127), (247, 128), (247, 129), (247, 130), (247, 131), (247, 132), (247, 133), (247, 134), (247, 135), (247, 136), (247, 137), (247, 138), (247, 140), (248, 83), (248, 118), (248, 119), (248, 120), (248, 121), (248, 122), (248, 123), (248, 125), (248, 126), (248, 127), (248, 128), (248, 129), (248, 130), (248, 131), (248, 132), (248, 133), (248, 134), (248, 135), (248, 136), (248, 137), (248, 139), (249, 83), (249, 85), (249, 86), (249, 87), (249, 88), (249, 89), (249, 90), (249, 91), (249, 92), (249, 93), (249, 94), (249, 95), (249, 96), (249, 97), (249, 98), (249, 99), (249, 100), (249, 101), (249, 102), (249, 103), (249, 104), (249, 105), (249, 106), (249, 107), (249, 108), (249, 109), (249, 110), (249, 111), (249, 112), (249, 113), (249, 114), (249, 115), (249, 116), (249, 117), (249, 120), (249, 121), (249, 124), (249, 128), (249, 129), (249, 130), (249, 131), (249, 132), (249, 133), (249, 134), (249, 135), (249, 136), (249, 138), (250, 83), (250, 118), (250, 121), (250, 122), (250, 126), (250, 130), (250, 131), (250, 132), (250, 133), (250, 134), (250, 137), (251, 128), (251, 136), (252, 121), (252, 130), (252, 132), (252, 134))
coordinates_f8_f8_ff = ((164, 154), (164, 155), (164, 156), (164, 157), (164, 158), (164, 159), (165, 151), (165, 153), (165, 161), (166, 151), (166, 154), (166, 155), (166, 156), (166, 157), (166, 158), (166, 159), (166, 161), (167, 150), (167, 152), (167, 153), (167, 154), (167, 155), (167, 156), (167, 157), (167, 158), (167, 160), (168, 150), (168, 152), (168, 153), (168, 154), (168, 155), (168, 156), (168, 157), (168, 159), (169, 149), (169, 151), (169, 152), (169, 153), (169, 154), (169, 155), (169, 156), (169, 158), (170, 148), (170, 150), (170, 151), (170, 152), (170, 153), (170, 154), (170, 155), (170, 156), (170, 158), (171, 147), (171, 149), (171, 150), (171, 151), (171, 152), (171, 153), (171, 154), (171, 155), (171, 156), (171, 158), (172, 146), (172, 148), (172, 149), (172, 150), (172, 151), (172, 152), (172, 153), (172, 154), (172, 155), (172, 156), (172, 158), (173, 146), (173, 148), (173, 149), (173, 150), (173, 151), (173, 152), (173, 153), (173, 154), (173, 155), (173, 156), (173, 158), (174, 145), (174, 148), (174, 149), (174, 150), (174, 151), (174, 152), (174, 153), (174, 154), (174, 155), (174, 156), (174, 157), (174, 159), (175, 145), (175, 147), (175, 150), (175, 151), (175, 152), (175, 153), (175, 154), (175, 155), (175, 156), (175, 157), (175, 159), (176, 148), (176, 149), (176, 152), (176, 153), (176, 154), (176, 155), (176, 156), (176, 157), (176, 159), (177, 150), (177, 153), (177, 154), (177, 155), (177, 156), (177, 157), (177, 158), (177, 160), (178, 154), (178, 155), (178, 156), (178, 157), (178, 158), (178, 160), (179, 153), (179, 155), (179, 156), (179, 157), (179, 158), (179, 159), (179, 161), (180, 153), (180, 155), (180, 156), (180, 157), (180, 158), (180, 159), (180, 160), (180, 162), (181, 139), (181, 154), (181, 156), (181, 157), (181, 158), (181, 159), (181, 160), (181, 162), (182, 139), (182, 155), (182, 157), (182, 158), (182, 159), (182, 160), (182, 161), (183, 138), (183, 155), (183, 157), (183, 158), (183, 159), (183, 160), (183, 161), (183, 162), (183, 165), (184, 137), (184, 156), (184, 158), (184, 159), (184, 160), (184, 161), (184, 162), (184, 163), (184, 164), (184, 166), (185, 136), (185, 137), (185, 156), (185, 158), (185, 159), (185, 160), (185, 161), (185, 162), (185, 163), (185, 164), (185, 165), (186, 135), (186, 137), (186, 157), (186, 159), (186, 160), (186, 161), (186, 162), (186, 163), (186, 164), (186, 165), (186, 166), (186, 169), (187, 134), (187, 136), (187, 137), (187, 157), (187, 159), (187, 160), (187, 161), (187, 162), (187, 163), (187, 164), (187, 165), (187, 166), (187, 167), (187, 170), (188, 133), (188, 135), (188, 137), (188, 158), (188, 160), (188, 161), (188, 162), (188, 163), (188, 164), (188, 165), (188, 166), (188, 167), (188, 168), (189, 121), (189, 124), (189, 132), (189, 134), (189, 135), (189, 136), (189, 138), (189, 158), (189, 160), (189, 161), (189, 162), (189, 163), (189, 164), (189, 165), (189, 166), (189, 167), (189, 168), (189, 169), (189, 172), (189, 174), (190, 120), (190, 133), (190, 134), (190, 135), (190, 136), (190, 137), (190, 139), (190, 158), (190, 160), (190, 161), (190, 162), (190, 163), (190, 164), (190, 165), (190, 166), (190, 167), (190, 168), (190, 169), (190, 170), (190, 171), (190, 174), (191, 123), (191, 125), (191, 129), (191, 132), (191, 133), (191, 134), (191, 135), (191, 136), (191, 137), (191, 138), (191, 140), (191, 159), (191, 161), (191, 162), (191, 163), (191, 164), (191, 165), (191, 166), (191, 167), (191, 168), (191, 169), (191, 170), (191, 171), (191, 172), (191, 174), (192, 127), (192, 128), (192, 133), (192, 134), (192, 135), (192, 136), (192, 137), (192, 138), (192, 139), (192, 142), (192, 159), (192, 161), (192, 162), (192, 163), (192, 164), (192, 165), (192, 166), (192, 167), (192, 168), (192, 169), (192, 170), (192, 171), (192, 172), (192, 174), (193, 130), (193, 132), (193, 136), (193, 137), (193, 138), (193, 139), (193, 140), (193, 144), (193, 159), (193, 161), (193, 162), (193, 163), (193, 164), (193, 165), (193, 166), (193, 167), (193, 168), (193, 169), (193, 170), (193, 171), (193, 173), (194, 133), (194, 134), (194, 135), (194, 139), (194, 140), (194, 141), (194, 142), (194, 145), (194, 146), (194, 147), (194, 160), (194, 162), (194, 163), (194, 164), (194, 165), (194, 166), (194, 167), (194, 168), (194, 169), (194, 170), (194, 171), (194, 173), (195, 136), (195, 137), (195, 138), (195, 142), (195, 143), (195, 144), (195, 148), (195, 160), (195, 164), (195, 165), (195, 166), (195, 167), (195, 168), (195, 169), (195, 170), (195, 171), (195, 173), (196, 139), (196, 140), (196, 141), (196, 145), (196, 146), (196, 148), (196, 161), (196, 162), (196, 163), (196, 166), (196, 167), (196, 168), (196, 169), (196, 170), (196, 172), (197, 142), (197, 144), (197, 148), (197, 164), (197, 165), (197, 168), (197, 169), (197, 171), (198, 145), (198, 146), (198, 149), (198, 166), (198, 167), (198, 169), (198, 171), (199, 147), (199, 149), (199, 168), (199, 170), (200, 150), (200, 169), (200, 170), (201, 151), (201, 170), (202, 152), (202, 170), (203, 152), (204, 152), (204, 155), (205, 153), (205, 156), (205, 169), (206, 153), (206, 155), (206, 158), (206, 169), (207, 153), (207, 155), (207, 156), (207, 160), (207, 161), (207, 167), (207, 169), (208, 154), (208, 156), (208, 157), (208, 158), (208, 162), (208, 163), (208, 164), (208, 165), (208, 166), (208, 169), (209, 154), (209, 156), (209, 157), (209, 158), (209, 159), (209, 160), (209, 161), (209, 167), (209, 169), (210, 155), (210, 156), (210, 157), (210, 158), (210, 159), (210, 160), (210, 161), (210, 162), (210, 163), (210, 164), (210, 165), (210, 166), (210, 167), (210, 169), (211, 155), (211, 157), (211, 158), (211, 159), (211, 160), (211, 161), (211, 162), (211, 163), (211, 164), (211, 165), (211, 166), (211, 167), (211, 169), (212, 155), (212, 157), (212, 158), (212, 159), (212, 160), (212, 161), (212, 162), (212, 163), (212, 164), (212, 165), (212, 166), (212, 167), (212, 169), (213, 156), (213, 158), (213, 159), (213, 160), (213, 161), (213, 162), (213, 163), (213, 164), (213, 165), (213, 166), (213, 167), (214, 156), (214, 158), (214, 159), (214, 160), (214, 161), (214, 162), (214, 163), (214, 164), (214, 165), (214, 166), (214, 168), (215, 157), (215, 159), (215, 160), (215, 161), (215, 162), (215, 167), (216, 158), (216, 163), (216, 164), (216, 166), (217, 159), (217, 161), (217, 162), (225, 160), (225, 162), (226, 160), (226, 164), (226, 166), (227, 160), (227, 162), (227, 163), (227, 167), (227, 169), (228, 159), (228, 161), (228, 162), (228, 163), (228, 164), (228, 165), (228, 166), (228, 171), (229, 159), (229, 161), (229, 162), (229, 163), (229, 164), (229, 165), (229, 166), (229, 167), (229, 168), (229, 170), (230, 159), (230, 161), (230, 162), (230, 163), (230, 164), (230, 165), (230, 166), (230, 167), (230, 169), (231, 159), (231, 161), (231, 162), (231, 163), (231, 164), (231, 165), (231, 166), (231, 168), (232, 158), (232, 160), (232, 161), (232, 162), (232, 163), (232, 164), (232, 165), (232, 166), (232, 168), (233, 158), (233, 160), (233, 161), (233, 162), (233, 163), (233, 164), (233, 165), (233, 166), (233, 167), (233, 168), (233, 169), (234, 158), (234, 167), (234, 169), (235, 158), (235, 160), (235, 161), (235, 162), (235, 163), (235, 164), (235, 165), (235, 166), (235, 170), (236, 167), (236, 170), (237, 155), (237, 169), (237, 171), (238, 152), (238, 155), (238, 170), (238, 171), (239, 150), (239, 154), (239, 170), (239, 172), (240, 149), (240, 152), (240, 154), (240, 170), (240, 172), (241, 148), (241, 150), (241, 151), (241, 153), (241, 170), (241, 173), (242, 147), (242, 149), (242, 150), (242, 169), (242, 171), (242, 173), (243, 146), (243, 148), (243, 149), (243, 152), (243, 169), (243, 171), (243, 172), (243, 174), (244, 145), (244, 147), (244, 148), (244, 151), (244, 168), (244, 170), (244, 171), (244, 172), (244, 174), (245, 144), (245, 146), (245, 147), (245, 150), (245, 167), (245, 169), (245, 170), (245, 171), (245, 172), (245, 174), (246, 143), (246, 146), (246, 149), (246, 166), (246, 168), (246, 169), (246, 170), (246, 171), (246, 172), (246, 174), (247, 143), (247, 145), (247, 148), (247, 165), (247, 167), (247, 168), (247, 169), (247, 170), (247, 171), (247, 172), (247, 174), (248, 142), (248, 144), (248, 164), (248, 166), (248, 167), (248, 168), (248, 169), (248, 170), (248, 171), (248, 172), (248, 174), (249, 141), (249, 143), (249, 145), (249, 163), (249, 165), (249, 166), (249, 167), (249, 168), (249, 169), (249, 170), (249, 171), (249, 172), (249, 174), (250, 140), (250, 142), (250, 144), (250, 162), (250, 164), (250, 165), (250, 166), (250, 167), (250, 168), (250, 169), (250, 170), (250, 171), (250, 172), (250, 174), (251, 139), (251, 141), (251, 143), (251, 161), (251, 163), (251, 164), (251, 165), (251, 166), (251, 167), (251, 168), (251, 169), (251, 170), (251, 171), (251, 172), (251, 174), (252, 140), (252, 141), (252, 161), (252, 163), (252, 164), (252, 165), (252, 166), (252, 167), (252, 168), (252, 169), (252, 170), (252, 171), (252, 172), (252, 174), (253, 136), (253, 139), (253, 140), (253, 142), (253, 160), (253, 162), (253, 163), (253, 164), (253, 165), (253, 166), (253, 167), (253, 168), (253, 169), (253, 170), (253, 171), (253, 172), (253, 174), (254, 133), (254, 135), (254, 138), (254, 139), (254, 141), (254, 160), (254, 162), (254, 163), (254, 164), (254, 165), (254, 166), (254, 167), (254, 168), (254, 169), (254, 170), (254, 171), (254, 172), (254, 174), (255, 136), (255, 137), (255, 138), (255, 140), (255, 159), (255, 161), (255, 162), (255, 163), (255, 164), (255, 165), (255, 166), (255, 167), (255, 168), (255, 169), (255, 170), (255, 174), (256, 134), (256, 136), (256, 137), (256, 138), (256, 140), (256, 159), (256, 161), (256, 162), (256, 163), (256, 164), (256, 165), (256, 166), (256, 167), (256, 168), (256, 169), (256, 172), (256, 174), (257, 135), (257, 137), (257, 138), (257, 140), (257, 159), (257, 161), (257, 162), (257, 163), (257, 164), (257, 165), (257, 166), (257, 167), (257, 170), (258, 136), (258, 138), (258, 140), (258, 158), (258, 160), (258, 161), (258, 162), (258, 163), (258, 164), (258, 165), (258, 166), (258, 169), (259, 136), (259, 138), (259, 140), (259, 158), (259, 160), (259, 161), (259, 162), (259, 163), (259, 164), (259, 165), (259, 167), (260, 137), (260, 140), (260, 157), (260, 159), (260, 160), (260, 161), (260, 162), (260, 163), (260, 164), (260, 166), (261, 138), (261, 140), (261, 157), (261, 159), (261, 160), (261, 161), (261, 162), (261, 163), (261, 165), (262, 138), (262, 141), (262, 156), (262, 158), (262, 159), (262, 160), (262, 161), (262, 162), (262, 163), (262, 165), (263, 139), (263, 142), (263, 156), (263, 158), (263, 159), (263, 160), (263, 161), (263, 162), (263, 164), (264, 140), (264, 155), (264, 157), (264, 158), (264, 159), (264, 160), (264, 161), (264, 163), (265, 142), (265, 144), (265, 155), (265, 157), (265, 158), (265, 159), (265, 160), (265, 161), (265, 163), (266, 144), (266, 145), (266, 154), (266, 156), (266, 157), (266, 158), (266, 159), (266, 160), (266, 162), (267, 145), (267, 146), (267, 153), (267, 155), (267, 156), (267, 157), (267, 158), (267, 159), (267, 160), (267, 162), (268, 146), (268, 147), (268, 152), (268, 154), (268, 155), (268, 156), (268, 157), (268, 158), (268, 159), (268, 160), (268, 162), (269, 147), (269, 150), (269, 153), (269, 154), (269, 155), (269, 156), (269, 157), (269, 158), (269, 159), (269, 161), (270, 148), (270, 152), (270, 153), (270, 154), (270, 155), (270, 156), (270, 157), (270, 158), (270, 159), (270, 161), (271, 151), (271, 152), (271, 153), (271, 154), (271, 155), (271, 156), (271, 157), (271, 158), (271, 159), (271, 161), (272, 149), (272, 151), (272, 152), (272, 153), (272, 154), (272, 155), (272, 156), (272, 157), (272, 158), (272, 159), (272, 161), (273, 150), (273, 152), (273, 153), (273, 154), (273, 155), (273, 156), (273, 157), (273, 158), (273, 159), (273, 160), (273, 162), (274, 151), (274, 153), (274, 154), (274, 155), (274, 156), (274, 157), (274, 158), (274, 159), (274, 160), (274, 162), (275, 152), (275, 154), (275, 155), (275, 156), (275, 157), (275, 158), (275, 159), (275, 160), (275, 161), (275, 162), (275, 164), (276, 152), (276, 154), (276, 155), (276, 156), (276, 157), (276, 158), (276, 159), (276, 160), (276, 161), (276, 162), (276, 164), (277, 153), (277, 155), (277, 156), (277, 157), (277, 158), (277, 159), (277, 160), (277, 161), (277, 163), (278, 153), (278, 155), (278, 156), (278, 157), (278, 158), (278, 159), (278, 160), (278, 163), (279, 154), (279, 156), (279, 157), (279, 158), (279, 159), (279, 162), (280, 154), (280, 156), (280, 157), (280, 160), (281, 154), (281, 159), (282, 155), (282, 157))
coordinates_f45_df4 = ((177, 144), (177, 146), (178, 94), (178, 95), (178, 96), (178, 97), (178, 98), (178, 100), (178, 143), (178, 147), (178, 149), (179, 91), (179, 93), (179, 100), (179, 142), (179, 144), (179, 145), (179, 146), (179, 150), (180, 89), (180, 94), (180, 95), (180, 96), (180, 97), (180, 99), (180, 142), (180, 144), (180, 145), (180, 146), (180, 147), (180, 148), (180, 149), (180, 151), (181, 87), (181, 91), (181, 92), (181, 93), (181, 94), (181, 95), (181, 99), (181, 141), (181, 143), (181, 144), (181, 145), (181, 146), (181, 147), (181, 148), (181, 149), (181, 150), (181, 152), (182, 85), (182, 86), (182, 89), (182, 90), (182, 91), (182, 92), (182, 97), (182, 141), (182, 143), (182, 144), (182, 145), (182, 146), (182, 147), (182, 148), (182, 149), (182, 150), (183, 84), (183, 87), (183, 88), (183, 89), (183, 93), (183, 94), (183, 95), (183, 140), (183, 142), (183, 143), (183, 144), (183, 145), (183, 146), (183, 147), (183, 148), (183, 149), (183, 150), (183, 151), (183, 153), (184, 82), (184, 85), (184, 86), (184, 90), (184, 91), (184, 92), (184, 140), (184, 142), (184, 143), (184, 144), (184, 145), (184, 146), (184, 147), (184, 148), (184, 149), (184, 150), (184, 151), (184, 152), (184, 154), (185, 81), (185, 87), (185, 88), (185, 89), (185, 139), (185, 141), (185, 142), (185, 143), (185, 144), (185, 145), (185, 146), (185, 147), (185, 148), (185, 149), (185, 150), (185, 151), (185, 152), (185, 154), (186, 79), (186, 84), (186, 85), (186, 86), (186, 139), (186, 141), (186, 142), (186, 143), (186, 144), (186, 145), (186, 146), (186, 147), (186, 148), (186, 149), (186, 150), (186, 151), (186, 152), (186, 154), (187, 77), (187, 83), (187, 139), (187, 141), (187, 142), (187, 143), (187, 144), (187, 145), (187, 146), (187, 147), (187, 148), (187, 149), (187, 150), (187, 151), (187, 152), (187, 153), (187, 155), (188, 76), (188, 79), (188, 81), (188, 139), (188, 142), (188, 143), (188, 144), (188, 145), (188, 146), (188, 147), (188, 148), (188, 149), (188, 150), (188, 151), (188, 152), (188, 153), (188, 155), (189, 74), (189, 77), (189, 78), (189, 80), (189, 140), (189, 144), (189, 145), (189, 146), (189, 147), (189, 148), (189, 149), (189, 150), (189, 151), (189, 152), (189, 153), (189, 154), (189, 156), (190, 72), (190, 76), (190, 77), (190, 79), (190, 142), (190, 146), (190, 147), (190, 148), (190, 149), (190, 150), (190, 151), (190, 152), (190, 153), (190, 154), (190, 156), (191, 71), (191, 74), (191, 75), (191, 76), (191, 78), (191, 144), (191, 148), (191, 149), (191, 150), (191, 151), (191, 152), (191, 153), (191, 154), (191, 156), (192, 69), (192, 72), (192, 73), (192, 74), (192, 75), (192, 76), (192, 78), (192, 146), (192, 147), (192, 150), (192, 151), (192, 152), (192, 153), (192, 154), (192, 155), (192, 157), (193, 67), (193, 68), (193, 71), (193, 72), (193, 73), (193, 74), (193, 75), (193, 77), (193, 148), (193, 150), (193, 151), (193, 152), (193, 153), (193, 154), (193, 155), (193, 157), (194, 66), (194, 69), (194, 70), (194, 71), (194, 72), (194, 73), (194, 74), (194, 75), (194, 77), (194, 150), (194, 152), (194, 153), (194, 154), (194, 155), (194, 156), (194, 158), (195, 64), (195, 67), (195, 68), (195, 69), (195, 70), (195, 71), (195, 72), (195, 73), (195, 74), (195, 75), (195, 77), (195, 150), (195, 152), (195, 153), (195, 154), (195, 155), (195, 156), (195, 158), (196, 62), (196, 66), (196, 67), (196, 68), (196, 69), (196, 70), (196, 71), (196, 72), (196, 73), (196, 74), (196, 75), (196, 76), (196, 78), (196, 150), (196, 152), (196, 153), (196, 154), (196, 155), (196, 156), (196, 157), (196, 159), (197, 60), (197, 64), (197, 65), (197, 66), (197, 67), (197, 68), (197, 69), (197, 70), (197, 71), (197, 72), (197, 73), (197, 74), (197, 75), (197, 76), (197, 78), (197, 151), (197, 153), (197, 154), (197, 155), (197, 156), (197, 157), (197, 158), (197, 160), (198, 58), (198, 59), (198, 62), (198, 63), (198, 64), (198, 65), (198, 66), (198, 67), (198, 68), (198, 69), (198, 70), (198, 71), (198, 72), (198, 73), (198, 74), (198, 75), (198, 76), (198, 77), (198, 79), (198, 151), (198, 153), (198, 154), (198, 155), (198, 156), (198, 157), (198, 158), (198, 159), (198, 162), (199, 56), (199, 57), (199, 60), (199, 61), (199, 62), (199, 63), (199, 64), (199, 65), (199, 66), (199, 67), (199, 68), (199, 69), (199, 70), (199, 71), (199, 72), (199, 73), (199, 74), (199, 75), (199, 76), (199, 77), (199, 78), (199, 80), (199, 152), (199, 154), (199, 155), (199, 156), (199, 157), (199, 158), (199, 159), (199, 160), (199, 163), (199, 165), (200, 53), (200, 54), (200, 55), (200, 58), (200, 59), (200, 60), (200, 61), (200, 62), (200, 63), (200, 64), (200, 65), (200, 66), (200, 67), (200, 68), (200, 69), (200, 70), (200, 71), (200, 72), (200, 73), (200, 74), (200, 75), (200, 76), (200, 77), (200, 78), (200, 81), (200, 155), (200, 156), (200, 157), (200, 158), (200, 159), (200, 160), (200, 161), (200, 162), (200, 167), (201, 51), (201, 63), (201, 64), (201, 65), (201, 66), (201, 67), (201, 68), (201, 69), (201, 70), (201, 71), (201, 72), (201, 73), (201, 74), (201, 75), (201, 76), (201, 77), (201, 78), (201, 79), (201, 82), (201, 154), (201, 156), (201, 157), (201, 158), (201, 159), (201, 160), (201, 161), (201, 162), (201, 163), (201, 164), (201, 165), (201, 168), (202, 51), (202, 53), (202, 54), (202, 55), (202, 56), (202, 57), (202, 58), (202, 59), (202, 60), (202, 61), (202, 62), (202, 63), (202, 75), (202, 76), (202, 77), (202, 78), (202, 79), (202, 80), (202, 81), (202, 84), (202, 85), (202, 155), (202, 158), (202, 159), (202, 160), (202, 161), (202, 162), (202, 163), (202, 164), (202, 165), (202, 166), (202, 168), (203, 64), (203, 65), (203, 66), (203, 67), (203, 68), (203, 69), (203, 70), (203, 71), (203, 72), (203, 73), (203, 74), (203, 86), (203, 87), (203, 88), (203, 156), (203, 160), (203, 161), (203, 162), (203, 163), (203, 164), (203, 165), (203, 166), (203, 168), (204, 75), (204, 76), (204, 77), (204, 78), (204, 79), (204, 80), (204, 81), (204, 82), (204, 85), (204, 89), (204, 90), (204, 91), (204, 92), (204, 93), (204, 94), (204, 95), (204, 96), (204, 97), (204, 158), (204, 163), (204, 164), (204, 165), (204, 166), (204, 168), (205, 83), (205, 84), (205, 87), (205, 88), (205, 89), (205, 98), (205, 99), (205, 100), (205, 102), (205, 160), (205, 162), (205, 167), (206, 85), (206, 86), (206, 89), (206, 90), (206, 91), (206, 92), (206, 93), (206, 94), (206, 95), (206, 96), (206, 102), (206, 163), (206, 165), (206, 166), (207, 87), (207, 88), (207, 98), (207, 99), (207, 101), (208, 89), (208, 90), (208, 91), (208, 92), (208, 93), (208, 94), (208, 95), (208, 96), (208, 97), (237, 89), (237, 91), (237, 92), (237, 93), (237, 94), (237, 95), (237, 96), (237, 97), (237, 99), (237, 157), (237, 159), (237, 160), (237, 161), (237, 162), (237, 163), (237, 164), (237, 165), (238, 88), (238, 100), (238, 157), (238, 166), (238, 167), (238, 168), (239, 87), (239, 89), (239, 90), (239, 91), (239, 92), (239, 93), (239, 94), (239, 95), (239, 96), (239, 97), (239, 98), (239, 99), (239, 101), (239, 157), (239, 159), (239, 160), (239, 161), (239, 162), (239, 163), (239, 164), (239, 165), (239, 168), (240, 73), (240, 74), (240, 75), (240, 76), (240, 77), (240, 78), (240, 79), (240, 80), (240, 81), (240, 82), (240, 83), (240, 84), (240, 85), (240, 88), (240, 89), (240, 90), (240, 91), (240, 92), (240, 93), (240, 94), (240, 95), (240, 96), (240, 97), (240, 98), (240, 102), (240, 156), (240, 158), (240, 159), (240, 160), (240, 161), (240, 162), (240, 163), (240, 164), (240, 165), (240, 166), (240, 168), (241, 67), (241, 68), (241, 69), (241, 70), (241, 71), (241, 72), (241, 87), (241, 99), (241, 101), (241, 156), (241, 158), (241, 159), (241, 160), (241, 161), (241, 162), (241, 163), (241, 164), (241, 165), (241, 166), (241, 168), (242, 60), (242, 61), (242, 62), (242, 63), (242, 64), (242, 65), (242, 66), (242, 73), (242, 74), (242, 75), (242, 76), (242, 77), (242, 78), (242, 79), (242, 80), (242, 81), (242, 82), (242, 83), (242, 84), (242, 88), (242, 89), (242, 90), (242, 91), (242, 92), (242, 93), (242, 94), (242, 95), (242, 96), (242, 97), (242, 98), (242, 155), (242, 157), (242, 158), (242, 159), (242, 160), (242, 161), (242, 162), (242, 163), (242, 164), (242, 165), (242, 167), (243, 54), (243, 55), (243, 56), (243, 57), (243, 58), (243, 59), (243, 67), (243, 68), (243, 69), (243, 70), (243, 71), (243, 72), (243, 73), (243, 74), (243, 75), (243, 76), (243, 77), (243, 78), (243, 79), (243, 80), (243, 81), (243, 82), (243, 85), (243, 86), (243, 87), (243, 154), (243, 156), (243, 157), (243, 158), (243, 159), (243, 160), (243, 161), (243, 162), (243, 163), (243, 164), (243, 166), (244, 54), (244, 55), (244, 57), (244, 61), (244, 62), (244, 63), (244, 64), (244, 65), (244, 66), (244, 67), (244, 68), (244, 69), (244, 70), (244, 71), (244, 72), (244, 73), (244, 74), (244, 75), (244, 76), (244, 77), (244, 78), (244, 79), (244, 80), (244, 81), (244, 84), (244, 153), (244, 155), (244, 156), (244, 157), (244, 158), (244, 159), (244, 160), (244, 161), (244, 162), (244, 163), (244, 165), (245, 59), (245, 60), (245, 63), (245, 64), (245, 65), (245, 66), (245, 67), (245, 68), (245, 69), (245, 70), (245, 71), (245, 72), (245, 73), (245, 74), (245, 75), (245, 76), (245, 77), (245, 78), (245, 79), (245, 80), (245, 81), (245, 152), (245, 154), (245, 155), (245, 156), (245, 157), (245, 158), (245, 159), (245, 160), (245, 161), (245, 162), (245, 164), (246, 61), (246, 65), (246, 66), (246, 67), (246, 68), (246, 69), (246, 70), (246, 71), (246, 72), (246, 73), (246, 74), (246, 75), (246, 76), (246, 77), (246, 78), (246, 79), (246, 80), (246, 82), (246, 151), (246, 153), (246, 154), (246, 155), (246, 156), (246, 157), (246, 158), (246, 159), (246, 160), (246, 161), (246, 163), (247, 63), (247, 67), (247, 68), (247, 69), (247, 70), (247, 71), (247, 72), (247, 73), (247, 74), (247, 75), (247, 76), (247, 77), (247, 78), (247, 79), (247, 81), (247, 150), (247, 152), (247, 153), (247, 154), (247, 155), (247, 156), (247, 157), (247, 158), (247, 159), (247, 160), (247, 162), (248, 65), (248, 69), (248, 70), (248, 71), (248, 72), (248, 73), (248, 74), (248, 75), (248, 76), (248, 77), (248, 78), (248, 79), (248, 81), (248, 149), (248, 151), (248, 152), (248, 153), (248, 154), (248, 155), (248, 156), (248, 157), (248, 158), (248, 159), (248, 161), (249, 67), (249, 70), (249, 71), (249, 72), (249, 73), (249, 74), (249, 75), (249, 76), (249, 77), (249, 78), (249, 80), (249, 148), (249, 150), (249, 151), (249, 152), (249, 153), (249, 154), (249, 155), (249, 156), (249, 157), (249, 158), (249, 160), (250, 69), (250, 72), (250, 73), (250, 74), (250, 75), (250, 76), (250, 77), (250, 78), (250, 80), (250, 147), (250, 149), (250, 150), (250, 151), (250, 152), (250, 153), (250, 154), (250, 155), (250, 156), (250, 157), (250, 158), (250, 160), (251, 70), (251, 73), (251, 74), (251, 75), (251, 76), (251, 77), (251, 78), (251, 80), (251, 146), (251, 148), (251, 149), (251, 150), (251, 151), (251, 152), (251, 153), (251, 154), (251, 155), (251, 156), (251, 157), (251, 159), (252, 72), (252, 75), (252, 76), (252, 77), (252, 78), (252, 79), (252, 81), (252, 145), (252, 147), (252, 148), (252, 149), (252, 150), (252, 151), (252, 152), (252, 153), (252, 154), (252, 155), (252, 156), (252, 158), (253, 73), (253, 76), (253, 77), (253, 78), (253, 79), (253, 80), (253, 83), (253, 144), (253, 146), (253, 147), (253, 148), (253, 149), (253, 150), (253, 151), (253, 152), (253, 153), (253, 154), (253, 155), (253, 156), (253, 158), (254, 75), (254, 78), (254, 79), (254, 80), (254, 81), (254, 84), (254, 143), (254, 145), (254, 146), (254, 147), (254, 148), (254, 149), (254, 150), (254, 151), (254, 152), (254, 153), (254, 154), (254, 155), (254, 157), (255, 76), (255, 79), (255, 80), (255, 81), (255, 82), (255, 83), (255, 86), (255, 143), (255, 145), (255, 146), (255, 147), (255, 148), (255, 149), (255, 150), (255, 151), (255, 152), (255, 153), (255, 154), (255, 155), (255, 157), (256, 78), (256, 81), (256, 82), (256, 83), (256, 84), (256, 88), (256, 142), (256, 144), (256, 145), (256, 146), (256, 147), (256, 148), (256, 149), (256, 150), (256, 151), (256, 152), (256, 153), (256, 154), (256, 155), (256, 157), (257, 79), (257, 82), (257, 83), (257, 84), (257, 85), (257, 86), (257, 89), (257, 142), (257, 144), (257, 145), (257, 146), (257, 147), (257, 148), (257, 149), (257, 150), (257, 151), (257, 152), (257, 153), (257, 154), (257, 156), (258, 81), (258, 84), (258, 85), (258, 86), (258, 87), (258, 88), (258, 91), (258, 142), (258, 144), (258, 145), (258, 146), (258, 147), (258, 148), (258, 149), (258, 150), (258, 151), (258, 152), (258, 153), (258, 154), (258, 156), (259, 82), (259, 85), (259, 86), (259, 87), (259, 88), (259, 89), (259, 90), (259, 93), (259, 142), (259, 144), (259, 145), (259, 146), (259, 147), (259, 148), (259, 149), (259, 150), (259, 151), (259, 152), (259, 153), (259, 154), (259, 155), (259, 156), (260, 84), (260, 87), (260, 88), (260, 89), (260, 90), (260, 91), (260, 95), (260, 142), (260, 144), (260, 145), (260, 146), (260, 147), (260, 148), (260, 149), (260, 150), (260, 151), (260, 152), (260, 153), (260, 155), (261, 85), (261, 88), (261, 89), (261, 90), (261, 91), (261, 92), (261, 93), (261, 97), (261, 143), (261, 145), (261, 146), (261, 147), (261, 148), (261, 149), (261, 150), (261, 151), (261, 152), (261, 153), (261, 155), (262, 87), (262, 90), (262, 91), (262, 92), (262, 93), (262, 94), (262, 95), (262, 99), (262, 143), (262, 145), (262, 146), (262, 147), (262, 148), (262, 149), (262, 150), (262, 151), (262, 152), (262, 154), (263, 88), (263, 91), (263, 92), (263, 93), (263, 94), (263, 95), (263, 96), (263, 97), (263, 101), (263, 144), (263, 146), (263, 147), (263, 148), (263, 149), (263, 150), (263, 151), (263, 152), (263, 154), (264, 90), (264, 93), (264, 94), (264, 95), (264, 96), (264, 97), (264, 98), (264, 99), (264, 103), (264, 145), (264, 147), (264, 148), (264, 149), (264, 150), (264, 151), (264, 153), (265, 91), (265, 94), (265, 95), (265, 96), (265, 97), (265, 98), (265, 99), (265, 100), (265, 101), (265, 105), (265, 146), (265, 148), (265, 149), (265, 150), (265, 152), (266, 93), (266, 105), (266, 107), (266, 147), (266, 152), (267, 94), (267, 96), (267, 97), (267, 98), (267, 99), (267, 100), (267, 101), (267, 102), (267, 103), (267, 148), (267, 150))
coordinates_ff5500 = ((168, 161), (169, 161), (169, 165), (170, 160), (170, 162), (170, 163), (170, 166), (171, 160), (171, 162), (171, 163), (171, 164), (171, 165), (171, 167), (172, 160), (172, 161), (172, 162), (172, 163), (172, 164), (172, 165), (172, 166), (172, 168), (173, 161), (173, 163), (173, 164), (173, 165), (173, 166), (173, 168), (174, 161), (174, 163), (174, 164), (174, 165), (174, 166), (174, 167), (174, 169), (175, 161), (175, 163), (175, 164), (175, 165), (175, 166), (175, 167), (175, 168), (175, 169), (176, 162), (176, 164), (176, 165), (176, 166), (176, 167), (176, 168), (176, 170), (177, 162), (177, 164), (177, 165), (177, 166), (177, 167), (177, 168), (177, 169), (177, 170), (178, 163), (178, 165), (178, 166), (178, 167), (178, 168), (178, 169), (178, 171), (179, 163), (179, 165), (179, 166), (179, 167), (179, 168), (179, 169), (179, 171), (180, 164), (180, 167), (180, 168), (180, 169), (180, 170), (180, 172), (181, 165), (181, 168), (181, 169), (181, 170), (181, 172), (182, 167), (182, 169), (182, 170), (182, 171), (182, 172), (182, 173), (183, 168), (183, 170), (183, 171), (183, 173), (184, 169), (184, 171), (184, 173), (185, 170), (185, 173), (186, 171), (186, 174), (187, 172), (187, 174), (258, 172), (258, 174), (259, 170), (260, 169), (260, 173), (261, 168), (261, 170), (261, 171), (261, 173), (262, 167), (262, 169), (262, 170), (262, 171), (262, 173), (263, 166), (263, 168), (263, 169), (263, 170), (263, 172), (264, 166), (264, 168), (264, 169), (264, 170), (264, 172), (265, 165), (265, 167), (265, 168), (265, 169), (265, 170), (265, 171), (265, 172), (266, 165), (266, 167), (266, 168), (266, 169), (266, 171), (267, 164), (267, 166), (267, 167), (267, 168), (267, 169), (267, 171), (268, 164), (268, 166), (268, 167), (268, 168), (268, 170), (269, 164), (269, 166), (269, 167), (269, 168), (269, 170), (270, 163), (270, 164), (270, 165), (270, 166), (270, 167), (270, 169), (271, 163), (271, 165), (271, 166), (272, 168), (273, 164), (273, 167))
coordinates_cc3300 = ((163, 143), (164, 142), (164, 144), (165, 141), (165, 143), (165, 146), (165, 147), (165, 149), (166, 140), (166, 142), (166, 143), (166, 144), (167, 139), (167, 141), (167, 142), (167, 143), (167, 144), (167, 145), (167, 146), (167, 148), (168, 141), (168, 142), (168, 143), (168, 144), (168, 145), (168, 147), (169, 138), (169, 140), (169, 141), (169, 142), (169, 143), (169, 144), (169, 146), (170, 137), (170, 139), (170, 140), (170, 141), (170, 142), (170, 143), (170, 145), (171, 136), (171, 138), (171, 139), (171, 140), (171, 141), (171, 142), (171, 143), (171, 145), (172, 138), (172, 139), (172, 140), (172, 141), (172, 142), (172, 144), (173, 135), (173, 137), (173, 138), (173, 139), (173, 140), (173, 141), (173, 143), (174, 134), (174, 136), (174, 137), (174, 138), (174, 139), (174, 140), (174, 141), (174, 143), (175, 133), (175, 135), (175, 136), (175, 137), (175, 138), (175, 139), (175, 140), (175, 141), (175, 143), (176, 133), (176, 135), (176, 136), (176, 137), (176, 138), (176, 139), (176, 140), (176, 143), (177, 132), (177, 134), (177, 135), (177, 136), (177, 137), (177, 138), (177, 139), (178, 131), (178, 133), (178, 134), (178, 135), (178, 136), (178, 137), (178, 138), (178, 140), (179, 131), (179, 133), (179, 134), (179, 135), (179, 136), (179, 137), (179, 139), (180, 130), (180, 132), (180, 133), (180, 134), (180, 135), (180, 136), (180, 138), (181, 131), (181, 132), (181, 133), (181, 134), (181, 135), (181, 137), (182, 129), (182, 131), (182, 132), (182, 133), (182, 134), (182, 136), (183, 128), (183, 130), (183, 131), (183, 132), (183, 133), (183, 135), (184, 128), (184, 130), (184, 131), (184, 132), (184, 134), (185, 127), (185, 129), (185, 130), (185, 131), (185, 133), (186, 127), (186, 129), (186, 130), (186, 132), (187, 126), (187, 128), (187, 129), (187, 131), (188, 126), (188, 130), (189, 126), (189, 129), (190, 127), (252, 123), (252, 126), (253, 123), (253, 128), (254, 123), (254, 125), (254, 126), (254, 130), (255, 124), (255, 125), (255, 126), (255, 127), (255, 128), (255, 131), (256, 124), (256, 126), (256, 127), (256, 128), (256, 129), (256, 130), (256, 132), (257, 125), (257, 127), (257, 128), (257, 129), (257, 130), (257, 131), (257, 133), (258, 125), (258, 127), (258, 128), (258, 129), (258, 130), (258, 131), (258, 133), (259, 126), (259, 128), (259, 129), (259, 130), (259, 131), (259, 132), (259, 134), (260, 127), (260, 129), (260, 130), (260, 131), (260, 132), (260, 133), (260, 135), (261, 127), (261, 129), (261, 130), (261, 131), (261, 132), (261, 133), (261, 135), (262, 128), (262, 130), (262, 131), (262, 132), (262, 133), (262, 134), (262, 136), (263, 129), (263, 131), (263, 132), (263, 133), (263, 134), (263, 135), (263, 137), (264, 130), (264, 132), (264, 133), (264, 134), (264, 135), (264, 136), (264, 138), (265, 130), (265, 132), (265, 133), (265, 134), (265, 135), (265, 136), (265, 137), (265, 139), (266, 131), (266, 133), (266, 134), (266, 135), (266, 136), (266, 137), (266, 138), (266, 140), (267, 132), (267, 134), (267, 135), (267, 136), (267, 137), (267, 138), (267, 139), (267, 142), (268, 133), (268, 135), (268, 136), (268, 137), (268, 138), (268, 139), (268, 140), (268, 143), (269, 134), (269, 136), (269, 137), (269, 138), (269, 139), (269, 140), (269, 141), (269, 142), (269, 144), (270, 137), (270, 138), (270, 139), (270, 140), (270, 141), (270, 142), (270, 143), (270, 145), (271, 135), (271, 137), (271, 138), (271, 139), (271, 140), (271, 141), (271, 142), (271, 143), (271, 144), (271, 146), (272, 136), (272, 138), (272, 139), (272, 140), (272, 141), (272, 142), (272, 143), (272, 144), (272, 145), (272, 147), (273, 137), (273, 139), (273, 140), (273, 141), (273, 142), (273, 143), (273, 144), (273, 145), (273, 146), (273, 148), (274, 138), (274, 140), (274, 141), (274, 142), (274, 143), (274, 144), (274, 145), (274, 146), (275, 139), (275, 141), (275, 142), (275, 143), (275, 144), (275, 145), (275, 146), (275, 147), (275, 149), (276, 140), (276, 142), (276, 143), (276, 144), (276, 145), (276, 146), (276, 147), (276, 148), (276, 150), (277, 141), (277, 143), (277, 144), (277, 145), (277, 146), (277, 147), (277, 148), (277, 149), (278, 142), (278, 144), (278, 145), (278, 146), (278, 147), (278, 148), (278, 151), (279, 143), (279, 145), (279, 146), (279, 147), (279, 149), (279, 150), (279, 152), (280, 144), (280, 146), (280, 148), (281, 145), (281, 147), (282, 146))
coordinates_ffcccc = ((159, 58), (159, 59), (160, 58), (161, 58), (161, 59), (163, 58), (163, 59), (183, 29), (183, 31), (184, 27), (184, 34), (185, 25), (185, 28), (185, 29), (185, 30), (185, 31), (185, 32), (185, 35), (185, 36), (185, 37), (186, 24), (186, 27), (186, 28), (186, 29), (186, 30), (186, 31), (186, 32), (186, 33), (186, 34), (186, 38), (186, 40), (187, 23), (187, 25), (187, 26), (187, 27), (187, 28), (187, 29), (187, 30), (187, 31), (187, 32), (187, 33), (187, 34), (187, 35), (187, 36), (187, 37), (187, 40), (188, 22), (188, 24), (188, 25), (188, 26), (188, 27), (188, 28), (188, 29), (188, 30), (188, 31), (188, 32), (188, 33), (188, 34), (188, 35), (188, 36), (188, 37), (188, 38), (188, 39), (188, 41), (189, 24), (189, 25), (189, 26), (189, 27), (189, 28), (189, 29), (189, 30), (189, 31), (189, 32), (189, 33), (189, 34), (189, 35), (189, 36), (189, 37), (189, 38), (189, 39), (189, 40), (189, 43), (189, 44), (189, 46), (190, 21), (190, 23), (190, 24), (190, 25), (190, 26), (190, 27), (190, 28), (190, 29), (190, 30), (190, 31), (190, 32), (190, 33), (190, 34), (190, 35), (190, 36), (190, 37), (190, 38), (190, 39), (190, 40), (190, 41), (190, 46), (191, 20), (191, 22), (191, 23), (191, 24), (191, 25), (191, 26), (191, 27), (191, 28), (191, 29), (191, 30), (191, 31), (191, 32), (191, 33), (191, 34), (191, 35), (191, 36), (191, 37), (191, 38), (191, 39), (191, 40), (191, 41), (191, 42), (191, 43), (191, 44), (191, 45), (191, 47), (192, 19), (192, 21), (192, 22), (192, 23), (192, 24), (192, 25), (192, 26), (192, 27), (192, 28), (192, 29), (192, 30), (192, 31), (192, 32), (192, 33), (192, 34), (192, 35), (192, 36), (192, 37), (192, 38), (192, 39), (192, 40), (192, 41), (192, 42), (192, 43), (192, 44), (192, 45), (192, 47), (193, 19), (193, 21), (193, 22), (193, 23), (193, 24), (193, 25), (193, 26), (193, 27), (193, 28), (193, 29), (193, 30), (193, 31), (193, 32), (193, 33), (193, 34), (193, 35), (193, 36), (193, 37), (193, 38), (193, 39), (193, 40), (193, 41), (193, 42), (193, 43), (193, 44), (193, 45), (193, 47), (194, 18), (194, 20), (194, 21), (194, 22), (194, 23), (194, 24), (194, 25), (194, 26), (194, 27), (194, 28), (194, 29), (194, 30), (194, 31), (194, 32), (194, 33), (194, 34), (194, 35), (194, 36), (194, 37), (194, 38), (194, 39), (194, 40), (194, 41), (194, 42), (194, 43), (194, 44), (194, 45), (194, 46), (194, 48), (195, 18), (195, 20), (195, 21), (195, 22), (195, 23), (195, 24), (195, 25), (195, 26), (195, 27), (195, 28), (195, 29), (195, 30), (195, 31), (195, 32), (195, 33), (195, 34), (195, 35), (195, 36), (195, 37), (195, 38), (195, 39), (195, 40), (195, 41), (195, 42), (195, 43), (195, 44), (195, 45), (195, 46), (195, 48), (196, 17), (196, 19), (196, 20), (196, 21), (196, 22), (196, 23), (196, 24), (196, 25), (196, 26), (196, 27), (196, 28), (196, 29), (196, 30), (196, 31), (196, 32), (196, 33), (196, 34), (196, 35), (196, 36), (196, 37), (196, 38), (196, 39), (196, 40), (196, 41), (196, 42), (196, 43), (196, 44), (196, 45), (196, 46), (196, 47), (196, 49), (197, 17), (197, 19), (197, 20), (197, 21), (197, 22), (197, 23), (197, 24), (197, 25), (197, 26), (197, 27), (197, 28), (197, 29), (197, 30), (197, 31), (197, 32), (197, 33), (197, 34), (197, 35), (197, 36), (197, 37), (197, 38), (197, 39), (197, 40), (197, 41), (197, 42), (197, 43), (197, 44), (197, 45), (197, 46), (197, 47), (197, 49), (198, 16), (198, 18), (198, 19), (198, 20), (198, 21), (198, 22), (198, 23), (198, 24), (198, 25), (198, 26), (198, 27), (198, 28), (198, 29), (198, 30), (198, 31), (198, 32), (198, 33), (198, 34), (198, 35), (198, 36), (198, 37), (198, 38), (198, 39), (198, 40), (198, 41), (198, 42), (198, 43), (198, 44), (198, 45), (198, 46), (198, 47), (198, 49), (199, 16), (199, 18), (199, 19), (199, 20), (199, 21), (199, 22), (199, 23), (199, 24), (199, 25), (199, 26), (199, 27), (199, 28), (199, 29), (199, 30), (199, 31), (199, 32), (199, 33), (199, 34), (199, 35), (199, 36), (199, 37), (199, 38), (199, 39), (199, 40), (199, 41), (199, 42), (199, 43), (199, 44), (199, 45), (199, 46), (199, 47), (199, 49), (200, 15), (200, 17), (200, 18), (200, 19), (200, 20), (200, 21), (200, 22), (200, 23), (200, 24), (200, 25), (200, 26), (200, 27), (200, 28), (200, 29), (200, 30), (200, 31), (200, 32), (200, 33), (200, 34), (200, 35), (200, 36), (200, 37), (200, 38), (200, 39), (200, 40), (200, 41), (200, 42), (200, 43), (200, 44), (200, 45), (200, 46), (200, 47), (200, 49), (201, 15), (201, 17), (201, 18), (201, 19), (201, 20), (201, 21), (201, 22), (201, 23), (201, 24), (201, 25), (201, 26), (201, 27), (201, 28), (201, 29), (201, 30), (201, 31), (201, 32), (201, 33), (201, 34), (201, 35), (201, 36), (201, 37), (201, 38), (201, 39), (201, 40), (201, 41), (201, 42), (201, 43), (201, 44), (201, 45), (201, 46), (201, 47), (201, 49), (202, 15), (202, 17), (202, 18), (202, 19), (202, 20), (202, 21), (202, 22), (202, 23), (202, 24), (202, 25), (202, 26), (202, 27), (202, 28), (202, 29), (202, 30), (202, 31), (202, 32), (202, 33), (202, 34), (202, 35), (202, 36), (202, 37), (202, 38), (202, 39), (202, 40), (202, 41), (202, 42), (202, 43), (202, 44), (202, 45), (202, 46), (202, 47), (202, 49), (203, 14), (203, 16), (203, 17), (203, 18), (203, 19), (203, 20), (203, 21), (203, 22), (203, 23), (203, 24), (203, 25), (203, 26), (203, 27), (203, 28), (203, 29), (203, 30), (203, 31), (203, 32), (203, 33), (203, 34), (203, 35), (203, 36), (203, 37), (203, 38), (203, 39), (203, 40), (203, 41), (203, 42), (203, 43), (203, 44), (203, 45), (203, 46), (203, 47), (203, 49), (204, 14), (204, 16), (204, 17), (204, 18), (204, 19), (204, 20), (204, 21), (204, 22), (204, 23), (204, 24), (204, 25), (204, 26), (204, 27), (204, 28), (204, 29), (204, 30), (204, 31), (204, 32), (204, 33), (204, 34), (204, 35), (204, 36), (204, 37), (204, 38), (204, 39), (204, 40), (204, 41), (204, 42), (204, 43), (204, 44), (204, 45), (204, 46), (204, 47), (204, 49), (205, 14), (205, 16), (205, 17), (205, 18), (205, 19), (205, 20), (205, 21), (205, 22), (205, 23), (205, 24), (205, 25), (205, 26), (205, 27), (205, 28), (205, 29), (205, 30), (205, 31), (205, 32), (205, 33), (205, 34), (205, 35), (205, 36), (205, 37), (205, 38), (205, 39), (205, 40), (205, 41), (205, 42), (205, 43), (205, 44), (205, 45), (205, 46), (205, 47), (205, 49), (206, 13), (206, 14), (206, 15), (206, 16), (206, 17), (206, 18), (206, 19), (206, 20), (206, 21), (206, 22), (206, 23), (206, 24), (206, 25), (206, 26), (206, 27), (206, 28), (206, 29), (206, 30), (206, 31), (206, 32), (206, 33), (206, 34), (206, 35), (206, 36), (206, 37), (206, 38), (206, 39), (206, 40), (206, 41), (206, 42), (206, 43), (206, 44), (206, 45), (206, 46), (206, 47), (206, 48), (207, 13), (207, 15), (207, 16), (207, 17), (207, 18), (207, 19), (207, 20), (207, 21), (207, 22), (207, 23), (207, 24), (207, 25), (207, 26), (207, 27), (207, 28), (207, 29), (207, 30), (207, 31), (207, 32), (207, 33), (207, 34), (207, 35), (207, 36), (207, 37), (207, 38), (207, 39), (207, 40), (207, 41), (207, 42), (207, 43), (207, 44), (207, 45), (207, 46), (207, 48), (208, 13), (208, 15), (208, 16), (208, 17), (208, 18), (208, 19), (208, 20), (208, 21), (208, 22), (208, 23), (208, 24), (208, 25), (208, 26), (208, 27), (208, 28), (208, 29), (208, 30), (208, 31), (208, 32), (208, 33), (208, 34), (208, 35), (208, 36), (208, 37), (208, 38), (208, 39), (208, 40), (208, 41), (208, 42), (208, 43), (208, 44), (208, 45), (208, 47), (209, 13), (209, 15), (209, 16), (209, 17), (209, 18), (209, 19), (209, 20), (209, 21), (209, 22), (209, 23), (209, 24), (209, 25), (209, 26), (209, 27), (209, 28), (209, 29), (209, 30), (209, 31), (209, 32), (209, 33), (209, 34), (209, 35), (209, 36), (209, 37), (209, 38), (209, 39), (209, 40), (209, 41), (209, 42), (209, 43), (209, 44), (209, 46), (210, 13), (210, 15), (210, 16), (210, 17), (210, 18), (210, 19), (210, 20), (210, 21), (210, 22), (210, 23), (210, 24), (210, 25), (210, 26), (210, 27), (210, 28), (210, 29), (210, 30), (210, 31), (210, 32), (210, 33), (210, 34), (210, 35), (210, 36), (210, 37), (210, 38), (210, 39), (210, 40), (210, 41), (210, 42), (210, 43), (210, 45), (211, 13), (211, 15), (211, 16), (211, 17), (211, 18), (211, 19), (211, 20), (211, 21), (211, 22), (211, 23), (211, 24), (211, 25), (211, 26), (211, 27), (211, 28), (211, 29), (211, 30), (211, 31), (211, 32), (211, 33), (211, 34), (211, 35), (211, 36), (211, 37), (211, 38), (211, 39), (211, 40), (211, 41), (211, 42), (211, 44), (212, 15), (212, 16), (212, 17), (212, 18), (212, 19), (212, 20), (212, 21), (212, 22), (212, 23), (212, 24), (212, 25), (212, 26), (212, 27), (212, 28), (212, 29), (212, 30), (212, 31), (212, 32), (212, 33), (212, 34), (212, 35), (212, 36), (212, 37), (212, 38), (212, 39), (212, 40), (212, 41), (212, 43), (213, 14), (213, 16), (213, 17), (213, 18), (213, 19), (213, 20), (213, 21), (213, 22), (213, 23), (213, 24), (213, 25), (213, 26), (213, 27), (213, 28), (213, 29), (213, 30), (213, 31), (213, 32), (213, 33), (213, 34), (213, 35), (213, 36), (213, 37), (213, 38), (213, 39), (213, 42), (214, 15), (214, 17), (214, 18), (214, 19), (214, 20), (214, 21), (214, 22), (214, 23), (214, 24), (214, 25), (214, 26), (214, 27), (214, 28), (214, 29), (214, 30), (214, 31), (214, 32), (214, 33), (214, 34), (214, 35), (214, 36), (214, 37), (214, 38), (214, 41), (215, 18), (215, 19), (215, 20), (215, 21), (215, 22), (215, 23), (215, 24), (215, 25), (215, 26), (215, 27), (215, 28), (215, 29), (215, 30), (215, 31), (215, 32), (215, 33), (215, 34), (215, 35), (215, 36), (215, 37), (215, 38), (215, 40), (216, 16), (216, 18), (216, 19), (216, 20), (216, 21), (216, 22), (216, 23), (216, 24), (216, 25), (216, 26), (216, 27), (216, 28), (216, 29), (216, 30), (216, 31), (216, 32), (216, 33), (216, 34), (216, 35), (216, 36), (216, 37), (216, 39), (217, 17), (217, 19), (217, 20), (217, 21), (217, 22), (217, 23), (217, 24), (217, 25), (217, 26), (217, 27), (217, 28), (217, 29), (217, 30), (217, 31), (217, 32), (217, 33), (217, 34), (217, 35), (217, 36), (217, 38), (218, 18), (218, 20), (218, 21), (218, 22), (218, 23), (218, 24), (218, 25), (218, 26), (218, 27), (218, 28), (218, 29), (218, 30), (218, 31), (218, 32), (218, 33), (218, 34), (218, 35), (218, 37), (219, 19), (219, 37), (220, 20), (220, 22), (220, 23), (220, 24), (220, 25), (220, 26), (220, 27), (220, 28), (220, 29), (220, 30), (220, 31), (220, 32), (220, 33), (220, 34), (220, 35), (220, 37), (225, 19), (225, 21), (225, 22), (225, 23), (225, 24), (225, 25), (225, 26), (225, 27), (225, 28), (225, 29), (225, 30), (225, 31), (225, 32), (225, 33), (225, 34), (225, 35), (225, 36), (225, 37), (225, 38), (225, 40), (226, 18), (226, 41), (227, 18), (227, 20), (227, 21), (227, 22), (227, 23), (227, 24), (227, 25), (227, 26), (227, 27), (227, 28), (227, 29), (227, 30), (227, 31), (227, 32), (227, 33), (227, 34), (227, 35), (227, 36), (227, 37), (227, 38), (227, 39), (227, 40), (228, 17), (228, 19), (228, 20), (228, 21), (228, 22), (228, 23), (228, 24), (228, 25), (228, 26), (228, 27), (228, 28), (228, 29), (228, 30), (228, 31), (228, 32), (228, 33), (228, 34), (228, 35), (228, 36), (228, 37), (228, 38), (228, 39), (228, 40), (228, 41), (228, 44), (229, 16), (229, 18), (229, 19), (229, 20), (229, 21), (229, 22), (229, 23), (229, 24), (229, 25), (229, 26), (229, 27), (229, 28), (229, 29), (229, 30), (229, 31), (229, 32), (229, 33), (229, 34), (229, 35), (229, 36), (229, 37), (229, 38), (229, 39), (229, 40), (229, 41), (229, 42), (229, 45), (230, 15), (230, 17), (230, 18), (230, 19), (230, 20), (230, 21), (230, 22), (230, 23), (230, 24), (230, 25), (230, 26), (230, 27), (230, 28), (230, 29), (230, 30), (230, 31), (230, 32), (230, 33), (230, 34), (230, 35), (230, 36), (230, 37), (230, 38), (230, 39), (230, 40), (230, 41), (230, 42), (230, 43), (230, 44), (230, 46), (231, 14), (231, 16), (231, 17), (231, 18), (231, 19), (231, 20), (231, 21), (231, 22), (231, 23), (231, 24), (231, 25), (231, 26), (231, 27), (231, 28), (231, 29), (231, 30), (231, 31), (231, 32), (231, 33), (231, 34), (231, 35), (231, 36), (231, 37), (231, 38), (231, 39), (231, 40), (231, 41), (231, 42), (231, 43), (231, 44), (231, 45), (232, 14), (232, 16), (232, 17), (232, 18), (232, 19), (232, 20), (232, 21), (232, 22), (232, 23), (232, 24), (232, 25), (232, 26), (232, 27), (232, 28), (232, 29), (232, 30), (232, 31), (232, 32), (232, 33), (232, 34), (232, 35), (232, 36), (232, 37), (232, 38), (232, 39), (232, 40), (232, 41), (232, 42), (232, 43), (232, 44), (232, 45), (232, 46), (232, 48), (233, 13), (233, 15), (233, 16), (233, 17), (233, 18), (233, 19), (233, 20), (233, 21), (233, 22), (233, 23), (233, 24), (233, 25), (233, 26), (233, 27), (233, 28), (233, 29), (233, 30), (233, 31), (233, 32), (233, 33), (233, 34), (233, 35), (233, 36), (233, 37), (233, 38), (233, 39), (233, 40), (233, 41), (233, 42), (233, 43), (233, 44), (233, 45), (233, 46), (233, 47), (233, 49), (234, 13), (234, 15), (234, 16), (234, 17), (234, 18), (234, 19), (234, 20), (234, 21), (234, 22), (234, 23), (234, 24), (234, 25), (234, 26), (234, 27), (234, 28), (234, 29), (234, 30), (234, 31), (234, 32), (234, 33), (234, 34), (234, 35), (234, 36), (234, 37), (234, 38), (234, 39), (234, 40), (234, 41), (234, 42), (234, 43), (234, 44), (234, 45), (234, 46), (234, 47), (234, 48), (234, 50), (235, 13), (235, 15), (235, 16), (235, 17), (235, 18), (235, 19), (235, 20), (235, 21), (235, 22), (235, 23), (235, 24), (235, 25), (235, 26), (235, 27), (235, 28), (235, 29), (235, 30), (235, 31), (235, 32), (235, 33), (235, 34), (235, 35), (235, 36), (235, 37), (235, 38), (235, 39), (235, 40), (235, 41), (235, 42), (235, 43), (235, 44), (235, 45), (235, 46), (235, 47), (235, 48), (235, 49), (235, 51), (236, 13), (236, 15), (236, 16), (236, 17), (236, 18), (236, 19), (236, 20), (236, 21), (236, 22), (236, 23), (236, 24), (236, 25), (236, 26), (236, 27), (236, 28), (236, 29), (236, 30), (236, 31), (236, 32), (236, 33), (236, 34), (236, 35), (236, 36), (236, 37), (236, 38), (236, 39), (236, 40), (236, 41), (236, 42), (236, 43), (236, 44), (236, 45), (236, 46), (236, 47), (236, 48), (236, 49), (236, 51), (237, 13), (237, 15), (237, 16), (237, 17), (237, 18), (237, 19), (237, 20), (237, 21), (237, 22), (237, 23), (237, 24), (237, 25), (237, 26), (237, 27), (237, 28), (237, 29), (237, 30), (237, 31), (237, 32), (237, 33), (237, 34), (237, 35), (237, 36), (237, 37), (237, 38), (237, 39), (237, 40), (237, 41), (237, 42), (237, 43), (237, 44), (237, 45), (237, 46), (237, 47), (237, 48), (237, 49), (237, 51), (238, 12), (238, 13), (238, 14), (238, 15), (238, 16), (238, 17), (238, 18), (238, 19), (238, 20), (238, 21), (238, 22), (238, 23), (238, 24), (238, 25), (238, 26), (238, 27), (238, 28), (238, 29), (238, 30), (238, 31), (238, 32), (238, 33), (238, 34), (238, 35), (238, 36), (238, 37), (238, 38), (238, 39), (238, 40), (238, 41), (238, 42), (238, 43), (238, 44), (238, 45), (238, 46), (238, 47), (238, 48), (238, 49), (238, 50), (238, 52), (239, 13), (239, 15), (239, 16), (239, 17), (239, 18), (239, 19), (239, 20), (239, 21), (239, 22), (239, 23), (239, 24), (239, 25), (239, 26), (239, 27), (239, 28), (239, 29), (239, 30), (239, 31), (239, 32), (239, 33), (239, 34), (239, 35), (239, 36), (239, 37), (239, 38), (239, 39), (239, 40), (239, 41), (239, 42), (239, 43), (239, 44), (239, 45), (239, 46), (239, 47), (239, 48), (239, 49), (239, 50), (239, 52), (240, 13), (240, 15), (240, 16), (240, 17), (240, 18), (240, 19), (240, 20), (240, 21), (240, 22), (240, 23), (240, 24), (240, 25), (240, 26), (240, 27), (240, 28), (240, 29), (240, 30), (240, 31), (240, 32), (240, 33), (240, 34), (240, 35), (240, 36), (240, 37), (240, 38), (240, 39), (240, 40), (240, 41), (240, 42), (240, 43), (240, 44), (240, 45), (240, 46), (240, 47), (240, 48), (240, 49), (240, 50), (240, 52), (241, 13), (241, 15), (241, 16), (241, 17), (241, 18), (241, 19), (241, 20), (241, 21), (241, 22), (241, 23), (241, 24), (241, 25), (241, 26), (241, 27), (241, 28), (241, 29), (241, 30), (241, 31), (241, 32), (241, 33), (241, 34), (241, 35), (241, 36), (241, 37), (241, 38), (241, 39), (241, 40), (241, 41), (241, 42), (241, 43), (241, 44), (241, 45), (241, 46), (241, 47), (241, 48), (241, 49), (241, 50), (241, 52), (242, 13), (242, 15), (242, 16), (242, 17), (242, 18), (242, 19), (242, 20), (242, 21), (242, 22), (242, 23), (242, 24), (242, 25), (242, 26), (242, 27), (242, 28), (242, 29), (242, 30), (242, 31), (242, 32), (242, 33), (242, 34), (242, 35), (242, 36), (242, 37), (242, 38), (242, 39), (242, 40), (242, 41), (242, 42), (242, 43), (242, 44), (242, 45), (242, 46), (242, 47), (242, 48), (242, 49), (242, 50), (242, 52), (243, 13), (243, 15), (243, 16), (243, 17), (243, 18), (243, 19), (243, 20), (243, 21), (243, 22), (243, 23), (243, 24), (243, 25), (243, 26), (243, 27), (243, 28), (243, 29), (243, 30), (243, 31), (243, 32), (243, 33), (243, 34), (243, 35), (243, 36), (243, 37), (243, 38), (243, 39), (243, 40), (243, 41), (243, 42), (243, 43), (243, 44), (243, 45), (243, 46), (243, 47), (243, 48), (243, 49), (243, 50), (243, 52), (244, 13), (244, 15), (244, 16), (244, 17), (244, 18), (244, 19), (244, 20), (244, 21), (244, 22), (244, 23), (244, 24), (244, 25), (244, 26), (244, 27), (244, 28), (244, 29), (244, 30), (244, 31), (244, 32), (244, 33), (244, 34), (244, 35), (244, 36), (244, 37), (244, 38), (244, 39), (244, 40), (244, 41), (244, 42), (244, 43), (244, 44), (244, 45), (244, 46), (244, 47), (244, 48), (244, 49), (244, 50), (244, 52), (245, 13), (245, 15), (245, 16), (245, 17), (245, 18), (245, 19), (245, 20), (245, 21), (245, 22), (245, 23), (245, 24), (245, 25), (245, 26), (245, 27), (245, 28), (245, 29), (245, 30), (245, 31), (245, 32), (245, 33), (245, 34), (245, 35), (245, 36), (245, 37), (245, 38), (245, 39), (245, 40), (245, 41), (245, 42), (245, 43), (245, 44), (245, 45), (245, 46), (245, 47), (245, 48), (245, 49), (245, 50), (245, 52), (246, 14), (246, 16), (246, 17), (246, 18), (246, 19), (246, 20), (246, 21), (246, 22), (246, 23), (246, 24), (246, 25), (246, 26), (246, 27), (246, 28), (246, 29), (246, 30), (246, 31), (246, 32), (246, 33), (246, 34), (246, 35), (246, 36), (246, 37), (246, 38), (246, 39), (246, 40), (246, 41), (246, 42), (246, 43), (246, 44), (246, 45), (246, 46), (246, 47), (246, 48), (246, 49), (246, 50), (246, 52), (247, 14), (247, 16), (247, 17), (247, 18), (247, 19), (247, 20), (247, 21), (247, 22), (247, 23), (247, 24), (247, 25), (247, 26), (247, 27), (247, 28), (247, 29), (247, 30), (247, 31), (247, 32), (247, 33), (247, 34), (247, 35), (247, 36), (247, 37), (247, 38), (247, 39), (247, 40), (247, 41), (247, 42), (247, 43), (247, 44), (247, 45), (247, 46), (247, 47), (247, 48), (247, 49), (247, 50), (247, 52), (248, 14), (248, 16), (248, 17), (248, 18), (248, 19), (248, 20), (248, 21), (248, 22), (248, 23), (248, 24), (248, 25), (248, 26), (248, 27), (248, 28), (248, 29), (248, 30), (248, 31), (248, 32), (248, 33), (248, 34), (248, 35), (248, 36), (248, 37), (248, 38), (248, 39), (248, 40), (248, 41), (248, 42), (248, 43), (248, 44), (248, 45), (248, 46), (248, 47), (248, 48), (248, 49), (248, 50), (248, 52), (249, 15), (249, 17), (249, 18), (249, 19), (249, 20), (249, 21), (249, 22), (249, 23), (249, 24), (249, 25), (249, 26), (249, 27), (249, 28), (249, 29), (249, 30), (249, 31), (249, 32), (249, 33), (249, 34), (249, 35), (249, 36), (249, 37), (249, 38), (249, 39), (249, 40), (249, 41), (249, 42), (249, 43), (249, 44), (249, 45), (249, 46), (249, 47), (249, 48), (249, 49), (249, 51), (250, 15), (250, 17), (250, 18), (250, 19), (250, 20), (250, 21), (250, 22), (250, 23), (250, 24), (250, 25), (250, 26), (250, 27), (250, 28), (250, 29), (250, 30), (250, 31), (250, 32), (250, 33), (250, 34), (250, 35), (250, 36), (250, 37), (250, 38), (250, 39), (250, 40), (250, 41), (250, 42), (250, 43), (250, 44), (250, 45), (250, 46), (250, 47), (250, 48), (250, 49), (250, 51), (251, 15), (251, 17), (251, 18), (251, 19), (251, 20), (251, 21), (251, 22), (251, 23), (251, 24), (251, 25), (251, 26), (251, 27), (251, 28), (251, 29), (251, 30), (251, 31), (251, 32), (251, 33), (251, 34), (251, 35), (251, 36), (251, 37), (251, 38), (251, 39), (251, 40), (251, 41), (251, 42), (251, 43), (251, 44), (251, 45), (251, 46), (251, 47), (251, 48), (251, 49), (251, 51), (252, 16), (252, 18), (252, 19), (252, 20), (252, 21), (252, 22), (252, 23), (252, 24), (252, 25), (252, 26), (252, 27), (252, 28), (252, 29), (252, 30), (252, 31), (252, 32), (252, 33), (252, 34), (252, 35), (252, 36), (252, 37), (252, 38), (252, 39), (252, 40), (252, 41), (252, 42), (252, 43), (252, 44), (252, 45), (252, 46), (252, 47), (252, 48), (252, 50), (253, 16), (253, 18), (253, 19), (253, 20), (253, 21), (253, 22), (253, 23), (253, 24), (253, 25), (253, 26), (253, 27), (253, 28), (253, 29), (253, 30), (253, 31), (253, 32), (253, 33), (253, 34), (253, 35), (253, 36), (253, 37), (253, 38), (253, 39), (253, 40), (253, 41), (253, 42), (253, 43), (253, 44), (253, 45), (253, 46), (253, 47), (253, 48), (253, 50), (254, 17), (254, 19), (254, 20), (254, 21), (254, 22), (254, 23), (254, 24), (254, 25), (254, 26), (254, 27), (254, 28), (254, 29), (254, 30), (254, 31), (254, 32), (254, 33), (254, 34), (254, 35), (254, 36), (254, 37), (254, 38), (254, 39), (254, 40), (254, 41), (254, 42), (254, 43), (254, 44), (254, 45), (254, 46), (254, 50), (255, 18), (255, 20), (255, 21), (255, 22), (255, 23), (255, 24), (255, 25), (255, 26), (255, 27), (255, 28), (255, 29), (255, 30), (255, 31), (255, 32), (255, 33), (255, 34), (255, 35), (255, 36), (255, 37), (255, 38), (255, 39), (255, 40), (255, 41), (255, 42), (255, 43), (255, 44), (255, 47), (255, 49), (256, 18), (256, 20), (256, 21), (256, 22), (256, 23), (256, 24), (256, 25), (256, 26), (256, 27), (256, 28), (256, 29), (256, 30), (256, 31), (256, 32), (256, 33), (256, 34), (256, 35), (256, 36), (256, 37), (256, 38), (256, 39), (256, 40), (256, 41), (256, 42), (256, 43), (256, 45), (256, 46), (256, 49), (257, 19), (257, 21), (257, 22), (257, 23), (257, 24), (257, 25), (257, 26), (257, 27), (257, 28), (257, 29), (257, 30), (257, 31), (257, 32), (257, 33), (257, 34), (257, 35), (257, 36), (257, 37), (257, 38), (257, 39), (257, 40), (257, 41), (257, 42), (257, 44), (258, 20), (258, 22), (258, 23), (258, 24), (258, 25), (258, 26), (258, 27), (258, 28), (258, 29), (258, 30), (258, 31), (258, 32), (258, 33), (258, 34), (258, 35), (258, 36), (258, 37), (258, 38), (258, 43), (259, 23), (259, 24), (259, 25), (259, 26), (259, 27), (259, 28), (259, 29), (259, 30), (259, 31), (259, 32), (259, 33), (259, 34), (259, 35), (259, 39), (259, 40), (259, 41), (259, 43), (260, 22), (260, 25), (260, 26), (260, 27), (260, 28), (260, 29), (260, 30), (260, 31), (260, 32), (260, 36), (260, 37), (260, 38), (261, 23), (261, 33), (261, 34), (261, 35), (262, 25), (262, 26), (262, 27), (262, 28), (262, 29), (262, 30), (262, 31), (264, 48), (264, 50), (265, 52), (265, 53), (266, 49), (266, 51), (266, 54), (267, 50), (267, 53), (267, 56), (268, 51), (268, 54), (268, 57), (269, 53), (269, 55), (269, 56), (270, 54), (270, 56), (270, 57), (271, 54), (271, 56), (271, 57), (271, 58), (271, 60), (272, 54), (272, 56), (272, 57), (272, 58), (272, 59), (272, 61), (273, 54), (273, 56), (273, 57), (273, 58), (273, 59), (273, 61), (274, 53), (274, 55), (274, 56), (274, 57), (274, 58), (274, 59), (274, 60), (274, 62), (275, 53), (275, 55), (275, 56), (275, 57), (275, 58), (275, 59), (275, 60), (275, 62), (276, 53), (276, 55), (276, 56), (276, 57), (276, 58), (276, 59), (276, 60), (276, 62), (277, 53), (277, 55), (277, 56), (277, 57), (277, 58), (277, 59), (277, 61), (278, 52), (278, 54), (278, 55), (278, 56), (278, 57), (278, 58), (278, 59), (278, 61), (279, 52), (279, 54), (279, 55), (279, 56), (279, 57), (279, 58), (279, 59), (279, 61), (280, 53), (280, 54), (280, 55), (280, 56), (280, 57), (280, 58), (281, 53), (281, 60), (282, 54), (282, 56), (282, 57), (282, 59))
coordinates_ff6600 = ((157, 76), (157, 78), (158, 74), (158, 78), (158, 79), (159, 68), (159, 73), (159, 76), (159, 77), (159, 78), (159, 80), (159, 81), (159, 82), (159, 83), (159, 84), (159, 86), (160, 66), (160, 68), (160, 73), (160, 75), (160, 76), (160, 77), (160, 78), (160, 83), (160, 85), (161, 64), (161, 69), (161, 72), (161, 74), (161, 79), (161, 80), (161, 82), (162, 61), (162, 65), (162, 66), (162, 67), (162, 68), (162, 75), (162, 76), (162, 77), (162, 78), (163, 61), (163, 63), (163, 64), (163, 65), (163, 66), (163, 67), (163, 68), (163, 69), (163, 73), (163, 74), (164, 61), (164, 63), (164, 64), (164, 65), (164, 66), (164, 67), (164, 68), (164, 72), (165, 58), (165, 60), (165, 61), (165, 62), (165, 63), (165, 64), (165, 65), (165, 66), (165, 67), (165, 70), (166, 59), (166, 61), (166, 62), (166, 63), (166, 64), (166, 65), (166, 68), (167, 60), (167, 62), (167, 63), (167, 64), (167, 67), (168, 60), (168, 61), (168, 62), (168, 65), (169, 61), (169, 64), (170, 60), (170, 62), (171, 61), (172, 57), (172, 60), (173, 55), (173, 58), (174, 54), (174, 57), (175, 52), (175, 56), (176, 50), (176, 55), (177, 49), (177, 54), (178, 47), (178, 50), (178, 53), (179, 46), (179, 49), (179, 52), (180, 45), (180, 47), (180, 48), (180, 49), (180, 51), (181, 44), (181, 46), (181, 47), (181, 48), (181, 50), (182, 43), (182, 45), (182, 46), (182, 47), (182, 49), (183, 42), (183, 44), (183, 45), (183, 46), (183, 48), (184, 42), (184, 44), (184, 45), (184, 47), (185, 42), (185, 44), (185, 45), (185, 47), (186, 42), (187, 43), (187, 46), (258, 46), (258, 48), (258, 49), (258, 50), (258, 51), (258, 52), (258, 53), (258, 54), (258, 55), (258, 56), (258, 57), (258, 59), (259, 45), (259, 60), (260, 46), (260, 48), (260, 49), (260, 50), (260, 51), (260, 52), (260, 53), (260, 54), (260, 55), (260, 56), (260, 57), (260, 58), (260, 59), (260, 61), (261, 47), (261, 52), (261, 53), (261, 54), (261, 55), (261, 56), (261, 57), (261, 58), (261, 59), (261, 60), (261, 63), (262, 48), (262, 50), (262, 51), (262, 54), (262, 55), (262, 56), (262, 57), (262, 58), (262, 59), (262, 60), (262, 61), (262, 64), (263, 52), (263, 53), (263, 56), (263, 57), (263, 58), (263, 59), (263, 60), (263, 61), (263, 62), (263, 63), (263, 65), (264, 54), (264, 58), (264, 59), (264, 60), (264, 61), (264, 62), (264, 63), (264, 64), (264, 66), (265, 56), (265, 59), (265, 60), (265, 61), (265, 62), (265, 63), (265, 64), (265, 65), (265, 68), (266, 58), (266, 60), (266, 61), (266, 62), (266, 63), (266, 64), (266, 65), (266, 66), (266, 69), (267, 59), (267, 61), (267, 62), (267, 63), (267, 64), (267, 65), (267, 66), (267, 67), (267, 70), (268, 60), (268, 62), (268, 63), (268, 64), (268, 65), (268, 66), (268, 67), (268, 68), (268, 69), (268, 71), (269, 61), (269, 63), (269, 64), (269, 65), (269, 66), (269, 67), (269, 68), (269, 69), (269, 70), (269, 72), (270, 62), (270, 64), (270, 65), (270, 66), (270, 67), (270, 68), (270, 69), (270, 70), (270, 71), (270, 74), (271, 63), (271, 65), (271, 66), (271, 67), (271, 68), (271, 69), (271, 70), (271, 71), (271, 72), (271, 75), (272, 63), (272, 65), (272, 66), (272, 67), (272, 68), (272, 69), (272, 70), (272, 71), (272, 72), (272, 73), (272, 76), (273, 64), (273, 67), (273, 68), (273, 69), (273, 70), (273, 71), (273, 72), (273, 73), (273, 74), (273, 75), (273, 77), (274, 64), (274, 66), (274, 69), (274, 70), (274, 71), (274, 72), (274, 73), (274, 74), (274, 75), (274, 76), (274, 78), (275, 68), (275, 71), (275, 72), (275, 73), (275, 74), (275, 75), (275, 76), (275, 77), (275, 79), (276, 69), (276, 72), (276, 73), (276, 74), (276, 75), (276, 76), (276, 77), (276, 78), (276, 81), (277, 71), (277, 74), (277, 75), (277, 76), (277, 77), (277, 78), (277, 79), (277, 82), (278, 72), (278, 75), (278, 76), (278, 77), (278, 78), (278, 79), (278, 80), (278, 83), (279, 74), (279, 76), (279, 77), (279, 78), (279, 79), (279, 80), (279, 81), (279, 82), (279, 84), (280, 75), (280, 77), (280, 78), (280, 79), (280, 80), (280, 81), (280, 82), (280, 83), (280, 85), (281, 76), (281, 79), (281, 80), (281, 81), (281, 82), (281, 83), (281, 84), (281, 86), (282, 77), (282, 80), (282, 81), (282, 82), (282, 83), (282, 84), (282, 85), (282, 88), (283, 81), (283, 82), (283, 83), (283, 84), (283, 85), (283, 86), (283, 89), (284, 80), (284, 82), (284, 83), (284, 84), (284, 85), (284, 86), (284, 87), (284, 90), (285, 81), (285, 83), (285, 84), (285, 85), (285, 86), (285, 87), (285, 88), (285, 89), (285, 91), (286, 82), (286, 85), (286, 86), (286, 87), (286, 88), (286, 89), (286, 90), (286, 92), (287, 83), (287, 86), (287, 87), (287, 88), (287, 89), (287, 90), (287, 91), (287, 93), (288, 84), (288, 87), (288, 88), (288, 89), (288, 90), (288, 94), (289, 86), (289, 89), (289, 90), (289, 92), (290, 87), (291, 90))
coordinates_ff9966 = ((152, 74), (152, 76), (153, 71), (153, 73), (153, 77), (154, 69), (154, 74), (154, 75), (154, 77), (155, 67), (155, 71), (155, 72), (155, 73), (155, 77), (156, 65), (156, 74), (156, 75), (157, 63), (157, 64), (157, 67), (157, 68), (157, 69), (157, 70), (157, 71), (157, 72), (158, 62), (158, 65), (158, 66), (159, 61), (159, 64), (160, 61), (160, 62), (276, 64), (276, 66), (277, 64), (277, 68), (278, 63), (278, 64), (278, 65), (278, 66), (278, 69), (279, 63), (279, 65), (279, 66), (279, 67), (279, 68), (279, 71), (280, 63), (280, 65), (280, 66), (280, 67), (280, 68), (280, 69), (280, 72), (281, 62), (281, 64), (281, 65), (281, 66), (281, 67), (281, 68), (281, 69), (281, 70), (281, 71), (281, 73), (282, 62), (282, 63), (282, 64), (282, 65), (282, 66), (282, 67), (282, 68), (282, 69), (282, 70), (282, 71), (282, 72), (282, 75), (283, 63), (283, 64), (283, 65), (283, 66), (283, 67), (283, 68), (283, 69), (283, 70), (283, 71), (283, 72), (283, 73), (283, 76), (284, 58), (284, 62), (284, 63), (284, 64), (284, 65), (284, 66), (284, 67), (284, 68), (284, 69), (284, 70), (284, 71), (284, 72), (284, 73), (284, 74), (284, 77), (285, 58), (285, 60), (285, 61), (285, 62), (285, 63), (285, 64), (285, 65), (285, 66), (285, 67), (285, 68), (285, 69), (285, 70), (285, 71), (285, 72), (285, 73), (285, 74), (285, 75), (285, 76), (285, 78), (286, 59), (286, 61), (286, 62), (286, 63), (286, 64), (286, 65), (286, 66), (286, 67), (286, 68), (286, 69), (286, 70), (286, 71), (286, 72), (286, 73), (286, 74), (286, 75), (286, 76), (286, 77), (286, 79), (287, 60), (287, 62), (287, 63), (287, 64), (287, 65), (287, 66), (287, 67), (287, 68), (287, 69), (287, 70), (287, 71), (287, 72), (287, 73), (287, 74), (287, 75), (287, 76), (287, 77), (287, 78), (288, 61), (288, 63), (288, 64), (288, 65), (288, 66), (288, 67), (288, 68), (288, 69), (288, 70), (288, 71), (288, 72), (288, 73), (288, 74), (288, 75), (288, 76), (288, 77), (288, 78), (288, 79), (288, 82), (289, 62), (289, 65), (289, 66), (289, 67), (289, 68), (289, 69), (289, 70), (289, 71), (289, 72), (289, 73), (289, 74), (289, 75), (289, 76), (289, 77), (289, 78), (289, 79), (289, 80), (289, 83), (290, 63), (290, 66), (290, 67), (290, 68), (290, 69), (290, 70), (290, 71), (290, 72), (290, 73), (290, 74), (290, 75), (290, 76), (290, 77), (290, 78), (290, 79), (290, 80), (290, 81), (290, 82), (290, 84), (291, 65), (291, 68), (291, 69), (291, 70), (291, 71), (291, 72), (291, 73), (291, 74), (291, 75), (291, 76), (291, 77), (291, 78), (291, 79), (291, 80), (291, 81), (291, 82), (291, 83), (291, 86), (292, 66), (292, 69), (292, 70), (292, 71), (292, 72), (292, 73), (292, 74), (292, 75), (292, 76), (292, 77), (292, 78), (292, 79), (292, 80), (292, 81), (292, 82), (292, 83), (292, 84), (292, 87), (293, 68), (293, 71), (293, 72), (293, 73), (293, 74), (293, 75), (293, 76), (293, 77), (293, 78), (293, 79), (293, 80), (293, 81), (293, 82), (293, 83), (293, 84), (293, 85), (293, 89), (293, 90), (294, 69), (294, 73), (294, 74), (294, 75), (294, 76), (294, 77), (294, 78), (294, 79), (294, 80), (294, 81), (294, 82), (294, 83), (294, 89), (295, 71), (295, 75), (295, 76), (295, 77), (295, 78), (295, 79), (295, 80), (295, 81), (295, 84), (295, 85), (295, 89), (296, 73), (296, 83), (296, 88), (296, 89), (297, 76), (297, 77), (297, 78), (297, 79), (297, 81), (297, 89))
coordinates_ccff33 = ((237, 83), (237, 86), (238, 83), (238, 85))
|
class TrimapError(Exception):
"""
Error when creating matting trimap.
"""
def __init__(self, err):
super(TrimapError, self).__init__(err)
class AnnError(Exception):
"""
Error with Input annotation.
"""
def __init__(self, err):
super(AnnError, self).__init__(err)
|
class Trimaperror(Exception):
"""
Error when creating matting trimap.
"""
def __init__(self, err):
super(TrimapError, self).__init__(err)
class Annerror(Exception):
"""
Error with Input annotation.
"""
def __init__(self, err):
super(AnnError, self).__init__(err)
|
class WiktionaryParaphrase:
def __init__(self, lexunit_id: str, wiktionary_id: str, wiktionary_sense_id: int, wiktionary_sense: str,
edited: bool):
"""
This class holds the Wictionary paraphrase object. A wictionary paraphrase can be part of lexical units. The
contain a definition of the lexical unit which helps to differentiate between different sense of a word.
:param lexunit_id: The lexical unit id, this wictionary entry belongs to
:param wiktionary_id: The corresponding wictionary identifier
:param wiktionary_sense_id: The sense identifier
:param wiktionary_sense: The sense definition
:param edited: If this paraphrase was edited.
"""
self._lexunit_id = lexunit_id
self._wiktionary_id = wiktionary_id
self._wiktionary_sense_id = wiktionary_sense_id
self._wiktionary_sense = wiktionary_sense
self._edited = edited
def __repr__(self):
return f'Wictionary(LexUnit ID={self.lexunit_id}, definition={self.wiktionary_sense})'
@property
def lexunit_id(self):
return self._lexunit_id
@property
def wiktionary_id(self):
return self._wiktionary_id
@property
def wiktionary_sense_id(self):
return self._wiktionary_sense_id
@property
def wiktionary_sense(self):
return self._wiktionary_sense
@property
def edited(self):
return self._edited
|
class Wiktionaryparaphrase:
def __init__(self, lexunit_id: str, wiktionary_id: str, wiktionary_sense_id: int, wiktionary_sense: str, edited: bool):
"""
This class holds the Wictionary paraphrase object. A wictionary paraphrase can be part of lexical units. The
contain a definition of the lexical unit which helps to differentiate between different sense of a word.
:param lexunit_id: The lexical unit id, this wictionary entry belongs to
:param wiktionary_id: The corresponding wictionary identifier
:param wiktionary_sense_id: The sense identifier
:param wiktionary_sense: The sense definition
:param edited: If this paraphrase was edited.
"""
self._lexunit_id = lexunit_id
self._wiktionary_id = wiktionary_id
self._wiktionary_sense_id = wiktionary_sense_id
self._wiktionary_sense = wiktionary_sense
self._edited = edited
def __repr__(self):
return f'Wictionary(LexUnit ID={self.lexunit_id}, definition={self.wiktionary_sense})'
@property
def lexunit_id(self):
return self._lexunit_id
@property
def wiktionary_id(self):
return self._wiktionary_id
@property
def wiktionary_sense_id(self):
return self._wiktionary_sense_id
@property
def wiktionary_sense(self):
return self._wiktionary_sense
@property
def edited(self):
return self._edited
|
class StockTrendPredictor:
def predict(self, headline: str) -> int:
r"""Predict stock trending from the given headline
Args:
headline: the news headline
Returns:
A prediction, 0 for not-changed or downward trend, 1 for upward trend
"""
pass
|
class Stocktrendpredictor:
def predict(self, headline: str) -> int:
"""Predict stock trending from the given headline
Args:
headline: the news headline
Returns:
A prediction, 0 for not-changed or downward trend, 1 for upward trend
"""
pass
|
# Part 1: 187
# Part 2: 4723283400
class Slope():
def __init__(self, path):
"""
input path to text file
text file should contain map data consisting of "." for open spaces, "#" for trees
"""
# put file data into 2D array of characters "." and "#"
with open(path, "r") as f:
self._data = [line.strip() for line in f.readlines()]
self._loop_length = len(self._data[0])
def __len__(self):
"""
returns number of rows in the data map
"""
return len(self._data)
def __repr__(self):
return str(self._data)
def __iter__(self):
"""
generator for each row as a list of characters
"""
for i in self._data:
yield i
def slopecheck(self, right, down=1):
"""
right = number of spaces to move right (positive integer), can be 0, no default value
down = number of spaces to move down (positive integer). cannot be 0, default = 1
"""
if down < 1 or right < 0:
raise ValueError("Right slope cannot be below 0. Down slope cannot be below 1")
position = trees = skip = 0
for line in self:
if skip > 1:
skip -= 1
continue # skip this loop iteration
if line[position] == "#": # increase tree count
trees += 1
position = (position + right) % self._loop_length # move position to the right
skip = down # set number of lines to skip
return trees
if __name__ == "__main__":
test = Slope(r"2020\day3\input.txt")
t1 = test.slopecheck(3,1) # 187
t2 = test.slopecheck(1,1) # 86
t3 = test.slopecheck(5,1) # 75
t4 = test.slopecheck(7,1) # 89
t5 = test.slopecheck(1,2) # 44
print(t1)
print(t1 * t2 * t3 * t4 *t5)
|
class Slope:
def __init__(self, path):
"""
input path to text file
text file should contain map data consisting of "." for open spaces, "#" for trees
"""
with open(path, 'r') as f:
self._data = [line.strip() for line in f.readlines()]
self._loop_length = len(self._data[0])
def __len__(self):
"""
returns number of rows in the data map
"""
return len(self._data)
def __repr__(self):
return str(self._data)
def __iter__(self):
"""
generator for each row as a list of characters
"""
for i in self._data:
yield i
def slopecheck(self, right, down=1):
"""
right = number of spaces to move right (positive integer), can be 0, no default value
down = number of spaces to move down (positive integer). cannot be 0, default = 1
"""
if down < 1 or right < 0:
raise value_error('Right slope cannot be below 0. Down slope cannot be below 1')
position = trees = skip = 0
for line in self:
if skip > 1:
skip -= 1
continue
if line[position] == '#':
trees += 1
position = (position + right) % self._loop_length
skip = down
return trees
if __name__ == '__main__':
test = slope('2020\\day3\\input.txt')
t1 = test.slopecheck(3, 1)
t2 = test.slopecheck(1, 1)
t3 = test.slopecheck(5, 1)
t4 = test.slopecheck(7, 1)
t5 = test.slopecheck(1, 2)
print(t1)
print(t1 * t2 * t3 * t4 * t5)
|
#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Base class. Eventually all optimizers will be implemented as classes with this
as the base class.
"""
class BaseOptimizer(object):
'''
Placeholder for now. Will eventually convert all methods to
instances of this class.
'''
pass
|
"""
Base class. Eventually all optimizers will be implemented as classes with this
as the base class.
"""
class Baseoptimizer(object):
"""
Placeholder for now. Will eventually convert all methods to
instances of this class.
"""
pass
|
class Solution(object):
def findMode(self, root):
"""
:type root: TreeNode
:rtype: List[int]
"""
global_val = list()
global_num = 0
if root is None:
return global_val
def in_traverse(root, result):
if root is None:
return
in_traverse(root.left, result)
result.append(root.val)
in_traverse(root.right, result)
result = list()
in_traverse(root, result)
pre_pointer = 0
post_pointer = 1
while post_pointer <= len(result) - 1:
if result[post_pointer] == result[pre_pointer]:
post_pointer += 1
else:
if post_pointer - pre_pointer > global_num:
global_val = [result[pre_pointer]]
global_num = post_pointer - pre_pointer
elif post_pointer - pre_pointer == global_num:
global_val.append(result[pre_pointer])
pre_pointer = post_pointer
post_pointer += 1
if post_pointer - pre_pointer > global_num:
global_val = [result[pre_pointer]]
elif post_pointer - pre_pointer == global_num:
global_val.append(result[pre_pointer])
return global_val
|
class Solution(object):
def find_mode(self, root):
"""
:type root: TreeNode
:rtype: List[int]
"""
global_val = list()
global_num = 0
if root is None:
return global_val
def in_traverse(root, result):
if root is None:
return
in_traverse(root.left, result)
result.append(root.val)
in_traverse(root.right, result)
result = list()
in_traverse(root, result)
pre_pointer = 0
post_pointer = 1
while post_pointer <= len(result) - 1:
if result[post_pointer] == result[pre_pointer]:
post_pointer += 1
else:
if post_pointer - pre_pointer > global_num:
global_val = [result[pre_pointer]]
global_num = post_pointer - pre_pointer
elif post_pointer - pre_pointer == global_num:
global_val.append(result[pre_pointer])
pre_pointer = post_pointer
post_pointer += 1
if post_pointer - pre_pointer > global_num:
global_val = [result[pre_pointer]]
elif post_pointer - pre_pointer == global_num:
global_val.append(result[pre_pointer])
return global_val
|
#!/usr/bin/env python
# -*- coding: utf-8 -*-
#
# Copyright 2011 Yesudeep Mangalapilly <[email protected]>
# Copyright 2012 Google Inc. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
""":synopsis: Mother of all our Python projects.
:module: mom
How many times have you noticed a ``utils`` subpackage or module?
-----------------------------------------------------------------
Yeah. There is a lot of code duplication that occurs throughout
our Python-based projects and results in code that is harder
to maintain in the long term. Not to mention all the duplicate
test code and more maintenance.
Therefore, we have decided to move all those ``util`` modules and
subpackages to a central library, which we use throughout our projects.
If you have a ``utils`` module, chances are you're duplicating
and wasting effort whereas instead you could use tested code
provided by this library. If there's something not included in
this library and think it should, speak up.
.. automodule:: mom.builtins
.. automodule:: mom.collections
.. automodule:: mom.decorators
.. automodule:: mom.functional
.. automodule:: mom.itertools
.. automodule:: mom.math
.. automodule:: mom.mimeparse
.. automodule:: mom.string
"""
__author__ = "[email protected] (Yesudeep Mangalapilly)"
|
""":synopsis: Mother of all our Python projects.
:module: mom
How many times have you noticed a ``utils`` subpackage or module?
-----------------------------------------------------------------
Yeah. There is a lot of code duplication that occurs throughout
our Python-based projects and results in code that is harder
to maintain in the long term. Not to mention all the duplicate
test code and more maintenance.
Therefore, we have decided to move all those ``util`` modules and
subpackages to a central library, which we use throughout our projects.
If you have a ``utils`` module, chances are you're duplicating
and wasting effort whereas instead you could use tested code
provided by this library. If there's something not included in
this library and think it should, speak up.
.. automodule:: mom.builtins
.. automodule:: mom.collections
.. automodule:: mom.decorators
.. automodule:: mom.functional
.. automodule:: mom.itertools
.. automodule:: mom.math
.. automodule:: mom.mimeparse
.. automodule:: mom.string
"""
__author__ = '[email protected] (Yesudeep Mangalapilly)'
|
class EmailAddress:
def __init__(self, email):
self.email = email
self._email_tpl = tuple(self._email.split('@'))
def __str__(self):
return self.email
def __repr__(self):
return f"{EmailAddress.__name__}('{self.email}')"
@property
def email(self):
return self._email
@email.setter
def email(self, email):
self._email = str(email)
if not self._is_valid():
raise ValueError(f'{self.email} is not a valid email address')
@property
def user(self):
return self._email_tpl[0]
@property
def domain(self):
return self._email_tpl[1]
def _is_valid(self):
email_split = self._email.split('@')
if len(email_split) != 2:
return False
domain_split = email_split[1].split('.')
if len(domain_split) < 2:
return False
return True
|
class Emailaddress:
def __init__(self, email):
self.email = email
self._email_tpl = tuple(self._email.split('@'))
def __str__(self):
return self.email
def __repr__(self):
return f"{EmailAddress.__name__}('{self.email}')"
@property
def email(self):
return self._email
@email.setter
def email(self, email):
self._email = str(email)
if not self._is_valid():
raise value_error(f'{self.email} is not a valid email address')
@property
def user(self):
return self._email_tpl[0]
@property
def domain(self):
return self._email_tpl[1]
def _is_valid(self):
email_split = self._email.split('@')
if len(email_split) != 2:
return False
domain_split = email_split[1].split('.')
if len(domain_split) < 2:
return False
return True
|
class Settings():
"""A class to store all settings for Allien Invation."""
def __init__(self):
"""Initialize the game's static settings"""
# Screen Settings
self.screen_width = 800
self.screen_height = 600
# self.bg_color = (0, 0, 0)
self.bg_color = (10, 10, 10)
# Ship
self.ship_speed_factor = 1.5
self.ship_limit = 3
# bullet
self.bullet_speed_factor = 5
self.bullet_width = 3
self.bullet_height = 15
# self.bullet_color = (252, 248, 8) # 60, 60, 60
self.bullet_color = (255,255,0)
self.bullets_allowed = 3
# Alien
self.alien_speed_factor = 3
self.fleet_drop_speed = 20
self.fleet_direction = 1 # 1: right; -1: left
# How quickly the game speed up
self.speedup_scale = 1.1
# How quickly the alien point values increase
self.score_scale = 1.5
self.initialize_dynamic_settings()
def initialize_dynamic_settings(self):
"""Initialize settings that change throughout the game."""
self.ship_speed_factor = 10 # original: 1.5
self.bullet_speed_factor = 3
self.alien_speed_factor = 1
# fleet direction of 1 represents right; -1 represents left.
self.fleet_direction = 1
# scoring
self.alien_points = 50
def increase_speed(self):
"""Increase speed settings and alien point values."""
self.ship_speed_factor *= self.speedup_scale
self.bullet_speed_factor *= self.speedup_scale
self.alien_speed_factor *= self.speedup_scale * 1.3
self.alien_points = int(self.alien_points * self.score_scale)
|
class Settings:
"""A class to store all settings for Allien Invation."""
def __init__(self):
"""Initialize the game's static settings"""
self.screen_width = 800
self.screen_height = 600
self.bg_color = (10, 10, 10)
self.ship_speed_factor = 1.5
self.ship_limit = 3
self.bullet_speed_factor = 5
self.bullet_width = 3
self.bullet_height = 15
self.bullet_color = (255, 255, 0)
self.bullets_allowed = 3
self.alien_speed_factor = 3
self.fleet_drop_speed = 20
self.fleet_direction = 1
self.speedup_scale = 1.1
self.score_scale = 1.5
self.initialize_dynamic_settings()
def initialize_dynamic_settings(self):
"""Initialize settings that change throughout the game."""
self.ship_speed_factor = 10
self.bullet_speed_factor = 3
self.alien_speed_factor = 1
self.fleet_direction = 1
self.alien_points = 50
def increase_speed(self):
"""Increase speed settings and alien point values."""
self.ship_speed_factor *= self.speedup_scale
self.bullet_speed_factor *= self.speedup_scale
self.alien_speed_factor *= self.speedup_scale * 1.3
self.alien_points = int(self.alien_points * self.score_scale)
|
x = int(input())
y = int(input())
ans = 0
if x > 0:
if y > 0:
ans = 1
else: ans = 4
else:
if y > 0:
ans = 2
else: ans = 3
print(ans)
|
x = int(input())
y = int(input())
ans = 0
if x > 0:
if y > 0:
ans = 1
else:
ans = 4
elif y > 0:
ans = 2
else:
ans = 3
print(ans)
|
# filename : csc_checks.py
# description : check definitions (security best practices and CVEs)
# create date : 2018-05-07 14:07:33.569768
csc1_1 = {'check_name': 'csc1_1',
'check_type': 'check_in_simple',
'match1': 'banner motd',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'A banner shoud be set',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_2 = {'check_name': 'csc1_2',
'check_type': 'check_in_simple',
'match1': 'no cdp enable',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'CDP should not be enabled globally',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_3 = {'check_name': 'csc1_3',
'check_type': 'check_in_simple',
'match1': 'snmpv1',
'match2': 'n/a',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP version 1 should not be configured',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_4 = {'check_name': 'csc1_4',
'check_type': 'check_in_simple',
'match1': 'snmp-server host \d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3} traps version 2c',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP version 2c ',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_5 = {'check_name': 'csc1_5',
'check_type': 'check_parameter',
'match1': 'ssh key rsa',
'match2': '2048',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'RSA key length [2048]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_6 = {'check_name': 'csc1_6',
'check_type': 'check_in_simple',
'match1': 'no ssh key dsa',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_7 = {'check_name': 'csc1_7',
'check_type': 'check_parameter',
'match1': 'snmp-server source-interface traps',
'match2': 'mgmt0',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_8 = {'check_name': 'csc1_8',
'check_type': 'check_parameter',
'match1': 'snmp-server location',
'match2': 'FR.*',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP location string',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_9 = {'check_name': 'csc1_9',
'check_type': 'check_parameter',
'match1': 'snmp-server host',
'match2': '\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP destination server',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_10 = {'check_name': 'csc1_10',
'check_type': 'check_parameter',
'match1': 'snmp-server community',
'match2': 'your_community_string_here',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP community string',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_11 = {'check_name': 'csc1_11',
'check_type': 'check_parameter',
'match1': 'ntp server',
'match2': '\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'NTP server have to be configured',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_12 = {'check_name': 'csc1_12',
'check_type': 'check_parameter',
'match1': 'ntp source-interface',
'match2': 'mgmt0',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'NTP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_13 = {'check_name': 'csc1_13',
'check_type': 'check_in_simple',
'match1': 'no feature telnet',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no feature telnet',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_14 = {'check_name': 'csc1_14',
'check_type': 'check_in_simple',
'match1': 'password strength-check',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'password strength-check',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_15 = {'check_name': 'csc1_15',
'check_type': 'check_in_simple',
'match1': 'password secure-mode',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'password secure-mode',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_16 = {'check_name': 'csc1_16',
'check_type': 'check_in_simple',
'match1': 'no ssh key dsa',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ssh key dsa',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_17 = {'check_name': 'csc1_17',
'check_type': 'check_in_simple',
'match1': 'aaa authentication login default group',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'aaa authentication login default group',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_18 = {'check_name': 'csc1_18',
'check_type': 'check_in_simple',
'match1': 'aaa authentication login console group',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'aaa authentication login console group',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_19 = {'check_name': 'csc1_19',
'check_type': 'check_in_simple',
'match1': 'no ip source-route',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ip source-route',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_20 = {'check_name': 'csc1_20',
'check_type': 'check_in_simple',
'match1': 'no ip igmp snooping',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ip igmp snooping',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_21 = {'check_name': 'csc1_21',
'check_type': 'check_in_simple',
'match1': 'exec-timeout 15',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'minimize axec timeout to 15s',
'url': 'n/a',
'fix': 'Command to fix',}
CVE_2018_0102 = {'check_name': 'CVE_2018_0102',
'check_type': 'check_two_parameters',
'match1': 'feature pong',
'match2': 'feature-set fabricpath',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.2(2)d1(1), 7.2(2)d1(2), 7.2(1)d(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0102/',
'fix': 'Command to fix',}
CVE_2018_0090 = {'check_name': 'CVE_2018_0090',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(20|30|55|56|60|70|77)00',
'match2': 'access-list',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.3(2)n1(0.6), 8.3(0)kms(0.31), 8.8(3.5)s0',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0090/',
'fix': 'Command to fix',}
CVE_2018_0092 = {'check_name': 'CVE_2018_0092',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(30|36|90|95)00',
'match2': 'role network-operator',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.0(3)i5(2), 7.0(3)i6(1), 7.0(3)i7(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0092/',
'fix': 'Command to fix',}
CVE_2017_12341 = {'check_name': 'CVE_2017_12341',
'check_type': 'check_in_simple',
'match1': '8.1\(1\)|8.2\(1\)|8.1\(0.59\)s0',
'match2': 'n/a',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 8.1(1), 8.2(1), 8.1(0.59)s0',
'url': 'https://www.cvedetails.com/cve/CVE-2017-12341/',
'fix': 'Command to fix',}
CVE_2017_12331 = {'check_name': 'CVE_2017_12331',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(70|77)00',
'match2': '8.1\(1\)',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 8.1(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2017-12331/',
'fix': 'Command to fix',}
|
csc1_1 = {'check_name': 'csc1_1', 'check_type': 'check_in_simple', 'match1': 'banner motd', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'A banner shoud be set', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_2 = {'check_name': 'csc1_2', 'check_type': 'check_in_simple', 'match1': 'no cdp enable', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'CDP should not be enabled globally', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_3 = {'check_name': 'csc1_3', 'check_type': 'check_in_simple', 'match1': 'snmpv1', 'match2': 'n/a', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP version 1 should not be configured', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_4 = {'check_name': 'csc1_4', 'check_type': 'check_in_simple', 'match1': 'snmp-server host \\d{1,3}\\.\\d{1,3}\\.\\d{1,3}\\.\\d{1,3} traps version 2c', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP version 2c ', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_5 = {'check_name': 'csc1_5', 'check_type': 'check_parameter', 'match1': 'ssh key rsa', 'match2': '2048', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'RSA key length [2048]', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_6 = {'check_name': 'csc1_6', 'check_type': 'check_in_simple', 'match1': 'no ssh key dsa', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP source interface [mgmt0]', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_7 = {'check_name': 'csc1_7', 'check_type': 'check_parameter', 'match1': 'snmp-server source-interface traps', 'match2': 'mgmt0', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP source interface [mgmt0]', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_8 = {'check_name': 'csc1_8', 'check_type': 'check_parameter', 'match1': 'snmp-server location', 'match2': 'FR.*', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP location string', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_9 = {'check_name': 'csc1_9', 'check_type': 'check_parameter', 'match1': 'snmp-server host', 'match2': '\\d{1,3}\\.\\d{1,3}\\.\\d{1,3}\\.\\d{1,3}', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP destination server', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_10 = {'check_name': 'csc1_10', 'check_type': 'check_parameter', 'match1': 'snmp-server community', 'match2': 'your_community_string_here', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'SNMP community string', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_11 = {'check_name': 'csc1_11', 'check_type': 'check_parameter', 'match1': 'ntp server', 'match2': '\\d{1,3}\\.\\d{1,3}\\.\\d{1,3}\\.\\d{1,3}', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'NTP server have to be configured', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_12 = {'check_name': 'csc1_12', 'check_type': 'check_parameter', 'match1': 'ntp source-interface', 'match2': 'mgmt0', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'NTP source interface [mgmt0]', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_13 = {'check_name': 'csc1_13', 'check_type': 'check_in_simple', 'match1': 'no feature telnet', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'no feature telnet', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_14 = {'check_name': 'csc1_14', 'check_type': 'check_in_simple', 'match1': 'password strength-check', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'password strength-check', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_15 = {'check_name': 'csc1_15', 'check_type': 'check_in_simple', 'match1': 'password secure-mode', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'password secure-mode', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_16 = {'check_name': 'csc1_16', 'check_type': 'check_in_simple', 'match1': 'no ssh key dsa', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'no ssh key dsa', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_17 = {'check_name': 'csc1_17', 'check_type': 'check_in_simple', 'match1': 'aaa authentication login default group', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'aaa authentication login default group', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_18 = {'check_name': 'csc1_18', 'check_type': 'check_in_simple', 'match1': 'aaa authentication login console group', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'aaa authentication login console group', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_19 = {'check_name': 'csc1_19', 'check_type': 'check_in_simple', 'match1': 'no ip source-route', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'no ip source-route', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_20 = {'check_name': 'csc1_20', 'check_type': 'check_in_simple', 'match1': 'no ip igmp snooping', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'no ip igmp snooping', 'url': 'n/a', 'fix': 'Command to fix'}
csc1_21 = {'check_name': 'csc1_21', 'check_type': 'check_in_simple', 'match1': 'exec-timeout 15', 'match2': 'n/a', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'minimize axec timeout to 15s', 'url': 'n/a', 'fix': 'Command to fix'}
cve_2018_0102 = {'check_name': 'CVE_2018_0102', 'check_type': 'check_two_parameters', 'match1': 'feature pong', 'match2': 'feature-set fabricpath', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 7.2(2)d1(1), 7.2(2)d1(2), 7.2(1)d(1)', 'url': 'https://www.cvedetails.com/cve/CVE-2018-0102/', 'fix': 'Command to fix'}
cve_2018_0090 = {'check_name': 'CVE_2018_0090', 'check_type': 'check_two_parameters', 'match1': 'cisco Nexus(20|30|55|56|60|70|77)00', 'match2': 'access-list', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 7.3(2)n1(0.6), 8.3(0)kms(0.31), 8.8(3.5)s0', 'url': 'https://www.cvedetails.com/cve/CVE-2018-0090/', 'fix': 'Command to fix'}
cve_2018_0092 = {'check_name': 'CVE_2018_0092', 'check_type': 'check_two_parameters', 'match1': 'cisco Nexus(30|36|90|95)00', 'match2': 'role network-operator', 'required': 'yes', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 7.0(3)i5(2), 7.0(3)i6(1), 7.0(3)i7(1)', 'url': 'https://www.cvedetails.com/cve/CVE-2018-0092/', 'fix': 'Command to fix'}
cve_2017_12341 = {'check_name': 'CVE_2017_12341', 'check_type': 'check_in_simple', 'match1': '8.1\\(1\\)|8.2\\(1\\)|8.1\\(0.59\\)s0', 'match2': 'n/a', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 8.1(1), 8.2(1), 8.1(0.59)s0', 'url': 'https://www.cvedetails.com/cve/CVE-2017-12341/', 'fix': 'Command to fix'}
cve_2017_12331 = {'check_name': 'CVE_2017_12331', 'check_type': 'check_two_parameters', 'match1': 'cisco Nexus(70|77)00', 'match2': '8.1\\(1\\)', 'required': 'no', 'result_ok': 'Test successful.', 'result_failed': 'Test failed.', 'info': 'Affected versions: 8.1(1)', 'url': 'https://www.cvedetails.com/cve/CVE-2017-12331/', 'fix': 'Command to fix'}
|
print("What is yas?")
word = input()
def isYas(word):
Yasses = True
state=0
for i in range(len(word)):
if word[i].isalpha():
if state == 0:
if word[i] in ["Y","y"]:
state=1
else:
Yasses = False
elif state == 1:
if word[i] in ["Y","y"]:
state=1
elif word[i] in ["A","a"]:
state=2
else:
Yasses = False
elif state == 2:
if word[i]in ["A","a"]:
state = 2
elif word[i]in ["S","s"]:
state = 3
else:
Yasses = False
elif state == 3:
if word[i]in ["S","s"]:
state = 3
else:
Yasses = False
if state != 3:
Yasses = False
return Yasses
isYas(word)
answer=isYas(word)
print(answer)
|
print('What is yas?')
word = input()
def is_yas(word):
yasses = True
state = 0
for i in range(len(word)):
if word[i].isalpha():
if state == 0:
if word[i] in ['Y', 'y']:
state = 1
else:
yasses = False
elif state == 1:
if word[i] in ['Y', 'y']:
state = 1
elif word[i] in ['A', 'a']:
state = 2
else:
yasses = False
elif state == 2:
if word[i] in ['A', 'a']:
state = 2
elif word[i] in ['S', 's']:
state = 3
else:
yasses = False
elif state == 3:
if word[i] in ['S', 's']:
state = 3
else:
yasses = False
if state != 3:
yasses = False
return Yasses
is_yas(word)
answer = is_yas(word)
print(answer)
|
class NGram:
# @param {int} n a integer
# @param {str} string a string
def mapper(self, _, n, string):
# Write your code here
# Please use 'yield key, value' here
for i in range(len(string) - n + 1):
yield string[i:i + n], 1
# @param key is from mapper
# @param values is a set of value with the same key
def reducer(self, key, values):
# Write your code here
# Please use 'yield key, value' here
yield key, sum(values)
|
class Ngram:
def mapper(self, _, n, string):
for i in range(len(string) - n + 1):
yield (string[i:i + n], 1)
def reducer(self, key, values):
yield (key, sum(values))
|
###################################################
## ##
## This file is part of the KinBot code v2.0 ##
## ##
## The contents are covered by the terms of the ##
## BSD 3-clause license included in the LICENSE ##
## file, found at the root. ##
## ##
## Copyright 2018 National Technology & ##
## Engineering Solutions of Sandia, LLC (NTESS). ##
## Under the terms of Contract DE-NA0003525 with ##
## NTESS, the U.S. Government retains certain ##
## rights to this software. ##
## ##
## Authors: ##
## Judit Zador ##
## Ruben Van de Vijver ##
## ##
###################################################
"""
Class to keep track fo the jobs and their id's
"""
# keys: job names
# values: job PBS id
job_ids = {}
|
"""
Class to keep track fo the jobs and their id's
"""
job_ids = {}
|
class Vector:
def __init__(self,x,y):
self.x=x
self.y=y
def __repr__(self):
return str(self.x) +"i, "+ str(self.y)+"j"
def dotProduct(v1,v2):
return v1.x*v2.x + v1.y*v2.y
|
class Vector:
def __init__(self, x, y):
self.x = x
self.y = y
def __repr__(self):
return str(self.x) + 'i, ' + str(self.y) + 'j'
def dot_product(v1, v2):
return v1.x * v2.x + v1.y * v2.y
|
class CalculatorException(Exception):
pass
class Calculator:
"""
This is a simple Calculator that performs basic addition, subtraction,
division, multiplication and root calculation of numbers.
"""
def __init__(self):
self.__val = 0
def add(self, num:int or float or complex):
"""add a number to the current value in the calculator"""
try:
self.__val += num
return self.__val
except Exception:
raise CalculatorException("Something went wrong. function add() takes only integers")
def subtract(self, num:int or float or complex):
"""subtract a number from the current value in the calculator"""
try:
self.__val -= num
return self.__val
except Exception:
raise CalculatorException("Something went wrong. Ensure to use the right input types")
def multiply(self, num:int or float or complex):
"""multiply a number with the current value in the calculator"""
self.__val *= num
return self.__val
def divide(self, num:int or float or complex):
"""divides the current value in the calculator by the given number"""
try:
self.__val /= num
return self.__val
except ZeroDivisionError:
raise CalculatorException("Something went wrong. "
"You are most likely attempting a division with 0")
def root(self, num:int):
"""gets the n root of the current value in the calculator"""
try:
self.__val **= (1/num)
return self.__val
except Exception:
raise CalculatorException("Something went wrong. "
"You are most likely attempting a division with 0")
def reset_memory(self):
"""clears all calculator history and resets the value to zero."""
self.__val = 0
return self.__val
|
class Calculatorexception(Exception):
pass
class Calculator:
"""
This is a simple Calculator that performs basic addition, subtraction,
division, multiplication and root calculation of numbers.
"""
def __init__(self):
self.__val = 0
def add(self, num: int or float or complex):
"""add a number to the current value in the calculator"""
try:
self.__val += num
return self.__val
except Exception:
raise calculator_exception('Something went wrong. function add() takes only integers')
def subtract(self, num: int or float or complex):
"""subtract a number from the current value in the calculator"""
try:
self.__val -= num
return self.__val
except Exception:
raise calculator_exception('Something went wrong. Ensure to use the right input types')
def multiply(self, num: int or float or complex):
"""multiply a number with the current value in the calculator"""
self.__val *= num
return self.__val
def divide(self, num: int or float or complex):
"""divides the current value in the calculator by the given number"""
try:
self.__val /= num
return self.__val
except ZeroDivisionError:
raise calculator_exception('Something went wrong. You are most likely attempting a division with 0')
def root(self, num: int):
"""gets the n root of the current value in the calculator"""
try:
self.__val **= 1 / num
return self.__val
except Exception:
raise calculator_exception('Something went wrong. You are most likely attempting a division with 0')
def reset_memory(self):
"""clears all calculator history and resets the value to zero."""
self.__val = 0
return self.__val
|
#poly_limit=10
def poly_check(seq,poly_limit):
if 'A'*poly_limit not in seq and 'T'*poly_limit not in seq and 'G'*poly_limit not in seq and 'C'*poly_limit not in seq:
return True
else:
return False
def var_check(change_from, change_to, seq,var_limit):
ALL=['A','T','C','G']
tmp=[]
for one in ALL:
if one !=change_from.upper() and one !=change_to.upper():
tmp.append(one)
flag=1
for one in tmp:
if seq.count(one) < var_limit/(float(len(tmp))+2):
flag=0
if flag==1:
return True
else:
return False
def reverse_base(base):
base=base.upper()
if base=='A':
return 'T'
elif base=='C':
return 'G'
elif base=='G':
return 'C'
elif base=='T':
return 'A'
else:
return 'N'
def recover_sam(sam_in_dir,sam_out_dir, var_limit=20,poly_limit=10,rm_multi=0):
fi=open(sam_in_dir)
fo=open(sam_out_dir,'w')
for line in fi:
seq=line.split('\t')
if line[0]=='@':
fo.write(line)
elif seq[1]=='4' and seq[2]=='*':
break
elif seq[1]!='4' and len(seq)>=9:
seq=line.split('\t')
seq[9]=seq[9].upper()
seq[1]=int(seq[1])
if len(bin(seq[1]))>=7:
if bin(seq[1])[-3]!='1':
if bin(seq[1])[-5]=='1':
seq[1]='16'
else:
seq[1]='0'
seq[1]=str(seq[1])
record=bin(int(seq[0].split('_|_')[2]))[3:]
change_from=seq[0].split('_|_')[1].split('_')[0]
change_to=seq[0].split('_|_')[1].split('_')[2]
if len(bin(int(seq[1]))) > 5 and bin(int(seq[1]))[-5]=='1': #seq[1]=='16':
change_from=reverse_base(change_from)
change_to=reverse_base(change_to)
record=record[::-1]
else:
record=record
changed_read=seq[9]
i=0
recovered_read=''
while i<len(seq[9]):
if record[i]=='1' and seq[9][i]==change_to:
recovered_read += change_from
elif record[i]=='1' and seq[9][i]!=change_to:
#print "recover error in "+seq[0]
recovered_read += 'N'
else:
recovered_read += seq[9][i]
i=i+1
seq[9]=recovered_read
#fo.write(seq[0])
#if len(record)==len(seq[9]) and 'I' not in seq[5] and 'D' not in seq[5] and len(record)-changed_read.count(change_to) > 25 and poly_check(seq[9],poly_limit):
if len(record)==len(seq[9]) and len(record)-changed_read.count(change_to) > var_limit and poly_check(seq[9],poly_limit): #and var_check(change_from,change_to,seq[9],var_limit):
if (rm_multi==1 and "XA:Z:" not in line) or rm_multi==0:
fo.write(seq[0])
j=1
while j<len(seq):
fo.write('\t'+seq[j])
j=j+1
# 1+1
fo.close()
fi.close()
|
def poly_check(seq, poly_limit):
if 'A' * poly_limit not in seq and 'T' * poly_limit not in seq and ('G' * poly_limit not in seq) and ('C' * poly_limit not in seq):
return True
else:
return False
def var_check(change_from, change_to, seq, var_limit):
all = ['A', 'T', 'C', 'G']
tmp = []
for one in ALL:
if one != change_from.upper() and one != change_to.upper():
tmp.append(one)
flag = 1
for one in tmp:
if seq.count(one) < var_limit / (float(len(tmp)) + 2):
flag = 0
if flag == 1:
return True
else:
return False
def reverse_base(base):
base = base.upper()
if base == 'A':
return 'T'
elif base == 'C':
return 'G'
elif base == 'G':
return 'C'
elif base == 'T':
return 'A'
else:
return 'N'
def recover_sam(sam_in_dir, sam_out_dir, var_limit=20, poly_limit=10, rm_multi=0):
fi = open(sam_in_dir)
fo = open(sam_out_dir, 'w')
for line in fi:
seq = line.split('\t')
if line[0] == '@':
fo.write(line)
elif seq[1] == '4' and seq[2] == '*':
break
elif seq[1] != '4' and len(seq) >= 9:
seq = line.split('\t')
seq[9] = seq[9].upper()
seq[1] = int(seq[1])
if len(bin(seq[1])) >= 7:
if bin(seq[1])[-3] != '1':
if bin(seq[1])[-5] == '1':
seq[1] = '16'
else:
seq[1] = '0'
seq[1] = str(seq[1])
record = bin(int(seq[0].split('_|_')[2]))[3:]
change_from = seq[0].split('_|_')[1].split('_')[0]
change_to = seq[0].split('_|_')[1].split('_')[2]
if len(bin(int(seq[1]))) > 5 and bin(int(seq[1]))[-5] == '1':
change_from = reverse_base(change_from)
change_to = reverse_base(change_to)
record = record[::-1]
else:
record = record
changed_read = seq[9]
i = 0
recovered_read = ''
while i < len(seq[9]):
if record[i] == '1' and seq[9][i] == change_to:
recovered_read += change_from
elif record[i] == '1' and seq[9][i] != change_to:
recovered_read += 'N'
else:
recovered_read += seq[9][i]
i = i + 1
seq[9] = recovered_read
if len(record) == len(seq[9]) and len(record) - changed_read.count(change_to) > var_limit and poly_check(seq[9], poly_limit):
if rm_multi == 1 and 'XA:Z:' not in line or rm_multi == 0:
fo.write(seq[0])
j = 1
while j < len(seq):
fo.write('\t' + seq[j])
j = j + 1
fo.close()
fi.close()
|
x = input()
if x == ".helpf":
print(".help : to show help menu")
|
x = input()
if x == '.helpf':
print('.help : to show help menu')
|
"""Hello world module"""
def hello_func():
"""return 'Hello!'"""
return "Hello!"
def main():
"""print 'Hello!'"""
print(hello_func())
if __name__ == '__main__':
main()
|
"""Hello world module"""
def hello_func():
"""return 'Hello!'"""
return 'Hello!'
def main():
"""print 'Hello!'"""
print(hello_func())
if __name__ == '__main__':
main()
|
class Config(object):
SQLALCHEMY_DATABASE_URI = 'sqlite:///app.db'
SQLALCHEMY_TRACK_MODIFICATIONS = False
SECRET_KEY = '1234567890'
SQLALCHEMY_ECHO = False
FLASK_ADMIN_SWATCH = 'united'
if __name__ == '__main__':
for key in Config.__dict__:
print(key, Config.__dict__[key])
|
class Config(object):
sqlalchemy_database_uri = 'sqlite:///app.db'
sqlalchemy_track_modifications = False
secret_key = '1234567890'
sqlalchemy_echo = False
flask_admin_swatch = 'united'
if __name__ == '__main__':
for key in Config.__dict__:
print(key, Config.__dict__[key])
|
# https://leetcode.com/problems/generate-a-string-with-characters-that-have-odd-counts
def generate_the_string(n):
if n % 2 == 0:
return 'a' * (n - 1) + 'b'
return 'a' * n
|
def generate_the_string(n):
if n % 2 == 0:
return 'a' * (n - 1) + 'b'
return 'a' * n
|
class Queue2Stacks:
def __init__(self):
self.stack1 = []
self.stack2 = []
def size(self):
return len(self.stack1)
def isEmpty(self):
return self.stack1 == []
def enqueue(self,item):
self.stack1.append(item)
def dequeue(self):
if(self.stack2 != []):
return self.stack2.pop()
else:
if(self.stack1 == []):
return "empty!!"
else:
for x in range(len(self.stack1)):
self.stack2.append(self.stack1.pop())
return self.stack2.pop()
#return out
q = Queue2Stacks()
q.enqueue("h")
q.enqueue("a")
q.enqueue("r")
q.enqueue("s")
q.enqueue("h")
print(q.size())
print(q.dequeue())
print(q.dequeue())
q.enqueue("r")
q.enqueue("a")
q.enqueue("j")
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
q.enqueue(1)
q.enqueue(2)
q.enqueue(3)
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
|
class Queue2Stacks:
def __init__(self):
self.stack1 = []
self.stack2 = []
def size(self):
return len(self.stack1)
def is_empty(self):
return self.stack1 == []
def enqueue(self, item):
self.stack1.append(item)
def dequeue(self):
if self.stack2 != []:
return self.stack2.pop()
elif self.stack1 == []:
return 'empty!!'
else:
for x in range(len(self.stack1)):
self.stack2.append(self.stack1.pop())
return self.stack2.pop()
q = queue2_stacks()
q.enqueue('h')
q.enqueue('a')
q.enqueue('r')
q.enqueue('s')
q.enqueue('h')
print(q.size())
print(q.dequeue())
print(q.dequeue())
q.enqueue('r')
q.enqueue('a')
q.enqueue('j')
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
q.enqueue(1)
q.enqueue(2)
q.enqueue(3)
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
|
def gen_counter(cnt=None):
res = 0
while True:
yield res
res += 1 if cnt is None else cnt
if __name__=='__main__':
cnt = gen_counter()
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
cnt = gen_counter(5)
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
|
def gen_counter(cnt=None):
res = 0
while True:
yield res
res += 1 if cnt is None else cnt
if __name__ == '__main__':
cnt = gen_counter()
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
cnt = gen_counter(5)
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
print(next(cnt))
|
#
# PySNMP MIB module NBS-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/NBS-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 20:07:17 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, Integer, OctetString = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "Integer", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
SingleValueConstraint, ValueRangeConstraint, ValueSizeConstraint, ConstraintsUnion, ConstraintsIntersection = mibBuilder.importSymbols("ASN1-REFINEMENT", "SingleValueConstraint", "ValueRangeConstraint", "ValueSizeConstraint", "ConstraintsUnion", "ConstraintsIntersection")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
IpAddress, Integer32, MibScalar, MibTable, MibTableRow, MibTableColumn, ObjectIdentity, Unsigned32, enterprises, iso, NotificationType, TimeTicks, Counter32, MibIdentifier, Bits, Counter64, Gauge32, ModuleIdentity = mibBuilder.importSymbols("SNMPv2-SMI", "IpAddress", "Integer32", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "ObjectIdentity", "Unsigned32", "enterprises", "iso", "NotificationType", "TimeTicks", "Counter32", "MibIdentifier", "Bits", "Counter64", "Gauge32", "ModuleIdentity")
DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention")
nbsMib = ModuleIdentity((1, 3, 6, 1, 4, 1, 629, 250))
if mibBuilder.loadTexts: nbsMib.setLastUpdated('201309170000Z')
if mibBuilder.loadTexts: nbsMib.setOrganization('NBS')
nbs = ObjectIdentity((1, 3, 6, 1, 4, 1, 629))
if mibBuilder.loadTexts: nbs.setStatus('current')
class Unsigned16(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(0, 65535)
class Unsigned64(TextualConvention, Counter64):
status = 'current'
class WritableU64(TextualConvention, OctetString):
status = 'current'
subtypeSpec = OctetString.subtypeSpec + ValueSizeConstraint(8, 8)
fixedLength = 8
class NbsTcTemperature(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-2147483648, 1000)
class NbsTcMilliVolt(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-1, 1000000)
class NbsTcMilliAmp(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-1, 1000000)
class NbsTcMicroAmp(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-1, 2147483647)
class NbsTcMilliDb(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ValueRangeConstraint(-2147483648, 100000)
class NbsTcMilliWatts(TextualConvention, Integer32):
status = 'current'
class NbsTcMHz(TextualConvention, Unsigned32):
status = 'current'
subtypeSpec = Unsigned32.subtypeSpec + ValueRangeConstraint(1, 4294967295)
class NbsTcStatusSimple(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))
namedValues = NamedValues(("notSupported", 1), ("bad", 2), ("good", 3), ("notInstalled", 4))
class NbsTcStatusLevel(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6))
namedValues = NamedValues(("notSupported", 1), ("statusLowError", 2), ("statusLowWarning", 3), ("statusGood", 4), ("statusHighWarning", 5), ("statusHighError", 6))
class NbsTcPartIndex(TextualConvention, Unsigned32):
status = 'current'
class NbsTcStagingCommit(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))
namedValues = NamedValues(("notSupported", 1), ("supported", 2), ("revertToCommitted", 3), ("apply", 4))
mibBuilder.exportSymbols("NBS-MIB", NbsTcStatusLevel=NbsTcStatusLevel, NbsTcPartIndex=NbsTcPartIndex, NbsTcStagingCommit=NbsTcStagingCommit, NbsTcMilliVolt=NbsTcMilliVolt, NbsTcTemperature=NbsTcTemperature, NbsTcMilliWatts=NbsTcMilliWatts, WritableU64=WritableU64, NbsTcMHz=NbsTcMHz, NbsTcStatusSimple=NbsTcStatusSimple, Unsigned16=Unsigned16, nbsMib=nbsMib, PYSNMP_MODULE_ID=nbsMib, nbs=nbs, NbsTcMilliAmp=NbsTcMilliAmp, NbsTcMicroAmp=NbsTcMicroAmp, Unsigned64=Unsigned64, NbsTcMilliDb=NbsTcMilliDb)
|
(object_identifier, integer, octet_string) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'Integer', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(single_value_constraint, value_range_constraint, value_size_constraint, constraints_union, constraints_intersection) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'SingleValueConstraint', 'ValueRangeConstraint', 'ValueSizeConstraint', 'ConstraintsUnion', 'ConstraintsIntersection')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(ip_address, integer32, mib_scalar, mib_table, mib_table_row, mib_table_column, object_identity, unsigned32, enterprises, iso, notification_type, time_ticks, counter32, mib_identifier, bits, counter64, gauge32, module_identity) = mibBuilder.importSymbols('SNMPv2-SMI', 'IpAddress', 'Integer32', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'ObjectIdentity', 'Unsigned32', 'enterprises', 'iso', 'NotificationType', 'TimeTicks', 'Counter32', 'MibIdentifier', 'Bits', 'Counter64', 'Gauge32', 'ModuleIdentity')
(display_string, textual_convention) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TextualConvention')
nbs_mib = module_identity((1, 3, 6, 1, 4, 1, 629, 250))
if mibBuilder.loadTexts:
nbsMib.setLastUpdated('201309170000Z')
if mibBuilder.loadTexts:
nbsMib.setOrganization('NBS')
nbs = object_identity((1, 3, 6, 1, 4, 1, 629))
if mibBuilder.loadTexts:
nbs.setStatus('current')
class Unsigned16(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(0, 65535)
class Unsigned64(TextualConvention, Counter64):
status = 'current'
class Writableu64(TextualConvention, OctetString):
status = 'current'
subtype_spec = OctetString.subtypeSpec + value_size_constraint(8, 8)
fixed_length = 8
class Nbstctemperature(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-2147483648, 1000)
class Nbstcmillivolt(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-1, 1000000)
class Nbstcmilliamp(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-1, 1000000)
class Nbstcmicroamp(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-1, 2147483647)
class Nbstcmillidb(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + value_range_constraint(-2147483648, 100000)
class Nbstcmilliwatts(TextualConvention, Integer32):
status = 'current'
class Nbstcmhz(TextualConvention, Unsigned32):
status = 'current'
subtype_spec = Unsigned32.subtypeSpec + value_range_constraint(1, 4294967295)
class Nbstcstatussimple(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4))
named_values = named_values(('notSupported', 1), ('bad', 2), ('good', 3), ('notInstalled', 4))
class Nbstcstatuslevel(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4, 5, 6))
named_values = named_values(('notSupported', 1), ('statusLowError', 2), ('statusLowWarning', 3), ('statusGood', 4), ('statusHighWarning', 5), ('statusHighError', 6))
class Nbstcpartindex(TextualConvention, Unsigned32):
status = 'current'
class Nbstcstagingcommit(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4))
named_values = named_values(('notSupported', 1), ('supported', 2), ('revertToCommitted', 3), ('apply', 4))
mibBuilder.exportSymbols('NBS-MIB', NbsTcStatusLevel=NbsTcStatusLevel, NbsTcPartIndex=NbsTcPartIndex, NbsTcStagingCommit=NbsTcStagingCommit, NbsTcMilliVolt=NbsTcMilliVolt, NbsTcTemperature=NbsTcTemperature, NbsTcMilliWatts=NbsTcMilliWatts, WritableU64=WritableU64, NbsTcMHz=NbsTcMHz, NbsTcStatusSimple=NbsTcStatusSimple, Unsigned16=Unsigned16, nbsMib=nbsMib, PYSNMP_MODULE_ID=nbsMib, nbs=nbs, NbsTcMilliAmp=NbsTcMilliAmp, NbsTcMicroAmp=NbsTcMicroAmp, Unsigned64=Unsigned64, NbsTcMilliDb=NbsTcMilliDb)
|
"""
Date Created: 2018-03-08
Date Modified: 2018-03-08
Version: 1
Contract Hash: 1aa965c53c373ef9d3be065bdb36b234cdcab66a
Available on NEO TestNet: False
Available on CoZ TestNet: False
Available on MainNet: False
Example:
Test Invoke: build /path/to/add.py test 0202 02 False False 2 5
Expected Result: 2
Operation Count: 51
GAS Consumption: 0.045
"""
def Main(a, b):
"""
:param a: First input number of concern
:param b: Second input number of concern
:type a: int
:type b: int
:return: The smallest value of the 2 input numbers
:rtype: int
"""
result = min(a, b)
return result
|
"""
Date Created: 2018-03-08
Date Modified: 2018-03-08
Version: 1
Contract Hash: 1aa965c53c373ef9d3be065bdb36b234cdcab66a
Available on NEO TestNet: False
Available on CoZ TestNet: False
Available on MainNet: False
Example:
Test Invoke: build /path/to/add.py test 0202 02 False False 2 5
Expected Result: 2
Operation Count: 51
GAS Consumption: 0.045
"""
def main(a, b):
"""
:param a: First input number of concern
:param b: Second input number of concern
:type a: int
:type b: int
:return: The smallest value of the 2 input numbers
:rtype: int
"""
result = min(a, b)
return result
|
def test_calculator_add_returns_correct_result():
result = calc_add(2,2)
assert result == 4
# def calc_add(x,y):
# pass
# return x+y
# if isinstance(x, number_types) and isinstance(y, number_types):
# return x + y
# else:
# raise ValueError("Non-numeric input given")
# def test_calculator_returns_error_message_if_both_args_not_numbers():
# try:
# calc_add("two", "three")
# except ValueError:
# print("Exception caught")
# assert True, "Fail: ValueError exception not caught"
# except:
# assert False, "Fail: Exception other than ValueError caught"
# else:
# assert False, "Fail: No exception caught"
# def test_calculator_returns_error_message_if_both_args_not_numbers():
# with pytest.raises(ValueError):
# calc_add("two", "three")
# def test_calculator_returns_error_message_if_x_arg_not_number():
# with pytest.raises(ValueError):
# calc_add("two", 3)
# def test_calculator_returns_error_message_if_y_arg_not_number( ):
# with pytest.raises(ValueError):
# calc_add(2, "three")
|
def test_calculator_add_returns_correct_result():
result = calc_add(2, 2)
assert result == 4
|
def getGroupCount(line):
#print("Line "+line)
curSet = set(())
for curChar in line:
curSet.add(curChar)
#print("Set: "+str(curSet))
return len(curSet)
filename = "inputs\\2020\\input-day6.txt"
with open(filename) as f:
lines = f.readlines()
group = ""
sum = 0
for line in lines:
if len(line.strip()) == 0:
sum += getGroupCount(group.strip())
group = ""
else:
group += line.strip()
sum += getGroupCount(group.strip())
print("Sum: "+str(sum))
|
def get_group_count(line):
cur_set = set(())
for cur_char in line:
curSet.add(curChar)
return len(curSet)
filename = 'inputs\\2020\\input-day6.txt'
with open(filename) as f:
lines = f.readlines()
group = ''
sum = 0
for line in lines:
if len(line.strip()) == 0:
sum += get_group_count(group.strip())
group = ''
else:
group += line.strip()
sum += get_group_count(group.strip())
print('Sum: ' + str(sum))
|
def up_array(arr):
if not arr:
return None
else:
string = ''
for item in arr:
if not str(item).isdigit() or item > 9:
return None
else:
string += str(item)
total = []
for char in str(int(string)+1):
total.append(int(char))
return total
|
def up_array(arr):
if not arr:
return None
else:
string = ''
for item in arr:
if not str(item).isdigit() or item > 9:
return None
else:
string += str(item)
total = []
for char in str(int(string) + 1):
total.append(int(char))
return total
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.