content
string | url
string | timestamp
timestamp[ms] | dump
string | segment
string | image_urls
list |
---|---|---|---|---|---|
photography
"Sleepwalk With Me" Official Trailer - In Theaters August 24, 2012 - IFC Filmsphotography 10mo ago
ABOVE THE RIM.movphotography 29m ago
Slide Wedding 1photography 33m ago
VERB FRAU TV episode 8 Joel Verwimpphotography 43m ago
Rumours Exclusive (Liang Court)photography 43m ago
Bonobo - Know Youphotography 57m ago
Χρήστος Κουκουλάκης - Το πιο μεγαλο θαυμα (+Στίχοι) ( Despoina2081 ) HD New song 2013photography 1h ago
Kenneth Moore Art Opening at Art First Gallery- Produced by OddBox Studiosphotography 1h ago
[Champagne]'s UK Live Debut at The Pipeline (London) by Japan Underground. You're so sweet 1080pphotography 1h ago
Mwurinno Sio Nap Seni Epinochphotography 1h ago
Dr Rajeswary Wedding Dinner Trailerphotography 2h ago
Dr. Pooma & Dr. Vignes Weddingphotography 2h ago
BEN&CLAIRE 永恆約定photography 2h ago
The Famous Unknowns Carlos Vamos Lindsay Buckland 16.wmvphotography 2h ago
GRIM MOSES (TSOI) "CLASSIC" OFFICIAL VIDEOphotography 2h ago
JOE & VAL Save the Date by Nice Print Photographyphotography 3h ago
Shoot The Face - Recap of Entries - Jan to March 2013photography 3h ago
Digital Photography One on One: Episode 61: Viewer Feedbackphotography 3h ago
Got it For Cheap Starring Finale Feat. Julio Cezer Directed By:BlackLightWave @Cupid176photography 3h ago
Blue Oathphotography 4h ago
Short Konkani Film - DON UTRAMphotography 4h ago
Year Onephotography 4h ago
Arthur Minasyan -- You [Official Video]photography 4h ago
Te Anau to Milford Sound (SH94) - Timelapsephotography 5h ago
Engagement Shoot / Newport Beach Wedding Photographer / Orange County Wedding Photographyphotography 6h ago
Mioara Dragan Photography | Promo Videophotography 6h ago
Horseshoe Bend: Final Image Processing in Lightroom 4 - From the HDR Photography Workshop Seriesphotography 6h ago
Digital Photography - What Are the Different Types Of Effect?photography 6h ago
donut moviephotography 6h ago
Espinosa y Ortega Murcielago Belicoso Cigar Reviewphotography 7
- just for laughs
-esse (WBEZ Chicago
|
http://www.frequency.com/video/sleepwalk-with-me-official-trailer-in/53637124/-/5-2199
| 2013-05-18T11:04:44 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://image1.frequency.com/uri/w60_h60/_/keyword/2/1/9/9/photography_2199_thumbnail.jpg",
"photography"
]
] |
Forgot your
Member benefits:
A modern, white raised fire pit set on a rock base makes this a sophisticated space to gather.
To make the most of this home's secret garden, the homeowners wanted a space where friends and family could hang out. They beautifully transformed a previously wasted backyard patch into this intimate al fresco retreat with pea gravel, a built-in brick bench and a cool outdoor fireplace from Surfing Cowboys, a vintage store in Venice, California.
Outdoor fireplace, Surfing Cowboys
A sleek, modern gas-fueled fireplace is the perfect backdrop to this garden boasting a mix of strong shapes and textures.
Adding a wood-burning chimney makes this outdoor space warm and inviting.
An over-size stone fireplace is a fabulous focal point on this patio.
The round covered fire pit echos the modern lines of the patio furnishings.
The built-in stone fire pit fits perfectly in the corner of this stone patio.
August 13, 2012 11:04 AM
Where did you find that fire pit ring ????
Reply
November 23, 2011 10:03 AM
Does anyone have an idea to spruce up my kitchen? I have a typical 1980s kitchen with the beige formica cabinets that go all the way to the 7 ft ceiling in my VERY small kitchen. It is a galley kitchen and the plain, drab beige is really getting to me, but I don't have any ideas or knowledge of how to redo the formica cabinets. I am on a fixed income and although the cabinets are in good shape, their dullness is depreswsing. Does anyone know the secret of how to paint these if, indeed, that is my only option?
© 2012 Reiman Media Group, LLC.
|
http://www.freshhomeideas.com/Room-Ideas/Outdoor/Outdoor-Furniture/outdoor-fire-pits-and-fireplaces
| 2013-05-18T10:42:13 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Fresh Selects: Joi – Sunshine and the Rain mp3
My old high school friend DJ AppleJac introduced me to a girl named Keya. I ran my magic and in no time we were on our way to a beautiful relationship. one of the things that i rememeber the most about that time period, was that key put me on to soooo much music…Omar, Jamiroquai, Meshell Ndegeocello, Vanessa Paradis the list goes on. One night while being schooled she dropped song that blew me a way. The song was loaded with heavy jeep bass that knocked like “Hold On” by EnVogue, but way harder. I didnt even have to ask who or what it was ringing out the speakers as she handed me the jewel case. The song was called “Sunshine and the Rain”, from a cd called The Pendulum Vibe. The artist was the same slim slender that lit up the hallways of my youth, my friend’s sister’s best friend JOI.
Now…
Since then I’ve JOI flossing billboards and posing slim and sexy in mega money print campaigns. I’ve been to many of her shows, and watched as her forward thinking style and attitude shed its influence on Atlanta and beyond. When i started dj’ing I searched high and low for a 12 inch copy of “Sunshine and the Rain”. It’s a timeless futuristic classic that always stays handy incase i have to rock vinyl.
Now rest assured that JOI is still that forward thinking sexy slim. This is very evident in her latest project Hot Heavy & Bad. Hot Heavy & Bad = JOI and Pal’s Lounge owner and original Proton memeber, Devon Lee. The video for their first single, “ONE” was directed by my old muchacho and Yin Yang Alumni Dashon.Is. A freshly serious piece of work that I’m not even going get started on cause it would take up too much time. I’ll let the Creative Loafing and the interwebs take it from here… Required reading: Creative Loafing. Be sure to follow Hot, Heavy & Bad.
|
http://www.freshlyserious.com/2010/08/09/the-atl-og-queen-bee-joi/
| 2013-05-18T10:13:20 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://img.youtube.com/vi/HvNoUYvDyIk/0.jpg",
"YouTube Preview Image"
]
] |
Is it a camera? Not quite. But Polaroid‘s new SC1630 isn’t really a smartphone either. Hence the creative designation of “smart camera”. With a 16-megapixel camera plus a 3X optical zoom lens housed in a nifty, leather bound case, the Polaroid SC1630 Smart Camera is capable of recording High Definition videos and ultra sharp still images. On the device’s back is a 3.2-inch touchscreen LCD display. It doubles as a Smartphone and controls to the camera. Thanks to its Wi-Fi and cellphone capabilities, images and videos can be geo-tagged, edit, and upload to the social network of you choice. Though competitors like Samsung, LG, Sony Ericsson, and Sharp all have peddled similar two-in-one devices in the past. This debut design from Polaroid shows the revamped label is thinking outside of the box. Currently on display at CES in Las Vegas, the Polaroid SC1630 Smart Camera will be available sometime this year with price yet to be determined.
POLAROID ANNOUNCES THE SC1630 SMART CAMERA POWERED BY ANDROIDâ„¢.
|
http://www.freshnessmag.com/2012/01/12/polaroid-sc1630-smartphone-android/
| 2013-05-18T10:53:06 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://images.freshnessmag.com/wp-content/uploads//2012/01/Polaroid-SC1630-Smartphone-Android-01.jpg",
"Polaroid-SC1630-Smartphone-Android-01 Polaroid SC1630 Smartphone Camera | Powered by Android"
],
[
"http://images.freshnessmag.com/wp-content/uploads//2012/01/Polaroid-SC1630-Smartphone-Android-02.jpg",
"Polaroid-SC1630-Smartphone-Android-02 Polaroid SC1630 Smartphone Camera | Powered by Android"
],
[
"http://images.freshnessmag.com/wp-content/uploads//2012/01/Polaroid-SC1630-Smartphone-Android-03.jpg",
"Polaroid-SC1630-Smartphone-Android-03 Polaroid SC1630 Smartphone Camera | Powered by Android"
],
[
"http://images.freshnessmag.com/wp-content/uploads//2012/01/Polaroid-SC1630-Smartphone-Android-04.jpg",
"Polaroid-SC1630-Smartphone-Android-04 Polaroid SC1630 Smartphone Camera | Powered by Android"
],
[
"http://images.freshnessmag.com/wp-content/uploads//2012/01/Polaroid-SC1630-Smartphone-Android-05.jpg",
"Polaroid-SC1630-Smartphone-Android-05 Polaroid SC1630 Smartphone Camera | Powered by Android"
],
[
"http://images.freshnessmag.com/wp-content/uploads//2012/01/Polaroid-SC1630-Smartphone-Android-06.jpg",
"Polaroid-SC1630-Smartphone-Android-06 Polaroid SC1630 Smartphone Camera | Powered by Android"
]
] |
WIL® (fulvestrant) Injection
Indication
FASLODEX is indicated for the treatment of hormone receptor-positive metastatic breast cancer in postmenopausal women with disease progression following antiestrogen therapy.
Please see full Prescribing Information for FASLODEX.
– ENDS –
NOTES TO EDITORS
About CONFIRM and overall survival, tolerability, and quality of life (QoL).1
The initial OS analysis conducted at a minimum follow up of 18 months and 50% maturity, showed no statistically significant difference in OS (HR=0.84; 95% CI: 0.69-1.03) (p=0.091). The median overall survival was 25.1 months with FASLODEX 500 mg and 22.8 months with 250 mg. The updated OS analysis, conducted at a minimum follow up of 50 months and 75% maturity, showed a 19% relative reduction in the risk of death (hazard ratio (HR) 0.81; 95% confidence interval (CI) 0.69 to 0.96). No adjustments were made for multiplicity, therefore these data cannot be considered statistically significant. The KM estimate showed a sustained separation of the curves and a median survival of 26.4 months vs 22.3 months for the 500 mg and 250 mg doses, respectively.3
About Metastatic Breast Cancer
Metastatic breast cancer occurs when cancer cells spread beyond the initial tumor site to other parts of the breast or body; it is the most advanced stage of breast cancer (stage four).5,6 Metastatic breast cancer may be diagnosed as an initial diagnosis, as a distant recurrence after treatment of early breast cancer, or as a progression of earlier stage disease.7,8 There is no cure for metastatic breast cancer; the goal of treatment is to delay the progression of the cancer).
2232405 Last Updated 12/12
Photos/Multimedia Gallery Available:
Media Inquiries US
Rachelle Benson +1 302 885 5853
mob: +1 302 5595861
|
http://www.freshnews.com/news/735431/final-overall-survival-analysis-confirm-shows-4-1-month-difference-median-overall-survi
| 2013-05-18T10:32:22 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
PALO ALTO, Calif. -- (BUSINESS WIRE) --ve served as senior director of software engineering for Transmeta Corporation, where he engineered an early form of virtualization known as “Code Morphing.” He also held previous engineering positions with Silicon Graphics and MIPS Technologies.
“Steve is a pioneer in virtualization and cloud technologies and we are incredibly pleased to have him join the General Catalyst partnership,” said Hemant Taneja, Partner at General Catalyst. “Steve will help lead the firm’s investment focus in next generation infrastructure technologies which we expect will go through significant transformation over the next decade.”
equity.
General Catalyst Partners
Michelle Daubar, 617-234-7028
[email protected]
|
http://www.freshnews.com/news/748897/vmware-cto-stephen-herrod-joins-general-catalyst-partner-palo-alto-office
| 2013-05-18T10:12:30 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
HOUSTON -- (BUSINESS WIRE) -- The Department of Health and Human Services (DHHS) is the United States government’s principal agency for protecting the health of all Americans and providing essential human services. As such, its mandate is one of the most extensive in the federal government – a real acid test for any software company’s products.
DHHS decided that the agency needed an IT service management solution that could provide consistent service to its IT-savvy internal customers. This would improve internal performance, and ultimately result in better service.
“When we can find ways to improve processes or make ourselves more efficient, it benefits not just our agency team but the taxpayers at large,” said Wallace Wilhoite, who leads the DHHS digital forensics team.
After a major evaluation, the agency selected BMC Remedyforce Service Desk from BMC Software (NASDAQ: BMC) because the solution best delivered the improved responsiveness and quick ROI that the agency was looking for. BMC’s in-depth understanding of federal security requirements and its active involvement in the FedRAMP program for cloud security were also important factors in the decision, as was the company’s strong support of the IT Infrastructure Library® (ITIL®) standards.
“With BMC Software, the agency’s return on investment was nearly immediate,” said Wilhoite. “In addition, BMC has been actively involved in FedRAMP compliance, which is what all Federal agencies are watching right now. They have essentially committed to making sure that they adhere to those security requirements and deliver us a secure solution.”
The Challenge
DHHS wanted to replace its slow, inconsistent ITSM processes – such as a paper-based IT service management process – with a solution that could consistently meet the demands of its IT-savvy internal customers. The agency also needed to meet government-mandated security requirements such as FedRAMP.
The Solution
The agency chose the BMC Remedyforce Service Desk solution to meet these goals with a cloud-based approach.
Benefits
By implementing the BMC Remedyforce Service Desk solution, DHHS has experienced a number of benefits, including:
For more information on the DHHS implementation and the BMC Remedyforce.
ITIL® is a registered trade mark of the Cabinet Office.
IT Infrastructure Library® is a registered trade mark of the Cabinet Office.
|
http://www.freshnews.com/news/749124/customer-success-u-s-department-health-and-human-services-delivers-better-service-bmc-r
| 2013-05-18T10:23:43 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
USC §119(e) of U.S. provisional application Ser. No. 60/582,357 filed Jun. 23, 2004.
Two copies of the sequence listing (Copy 1 and Copy 2) and a computer readable form (CRF) of the sequence listing, all on CD-ROMs, each containing the file named SEQUENCE_LISTING.txt, which is approximately 901,120 Bytes (measured in MS-WINDOWS), are herein incorporated by reference.
The invention relates generally to plant molecular biology and more particularly to the expression of isopentenyl transferase genes in plants under the control of cell cycle promoters that function in plants.
One of the goals of plant genetic engineering is to produce plants with agronomically important characteristics or traits. Recent advances in genetic engineering have provided the requisite tools to transform plants to contain and express foreign genes. Particularly desirable traits or qualities of interest for plant genetic engineering include but are not limited to resistance to insects and other pests and disease-causing agents, tolerances to herbicides, enhanced stability, yield, yield stability, shelf-life, environmental tolerances, and nutritional enhancements. The technological advances in plant transformation and regeneration have enabled researchers to take pieces of DNA, such as a gene or genes from a heterologous source, or a native source, and incorporate the exogenous DNA into the plant\'s genome. The gene or gene(s) can then be expressed in the plant cell to exhibit the added characteristic(s) or trait(s). In one approach, expression of a novel gene that is not normally expressed in a particular plant or plant tissue confers a desired phenotypic effect(s).
Plant growth and development is controlled by a diverse array of phytohormones in response to endogenous signals and environmental cues. These molecules include auxins, gibberellins, ethylene, cytokinins, abscisic acid, brassinosteroids, oligosaccharides, jasmonates, salicylic acid, and polyamines. In recent years, the large-scale sequencing of plant genomes, together with extensive molecular, genetic and biochemical studies, has led to the elucidation of the biosynthetic pathways for cytokinin biosynthesis. This in turn has allowed for new approaches to crop improvement by manipulating the expression of genes regulating the plant hormone biosynthesis through novel combination of gene expression elements and structural genes. Prior work has shown through both forward and reverse genetic analyses that plant hormonal regulation is highly complex. This has made it difficult to develop transgenic plants with improved agronomic traits but without deleterious pleiotropic effects.
Isopentenyl transferase (IPT) is a gene that was first isolated from Agrobacterium tumefaciens T-DNA. It was shown that expression of IPT in transgenic plants resulted in elevated cytokinin accumulation, which was accompanied by morphological alterations of transgenic plants. Expression of IPT in an entire plant has phenotypes that are not advantageous, causing dwarfing, reduced leaf area, and thicker stems (Hlinkova, E., et al., Biologia Plantarum, Vol. 41: 25-37, 1998). Expression in entire plants also leads to stunting, loss of apical dominance, reduction in root initiation and growth, either acceleration or prolonged delayed senescence in leaves (depending on growth conditions), adventitious shoot formation from unwounded leaf veins and petioles, altered nutrient distribution, and abnormal tissue development in stems (Li, et al., Dev Biol 153: 386-395, 1992). When IPT is constitutively expressed at high level through either the CaMV 35S promoter or the native IPT promoter, the transgenic plants would develop severely retarded shooty morphology and would fail to root (Klee et al., Ann Rev Plant Phys 38:467-486, 1987). Whole plants transformed with IPT genes with weaker or controlled expression, such as the promoter of heat shock protein genes, also display the effects of cytokinin overproduction, such as uncontrolled axillary bud growth as a result of the loss of apical dominance, the development of small, rounded or curling leaves, and the retardation of root formation (Medford et al., Plant Cell 1:403-413, 1989; Schmulling et al., FEBS Letters 249:401-406, 1989; Smigocki, PNAS 85: 5131-5135, 1991; Hewelt et al., Plant J 6: 879-891, 1994; Smart et al., Plant Cell 647-656, 1991; Van Loven et al., J Exp Bot 44: 1671-1678, 1993; Faiss et al., Plant J 12: 401-425, 1997). It was also shown that low level of constitutive IPT expression, such as that directed by a heat shock promoter under non-inductive conditions, would be sufficient to induce abnormal plant growth and development (Medford et al., Plant Cell 1:403-413 1989; Smigocki, PNAS 85: 5131-5135, 1991). Remarkably, such deleterious pleiotrophs occurred even when some seemingly tissue or organ specific promoters were used to drive the IPT expression in plants. For example, when an auxin-inducible bidirectional promoter from the soybean SAUR gene was used to drive the expression of IPT in transgenic tobacco plants, the transgene-produced cytokinin was present in a tissue- and organ-specific manner. Yet the localized overproduction of cytokinins still resulted in a number of morphological and physiological off-types, including stunting, loss of apical dominance, reduction in root initiation and growth, abnormal leaf development, adventitious shoot formation from unwounded leaf veins and petioles, altered nutrient distribution, and abnormal tissue development in stems (Li, et al., Dev Biol 153: 386-395, 1992). When IPT was specifically expressed in developing seeds using a highly specific seed promoter, no seed size increase was observed (Roeckel et al., Transgenic Res 6:133-141, 1997). We show that, despite these and other teachings against expression of IPT in plants, the expression under certain cell cycle regulated promoters leads to advantageous phenotypes.
In accordance with the present invention, it has been found.
In accordance with one aspect of the invention transgenic plants expressing a cytokinin biosynthetic protein under the control of a cell cycle regulated promoter are provided wherein the plants exhibit at least one phenotypic trait selected from the group consisting of accelerated plant growth, increased organ size, increased organ number, increased reproductive organ number, increased seed size, increased silique number, and/or increased seed number when compared to a plant of the same species not expressing such cytokinin biosynthetic protein under the control of a cell cycle regulated promoter.
In accordance with a further aspect of the invention, recombinant DNA polynucleotides comprising a cell cycle regulated promoter that functions in plants operably linked to a DNA polynucleotide which encodes a protein involved in cytokinin biosynthesis are provided.
In accordance with another aspect of the invention, cell cycle regulated promoters are provided. More particularly, such promoters are identified from the 5′ upstream region of the family of cyclin genes, such as the promoter regions selected from the group consisting of the CycD3 and CycB1 genes.
Also provided are recombinant DNA polynucleotides encoding a protein that are similar to an isopentenyl transferase, encodes a protein that is substantially identical to, or hybridizes to a nucleic acid encoding, a protein selected from the group consisting of SEQ ID NO: 1, 2, 15, 17, 19, 21 and 22-359.
Also provided are recombinant DNA molecules with combinations of cyclin promoters and DNA polynucleotides encoding an isopentyl transferase and transgenic plants containing such a recombinant DNA molecule.
FIG. 1 shows a northern blot of the expression levels in roots, flowers, and leaves of plants containing in their genome an IPT gene under the control of CycD3, CycB1, and CDC2a. ACT is shown as loading control to show each lane is loaded with an equivalent amount of RNA.
FIG. 2 shows the expression in leaf of plants with different copy numbers of transgene containing IPT under the control of different promoters. Quantitation was done using Taqman.
FIG. 3 shows the number of plants created with each transgene (panel A), and the percent survival of the plants (panel B).
FIG. 4 is a visual representation of the problems of expression of IPT in non-dividing cells. Panels A (left) illustrates the observed phenotype of a plant when a largely constitutive promoter is used (E35S) in accordance with the constructs of the present invention. Panel B (right) shows the observed phenotype when a less constitutive promoter is used, but one that allows expression in non-dividing cells (AtCDC2a).
FIG. 5 shows the increased canopy size of plants transformed with CycD3::IPT compared to wild type.
FIG. 6 shows the mature plant size of plants transformed with CycD3::IPT compared to wild type.
FIG. 7 shows the relative seed size of plants transformed with different promoters driving IPT.
FIG. 8 shows a map of plasmid pMON66507. This plasmid was the base vector for many plasmids used herein and contains the portions required for propagation in bacteria and Agrobacterium-mediated transformation in plants. The E35S promoter was removed and a number of different cyclin promoters and CDC2a promoter were added to this vector to create many of the vectors created herein, see examples.
It has been discovered.
Isopentyl transferase (IPT) is a gene involved in cytokinin biosynthesis that may be isolated from many species. One particular IPT is a gene isolated from Agrobacterium tumefaciens T-DNA. It has been shown that expression of IPT in transgenic plants resulted in elevated cytokinin accumulation, which was accompanied by morphological alterations of transgenic plants. Constitutive expression of IPT in an entire plant exhibits phenotypes that are not advantageous for a growing crop. Herein it is shown that the expression of IPT under the regulatory control of a cell cycle regulated promoter whose expression is predominantly in dividing cells of the plant provides advantageous phenotypes directed to yield that are useful for a growing crop plant.
“Isopentyl transferase” or “isopentenyl transferase” or “IPT” or “ipt” as used herein includes any enzyme that catalyzes the reaction of adenosine 5′-monphosphate or adenosine 5;-triphosphate and dimethylallyl disphosphate to N6-(Δ2-isopentenyl)adenosine 5′-phosphate, including but not limited to all isopentenyl transferase/dimethylallyl transferase from all sources including plants, animals, and microbes (Buchanan, et al., Biochemistry and Molecular Biology of Plants, Courier Companies, Inc., USA, ISBN 0-943088-39-9; Haberer and Kieber, Plant Physiology 128:354 (2002)). “Isopentyl transferase” or “isopentenyl transferase” or “IPT” or “ipt” also includes any enzyme that increases cytokinin levels through a pathway which includes zeatinriboside-5′-monphosphate (ZMP) (Astot, et al., PNAS 97:14778-14883, 2000). Examples of IPT and IPT-like proteins that are within the scope of the invention include SEQ ID NOs: 2, 15, 17, 19, 21, and 22-359, and any protein related thereto, or any nucleotide sequence encoding such a protein including such nucleotide sequences that would hybridize to any of SEQ ID Nos: 1, 14, 16, 18 and 20 under stringent conditions as described hereinafter. IPT genes expected to function in the invention include, but are not limited to, for example, proteins which contain the motif found in many IPT genes, such as PF01715 are also expected to function in the invention. These latter motifs are from Pfam which describes IPT and IPPT as follows: IPT or isopentenyl transferase/dimethylallyl transferase synthesizes isopentenyladensosine 5′-monophosphate, a cytokinin that induces shoot formation on host plants infected with the Ti plasmid. IPPT). Pfam is a large collection of multiple sequence alignments and hidden Markov models covering many common protein families. Pfam version 12.0 (January 2004) contains alignments and models for 7316 protein families, based on the Swissprot 42.5 and SP-TrEMBL 25.6 protein sequence databases.
“Promoter,” as used herein, refers to a DNA polynucleotide that binds an RNA polymerase (either directly or indirectly through another transcription factors) and promotes transcription of a downstream DNA polynucleotide. The downstream DNA polynucleotide can be transcribed into an RNA that has function, such as rRNA, RNAi, dsRNA, or tRNA. Often, the RNA produced is a hetero-nuclear (hn) RNA that has introns which are spliced out to produce an mRNA (messenger RNA). A “plant promoter” is a native or non-native promoter that is functional in plant cells
A cell cycle regulated promoter is a promoter that is regulated in its expression during the cell cycle. Cell cycle regulated promoters, as used herein, are further characterized in that they express an operably linked polynucleotide at their highest levels in actively dividing cells as compared to non-dividing cells. Preferably, cell cycle regulated promoters of the present invention are characterized by a reduction of about 20%-about 30% in the expression level of an operably linked polynucleotide in non-dividing cells. More preferably, a cell cycle regulated promoter of the present invention has an expression pattern wherein 10% or less of the expression of an operably linked polynucleotide can be attributed to non-dividing cells. The promoters herein encompass not only the sequences of the cell cycle regulated promoters described herein, but sequences that hybridize (as defined hereinafter) to at least one of the cell cycle regulated promoter sequences provided herein and operative fragments thereof, that function as plant promoters in the same or similar manner. In particularly preferred embodiments, the cell cycle regulated promoter is a promoter isolated from a member of the cyclin gene family. Specific cyclin promoters include those selected from the group consisting of the promoters identified herein as CycD3 (SEQ ID NO:8) or CycB1 (SEQ ID NO:5), both Arabidopsis promoters. The term “cyclin” refers to a regulatory protein, comprising a protein domain of about 100 amino acids known as the “cyclin box”. The cyclin box is the binding site for cyclin-dependent kinases, allowing the cyclin to exert its regulatory effect on the kinase activity of the CDKs. A cyclin box can be identified by comparing the amino acid sequence of the protein with known cyclin boxes. An amino acid sequence identified as a cyclin box on the basis of sequence comparison should possess at least the 5 conserved residues required for cyclin activity R(97), D(126), L(144), K(155), and E(185) (indicated positions are from the sequence of CYCD2 from Arabidopsis thaliana) at equivalent positions. (See, e.g., Soni et al., Plant Cell, 7:85-103 (1995) and Renaudin et al., Plant Molecular Biology, 32:1003-1018 (1996)) (R=arginine, D=aspartic acid, L=leucine, K=lysine, and E=glutamic acid). Cyclin promoters are those promoters that drive the expression of cyclin genes at specific times within each cell cycle in the organism in which they occur, for example, plants. Specific cyclin promoters include those of specific cyclin genes, for example see the sequence listing and examples. Cell cycle progression requires the activation of cyclin-dependent kinases (CDKs) whose catalytic activity and substrate specificity are determined by cyclins and by other regulatory proteins (Hilde et al., Plant Molecular Biology, 43:583-593, 2000; Marcel and Murray, Current Opinion in Plant Biology, 4:44-49, 2002). The activity of the CDK-cyclin complexes is activated and deactivated at specific points in the cell cycle. Certain CDK-cyclin complexes are activated at the G1-S transition and trigger the start of DNA replication. Different CDK-cyclin complexes are activated at the G2/M transition and induce mitosis leading to cell division. As used herein, cell division control (CDC) genes are genes that control cell division, and are differently expressed during cell division. Promoters isolated from a CDC genes of specific types, for example, CDC2a (SEQ ID NO: 11) do not have expression patterns that provide high level expression predominantly in dividing cells.
A first nucleic acid or protein sequence displays “substantial identity” or “substantial similarity” to a reference nucleic acid sequence or protein if, when optimally aligned (with appropriate nucleotide or amino acid insertions or deletions totaling less than 20 percent of the reference sequence over the window of comparison) with the other nucleic acid (or its complementary strand) or protein, there is at least about 60% nucleotide sequence equivalence, even better would be 70%, preferably at least about 80% equivalence, more preferably at least about 85% equivalence, and most preferably at least about 90% equivalence over a comparison window of at least 20 nucleotide or amino acid positions, preferably at least 50 nucleotide or amino acid positions, more preferably at least 100 nucleotide or amino acid positions, and most preferably over the entire length of the first nucleic acid or protein. Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm(s), preferably by computerized implementations of these algorithms (which can be found in, for example, Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.). The reference nucleic acid may be a full-length molecule or a portion of a longer molecule. Alternatively, two nucleic acids have substantial identity if one hybridizes to the other under stringent conditions. Appropriate hybridization conditions can be determined empirically, or can be estimated based, for example, on the relative G+C content of the probe and the number of mismatches between the probe and target sequence, if known. Hybridization conditions can be adjusted as desired by varying, for example, the temperature of hybridizing or the salt concentration (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989).
The term “recombinant DNAs” or “recombinant DNA molecules” as used herein means DNAs that contains a genetically engineered modification through manipulation via mutagenesis, restriction enzymes, and the like. The polynucleotide itself can come from either naturally occurring sources or can be created in the laboratory. It can also include all vectors created by DNA engineering, for example, all the DNA molecules included herein designated by pMON. For example, it can include molecules containing naturally occurring DNA or cDNA, or DNA molecules of synthetic origin in a plasmid, or isolated DNA. A “recombinant” polynucleotide or “recombinant DNA molecule” can be made by an artificial combination of two otherwise separated segments of a polynucleotide, e.g., by chemical synthesis or by the manipulation of isolated segments of polynucleotides by genetic engineering techniques. Techniques for nucleic-acid manipulation are well-known (see, e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y. (1989); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y. (1988). The terms “recombinant DNA construct”, “recombinant vector”, “expression vector” or “expression cassette” refer to any agent such as a plasmid, cosmid, virus, BAC (bacterial artificial chromosome), autonomously replicating polynucleotide, phage, or linear or circular single-stranded or double-stranded DNA or RNA polynucleotide, derived from any source, capable of genomic integration or autonomous replication, comprising a DNA molecule in which one or more DNA polynucleotides have been linked in a functionally operative manner.
Hybridization conditions are dependent on the sequence of the polynucleotide and will be different in different circumstances. As used herein “stringent conditions” are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific polynucleotide at a defined ionic strength and pH. The “thermal melting point” is the temperature (under defined ionic strength and pH) at which 50% of a target molecule hybridizes to a completely complementary molecule. Appropriate stringent, incorporated herein by reference in its entirety. For example, the salt concentration in the wash step can be selected from a low stringent condition of about 2.0×SSC at 50° C. to a high stringency of about 0.2×SSC at 50° C. In addition, the temperature in the wash step can be increased from low stringent conditions at room temperature, about 22° C., to high stringent conditions at about 65° C. Both temperature and salt concentration may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed. For the purposes of this disclosure, stringent conditions include at least one wash in 2.0×SSC at a temperature of at least about 50° C. for 20 minutes, or equivalent conditions.
A first polynucleotide is “operably linked” with a second polynucleotide when the polynucleotides are so arranged that the first polynucleotide affects the function of the second polynucleotide. Often, the two polynucleotides are part of a single contiguous polynucleotide molecule and sometimes are adjacent. For example, a promoter is operably linked to a gene if the promoter regulates or mediates transcription of the gene. A promoter is “naturally operably linked” to a structural gene if the promoter drives the transcription of the structural gene in the genome of an organism when said promoter and said structural gene are in their native locations within said genome.
“Heterologous” sequence refers to a sequence which originates from a foreign source or species or, if from the same source or species, is modified from its original form; for example, a gene from a fungus being expressed in a plant; or a gene from the same species present under a different promoter, or a promoter driving the expression of a gene or RNA in a non-native location within the genome.
An “isolated” nucleic acid sequence or DNA molecule.
“Native” refers to a naturally occurring (“wild-type”) nucleic acid sequence.
In a preferred embodiment, the instant invention comprises a transgenic plant comprising a recombinant DNA molecule having a cell cycle regulated promoter operably linked to a cytokinin biosynthetic enzyme. The plant may be a monocotyledonous plant or dicotyledonous, and includes but is not limited to corn, soybean, Arabidopsis, cotton, wheat, rice, and canola.
Recombinant DNA molecules of the instant invention can be transformed into a many commercially useful plants. In a preferred embodiment of the invention, a transgenic plant expressing the desired protein is to be produced. In this case the desired protein may be operably linked to particular promoter controlling expression in a cell cycle regulated way.. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold..
Microprojectile bombardment techniques are widely applicable, and may be used to transform virtually any plant species. Examples of species that have been transformed by microprojectile bombardment include monocot species such as maize (PCT Publication WO 95/06128), barley, wheat (U.S. Pat. No. 5,563,055, specifically incorporated herein by reference in its entirety), rice, oat, rye, sugarcane, and sorghum; as well as a number of dicots including tobacco, soybean (U.S. Pat. No. 5,322,783, specifically incorporated herein by reference in its entirety), sunflower, peanut, cotton, tomato, and legumes in general (U.S. Pat. No. 5,563,055, specifically incorporated herein by reference in its entirety)..
The regeneration, development, and cultivation of plants from various transformed explants.
The regeneration, development and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art. See generally, Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995); Weissbach and Weissbach, In: Methods for Plant Molecular Biology, Academic Press, San Diego, Calif. (1988). Plants of the present invention can be part of or generated from a breeding program, and may also be reproduced using apomixis. Methods for the production of apomictic plants are known in the art. See, e.g., U.S. Pat. No. 5,811,636.
The transgenic plant prepared in accordance with the invention may be of any generation, including a fertile or sterile R0 transgenic plant as well as seeds thereof, and hybrid seed wherein the seed comprises a cell cycle regulated promoter operably linked to a cytokinin biosynthetic enzyme, e.g. isopentyl transferase. Also included within the invention are progeny plants of any generation of such a fertile R0 transgenic plant as well as seed of a progeny plant.
Another aspect of the present invention relates to methods for obtaining a nucleic acid molecule comprising a nucleotide sequence of the present invention. One method for obtaining a nucleic acid molecule encoding all or a substantial portion of the amino acid sequence of a protein encoded on the same gene as the sequences described herein would be: (a) probing a cDNA or genomic library with a hybridization probe comprising a nucleotide sequence encoding all or a substantial portion of a DNA, cDNA, or RNA molecule described herein (b) identifying a DNA clone that hybridizes under stringent conditions to the hybridization probe; (c) isolating the DNA clone identified in step (b); and (d) sequencing the cDNA or genomic fragment that comprises the clone isolated in step (c).
The IPT gene (SEQ ID NO: 1 and 2) of 720 bp from Agrobacterium tumefaciens was amplified by PCR from plasmid pMON38210, using two primers that introduced a NcoI site at the 5′ end and an EcoRI site at the 3′ end of the amplified gene. The two primer sequences are CGCGGCCCATGGATCTGCGTCTAATTTTCGGTCCAAC (Seq ID NO: 3) and CGGCGCGAATTCTAATACATTCCGAATGGATGACCTT (Seq ID NO: 4).
The promoter of Arabidopsis CycB1 (Seq ID NO: 5) was cloned by using the upstream DNA polynucleotide sequence of CycB1 from the genomic clone with Genbank number AL035601. Two primers were designed to amplify from the total genomic DNA the 1550 bp fragment immediately upstream from the ATG start codon, introducing a PacI site at the 5′ end and a NcoI site at the 3′ end. The two primer sequences are CGCGGCTTAATTAAGAGCAATAACAGTGTGTGAGGCATT (SEQ ID NO: 6) and CGGCGCCCATGGTCTTAGTGTTCTCTTCTCTTTCTCTC (SEQ ID NO: 7). To clone the promoter of Arabidopsis CycD3 (SEQ ID NO: 8), the upstream sequence of 1500 bp was determined from the genomic contig AL161585 (Genbank), which was then cloned by PCR using two primers that introduced a Pad site at the 5′ end and a NcoI site at the 3′ end. The primer sequences are: CGCGGCTTAATTAAGCATTATGCGGGAGCAAAGGTAAGT (SEQ ID NO: 9) and CGGCGCCCATGGTGGGGGACTAAACTCAAGAATGAGAA (SEQ ID NO: 10). Similarly, to clone the promoter of CDC2a (SEQ ID NO: 11) from Arabidopsis, the corresponding 1400 bp upstream sequence was determined from AL132963 (Genbank number), and amplified from genomic DNA using two primers, introducing a AscI site at the 5′ end and a NcoI site at the 3′ end. The two primer sequences are: CGCGGCGGCGCGCCATATATATTATTATATAAATATAAC (SEQ ID NO: 12) and CGCGGCCCATGGTTTCCTGAATAATAAAGCTGAAG (SEQ ID NO: 13).
To construct the binary vector of IPT driven by the constitutive 35S promoter, the binary vector pMON23450 was linearized with NcoI and EcoRI, followed by ligation with the NcoI-EcoRI IPT fragment. The resulting vector was named pMON66507 (FIG. 8), in which the IPT gene is under the control of an enhanced 35S promoter (e35S). To put the IPT gene under the control of the CycB1 promoter, pMON66507 was digested with PacI and NcoI to release the e35S promoter, which was then replace by the PacI-NcoI P_CycB1 fragment. The resulting vector was named as pMON66508. Similarly, the PacI-NcoI P_CycD3 fragment was used to replace the e35S promoter in pMON66507 to generate the plasmid pMON66509, in which the IPT gene is under the control of the CycD3 promoter. To construct the IPT gene under the control of P_CDC2a, the amplified P_CDC2a fragment was digested with AscI and NcoI and ligated to pMON66507 that had the e35S promoter released by AscI and NcoI. The resulting plasmid was named as pMON66510.
The constructed binary expression vectors from Example 1 were used to transform Arabidopsis thaliana, ecotype Columbia using an Agrobacterium mediated procedure. Transformants were selected on kanamycin MS plates and thirty two independent transformation events were transferred to potted soil in growth chamber and grown to maturity for seed harvest. Expression of the IPT transgene was monitored at the transcript level using Taqman analysis.
Plant Growth
Seeds of the transgenic plants were sowed in potted soil along with wild-type plants (controls), and were vernalized at 4° C. for three days before moving to a growth chamber. The plants were grown under the following conditions: at 22° C., 24 hours constant light with light intensity of 170-200 μm Einstein m−2s−1, and a humidity of 70%. Plants were also grown under short day conditions, with 10 hours of light period. Plants were fertilized twice a week using Peters 20-20-20 fertilizer (in half strength) from Hummert International, Earth City, Mo.).
RT-PCR Analysis
Total RNA was prepared from roots, rosette leaves and flowers of Arabidopsis plants using Trizol reagent from Life Technologies (Gibco BRL, Life Technologies, Gaithersburg, Md. U.S.A.). The RNA was then treated with DNAse and column purified. All samples were adjusted to same concentration based on spectrophotometer readings. 2.4 μg of total RNA was used to synthesize the first strand cDNA in a 20 μl reaction with SuperScript II-RT Kit (Life Technologies, Gaithersburg, Md.) according to the manufacture\'s procedure. An aliquot of 1 μl of the synthesized cDNA was used as template for PCR reaction (a total volume of 50 μl), using gene-specific primers. The reactions were limited to 20 cycles so the amplifications were still in linear range. The amplified PCR products were resolved on agarose gels and photographed.
Real-Time PCR (Taqman) Analysis
Two hole punches, or a piece of the youngest leaf tip approximately 1-cm long, were sampled from each Arabidopsis thaliana plant. The sampled tissue was placed in 96 well format boxes (1.1 ml micro tubes, VWR, Cat# 20901-027) with 4 mm parylene-coated stir balls (V&P Scientific, Cat#725E-1) on dry ice. Equal volumes of nucleic acid purification lysis solution (ABI, Cat#. 4305895) and Phosphate Buffered Saline (Life Technologies, Cat # 12394-011) were added. 0.40 ml of the Lysis buffer/PBS mixture (1:1 of 2×ABI Nucleic acid purification lysis solution and LifeTech Ca—Mg free 1×PBS) was added to each well, then tightly cap the tubes. The tissue was homogenized by shaking the samples with a Qiagen MixerMill—MM300 (Qiagen, Cat# 85110) for 5 minutes at 30 rev/sec. Particulate matter was removed using a 96 well QiaFilter (Qiagen, Cat# 10020). Genomic DNA was prepared using the Automated Nucleic Acid Workstation from Applied Biosystems (ABI, Cat#6700). 25 μl PCR reactions were prepared using the ABI 2× SYBR-Green PCR Master Mix, (ABI, Cat# 4304437) and 10 μl of template DNA prepared on the ABI6700. Primers used were purchased from Life Technologies and were used at the same concentration in all experiments.
Real-time thermo cycling was performed on the ABI 7700 with standard cycling conditions of: 50° C. for 2 minutes, 95° C. for 10 minutes, and 40 cycles of 95° C. for 20 seconds, 60° C. for 1 minute. Standard data analysis procedures were followed for baseline adjustment then the data was screened for two-fold standard deviation of variance. Results of these analysis are discussed below. IPT was differentially expressed among different promoters in transgenic plants.
Gene Expression Results.
Four promoters were used to drive the expression of IPT in transgenic Arabidopsis plants, CycD3, CycB1, CDC2a, as well as the constitutive e35S promoter. The CycB1 promoter, P_CycB1, is expressed at the G2/M phase. The CycD3 promoter, P_CycD3, is expressed throughout the cell cycle in dividing cells. Both P_CycB1 and P_CycD3 are therefore cell cycle promoters. CDC2a, encoding a cyclin-dependent kinase, is constitutively expressed throughout the cell cycle, and is expressed in certain non-dividing cells. We conducted a semi-quantitative RT-PCR assay on the expression patterns of these genes in wild-type Arabidopsis plants. As is shown in FIG. 1, CycD3 and CycB1 were most abundantly expressed in flower and root tissues, but were expressed at much reduced level in expanding leaves, with CycB1 only showing trace amount of leaf expression. In contrast, CDC2a was expressed at about same but relatively low level in the different tissues. Because expanding leaves have been shown to only have trace cell division activity, these results confirm that CDC2a expression is not tightly correlated with cell division.
Transgenic Arabidopsis plants expressing IPT under the direction of the four different promoters were generated. Given the fact that all the promoters are capable of directing at least low levels of gene expression in leaves, we conducted transgene expression assays using the young leaf tissues from the transgenic plants. FIG. 2 shows the real-time quantitative RT-PCR, as well as the copy number determination (Taqman) of multiple independent transgenic plants expressing IPT from the four promoters. It is apparent that the strong promoter e35S led to high level IPT expression, while the promoters of CycD3, CycB1 and CDC2a resulted in significantly reduced expression. A comparison of the expression levels of the transgene driven by the promoters of CycB1, CycD3 and CDC2a showed that plants containing P_CycD3::IPT had the highest leaf expression level, whereas that of P_CycB1::IPT had the lowest. In the latter case, the one plant with a single copy of the transgene showing relatively high level of IPT expression is likely a result of transgene positional effect. Interestingly, although the CDC2a promoter is stronger than that of CycD3 in directing transcription in leaves (FIG. 1), the expression of IPT driven by CDC2a promoter was much lower than that driven by CycD3 promoter in the leaf tissues (FIGS. 2C and D); furthermore, while the IPT expression level of transgenic events driven by the promoter of CycD3 appeared to be positively correlated with the copy number of the transgene per genome, with more copies having higher level of transgene expression (FIG. 2C), all the transgenic plants expressing IPT driven by the CDC2a promoter contained only one copy of the transgene. This could at least partly suggest that high level of IPT expression by CDC2a promoter was deleterious, and only those with lower copy and thus lower expression had survived. Four independent transgenic events expressing IPT from the CDC2a promoter were advanced and their progeny analyzed for expression and transgene copy number. It was shown that 2 out of the 4 events resulted in progenies segregating 1:1 for 1 vs. 0 copy transgene, while the other two events had the majority of the progenies containing only one copy of the transgene, with a few plants missing the transgene (data not shown), which further suggest that, not only high level IPT by the CDC2a promoter was deleterious to the plant growth, but also the deleterious effect appeared to take place at gametophytic stage, resulting in the high occurrence of negative segregants.
Methods
Seed Size Analysis
To determine the seed size of different transgenic plants, about 50 transgenic seeds (V2 and V3) were dispersed evenly in an area of about 0.5 cm in diameter on a flat surface, along with wild-type controls. Magnified Images were then taken and the image size in pixels was determined using the Image-Plus™ software. Four samples for each seed set were used in the analysis, and statistical significance of the seed size variation was determined by T-test.
A high throughput screen was also developed internally to determine the Arabidopsis seed size. The software is a UNIX command line image processing program that automatically segments images containing touching seeds, screens out non-seed subjects, and then measures the areas of seeds on TIF images. Using this program, seeds from about 600 independent transgenic events involving 21 vectors were assayed for seed size compared to wild-type controls. The Arabidopsis with cyclin promoters operably linked to IPT showed increased seed size. Detailed analysis is discussed in the results section of this example.
Canopy Size/Vegetative Growth Rate Determination.
Transgenic plants, along with wild-type controls, were arranged in Latin Square, with 12 plants for each genotype, and grown under uniform conditions. At days 25, 32 and 42, images were taken for each plants, and the canopy size of the one-dimensional image was determined with the Image-Plus software. Statistical significance of size variation was determined using T-test. The growth rate for a given genotype was determined by comparing the percentage of canopy size variation of that genotype to wild-type among different growth stages. The Arabidopsis with cyclin promoters operably linked to IPT showed increased canopy size/growth rate. Detailed analysis is discussed in the results section of this example.
Analysis of Other Plant Seed Weight Components.
When siliques were starting to turn yellow, individual plants were placed within transparent plastic cones to prevent tangling and thus facilitate seed collection. At maturity, both siliques and seeds were harvested and naturally dried for quantitative analysis, including seed weight per plant, silique number per plant and silique length. For silique length, 50 siliques were randomly selected from each plant, and the means were used for comparison. The Arabidopsis with cyclin promoters operably linked to IPT showed increased seed weight. Detailed analysis is discussed in the results section of this example.
Results.
IPT Expression in Non-Dividing Cells LED to Abnormal Plant Growth and Development.
The deleterious effect of non-specific IPT expression was manifested throughout the plant life cycle. When the transgenic seeds were plated on selection medium, seeds transformed with E35S::IPT and P_CDC2a::IPT exhibited much lower shoot regeneration rates when compared to those transformed with P_CycD3::IPT and P_CycB1::IPT. As is shown in FIG. 3A, with similar effort for each transgene, while we were able to generate more than 250 independent transgenic shoots transformed with P_CycB1::IPT (bar 2) and P_CycD3::IPT (bar 3), only 4 events for E35S::IPT (bar 1) and 50 events for P_CDC2a::IPT (bar 4) were generated. Furthermore, as is shown in FIG. 3B, the regenerated transgenic shoots survived differently, with E35S::IPT shoots (bar 1) having only one survive to maturity, which turned out to be the event with the lowest IPT expression; for P_CDC2a::IPT plants, only 25% of the shoots were able to grow to maturity (bar 4). In contrast, over 95% of the transgenic shoots of P_CycB1::IPT (bar 2) and P_CycD3::IPT (bar 3) developed and grew to maturity. The pleiotropic effect of the transgenes E35S::IPT involved a number of abnormalities (FIG. 4, Panel A), including the lack of root development, severely retarded shoot growth, extensive leaf curling and reproductive arrest. Most of the plants died before the flowering stage. A similar, though less severe, phenomenon was also observed for the transgenic plants of P_CDC2a::IPT, with one third of the seedlings failed to set seeds as a result of retarded plant growth and development (FIG. 4, Panel B). Remarkably, the deleterious effect of P_CDC2a driven IPT expression became apparent at very early stages of plant development, as all the kanamycin resistant seedlings had very low level of IPT expression (FIG. 2). On the other hand, over 95% of the transgenic plants of P_CycB1::IPT (FIG. 3B, bar 2) and P_CycD3::IPT (bar 3) were developmentally normal throughout their life cycle (FIG. 6).
It has been shown previously that transgenic expression of IPT by various promoters resulted in deleterious pleiotropic effects on plant growth and development, the inventors reasoned that such pleiotrophs were likely due to the ectopic expression of IPT and consequently forced division in cells that were not committed to proper patterning after cell mass increase. Several lines of evidence from this study suggested that uncontrolled expression pattern, rather than the level of expression, was indeed a cause of the deleterious effect of the transgene on plant growth and development. First, a survey of the IPT transgene expression levels and the normality of plant growth and development when using the four different promoters showed that the transgenic plants were able to tolerate much higher level of IPT expression when the transgene was driven by the cell cycle-specific promoters P_CycD3 and P_CycB1 than that driven by non-specific promoters 35S and P_CDC2a (Table 1).
TABLE 1
Promoter-dependent leaf transgene RNA level and normal plant
development.
Event
Highest
Highest exp w/
Transgene
number
expression
normal develop
P_e35S::IPT
4
882.00
0.02
P_CDC2a::IPT
32
0.11
0.11
P_CycB1::IPT
32
0.48
0.48
P_CycD3::IPT
32
3.99
3.99
Thus while only at very low level of IPT expression that the transgenic plants harboring E35S::IPT could grow and develop normally, they would display normal plant growth and development even at 200 folds increase in IPT expression when driven by the CycD3 promoter, suggesting not only that plant development is very sensitive to uncontrolled pattern of IPT expression, but also that the cells that had been programmed for cell division are a primary natural target of cytokinin for growth regulation, and can tolerate high levels of transgene expression without disrupting the subsequent organ patterning and formation.
Taking together, these results demonstrated that cytokinin expression in non-dividing cells in plants as shown by the IPT expression by P_CDC2a, had a pleiotropic effect, leading to abnormal plant growth and development. In contrast, cell cycle-specific IPT expression, directed by the promoters P_CycB1 and P_CycD3, were able to effectively eliminate the deleterious effects associated with uncontrolled IPT expression, and even at relatively high transgene expression level, the transgenic plants were able to grow and develop much like the wild-type plants.
Cyclin-Dependent IPT Expression led to Accelerated Plant Growth Rate
The inventors further examined the effect of IPT expression from the different promoters used in this study on plant growth rate. The inventors wanted to determine whether amplified cytokinin expression in the natural cyclin-expressing cells would also lead to accelerated plant growth rate. To this end, the inventors conducted an experiment to quantify the morphological variations of transgenic plants compared to wild-type controls in the course of plant life cycle. FIG. 5 shows the accelerated plant growth rate of a typical transgenic plant of P_CycD3::IPT compared to a typical wild-type control plant. For example, at the age of 32 days, the transgenic plants of P_CycD3::IPT exhibited a critically significant (P<0.01) canopy size increase by 35% over that of the wild-type control (FIG. 5). Size comparison of leaves of the same position showed that the transgenic leaves were much larger than the wild-type control (FIG. 5A, lower panel). Noticeably, the degrees of canopy size increase varied along the growth stages, with the largest increase after about one month plant growth, and the increase declining at flowering. Thus the canopy size increase over wild-type control was 28%, 32% and 18% when measured at days 25, 32 and 42 after sowing, respectively (FIG. 5B
It was previously shown that, although the constitutive CycD2 expression could accelerate the growth rate of transgenic tobacco plants, the transgenic plants flowered earlier than the non-transformed plants, resulting in plants that are similar in size and overall productivity as compared to the wild-type controls at maturity. The inventors examined the organ size, organ number and overall plant productivity of transgenic Arabidopsis plants expressing IPT from the cell cycle-specific promoters. In contrast to over-expression of CycD2 by the 35S promoter, cell cycle-specific IPT expression, while accelerating the plant growth rate, did not alter the timing of developmental stages, with the transgenic plants flowering at the same time as the wild-type controls (FIG. 5A). Furthermore, by comparing to the wild-type control, It is clear that the transgenic plants, while developing normally, showed an overall enhanced productivity, including increased leaf size/vegetative mass (FIGS. 5A and B), increased plant height, increased branch number, increased flower and silique number (FIG. 6).
The inventors further examine all the transgenic events for the size of seeds, an organ in which CycD3, CycB1 and CDC2a in their native forms all express in wild-type Arabidopsis plants, and the size of which is mainly determined by cell cycle and the resulting cell number. The inventors developed an automated seed size (seed image area in pixels) screen and assayed the seed size of all the 70 independent transgenic lines that had been advanced, including 29 transgenic events of P_CycB1::IPT, 30 of P_CycD3::IPT, 10 of P_CDC2a::IPT, and 1 of E35S::IPT. A power calculation has determined that, at high detection power of 95%, our standard operation protocol would be capable of detecting 9% seed size difference at critically significant level (P<0.01). Using 10% as the cut-off value, the inventors showed (FIG. 7) that 72% of the P_CycB1::IPT events and 63% of the P_CycD3::IPT events exhibited significant seed size increase, ranging from 10% to 70% size increase over wild-type controls. In contrast, none of the P_CDC2a::IPT nor E35S::IPT events exhibited significant seed size increase. These results demonstrate that the amplified expression of cytokinin in dividing cells not only eliminated the deleterious pleiotrophs associated with ectopic cytokinin expression, but also accelerated target organ growth and size with high phenotypic penetrance. The improvement of multiple attributes of the transgenic plants expressing IPT from the cell cycle-specific promoters, including increased silique/seed number and increased seed size, has led to the increased seed production of the transgenic plants.
A GATEWAY™ Destination (Invitrogen Life Technologies, Carlsbad, Calif.) plant expression vector, pMON65154, was constructed for use in preparation of constructs comprising recombinant polynucleotides for corn transformation. The elements of the expression vector are summarized in Table 2 below. Generally, pMON65154 comprises a selectable marker expression cassette comprising a Cauliflower Mosaic Virus 35S promoter operably linked to a gene encoding neomycin phosphotransferase II (nptII). The 3′ region of the selectable marker expression cassette comprises the 3′ region of the Agrobacterium tumefaciense nopaline synthase gene (nos) followed 3′ by the 3′ region of the potato proteinase inhibitor II (pinII) gene. The plasmid pMON 65154 further comprises a plant expression cassette into which a gene of interest may be inserted using GATEWAY™ cloning methods. The GATEWAY™ cloning cassette is flanked 5′ by a rice actin 1 promoter, exon and intron and flanked 3′ by the 3′ region of the potato pinII gene. Using GATEWAY™ methods, the cloning cassette may be replaced with a gene of interest. The vector pMON65154, and derivatives thereof comprising a gene of interest, are particularly useful in methods of plant transformation via direct DNA delivery, such as microprojectile bombardment.
TABLE 2
Elements of Plasmid pMON65154
FUNCTION
ELEMENT
REFERENCE
Plant gene of interest
Rice actin 1 promoter, for example
U.S. Pat. No. 5,641,876
expression cassette or other
Rice actin 1 exon 1, intron 1
U.S. Pat. No. 5,641,876
plant promoter
enhancer, for example
Gene of interest insertion
Download full PDF for full patent description/claims.You can also Monitor Keywords and Search for tracking patents relating to this Transgenic plants expressing cytokinin biosynthetic genes and methods of use therefor patent application.Patent Applications in related categories:
20130117892 -. ...
###
Other recent patent applications listed under the agent Snr Denton US LLP:
|
http://www.freshpatents.com/-dt20110120ptan20110016588.php
| 2013-05-18T10:21:50 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
ebd5
xvidcap is a screen capture enabling you to capture videos off your
X-Window desktop for illustration or documentation purposes.
It is intended to be a standards-based alternative to tools like Lotus
ScreenCam.
WWW:
NOTE: FreshPorts displays only required dependencies information. Optional dependencies are not covered.
To install the port: cd /usr/ports/sysutils/xvidcap/ && make install cleanTo add the package: pkg_add -r xvidcap
cd /usr/ports/sysutils/xvidcap/ && make install clean
pkg_add -r xvidcap
No options to configure
Number of commits found: 41
- Convert USE_GETTEXT to USES (part 3)
Approved by: portmgr (bapt)
-
6 vulnerabilities affecting 28 ports have been reported in the past 14 days
* - modified, not new
All vulnerabilities
|
http://www.freshports.org/sysutils/xvidcap/
| 2013-05-18T11:02:40 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
FRESHZEST Pty Ltd - PRIVACY POLICY
Introduction.
This policy applies only to the website (“Freshzest Pty Ltd Website”) operated by Freshzest Pty Ltd ABN 42 004 779 828 (hereinafter called “Freshzest”).
Freshzest respects the rights of individuals to privacy in relation to their personal information and is bound to the National Privacy Principles contained in the Privacy Act 1988 in dealing with personal information.
Freshzest will make this policy available on its website at.
The use of the term "Personal Information" in this privacy statement means any information from which your identity is apparent or can be reasonably ascertained.
Information we collect.
You can generally visit the site without revealing Personal Information, unless you choose to provide such information. The information received depends upon what you do when visiting the site.
The type and amount of information we collect depends upon the circumstances of collection and the type of products or services you request and use. It may include:
- your name, street or postal address, position, telephone number, facsimile number and email or other electronic communication address;
- your date of birth;
- your account name and your account number for banks or financial institutions from which we receive payments or into which we make payments to you (as applicable);
- information we obtain as a result of credit checks which you authorise us to carry out;
- records of communications between us; and
- information relating to invoices and billing statements.
How we collect your personal information
For entities including but not limited to corporations, we collect some personal information from the entity’s employees, principals or directors. Freshzest will usually collect your personal information directly from you. Personal information that we collect may also be provided by you when you register your details on the Freshzest Website or send us an enquiry, feedback or comment through the Freshzest Website.
|
http://www.freshzest.com.au/legal/
| 2013-05-18T10:52:56 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
(05-08-2012 01:15 AM)Xanthos Wrote: If all else fails ------\/
Spoiler below!
Find your way back to Agrippa after escaping the cell.
There should be slime covering 70% of the rooms.
Once back to Agrippa you will notice a hole in the wall to the left of him.
On entering there's a little drainage to the left.
Combine string and the jar.
Dip the combined item into the drainage of blood to obtain your goal.
|
http://www.frictionalgames.com/forum/thread-15291-post-136778.html
| 2013-05-18T10:42:22 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Join Friends Reunited
Log in to keep, share and add your own memories.Sign me in now
Not Registered?
Sign up now to make the most of your memories – it's quick, completely free!Register now
Why join the new Friends Reunited?
Collect & Keep the memories you love
If you stumble across a blast from the past, press "Keep" and the memory will be stored in your keepsafe, safely and securely.
Store your personal memories
Upload your own memories and store them safely in your Keepsafe. Everything you add is private until you choose to share it.
Share with the people that were there too
Whether private (like your wedding), or public (like Live Aid), start your own memory collection and "Remember when?" with friends.
Make something with your memories
Create personalised gifts and prints with the memories you cherish most. From canvases to calendars, make your memories last.
...and it's still completely FREE
Friends Reunited is still 100% free! We hope you enjoy looking back.
|
http://www.friendsreunited.co.uk/JoinUs?returnUrl=%2Fmusic-bob-dylan-wembley-stadium%2FMemory%2Fc1ba3155-b3c2-4439-82a2-a00a0010ab5f
| 2013-05-18T10:31:56 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://www.frstatic.net/Images/help/helpJoinUs1.gif",
"Keep"
],
[
"http://www.frstatic.net/Images/help/helpJoinUs2.gif",
"Keep"
],
[
"http://www.frstatic.net/Images/help/helpJoinUs3.gif",
"Upload"
],
[
"http://www.frstatic.net/Images/help/helpJoinUs4.gif",
"Keep"
],
[
"http://www.frstatic.net/Images/help/helpJoinUs5.gif",
"Keep"
]
] |
Yay! Yay! YAY!!! It's CopyCat Friiiiday!!
The day of the month where we all copy a look we've seen on someone else!
This month I am copying the adorable Kourtney Kardashian.
This is not my first time copying a Kardashian, and last time I copied one it was Kim and I wore this same camel colored blazer!
What can I say? We're all Armenian and they have great style!
I don't know why I keep choosing looks with hair up. I seriously NEVER wear my hair up and so I'm confused as to why I decided to do it again. Oh wells.
The good news is that when we were walking over to take these pictures Ian said, "You look like Kim Kardashian from behind. That seems like something she would wear."
Although I'm copying her sister Kourtney this time, I took that as a compliment because that is exactly what I was going for... obviously!
So there you have it!
I must say, I was worried I would go into labor and not be able to host the link-up this week, but alas, Greyer is still super comfs inside me and it could still be a while...
If you are linking up this week, please include this button somewhere on your post and link up below:
<div align="center"><a href="" title="FrillsforThrills CopyCats"><img src="" alt="FrillsforThrills CopyCats" style="border:none;" /></a></div>
|
http://www.frillsforthrills.com/2012_09_01_archive.html
| 2013-05-18T10:31:02 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://i55.photobucket.com/albums/g146/sarah_christine122/Picture6-1-2.png",
"FrillsforThrills CopyCats FrillsforThrills CopyCats"
]
] |
Fringe co-creator JJ. Abrams has lauded the script for the series finale as “incredible”.
{ 36 comments }
Fringe co-creator JJ. Abrams has lauded the script for the series finale as “incredible”.
{ 36 comments }
Fox has issued the full set of promotional photos for the Friday, Jan 11 installment of Fringe, “The Boy Must Live”.
{ 47 comments }
Fox has released the official press release for the two-hour Fringe series finale — episodes 99 and 100, “Liberty”/”An Enemy Of Fate”.
{ 66 comments }
Welcome to Fringie of the Week — your chance to vote for your favorite character performance from 5.10 “Anomaly XB-6783746″.
{ 36 comments }
Blair Brown and John Noble discuss recent developments on Fringe in a newly-released featurette.
{ 5 comments }
While teasing his villainous new role on Arrow recently, Seth Gabel tipped his hat to the ‘inspirational’ Fringe fans.
{ 29 comments }
The cast discuss recent events in a slew of new video interviews released by Fox.
{ 5 comments }
We’d like to take a quick moment to wish the entire Fringe Bloggers community a merry Fringemas and happy new year!
{ 20 comments }
Fox has released the Noble Intentions for Fringe 5.10.
{ 3 comments }
The Fringe Timeline has been updated to Season 5, Episode 7, “Five Twenty Ten”.
|
http://www.fringebloggers.com/page/10/
| 2013-05-18T10:12:19 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Frisco Fire Safety Town is a place where children learn real life strategies for dealing with emergencies while developing a positive attitude towards safety. Frisco Fire Safety Town combines traditional classroom education methods with unique interactive experiences in a realistic child-sized townscape. Children participate in activities designed to build self-confidence and to strengthen their ability to make safe decisions. Students then have the opportunity to practice a variety of their newly learned safety skills in a safe environment, complete with 5/8th scale replicas of local buildings, roads with realistic pavement markings, traffic signals and street signs.
Interactive areas include an actual living room and kitchen, which illustrate various fire safety hazards such as a lighter and matches, candles, frayed electrical cords and an overloaded electrical outlet. A child sized bedroom is equipped with a nontoxic “smoke machine” that demonstrates to students how smoke fills a room during a fire. Children then have the opportunity to practice escaping safely from a bedroom through either their primary or backup escape route.
Pedestrian, bicycle and motor vehicle safety are taught in an outdoor environment while children operate battery powered vehicles and ride bicycles on realistic streets. Children have the unique opportunity to practice safety skills from both youth and an adult perspective, while remaining in the safe environment of Frisco Fire Safety Town and under the watchful eye of trained educators.
Our mission is to eliminate preventable accidents and injuries. With the generous support of local developers and businesses, we can achieve this goal with Frisco Fire Safety Town. We appreciate your interest in the project and would like to invite your organization to become involved today. Please look at our Sponsorship Benefits Package for more details regarding benefits afforded to sponsors. As well, all bicycles and motorized cars are available for sponsorship. Please look at our Bicycle and Jeep Sponsorship Package for more details.
Thank you.
|
http://www.friscotexas.gov/safetytown/Pages/SponsorsOverview.aspx
| 2013-05-18T11:02:15 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
I'm today's featured writer on TheSmartlySocal
I'd love it if you popped over , checked out the essay and left me a comment on today's essay:
Trainspotting : one woman's journey on public transportation
Tell me what you think about public transportation in this time of ridiculously high gas prices!!!
Great article Amber! As a suburbanite, I always thought "taking the train" sounded so chic, so Sex in the City. I think I'm hearing, not so much? :)
Mindy
|
http://www.fromcarpoolstococktails.com/2011/03/featured-today-trainspotting.html
| 2013-05-18T10:12:40 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Tweet
Oakland-Alameda County Coliseum, formerly known as McAfee Coliseum/Network Associates Coliseum, has been home to the Oakland Athletics since 1968. It is also home to the Oakland Raiders of the NFL. It was constructed at an estimated cost of 25.5 Million dollars and has a capacity of 35,067 for baseball games; the smallest MLB Ballpark. An additional 200 Million dollars was used for renovations to the stadium in 1996. 7000 Coliseum Way Oakland, California 94621
.
All Contents Copyright © - FromThisSeat.com. 2010-2013 - All Rights Reserved | Site By Peach Technology
|
http://www.fromthisseat.com/index.php/mlb/oakland-athletics
| 2013-05-18T10:12:31 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
- Customer Service
- Contacting Frontgate
- Store Locations
- Trade Sales
- Gift Services
- Privacy & Security
- Shipping & Processing
- Returns & Exchanges
- Order Tracking
- Price Guarantee
- How to Order
- INTERNATIONAL CUSTOMER SERVICE
Shipping & Processing.
Oversized Delivery
Some of our larger items are delivered via Oversized Delivery. Some additional shipping charges may apply based on the weight of the item; if applicable, they are shown in parentheses to the right of the Quantity field on the product page. (These charges are applied in addition to Standard Shipping and Processing charges for each oversized item.) Additional charges may accrue for orders over 15 lbs. If any additional fees are incurred, a Customer Service representative will contact you before any charges are applied to your credit card.
Through-the-door Truck Delivery
Delivery is typically 2.
|
http://www.frontgate.com/shipping/content
| 2013-05-18T10:52:26 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
FS NEPA Information
Contact Information
Colville National Forest
315 North WarrenNewport, WA 99156
(509) 447-7300
Go to main Colville National Forest web site
You are here: NEPA Home / Colville National Forest NEPA Projects / Power Lake Vegetation Management Projects EA
Vegetation management projects to address forest health, wildlife habitat, fuels, fish habitat and water quality.
Expected Analysis TypeEnvironmental Assessment
Special AuthorityNot applicable / Other
Lead Management UnitNewport Ranger District
Notice and Comment Regulation215
Project PurposeWildlife, Fish, Rare plants; Forest products; Fuels management; Watershed management
Project ActivityRoad decommissioning; Forest vegetation improvements; Species habitat improvements; Road maintenance; Road improvements/construction; Timber sales (green); Watershed improvements
Current StatusAnalysis Completed
Project Milestones
All planning milestones have been completed.
Decision Signed Date2012-08-30
Last Updated: 9/05
|
http://www.fs.fed.us/nepa/nepa_project_exp.php?project=32748&exp=detail
| 2013-05-18T10:34:07 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Matthew Dare, Postdoctoral Ecologist, Boise Lab
Kate Dwire, Research Riparian Ecologist, Fort Collins Lab
Kelly Elder, Team Leader; Research Hydrologist, Fort Collins Lab
Bill Elliot, Team Leader; Research Civil Engineer, Moscow Lab
Randy Foltz, Research Engineer, Moscow Lab
Jaime Goode, Postdoctoral Geomorphologist, Boise
Kerry Overton, Fisheries Technology Transfer Specialist, Boise Lab
Chuck Rhoades, Research Biogeochemist, Fort Collins Lab
Bruce Rieman, Emeritus Fisheries Scientist, Boise Lab
John Rinne, Emeritus Fisheries Scientist, Flagstaff Lab
Peter Robichaud, Research Engineer, Moscow Lab
Sandra Ryan-Burkett, Research Hydrologist/Geomorphologist, Fort Collins Lab
Russ Thurow, Team Leader; Research Fisheries Scientist, Boise Lab
Joe Wagenbrenner, Engineer, Moscow Lab
Natalie Wagenbrenner, Engineer, Moscow Lab
Michael Young, Team Leader; Research Fisheries Biologist, Missoula Lab
Entire AWAE Staff Directory | AWAE "Go To" Scientists document
AWAE Technology Transfer focuses on improving the communication between researchers and practitioners/managers to meet two primary objectives:
Provide timely awareness and delivery of relevant knowledge, technical tools and procedures to assist land managers and practitioners address current and emerging fisheries/aquatic issues.
Ensure researchers and practitioners/managers were working together to define knowledge gaps and needed research, tools and procedures.
Air
Quality in Mountain Ecosystems - Ozone
Assessing Environmental Impacts of Dam Operation
Bayesian Belief Network Decision Support Tool
Bull Trout and Climate Change
Bull Trout Monitoring
Clean Water - Insect Outbreaks and Watersheds
Climate Change & Wildfires: Effects on Stream Temperatures
Climate Change, Water, and Aquatic Ecosystems
Detecting Mobile Boreal Toads
Fire, Fuel Management, and Aquatic Ecosystems
Fisheries and Aquatic Sciences Technology Transfer Program
GRAIP:
Quantifying and Prioritizing Road Impacts
Hyporheic Exchange in Gravel Bed Rivers with
Pool-Riffle Morphology
In-Stream Wood Studies: Call for Common Metrics
Invasive Species Managing for Native Trout
Nonnative Fish Removal
Remotely Assessing and Monitoring Channel Physical
Habitat
Sediment Impacts from Debris Flows
Spatial and Temporal Variation in Chinook Redd Distributions
Stream Temperature Modeling
Water Resources Availability Trends & History
Western US Stream Flow Metric Dataset?
Briefing Paper | GRAIP Website.
, supporting the RMRS Rocky Mountain Center development and deployment of real-time computer applications for fire-weather intelligence and smoke dispersion forecasts over the Western USA. Developed by the Natural Resource Assessment, Ecology, and Management Science Research group at the Rocky Mountain Research Station.
, a software application for analyzing rating judgments, useful to practitioners needing to summarize or analyze rating data, and to researchers interested in comparing and evaluating alternative scaling methods. Available from the Identification and Valuation Of Wildland Resource Benefits group at the Rocky Mountain Research Station..
, a geographical information system (GIS) model that estimates the ability of an area to meet the food and cover requirements of an animal species, from the Center for Great Plains Ecosystem Research group at the Rapid City
NEW: NorWeST Stream Temperature- Regional Database and Model
Upper Verde River: Review of Stream-Riparian Monitoring Efforts Conducted by the U.S. Forest Service Rocky Mountain Research Station
Stream
Temperature Modeling and Monitoring Website
River Bathymetry Toolkit (RBT)
Technology Transfer Program
Western Watersheds and Climate Change Workshop - November 17-19, 2009
Rocky Mountain Research Station
- Air, Water and Aquatic Environments Sciences Program
Last Modified:
Tuesday, 14 May 2013 at 13:28:40 EDT
13 May, 2013
|
http://www.fs.fed.us/rm/boise/awae_home.shtml/AWAE/labs/publications/research/research/scientists/profiles/research/techtrans/AWAE/projects/AWAE/projects/research-subjects/firefuels.SHTML
| 2013-05-18T10:42:40 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Rocky Mountain Research Station Publications
RMRS Online Publication - Journal
Articles, External Publications, and Special Reports
Bull trout recovery: Monitoring and evaluation guidance
U.S. Fish and Wildlife Service (USFWS). 2008. Bull trout recovery: Monitoring and evaluation guidance. Report prepared for the U.S. Fish and Wildlife Service by the Bull Trout Recovery and Monitoring Technical Group (RMEG). Portland, OR. Version 1. 74: Bull trout recovery: Monitoring and evaluation guidance
Electronic Publish Date: September 25, 2008
Last Update: September 25, 2008
RMRS Publications | Order a publication | Contact Us
|
http://www.fs.fed.us/rm/pubs_other/rmrs_2008_USFWS_001.html
| 2013-05-18T10:13:25 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Archives
Random Quotes
Latest Comments
Top 100
Submit Quote
Search
Forums: 106
WTF?!
||
meh
Username:
Comment:
Check here
1
2
3
#1184724
Why is it that the part of this that bothers me the most is "She loses his stripes"?
As Bobby rightly pointed out, Fail.
7/24/2010 4:10:39 PM
#1184729
vaguelyhumanoid
What the hell do mythological creatures have to do with evolution?
7/24/2010 4:26:02 PM
#1184732
I read about the afterlife
"Lions are felines, true."
Yes, good. And dogs are Canine!
"Lions and cats evolved from reptiles or others, false."
The "or others" part is actually true.
"Let's take an example:
You care of a tiger in your house. and with time, she loses his stripes"
okay one: is this hypothetical tiger transgendered? Secondly, why would he/she lose his/her stripes?
"She will look all orange and white. but she is still a tiger."
Yeah, okay. I guess.
"She will give birth to tiger cubs and they will grow to be tigers."
No shit sherlock.
"If they continue like that, after a hundred years, they will always be tigers..."
Yep. Pretty much. Of course, they might be longer or shorter and have slight changes due to survival of the fittest.
"You can call them cats or big cats. But they won't grow horns or wings."
Again, no shit sherlock.
"mythological creates play a lot with evolutionists minds. The likes of Minotaur and pegasus are behind all this evolution hoax."
All I've learned from your rambling is that you're a lunatic that knows jack shit about evolution.
7/24/2010 4:43:56 PM
#1184739
TGRwulf
Evolution. You keep using that word, but I don't think you know what it means.
7/24/2010 5:08:20 PM
#1184753
Scorpius
WTF? Since when..the...*fizzle*
7/24/2010 5:42:15 PM
#1184757
Berny
You really don't have a fucking clue what evolution really is all about, do you?
Let me give you a hint, the ones who keep resorting to magic are the creationists.
Call it a hoax if you want to but so far all the evidence is in favor of it, not your stupid myth.
7/24/2010 5:55:34 PM
#1184758
Nowonmai
Clearly you have not a fucking clue how evolution works. Moving a tiger into your house will not make her 'lose her stripes'.
And hundreds of years? Oy.. your dumb is making my brain hurt.
Mythological creatures that were written about thousands of years ago, before evolution was even considered??? Please, don't breed.
7/24/2010 5:56:04 PM
#1184771
Zits
How does this person turn on his/her computer, get on the Internet, point a browser to a website, and type text? How? Windows is easy to use, but can it be THAT easy? This is some industrial strength stupid guys!
7/24/2010 6:15:57 PM
#1184776
Vince
You just listed every last evolutionary bullshit myth that just prove you fuckwits don't have the slightest clue how evolution works.
7/24/2010 6:21:22 PM
#1184779
Lucilius
Creotards are hominoids, true.
Creotards evolved into hominids, false.
There is something called adapting to one's environment. Creotards have abjectly failed to do this. Their hair dye and polyester levels may change with their denomination, but the stupidity will remain the same.
Let's take an example:
You take care of FullWhiteMoon in your house, and over time she/he learns to sit upright and not to fling feces. But FWM is still a moron and will keep mouthing idiocies. If FWM lives for a hundred years she/he will still be a stranger to reason. You can call him/her human, but FWM still won't know an ass from an elbow.
Mythology plays a lot with creotard minds. Stories of talking snakes and flying telepathic zombies are behind all this creationism hoax.
7/24/2010 6:27:21 PM
#1184830
Thinking Allowed
Ever try to breed a lion to a bobcat?
7/24/2010 7:23:51 PM
#1184950
Justanotheratheist
"Lions are felines, true." Very nice of you to admit to this tricky, little known fact.
" color/nature/habits may change....but the animal will remain the same." Um, no. It can't change and still stay the same. Only god could do that, if he existed.
Take a tiger into your house and you will lose your head (literally - they are hungry carnivores, y'know) long before she loses her stripes - which will never happen.
Very astute of you, though, to understand that a mummy tiger gives birth to baby tigers and not to baby elephants or baby penguins. You should get a job teaching biology and zoology in Texas. It would be a step up for their education system, by the sounds of it.
PS Mythical creatures never evolved coz they never axisted. That's why they are mythical. Think of god, for example, and you will understand what I mean.
7/24/2010 11:01:55 PM
#1184952
bennyboy
What in the name of FUCK are you chatting about, you single-helixed twatting spasticunt?
7/24/2010 11:03:54 PM
#1184954
Rat of Steel
(Thinking Allowed)
"Ever try to breed a lion to a bobcat?"
(Rat gasps as he has a "eureka!" moment.)
So
THAT'S
where lolcats came from!
7/24/2010 11:06:52 PM
#1184957
You realise that it's
your
staggering lack of comprehension that equates evolution with bull-headed men and not the reality of modern evolution theory?
What I'm saying is: educate yourself properly, muppet.
7/24/2010 11:19:14 PM
#1185097
moose
AHHHH YESSSSSSSSSSSSSs.....the old fundie creation science argument about "adaptation" instead of evolution.
To wit: "there is something called to adapt with the evironment. color/nature/habits may change with the climate and other reasons. but the animal will remain the same.
Oh REALLY????? Let's see how well that works. If you make a poodle a guard dog, will it turn into a german shepard? How about racing a chihuahua, will it "adapt" into a greyhound? If you put a pigeon into the water, will it "adapt" into a duck?
And... in case you didnt realize it ....evolutionists realize that "the like of Minotaur and gegasus" or mythologies. Evidently you think that believers in evolution think they are real. Shows how much you really truly understand about evolution. Notta.....
7/25/2010 8:18:07 AM
#1185100
Tyler
.......No
7/25/2010 8:25:39 AM
#1185115
happysmiles
Oh crap, he's onto me. I indeed only agree with the theory of evolution because of coercion by a minotaur. If it weren't for the minotaur I would actually believe in god and creationism. But every time I start to believe in god the minotaur comes along and jabs me in the back with its horns, threatening to run me through with them. Damn you mINOTAUr, dAMN YOU!!!!!!!!!!!!!!
7/25/2010 9:14:13 AM
#1185130
Swede
Nope, Minotaurs and Pegasuses are completely against the theory of evolution, they are part of a religion mythology.
Lions and cats evolved from lion/cat-looking animals, who evolved from somewhat less lion/cat-looking animals, who evolved from even less lion/cat-looking animals, and so on. I highly doubt they evolved from reptiles.
7/25/2010 9:35:37 AM
#1185152
Yama the Space Fish
100 years isn't a long time at all. Therapsids were around 250,000,000 years ago.
7/25/2010 10:20:58 AM
#1185164
dionysus
you take care of a tiger in your house. and with time, she loses his stripes. she will look all orange and white.
What the hell is this shit? No, that can't happen and ToE doesn't support this.
mythological creatures play a lot with evolutionists minds. the likes of Minotaur and pegasus are behind all this evolution hoax
ToE doesn't support their existence either. Basically, you're railing against something you have absolutely no understanding of. Your post is in good company here.
7/25/2010 10:43:18 AM
#1185198
Old Viking
you take care of a tiger in your house.
You first.
7/25/2010 12:56:03 PM
#1185230
Kefka
This was written by a muslim fundy who seems, from his drawings, to believe that most muslim women are white.
7/25/2010 3:01:03 PM
#1185279
The Jamo
So you're saying that even though the animal will change it will remain the same? What the fuck are you on about?
If a tiger was to 'lose' its stripes, that would mean that a genetic change/mutation had occurred and the animal has changed. Even though that particular mutation may not inhibit cross-breeding, it's still a mutation. That's called evolution, dumbass.
7/25/2010 7:09:16 PM
#1185284
TheJebusFire
7/25/2010 7:26:15 PM
1
2
3
|
http://www.fstdt.com/QuoteComment.aspx?QID=74623&Page=2
| 2013-05-18T10:12:07 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Tammy and her husband David live in Kansas City. In October 2008, Tammy went to give blood, something she had done almost every year since she turned 21. After having her hemoglobin checked, Tammy was told she was a little anemic. It was recommended that she get some more tests from her doctor, which she did. A complete blood analysis was done; all her counts were low. Following a bone marrow biopsy in November, she was diagnosed with mylodysplastic syndrome, the precursor to leukemia.
Over the next few months, her condition deteriorated rapidly. Though she had no clue she was sick when she first got the test results, she quickly started to develop symptoms. The doctors did what they could to keep it from progressing, but it was obvious that she would need a bone marrow transplant in order to survive. David's latest email summarized the ordeal: "That was the beginning of a long, arduous process requiring this family to fully rely on the Lord for the healing Tammy would need."
Friends were kept informed of Tammy's progress through periodic blogs from her husband, and we all celebrated when we heard that an anonymous donor had given Tammy the blood she needed.
A year ago David had posted, "We were talking earlier tonight that her donor is now 39 years old. Somewhere, he is probably thinking about the sacrifice he made, and we hope he is proud of his service. We still hope to meet him someday to say thank you in person."
That wish came true last week when Tammy received a phone call from a man named Jim who, as it turned out, was her match. In David's own words: "We have shed a lot of tears of joy today, as Tammy finally got to say thanks to the man who saved her life. He didn't want any credit for that. He just wanted to know how she was doing. He readily acknowledges God's role in this story. He and Tammy talked about God's will during their discussion, and Jim recognizes that God led him to drive past that fire station that day.
"It turns out that Jim is from Waverly, a small town in upstate New York, about 100 miles south of Syracuse. The fire station in his community was having a bone marrow drive one day in early spring 2009, and he felt the nudge of God to go in and sign up. When he got the call that he might be a match for a 49-year-old woman in Kansas, he agreed to be a donor. Tammy is alive today because of his willingness to obey that nudge."
David's email continued: "We had a bone marrow drive at our church in Kansas City, but around the same time, the fire station in Waverly was having its own drive. It may have been in honor of someone in that area, but God had other plans. Just like He had a friend of ours donate her bone-marrow to someone about a year and a half ago as a result of our drive, He had Jim respond to the sign at the firehouse to save Tammy's life.
"Today, Tammy is the picture of health. She amazes people with how good she looks (like she's been amazing me with her beauty for more than 45 years). No one who doesn't know her story can believe that she survived cancer so recently.
"Thanks, in large part, to our new friend Jim, who was willing to respond to the divine nudge of the mighty God we serve."
Reading Tammy's story reminds me to become keenly aware of those "divine nudges," no matter how inconvenienced I might be. I hope it does the same for you.)
|
http://www.fstribune.com/story/1824004.html
| 2013-05-18T10:53:15 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
He was born Aug. 29, 1947, in West Plains, Mo., the son of Delbert Johnson Sr. and Letha Faye Rose Johnson.
He worked as a truck driver for Midwestern Distribution in Fort Scott for many years. He later drove for Palmetier Trucking Company, Kansas City, Mo. He married Billie Gayle Martin on Feb. 27, 1970, in Nevada, Mo.
He enjoyed fishing, shooting guns, motorcycling and working on stock cars.
His greatest joy was spending time with the grandkids watching movies, especially westerns.
Survivors include his wife Billie Gayle Johnson, Fort Scott; one daughter, Lisa Colley and husband Earl, Garland, Kan.; three brothers, Mike Johnson, Timothy Johnson and Thomas Johnson, all of the West Plains, Mo., area; two grandchildren, Zachary and Kaitlyn Lyman; and one great-grandchild on the way. Also surviving are nieces and nephews.
He was preceded in death by one brother, David Johnson; and one sister, Janice Storms; as well as his parents.
Rev. Chuck Russell will conduct graveside services at 11 a.m. Friday, April 20, in Evergreen Cemetery.
The family will receive friends from 10 a.m. until 10:45 a.m. at the Cheney Witt Chapel, 201 S. Main, Fort Scott, Kan.
Words of remembrance may be submitted to the online guestbook at cheneywitt.com.
|
http://www.fstribune.com/story/1838872.html
| 2013-05-18T10:21:18 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
- •Advertise with the FT
© The Financial Times Ltd 2013 FT and 'Financial Times' are trademarks of The Financial Times Ltd.
The Starboard Seak, by Amber Dermont, Corsair, RRP£14.99/ St Martin’s Press, RRP$24.99, 320 pages
Amber Dermont’s debut novel is set in the summer of 1987, and we first meet Jason Prosper on his 18th birthday. He is, according to his father, “damaged goods” and the story opens with father and son driving together; Jason daydreaming about “the car flipping forward and crushing Dad’s body.” They are en route to Bellingham Academy, a boarding school specialising in second chances for the delinquent offspring of America’s elite. At Bellingham, Jason explains, “If you could pay, you could stay.”
Jason can’t forget his best friend, sailing partner and secret lover, Cal. It was Jason who discovered Cal’s body in the bathroom at their prep school, but the truth about the events that led to Cal’s death and Jason’s subsequent expulsion are withheld until the end of the novel.
Jason tries to fit in at his new school by joining the sailing club, only to quit after the first tryout ends with his sailing partner momentarily trapped under the water. He retreats, and befriends a girl called Aidan. The pair become lovers. When she disappears, Jason takes it upon himself to work out what has happened to her. Learning of Aidan’s fate, he feels “the waves of this new truth, this new loss crash over me”.
The sea is a constant presence, both physically and in the language used: Dermont’s passion is sailing, and the novel’s title, The Starboard Sea, is a made-up sailing reference. As Cal explains to Jason: “It means the right sea, the true sea, or like finding the best path in life.”
Dermont sketches Bellingham’s self-contained world of privilege with authority and ambitiously borrows characters and themes from Shakespeare: Jason Prosper and his lovers Cal and Aidan evoke Prospero and his servants Caliban and Ariel in The Tempest.
The Starboard Sea also exposes illusions of justice and power. At Bellingham fortune is fickle and power breeds cruelty: the Black Monday crash robs one student of her place at the school. As her dishevelled father comes to collect her in an old station wagon, Dermont writes: “She put me in mind of a fabulous hotel room some rock star had trashed.”
Meanwhile, the male students torture one another in ritual initiation rites that have been passed down through generations. Having been rolled up in a carpet and left out on a football field in the cold, Jason thinks only of revenge: “I can’t wait to get even. I can’t wait to do this to someone else.”
Dermont measures out the stories behind Jason’s twin tragedies coolly, without altering the pace of her well-crafted narrative.
Copyright The Financial Times Limited 2013. You may share using our article tools.
Please don't cut articles from FT.com and redistribute by email or post to the web.
|
http://www.ft.com/cms/s/2/0416582c-63e2-11e2-b92c-00144feab49a.html?ftcamp=published_links/rss/life-arts_books_fiction/feed/product
| 2013-05-18T10:22:57 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Comments:The entire idea of signing up on the Do Not Call List is because you don't want these people calling you. People includes the automated, worse than having a real telemarketer call you, machines. I do NOT want these people bothering me in any form or fashion. Furthermore, "prior business relationship" is abused beyond all recognition - "we sent Bob a peice of mail, so we have a prior business relationship." I strongly oppose this measure as you will be defeating the purpose of the DNCL
|
http://www.ftc.gov/os/comments/tsrcallabandon/OL-101451.htm
| 2013-05-18T10:42:29 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Fulbright Partner and Former U.S. Attorney Michael Shelby Dies at Age 47
Michael T. Shelby
Partner
Houston
Mr. Shelby passed away Tuesday at age 47. He fought an extended battle with cancer. His favorite saying was “remember what’s important.”
“The partners and employees at Fulbright & Jaworski are deeply saddened by the loss of Michael Shelby,” said Steven B. Pfeiffer, chair of Fulbright’s Executive Committee. “Michael dedicated his life to public service and making sure the law was upheld. His honorable life and career is one to be emulated by others. We at Fulbright were honored to have worked alongside Michael – a man who inspired so many. Our heartfelt sympathy goes to the entire Shelby family.”
He spent most of his career with the U.S. Attorney’s Office, with the last three years as the U.S. Attorney for the Southern District of Texas, one of the largest and most prolific federal judicial districts in the nation. Mr. Shelby wanted to make sure his two young daughters were able to attend colleges they chose. As a result, he decided to leave behind public service and enter private practice.
Leon Jaworski had long been an inspiration to Mr. Shelby, who decided Fulbright was the place where he would take his comprehensive experience in white-collar crime and government investigations.
“Michael said he wanted to be a part of the firm Leon Jaworski helped build,” Mr. Pfeiffer said. “Like Col. Jaworski, Michael had a passion for public service, was a trusted leader and took difficult stances in the courtroom.”
Mr. Shelby was born in Central Texas and raised in Houston. After attending Texas A&M University, he went onto law school at the University of Texas. He later became a commissioned officer in the U.S. Naval Reserves. He served in the Middle East during Operation Desert Storm, and his active military duty also included service in Bosnia.
Mr. Shelby’s legal career began in the Harris County District Attorney’s office, where he spent five years in the Special Prosecutions Division. He joined the U.S. Attorney’s office in 1989 as an Assistant U.S. Attorney. He specialized in the investigation and prosecution of cases involving public corruption, organized crime and environmental law.
Mr. Shelby prosecuted corrupt public officials after moving to Phoenix in 1997 and then returned to Houston in 2001 to become the U.S. Attorney for the Southern District of Texas.
As the U.S. Attorney, Mr. Shelby served on the President’s Corporate Fraud Task Force. He tried more than 250 state and federal jury trials and argued before the U.S. Court of Appeals for the Fifth Circuit during his legal career.
In June 2005, Mr. Shelby became a partner at Fulbright, where he headed the firm’s nationwide white-collar criminal defense practice.
“Michael brought a combination of experience, trial skills and tremendous respect when he joined Fulbright,” Mr. Pfeiffer said. “We’ll always remember the remarkable contributions he made throughout his career.”
When not serving and protecting others, Mr. Shelby basked in the time he had with his wife, two daughters, family and friends.
“When Michael wasn’t on a foreign battleground or in a courtroom, he was a family man who enjoyed life,” Mr. Pfeiffer said. “He was known for his adventuresome spirit and fondness for skydiving, cars and space. He was a man of great courage. He fought a difficult battle against cancer.”
|
http://www.fulbright.com/index.cfm?fuseaction=news.detail&article_id=5596&site_id=286
| 2013-05-18T10:53:02 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://www.fulbright.com/fjLib/img/color_photos/13141.jpg",
"Fulbright Attorney Michael T. Shelby"
]
] |
DeusOdarkness
06-27-2004, 02:44 PM
i have a 94 with a 5.7 350 and im not that good with engines.. but i replaced my plugs with the right gap and replaced the plug wires. and now it runs rough and i cant figure out what is wrong with it. any help would be good.
|
http://www.fullsizechevy.com/forum/archive/index.php/t-114438.html
| 2013-05-18T11:02:36 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Many of our Funky English members use Skype to chat with people around the world. Skype is a free program that lets us have video or voice chat with other Skype members.
Are you a Skype member? Would you like to find a partner to chat and practice English with? Introduce yourself here if you are looking for a partner! Try and find someone that speaks a different language to you. This way you'll have to use English to communicate!
If you would like a Funky Skype date with a fellow Funky English member leave your details below! Please tell us:
You don't have to share your Skype id on this forum if you don't want to. Get to know some of our members then pass them your Skype id in a private message!
This discussion is now closed. Please join the group below if you wish to take part in Skype sessions.
Join our new Funky English group to take part in our group Skype activities!
Views: 1595
Replies are closed for this discussion.
Hi,
i could talk to somebody who would want to chart to person from russia but i cannot be useful for whose who learn english language as i myself need someone native what to improve my english (most of all i mean my pronunciation).
Hi Natalia. I understand your comment about needing to speak with a native English speaker but chatting to people from other non-English speaking countries is also useful in different ways. You will get to listen to different accents (in the real world there are literally 1000s of different accents) and you must make sure your English language is clear and easy for people to understand. It's just another - slightly different - way to practice English!
i agree with you Jamie, I would just like people to know I only teach English as well and do not want to disappoint them. any way, we should try any possibility to improve our english skills.
Ok
IT will be nice to practice english with you
please send me your skype name
oh sorry i had to write *that* instead of *what*
Hi, I'm Edriany from Indonesia. i would like to have friend for practice using English through skype. usually i'm free around 9-11 PM Jakarta time. but sometimes i have time in the morning and afternoon too. so i think we can try make a deal with time in person later, my English level is Beginner. and i would like to talk about language studying experience, Korean drama n movies, your activities in life, your experience, sports, and etc.
thank you ^^
Hello I'm from Austria and I would like to find some friends for practise English. I'm here in the evening GMT Time +1 in Austria. So im her at 8 pm in my time. I have to work during the day so I can talk just in the evening. I like communication and everbody is welcome. So I'm looking forward to meet you. :)
hiiiiiiiiii my name is zahid hussain i will talk to u for improving enlish.My skype id is **********
Hello... I am Ashish Gupta... I want to improve my english skill and communication
skill and i hope you all want same thing. This is the only one reason i am sending friend-request so, please add my if you all want a English-Partner.My SKYPE ( ********** ) Thanks ^_^
1. INDIA
2. ALL Day
3. Medium
Hi everyone, I'm Blue Peace
1) I'm from Vietnam
2) I'm free on weekend (all Saturday+ all Sunday, except some days - very rarely). (Vietnam's time belt: GMT+7)
3) Medium
4) Studying English, culture of other countries and football (just listen, beaucause I don't know much about football)
I signed up Skype with name **********
I hope I will have many friends
Would anyone be interested in setting up a group conversation? A few members can log in at the same time and talk about a subject - for example a news story or one of our lessons. It will be difficult because we are all in different time zones but it might be worth a try in the future.
This is something I will arrange for some time after the New Year. If you are interested let me know and we'll try and make it happen!
Hi ! I think it would be very interesring to talk in a group. I live in Austria GMT +1 so maybe it's difficult to join. Please let me know when you arrange a group and I will try to be there.
|
http://www.funkyenglish.com/forum/topics/find-a-friend-to-skype-with
| 2013-05-18T10:41:25 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Michael Madisonis drinking chocolate milk.
- Links
- Website
- Groups
- TheMeatgrinderShow
Video CRIMEBUSTERS
CRIMEBUSTERS from Michael Madison Crimebusters is the tale of crime and busting. Based on the graphic novel of the same name. This is what happens when cops have too much time on their hands. Filmed before a liv...
Time: 4:46 | Views: 1,705 | Rating: 87% Funny
Video CRIMEBUSTERS
Video Peas With Mom
Peas With Mom from SpasticAV Ahhhhhhh, where do I begin? I did everything I could to help this young filmmaker. I gave him funds because he was doing something deeply Freudian. I helped him with his next fi...
Time: 15:24 | Views: 990 | Rating: 70% Funny
|
http://www.funnyordie.com/michael_madison
| 2013-05-18T11:02:52 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Difference between revisions of "Talk:Funtoo Linux Kernels"
Latest revision as of 12:24, 19 November 2012
config-extract need update, doesn't work with recent debian-kernels. binary flag not working as there is no default .config generated by config-extract. providing kernel configs used in debian releases
[edit] tuxonice-sources
I am using my laptop for development and all desktop stuff. (LXDE with compiz - looks great, works fine, consumes few power)
When I switch on my machine I see my funtoo grub theme. This is followed by my funtoo boottime splash. This is also schown when suspending, hibernating and waking up and shutdown. This works great with tuxonice-sources and splashutils.
Each time "funtoo" starts, I feel save and home. This is my machine, it looks good and works even better.
Maybe somebody else wants his/her machine to fit exactly his/her requirements. Then You may want to have a look at tuxonice-sources.
|
http://www.funtoo.org/index.php?title=Talk:Funtoo_Linux_Kernels&diff=8170&oldid=6499
| 2013-05-18T10:13:26 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
FunTrivia Points: 30,249
Point Rank: # 46,193 of
1,844,059 players
Points Today: 0, Yesterday:
0
cycloidmike's Team Points:
7,726
( info )
For those who don't want a team but kind of want to be eligible for the team prizes.
* Join Now
Quizzes Authored:
0
Single Questions Accepted:
0
Quizzes Played: 67
Questions Correct: 524 /
750 (70%)
Crosswords Played: Gold Member Feature
Knockout Points: 0 (goto)
Brains Collected: 0 (info)
Monster Quizzes Taken: 51 (765 questions)
Division: (1) The Newbies
Mode: Normal
User Rating: 1498
Last Graduation: None
Games Played: 2
|
http://www.funtrivia.com/profile/cycloidmike.html
| 2013-05-18T10:16:23 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Ruth Carver, 95, of Fuquay-Varina, formerly of Spindale, died Tuesday, Jan. 29 more than 30 years.
Ruth is survived by her daughter, Kaye Carver of Charlotte; son, Wayne Carver of Fuquay-Varina; sister, Grace Pritchard of Vero Beach, Fla.; 10 grandchildren; 17 great grandchildren and six great great grandchildren. In addition to her parents, she was preceded in death by her husband, Gilbert M. Carver; son, Marion Carver and five brothers.
Funeral services were held at 2 p.m. on Feb. 2 at Pleasant Grove United Methodist Church with Rev. Ronald Setzer officiating. Interment followed in the church cemetery. The family received friends following the service.
In lieu of flowers, memorials may be made to Pleasant Grove United Methodist Church cemetery fund, PO Box 880, Forest City, NC 28043.
Online condolences at. Crowe’s Mortuary is assisting the Carver family.
|
http://www.fuquay-varinaindependent.com/view/full_story/21630494/article-Ruth-Thornton-Carver?instance=popular
| 2013-05-18T10:41:23 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
6SigmaFM
Predictive DCIM
The modern datacenter can often house hundreds of racks or cabinets containing thousands of servers, with changes often happening daily. Once installed equipment will often be required to be available 24/7 with little or no opportunity to power it down to change the configuration. Combine this with the ever-increasing power densities of the IT equipment, and it can represent an ever-present risk of thermal failure with very limited possibilities for remedial actions.
6SigmaFM enables the datacenter operator to test proposed configurations in order to predict outcomes, so minimising the risk of failure and indeed of getting into this difficult to manage scenario. In addition, a comprehensive change history – including environmental impact and performance – is stored so past decisions can be revisited to help refine the decision process and better predict the future.
Once your Virtual Facility (VF) is up and running, you can easily: drag-&-drop new equipment into every cabinet and fill it to capacity; add or change cabinets in the model; move floor grilles around; or model almost any other everyday operation you wish do in your datacenter.
In-depth understanding
Gain a better perspective on your data center running your asset management operations within a 3D space.
Up to the minute information
Just like the asset management integration, 6SigmaFM works with Real-Time Monitoring Systems to provide the current status of your data center.
(see 3rd party integration page for more information)
Principal Uses
IT Demand Management
- Consider Installs, Moves, Uninstalls… to IT equipment considering space, power, cooling, network
and weight in choosing locations.
- Synchronize the virtual facility with other management tools by, for example, importing changes from
asset management tools, and use simulation to assess plans before deployment.
Capacity Management
- Use thermal simulations to reset cooling limits on cabinets as IT layout deviates from original
design loads.
- Export updated cooling limits back to IT asset management tools. o Modify layout of data-hall. o Add
or remove rows of racks and floor-tiles.
Design Upgrade
- Test effectiveness of proposed changes such as hot- or cold- aisle containment or cabinet-level
cooling before deployment.
- Test impact of new cable routes on airflow management before deployment.
- Consider changes to cooling strategies.
- Assess effects of different control strategies such as group control, control-on-supply or pressure
control.
- Test performance of a new ACU design such as EC fans in the floor void or variable-speed drives.
Trouble shooting
- Diagnose the cause of overheating equipment.
- Test potential fixes before deployment.
Facility Management
- Assess the impact of taking an ACU down for maintenance or simulate an ACU failure scenario.
- Identifying potential energy savings – for example, identify bypass air and ACU short-circuiting plus
test potential fixes before deployment.
- Periodically assess whether the facility is being overcooled and reconsider energy efficiency
measures that could be adopted.
- Test whether cooling set-points can be turned up to make cooling system more efficient without
compromising resilience.
Integrating Products
6SigmaFM integrates with other parts of the 6SigmaDCsuite to enable the simulation and assessment of various aspects of the facility before any changes are implemented:
6SigmaCooling – 6SigmaDC CFD solver for prediction of thermal conditions and airflow paths;
6SigmaRack – pre-test IT layout inside a cabinet;
6SigmaPower – power configuration and SPOF analysis;
6SigmaWeight – check loading on the raised floor;
6SigmaRoom – major design changes to the infrastructure of the facility;
6SigmaITM – (primarily for IT managers) view rooms being managed by 6SigmaFM to enable effective
separation of tasks and responsibilities and raise Change Requests (CRs) in order to service them.
Typical CR actions include:
- Adding and removing items from the Store Room;
- Installing, decommissioning or moving, equipment around a facility;
- Changing one item for another;
- General maintenance.
Back To Top
Interested in Learning More? Get in touch>>
Predictive DCIM Focussed Literature
Additional
|
http://www.futurefacilities.com/software/fm/6SigmaFM.php
| 2013-05-18T11:01:27 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Last week gold dropped like a NASA satellite falling from space. What was the driving force of this drop?
Last week December gold opened the week at $1,820 and closed the week at $1,639.80. The weakness in the market was very clear if you were watching the COT report week to week. Before I cover the COT, look at the daily chart below to see the technicals. We see ADX now at 33 reflecting a strengthening downtrend. You can see how the very strong uptrend that started back in early July started weakening mid-August after gold touched $1,900 for the first time. MACD is showing momentum building in the move down with increasing divergence and Stochastics are deeply oversold. Not concerned about this as ADX is at 33 and rising. You also can see the large drop in Open Interest. So who is responsible for this large drop? Let’s have a look.
Proceed to Page 2 for the latest COT Data...
COT Data
Looking at the weekly chart below you can see that back on Aug. 5 Commercials on the old legacy COT report were 287,634. As of this past Friday, Sept. 23 Commercials came in at 197,628 contracts net-short. That shows liquidation at just over 90,000 contracts. As you know from reading Market Pulse, I prefer the newer Disaggregated COT report. And here is why.
On Aug. 5, Producers (true commercials) had a net-short position of -195,940 contracts. On Sept. 23, Producers were net-short -181,944 contracts. Managed money back on Aug. 5 was net-long 228,824 contracts. This past Friday managed money came in at 151,425 net-long. A much larger drop in longs than producers drop in shorts. So who exactly was liquidating on the other side of managed money? You guessed it, our friends the Swap Dealers. Back on Aug. 5 Swap Dealers were -91,693 contracts net-short. This past Friday, Sept. 23 Swaps came in at -15,684 contracts net-short. This is the lowest we have seen since late 2008.
So you want to know when gold will drop it’s free fall? Keep an eye on the Swap Dealers because when they start adding to their net-shorts again, that is when we will see price rise. And if they continue liquidating, we definitely can see gold test $1,500.00..
|
http://www.futuresmag.com/2011/09/26/is-goldrsquos-dip-a-correction-or-trend-change?t=commodities&page=2
| 2013-05-18T10:15:16 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
U.S. stocks advanced as equity markets in the world’s largest economy reopened after Hurricane Sandy caused the longest weather-related shutdown since 1888.
The Standard & Poor’s 500 Index increased 0.1 percent from Friday’s close to 1,413.83 at 9:31 a.m. in New York. The benchmark gauge has declined 2 percent in October after four straight months of gains.
“Investors are braced for an exceptionally busy open, as three days of trading are combined into one,” Richard Hunter, head of equities at Hargreaves Lansdown Plc in London, wrote in an e-mail. “There is the additional feature of some likely window-dressing business, given today being the last trading day of the month and the end of the year for many mutual funds. There has been some encouraging economic data in the form of house prices.”.
Backup Power
Internet and mobile-phone connections were limited on the floor of the New York Stock Exchange as U.S. equity markets prepared to open after the longest weather-related shutdown in more than a century. The NYSE’s headquarters are running on backup power and will keep using it if necessary all week, Larry Leibowitz, the chief operating officer, said in a phone interview.
Data yesterday showed the S&P/Case-Shiller Index of property values in 20 cities rose 2 percent in August from a year earlier, after a 1.2 percent advance in July. The average estimate by economists in a Bloomberg survey had called for a 1.9 percent increase.
A report today may reveal business activity in the U.S. expanded in October. The Institute for Supply Management-Chicago Inc.’s business barometer rose to 51 from 49.7 last month, according to the median forecast in a Bloomberg survey of 54 economists. A reading of 50 is the dividing line between expansion and contraction.
Economic Data
The Labor Department is striving to issue its monthly report on employment on Nov. 2 as scheduled, a spokesman said yesterday. Payrolls increased by 125,000 workers in October and the jobless rate rose to 7.9 percent, according to the median forecasts of economists surveyed by Bloomberg.
The jobs report is the last before the Nov. 6 presidential election, and may help sway voters trying to decide between giving President Barack Obama another four years in office or to change course with Republican challenger Mitt Romney.
Investors are also watching corporate results. Some 24 companies in the S&P 500 are due to report earnings today, according to data compiled by Bloomberg. Profit has exceeded projections at 72 percent of companies to have released third- quarter results, while sales trailed estimates at 60 percent of firms, Bloomberg data show.
Hurricane Sandy may reduce economic output by $25 billion in the fourth quarter, according to Gregory Daco, a U.S. economist at IHS Global Insight in Lexington, Massachusetts. That could lower the fourth-quarter pace of growth to between 1 percent and 1.5 percent, from an estimate of 1.6 percent, he said.
|
http://www.futuresmag.com/2012/10/31/us-stocks-advance-as-market-reopens-after-hurrican?t=educationtfinancials?t=managed-funds
| 2013-05-18T10:34:22 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://media.futuresmag.com/futuresmag/article/2012/10/31/iStock_000015213707XSmall-resize-380x300.jpg",
null
]
] |
For Educators
Beholder
This film is set in a future where technology has allowed for everyone living in a fictional gated community to pick and choose all of the genetic features of the children before they are born. Students will contemplate how far they are willing to go to defend their own beliefs.
Crossover
This film depicts the ethical dilemma of a mother whose children are trapped in a vastly unequal school system. The lesson plan asks students to reflect more deeply about the state of our public education system -- both in the near future, and today.
Gunny
The film is a powerful exploration of the lasting effects of war on soldiers returning home, told in a unique style that moves backward in time. Students will analyze the effects of the filmmaker's choices concerning how to structure a text, order events within it, and manipulate time.
That Which Once Was
This film about an unlikely friendship between two "environmental refugees" and accompanying lesson plan allow students to connect with the urgent and complex problem of global warming.
Predicting the Future
Use this lesson to help students think about how and why humans like to predict the future.
The Visual Grammar of Film
Use this lesson to help students engage actively with film terminology and concepts.
Mister Green
Global Warming and Carbon Dioxide Sequestration
In this lesson, students will analyze global warming, watch the film Mr. Green, analyze the validity of the solution presented in the film, and investigate the concept of carbon dioxide sequestration.
Plastic Bag
Where Does it All End Up?
Struggling with its immortality, a discarded plastic bag ventures through the environmentally barren remains of America as it searches for its maker. Students examine the scope of plastic bag use and disposal issues.
Play
Video Games and Social Control
What happens when people lose control over their own technology? In this lesson students investigate their own use of technology and consider how to maintain control.
Seed
The Future of Genetic Engineering
The lesson plan for Seed reviews the history of agricultural biotechnology. Students will propose a new GMO product based on need, potential for profit, and minimal environmental effects.
Silver Sling
The Future of Reproduction
Students will analyze the video to determine what aspects appear to be possible now and what do not. Then they will read and respond to an article about surrogate mothers.
Tent City
Building a Story Within a Story
This lesson focuses on the narrative technique of frame story. Students analyze its structure, and in extension activities write their own frame stories and research real tent cities
Tia & Marco
Developing Empathy for Others
Students analyze the video to watch the development of empathy. They explore the impact of empathy in their own lives, and they produce a story that models empathy.
Refuge
A cyber attack on the United States Immigration database puts Sonia at risk of being deported back to Iran. But remaining in the U.S. may come at a greater price than she’s willing to pay.
|
http://www.futurestates.tv/about/for_educators
| 2013-05-18T10:30:26 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Utilities Fund Portfolio Manager
Objective
Fund Details
Price & Performance
Dividend & Tax Info
The Gabelli Utilities Fund
Portfolio Management
The Gabelli Asset Fund
The Gabelli Value Fund
The Gabelli Small Cap Growth Fund
The Gabelli ABC Fund
The Gabelli Equity Income Fund
The Gabelli Utilities Fund
TETON Westwood Mighty Mites Fund
Gabelli Enterprise Mergers and Acquisitions Fund
The Gabelli Equity Trust Inc.
The Gabelli Convertible Securities Inc.
The Gabelli Multimedia Trust Inc.
The Gabelli Utility Trust Inc.
The Gabelli Dividend & Income Trust
The Gabelli Global Utility & Income Trust
The Gabelli Global Deal Fund
The Gabelli Healthcare & Wellness
Rx
Trust.
|
http://www.gabelli.com/Template/show_bios.cfm?tid=NTQzOGM=&bid=NGI2Nw==&mid=M2E2NDI=&num=OTRmMw==&kid=NDQyYw==&fid=MWMwOTA=&rid=074=edoc_dnuf
| 2013-05-18T10:14:38 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Leapfrog Tag - the latest in teaching children to read
Leapfrog make reading interactive with the use of a Tag pen to help read the book and play games. Your child can hold the pen and touch a symbol on the page to read the story to them by the characters in the book, with a signalling sound to tell them when to turn the page. Alternatively they can touch another symbol to have just that page read to them. To aid understanding and memory there are games within the story asking kids to find favourite characters or demonstrate their understanding by pointing to parts of the picture when asked a question.
The stories are cute and the characters are colourful and fun.
In the Ozzie and Mack story I tested, the tale is followed by a series of learning games. There is an alphabet page when pounces the letters and gives examples of words starting with the individual letters. In Ozzie's Rhyme Time Band the kids can point to ryhming words which are read out loud to them. The game that goes with this page asks kids to find words as they are read to them. Tree House Telephone shows children how adding the letter 'e' to words changes them - for example, not to note. River roundup explains more complicated words like a mini dictionary. On each of the game pages there are 3 levels - children work their way through each level. Because the Tag stores what your children have played so far, they can only move up a level once they have mastered the previous one.
The Tag system comes with a CD which loads a program connecting your Tag pen to programs on the Leapfrog website. Here you can dowload stories and receive rewards for using the Tag Reading system. I'm not sure what the rewards are - as clearly I didn't play long enough with my TAG to earn any!!!
I started off unsure about the Tag reading system - as I'm very much one for natural parenting and I'd prefer to play these games with the kids myself rather than relying on technology. However, as I played with the Leapfrog Tag I could see how useful it could be for busy families. These days not everyone has enough time to teach kids to read, or maybe can't think up enough entertaining games to play with the kids to help them. I also know that some kids are very reluctant to be shown what to do by an adult, but are quite happy to sit by themselves learning from this type of technology.
I wasn't enamoured by the internet part of the product and was concerned about entering personal data into yet another website - even though I was assured this was intended to help construct an age appropriate learning plan. I thought the product was good enough on its own not to need the rewards element on the website. It's just a personal opinion, but I really don't think we need to use the internet for everything - including learning how to read.
On balance, my concerns are purely personal and for what it is setting out to do, the Leap Frog does succeed. It's easy for children to understand and very easy to use. The stories are well laid out and beautifully illustrated. The games are well thought through for the intended age range of 4 - 8 years old - though you could start kids on these books earlier than that. I like the fact that there are levels of games to play and so the book continues to be useful as the child reading progresses.
The Leapfrog Tag system can be bought at Amazon for £33.99 and includes your first Tag book.
There are more Tag books available from £11.10 on Amazon and include some favourite characters such as Spongbob Square Pants, Cat in the Hat and Kung Fu Panda. A selection is here at Amazon:
|
http://www.gadgetspeak.com/gadget/article.rhtm/751/553177/Leapfrog_Tag_-_using_technology_to_teach.html
| 2013-05-18T10:53:05 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"/user/getpic.rhtm?memberid=264064&defImage=/custom/images/noimage_s.gif",
"Image of author"
],
[
"/custom/images/loading.gif",
"Loading"
]
] |
Apple has launched iPhone 3GS in India at new amazing price. The iPhone 3GS 8GB runs on iOS 4 and provides faster applications & support to multiple languages at the same screen.
The Apple iPhone 3GS sports a 3.5 inch diagonal multi-touchscreen display with 480×320 pixel resolution, a 3MP camera, Video player, recording, music player, and more.
The Apple iPhone 3GS is equipped with Li-Ion standard battery for long standby, talk time, internet use, music and video playback. The iPhone 3GS weighs 115 grams.
Apple iPhone 3GS 8GB features and specifications:
Dimensions: 115.5×62.1×12.3 mm
Supports multiple languages
OS: iOS 4
Display: 3.5 inch Diagonal multi-touch display
480×320 pixel resolution
3 megapixel camera
Video recording and playback
Music Player
8GB storage
Wi-Fi, GPS, Digital compass
Battery: Li-ion
Talk time: Up to 5 hours on 3G, Up to 12 hours on 2G
Standby time: up to 500 hours
Weight: 115 gram
Apple iPhone 3GS 8GB Price
The iPhone 3GS 8GB is available in India at new amazing price of Rs. 19,990.
prise in us & prise in banglore
pls send new price
price high .compared other company
is that true that it is sold for such a good price?????
i dont belive it!!!!!!!!
|
http://www.gadgetspriceindia.com/apple-iphone-3gs-8gb-price/
| 2013-05-18T10:32:32 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://www.gadgetspriceindia.com/wp-content/uploads/2011/06/iphone-3gs.jpg",
"iphone-3gs iphone-3gs"
]
] |
Tell me my mother: Stories of Campbelltown’s Aboriginal Women
Campbelltown Arts Centre
ISBN: 978-1-875199-55-6
“Stories of resilience and inspiration” is how I would sum up this collection of oral histories with 15 local Aboriginal women residing in the Campbelltown District. They are stories that resolve issues for each of these women, and help the younger generations understand the lives we are fortunate to have today.
Many stories revolve around the history of the local areas these women have come from across the State and even Victoria, and life under the Protection Act including mission life, as well the negative effects of alcohol and domestic violence on the family. But most stories end with life today in Campbelltown and the roles the women play in community activities such as the street patrols Gladys Lock is part of.
The stories are about reconciling the past for these women. Marnie Williamson says, “Reconciliation must begin within ourselves. As elders, we must strive to reconcile our own past, somehow make sense of it, or we’ll always live in this voice, shadows in our own land.” And in trying to reconcile such stories of hardship, the women also recall the funnier side of life and growing up, such as the first time Verna Barker saw a plane and how she screamed thinking it was aliens coming to get her.
I was astounded at the size of the families that some of these women raised and continue to raise. Jenny Brown had four kids of her own but raised another 600 foster kids, while Christina Craig has 93 grand kids.
Some stories were also interesting local histories such as Glenda Chalker’s entry about living at Pheasant’s Nest, which is named PN because it’s the first place lyrebirds were recorded at. The Lyrebird is also Glenda’s totem, so she feels especially at home at Pheasant’s Nest. I’ll remember that when next I drive to Canberra along the M5.
Most women had key messages for their children and for all young people. Sue Davis’ message was that we should respect one another, respect culture and respect ourselves. In line with that Kylie Dickson believes that “to earn respect, you’ve got to give respect”. Artist and painter Sue Grant advises that you should follow your spirit and your dreams and be proud. And Julie Hoffmanbeck’s words to her children and other parents are “The most important thing is protecting you and your kids.”
Judy McKay recommends taking one day at a time, enjoying a sunset or a sunrise, the birds chirping, and the smells around you. And to never lose the little child inside.
Some of the stories are about achievement for these women, and that is measured in different ways. For Norma Layt her greatest achievements in life were going to uni, buying her own home and bringing up seven children. I would’ve thought one of those would be enough!
The book is really about the role of the mother and other key women in our lives and Alana Moffatt talks about the guidance and knowledge she got from her Mimi (grandmother) and how that’s where her drive stems from.
Each short autobiographical narrative is complimented by a beautiful black and white portrait by Mervyn Bishop.
Finally, Ruby Langford Ginibi says she tells her stories to make things change and to make people wake up. And this collection of truly hard lives lived, by women who are not bitter or twisted, but who are full of love and compassion should really make some of our young people wake up to themselves and see that what they enjoy today is a far cry from what our old people had to endure.
This is an inspirational read about women, many whom were born in dire conditions and raised without the basic human right we enjoy today. Show them you appreciate their generosity of spirit to tell their stories by reading them, and in turn you will show and that they deserve a place, as Mona Porter says, “My philosophy is that in the world, it doesn’t matter who you are, where you are or where you are from, you deserve your place in this world.”
This small volume is a gift to the Campbelltown community by these women, through the Campbelltown Arts Centre who coordinate the Campbelltown Intergenerational Aboriginal Project, through which this book was completed.
TO ORDER CONTACT:
PO Box 57
Campbelltown NSW 2560
Phone: 02 46454111
Drop in to the Cnr of Camden and Appin Roads Campbelltown
|
http://www.gadigal.org.au/arts/Tell%20me%20my%20mother.aspx?Id=117
| 2013-05-18T10:12:15 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Click on a label to read posts from that part of the world.
Learn photography skills while trekking the Himalaya
.
Filed under: Climbing, Arts and Culture, Hiking, Learning, Photos, Podcasts, Asia, Nepal, Camping, Ecotourism
Reader Comments (Page 1 of 1)
Andrea Sep 8th 2009 11:58AM
I will be doing my own watered-down version of this soon! It's called 'Learning how my new camera works while on holiday in Bhutan'.
|
http://www.gadling.com/2009/09/08/learn-photography-skills-while-trekking-the-himalaya/
| 2013-05-18T10:30:30 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://www.blogsmithmedia.com/www.gadling.com/media/xdgmap4.jpg.pagespeed.ic.UYNbssMXdp.jpg",
"Map of the world"
],
[
"http://www.blogcdn.com/www.gadling.com/media/2009/09/stacks_image_130_1.jpg",
null
]
] |
Acai Berry
Potent antioxidant support*
Every day, the body is confronted with stressors that challenge your antioxidant capacity. Certified Organic…Continue
Adrenal Health
Promotes healthy response to stress*
Stress is at the heart of many health conditions. When the body is stressed, your…Continue
Aller-leaf
Promotes upper respiratory health*
Gently supporting the body's response is essential to daily comfort. Aller-Leaf features herbs studied for…Continue
American Ginseng
Validated full spectrum extract
Ginseng is one of the most widely used medicinal herbs, with at least six species…Continue
Arnica Flower Oil
Arnica montana
Promotes Restoring Overworked Muscles Supports Relaxation of Muscles to Aid in Normal Day to Day…Continue
Ashwagandha Root
Supports a healthy immune & stress response*
When the body is stressed, the immune and nervous systems can be affected, leaving a…Continue
Astragalus Root
667 mg/ml herb equivalency
Supports Healthy Resistance from the Occasional Physical and Emotional Stressors Supports Healthy Immune Functions Supports…Continue
Astragalus Root, Alcohol-free
Astragalus membranaceus
Supports Healthy Resistance from the Occasional Physical and Emotional Stressors Supports Healthy Immune Functions Supports…Continue
Astragalus Supreme
Supports deep immune function*
Gaia Herbs' Astragalus Supreme is specially designed to provide deep-level immune support while assisting the…Continue
Astragalus Supreme
Supports Healthy Immune Functions
Supports Healthy Resistance from the Occasional Physical and Emotional Stressors Supports Deep Immune & Liver…Continue
Bilberry, Certified Organic
333 mg/ml herb equivalency
Protects Tissue Integrity within the Eyes from Normal Age-Related Oxidative Stress* Promotes Healthy Visual Acuity*…Continue
Black Cohosh
Healthy female reproductive function*
Black Cohosh has a long history of use - now backed by scientific evidence -…Continue
Black Cohosh Root
Actaea racemosa
Supports the Body’s Adaptation Associated with Normal Menstrual Cycles Supports the Female Reproductive Organs Supports…Continue
Black Elderberry
Supports a healthy immune response*
Black Elderberry helps maintain a healthy immune response whenever you need it.* Black Elderberry is…Continue
Black Elderberry Nighttime Syrup
Supports sleep during immune stress*
Black Elderberries have been recognized for centuries throughout Europe for their immune supportive properties. Modern…Continue
Black Elderberry Syrup
Immune support for the whole season*
Black Elderberries have been recognized for centuries throughout Europe for their immune supportive properties. Modern…Continue
Black Elderberry, Certified Organic
500 mg/ml herb equivalency
Encourages Healthy Upper Respiratory Function Supports Immune Function and Response Promotes Healthy Mucosal TissueContinue
Black Walnut Fresh Green Hulls
Juglans nigra
Supports the Natural Balance of Healthy Intestinal Flora within the GI Tract Supports Healthy Intestinal…Continue
Breathe Naturally
Assists in Maintaining Healthy Respiratory Function
Supports Healthy Immune System Functions Supports the Upper Respiratory Tract Assists in Healthy Breathing Passages…Continue
Bronchial Wellness Herbal Syrup
Soothing Support for Respiratory Health*
Soothes occasional bronchial irritation* Emollient properties support healthy mucous membranes* Enriched with honey & aromatic…Continue
Bronchial Wellness Tea
Soothing support for respiratory health*
Bronchial irritation, whether acute or chronic, can leave you feeling achy and exhausted. With herbs…Continue
Burdock Root, Certified Organic
500 mg/ml herb equivalency
Supports Healthy and Vital Skin with a Clear Complexion* Promotes Normal Liver Function by Supporting…Continue
California Poppy
500 mg/ml herb equivalencyContinue
Cat's Claw Bark
Uncaria tomentosa
Supports Healthy Functions of the Immune System Promotes a Healthy Inflammatory ResponseContinue
Chaste Tree Berry, Certified Organic
250 mg/ml herb equivalency
Provides Support for a Normal Menstrual Cycle * Support for the Transition into Menopause and…Continue
Chia Fresh Daily Fiber
Supports regularity, healthy weight and cardiovascular health*
The vitality and benefits of chia seeds are uniquely harnessed in ChiaFresh™ Daily Fiber using
Supports Digestion and the Occasional Feeling of Fullness within the Stomach* Warming Digestive Aid* Support…Continue
Cleanse & Detox Tea
Naturally supports the detoxification process*
Cleanse & Detox Herbal Tea supports healthy liver function that is essential to maintaining wellness.*…Continue
Coleus Forskohlii Root
Supports the Activation of cAMP: an Important Tool in Cellular Communication Promotes Healthy Metabolism Supports…Continue
Comfrey Compound
Natural First Aid
Herbal Skin Care to Support Natural Healing of Minor Skin Abrasions Preserves Skin IntegrityContinue
Cranberry Concentrate
Optimizes urinary tract health*
Cranberry has a long history of use —now backed by modern science — for supporting…Continue
Daily Cleanse Fiber (fomerly named Rejuve Gentle Daily Fiber)
Supports healthy & gentle elimination*
Daily Cleanse Fiber (fomerly named Rejuve Gentle Daily Fiber) is a proprietary blend of plant…Continue
Dandelion Root & Leaf, Certified Organic
500 mg/ml herb equivalency
Promotes Healthy Excretion from the Urinary Tract* Supports the Liver and the Gall Bladder to…Continue
Dandelion Root, Certified Organic
500 mg/ml herb equivalency
Supports the Liver and the Gall Bladder to Promote Digestion* Supports the Liver and the…Continue
Deep Liver Support
Supports healthy liver defense*
Deep Liver Support helps maintain liver function by promoting healthy liver enzymes and providing nourishing…Continue
Diet Slim Tea
Support for maintaining a healthy weight*
Maintaining a healthy weight can be a challenge, yet with regular exercise and a healthy…Continue
Dong Quai Root
Angelica sinensis
Help Support the Normal Process of Menstruation and Menopause Supports the Female Reproductive SystemContinue
Dong Quai Supreme
Concentrated synergistic formula
Provides a Natural Hormonal Balance During the Onset Of Menopause Rich Natural Source of Phytoestrogens…Continue
Ear Oil With Mullein & St. John's Wort
Natural herb & oil blendContinue
Echinacea Goldenseal
Supports immune & respiratory response*
A healthy respiratory response is essential for optimal overall immune health. Concentrated to be fast-acting,…Continue
Echinacea Goldenseal Propolis Throat Spray
Contains Gaia Farm Echinacea
Supports a Healthy Immune System Response Maintains a Healthy Inflammatory Response to Seasonal Stressors Promotes…Continue
Echinacea Goldenseal Supreme
Contains Gaia Farm Echinacea
Supports a Healthy Immune System Response Maintains a Healthy Inflammatory Response to Seasonal Stressors Promotes…Continue
Echinacea Goldenseal Supreme, Alcohol-free
Contains Gaia Farm Echinacea
Supports a Healthy Immune System Response Maintains a Healthy Inflammatory Response to Seasonal Stressors Promotes…Continue
Echinacea Goldenseal Supreme, Extra Strength
Contains Gaia Farm Echinacea
Supports a Healthy Immune System Response Maintains a Healthy Inflammatory Response to Seasonal Stressors Promotes…Continue
Echinacea Red Root Supreme
Contains Gaia Farm Echinacea
Supports a Healthy Immune System Response Maintains a Healthy Inflammatory Response to Seasonal Stressors Supports…Continue
Echinacea Supreme
Supports healthy immune response at onset*
Echinacea Supreme has been used successfully for hundreds of years to support immune health.* Gaia…Continue
Echinacea Supreme, Alcohol-free
Contains Gaia Farm Echinacea
Ultimate Support for the Immune System Promotes the Production of Key Immune Functions Unique Combination…Continue
Echinacea Supreme, Certified Organic
Validated Full Spectrum Extract
Supports a Healthy Immune System Response* Supports Maintenance of a Healthy Inflammatory Response to Seasonal…Continue
Echinacea Supreme, Extra Strength
Contains Gaia Farm Echinacea
Supports a Healthy Immune System Response Maintains a Healthy Inflammatory Response to Seasonal Stressors Promotes organic herbs, this formula helps to support a healthy…Continue
Acai
Euterpe oleraceaContinue
Acai fruit is obtained from the Amazon River basin and plants are manually harvested from wild Acai palms (Euterpe oleraceae), which are native…
Arjuna
Terminalia arjunaContinue
Arnica
Arnica montanaContinue…
Brown Seaweed
Padina paronicaContinue
Buckthorn
Rhamnus catharticaContinue
Bupleurum
Bupleurum chinenseContinue
Bupleurum is a member of the Apiaceae family of plants and has been a staple of Traditional Chinese Medicine (TCM) for over 2,000…
Antioxidant Support
Bladder Function
Bowel Regulatory
Brain Function
Carbohydrate Metabolism
Cardiovascular Function
Cholesterol
Circulatory Function
Connective Tissue Function
Digestive Function
Endocrine Function - Adrenal
Endocrine Function - Thyroid
|
http://www.gaiaherbs.com/pages/detail/34/522/575/568/Brown-Seaweed
| 2013-05-18T10:21:49 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Conscious Acts of Creation
Item# 84-0460
$20.00
Manifest your wishes with a trained mind
Quantity:
Availability:
Gift wrapping available
Focus your mind — on what you wish to manifest and, scientifically, your chances for success are good. This is the message of this program that presents “a new physics,” proving we can consciously create what we choose. This scientifically oriented film features three experiments done under controlled conditions, mathematical formulas and graphs. 90 minutes.
|
http://www.gaiam.com/conscious-acts-of-creation/84-0460,default,pd.html?start=62&cgid=6010000
| 2013-05-18T10:42:40 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://demandware.edgesuite.net/sits_pod21/dw/image/v2/AAIZ_PRD/on/demandware.static/Sites-gaiam-Site/Sites-gaiam-master-catalog/default/v1368860420814/84-0000/84-0460.jpg?sw=440&sh=480",
"Conscious Acts of Creation Conscious Acts of Creation"
]
] |
Pilates Beginners Collection
Item# 95-9268
$45.00
Your perfect Pilates starter DVD kit
Quantity:
Availability:
Gift wrapping available:.
Print<strong>GET TO KNOW ANA CABAN</strong><br>.
|
http://www.gaiam.com/pilates-beginners-collection/95-9268,default,pd.html?start=12&cgid=4010700&prefn1=dvdType&prefv1=Pilates%7CBudokon%7CStrength%20Training%7CHealth%20%26%20Healing
| 2013-05-18T10:22:55 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://demandware.edgesuite.net/sits_pod21/dw/image/v2/AAIZ_PRD/on/demandware.static/Sites-gaiam-Site/Sites-gaiam-master-catalog/default/v1368860420814/95-0000/95-9268.jpg?sw=440&sh=480",
"Pilates Beginners Collection Pilates Beginners Collection"
]
] |
Compare Items
100% satisfaction guarantee — We offer Gaiam.
Gaiam may be obligated to cooperate with various law enforcement inquiries. Gaiam Gaiam.
Providing a secure site is essential for your peace of mind and trust in Gaiam. Gaiam Colorado, in the USA at 833 W. South Boulder Rd., Louisville, CO 80027. September 17, 2012.
© 2013 Gaiam, Inc. — All
Rights Reserved | For assistance, call toll free
(877) 989-6321 | Site Map | Privacy Policy | Terms of
Use
|
http://www.gaiam.com/sale/womens-clothing/7000800,default,sc.html?prefn1=type&prefv1=Long%20Sleeve%20Shirts%7CJackets%7CLeggings
| 2013-05-18T10:14:20 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Registered: 05/01/2005
Gender: Female
Location: Houston, Texas
Occupation: (High school) Student
View All Comments
Made by kappa-dono!
Made by AniHanyou!
Made by M y Tr ue Li g ht!
Made by Rje!
Made by Orinsu!
Made by Kiwi Flavored Bubbles!
Express your affection
View All Comments
he is pretty boss! XD i heart him so much!! whee
Hurray for Castiel luvers!!! ;3
Anything you wanna talk about?
Do you talk to people in Humphrey Poptart's chat thread? It's a really nice bunch of people and I think you'd get bumps from them even with a modest tank of 17 fish. And free advice.
I wish more booty grab players would do as you do -- bump for every grab. Just one bump makes a world of difference to a tank owner trying to recoup the cost of fish.
Except, I stalk people too ;P Then I figure after I find out all their interests are similar to mine, I fantasize about our should-be life together.
Sorry, I know I'm weirder than you ;P
|
http://www.gaiaonline.com/profiles/mokitty/1828529/
| 2013-05-18T10:14:30 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
To send a letter to the editor, click here for a form and letters policy or send to [email protected]. Please include your full name, hometown and a contact number for confirmation..
Let me digress briefly: I am not a scientist; I have however, done research on this theory and have written articles about it and participated in a colloquium in February 2009 in Atlanta titled “Weather or Not” sponsored by and as a member of Mensa.
For those who are still reading this, I don’t have to bore you with data, statistics or even hockey sticks to remind you of some very basic science. CO2 is a byproduct expelled from our lungs during the breathing process. Plants then breathe in the carbon dioxide in order to expel oxygen for us to breathe; this process is called photosynthesis. CO2 is also created by manmade activities such as the combustion of carbon containing hydrocarbons in fuels or wood. It is also used to make our soft drinks fizzle, fire extinguishers put out fires and you may also recognize it in solid form as dry ice.
The reason for my grievance manifests itself when I hear so-called scientists, who receive taxpayer subsidized government grants, and politicians staking claim on more of our money in order to combat this most dangerous of gases. There is not one shred of genuine scientific data that proves the theory of global warming. Nor is there consensus in the scientific community.
There has been a lot of inaccurate and purposefully skewed data offered up as proof, but it has been discredited by genuine scientific data and historical records. One does not have to know much about science to realize that while CO2 is colorless and odorless, something indeed looks and smells rotten.
If you have followed the political path of this topic, you know what I mean. However, I will concede this; carbon dioxide does indeed become dangerous as soon as politicians open their mouth.
Jim GormanGainesville
Contents of this site are © Copyright 2010 The Times, Gainesville, GA. All rights reserved. Privacy policy and Terms of service
|
http://www.gainesvilletimes.com/archives/81230/
| 2013-05-18T10:22:53 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
!
Ok, someone help me out
Ok, someone help me out here...
The Swampspeeder and the Hyena Bomber are new, but I'm not to sure about the AT-AP and the AAT. Are there any deco changes that would warrent these as "newish"?
Corman
Yes, there are new deco
Yes, there are new deco changes on both vehicles.
New Vehicles
I'm all for the Swamp speeder but will pass on the rest. not enough interest in the vehicles to warrant spending the $$$
|
http://www.galactichunter.com/gh/story/new-vehicles-tru
| 2013-05-18T11:03:06 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Your browser does not support iframes..
|
http://www.galaxgazette.com/news/publicsafety?page=34&mini=calendar-date%2F2013-01
| 2013-05-18T10:22:44 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
1944 born in Prague
1964-67 studied at the Academy of Fine Arts, Prague
1970-75 Staatliche Kunstakademie, Düsseldorf,
studied with Joseph Beuys and Gerhard Richter
1979 with Jan Knap and Peter Angermann founded the Normal group
1984 lived and worked in Cologne
1988-91 lived and worked in Rome and Tuscany
1995-96 Studio in New York and East Hampton
1996-97 worked on ceramic sculptures in Den Haag
2001-04 Studios in Prague and Cologne
2004 lives and works in Prague
|
http://www.galerieubetlemskekaple.cz/artists/id-9/
| 2013-05-18T10:13:01 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
PRODUCTS & SERVICES
Would you like to get your message out & market your product on this web
site? Gallopers peaks at around 450 individual visitors per day, so
get your message out there. Advertising space is now available at most
competitive rates. They start at $55 per month inclusive of GST. So send us
your banner or Company Logo and attract new clients through Gallopers.
Ownership & Syndication
Management
Jockey Management
Administration & Account Management
Taylor Made Information For All Punters
Full Summaries for individual race meeetings
In depth analysis for individual races
Exotic analysis for quadrellas, trifectas & first 4s
Accurate information to make you a successful winning punter
The most comprehensive and analytical
compilation of real filters available on the internet. These filters will stop
punters from backing a myriad of losers.
Please
us for full details
WARRANTY & DISCLAIMER
|
http://www.gallopers.com.au/services.html
| 2013-05-18T10:31:50 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Beginning with the
death of
my father, my journey began in Auckland and has taken me to Australia, England, Ireland, Scotland,
Italy and France. I have diverted many times
to other places and times and have met a few of my distant relatives. I
have spoken of things unspoken in the past and learnt a lot, both historical
and also within myself.
You can read more about me
here.
Although my studies and
interest will never be satisfied, I trust this work completed to date will
prove fascinating and informative.
This site was last updated
04/25/08
|
http://www.gallot.co.nz/aboutme.htm
| 2013-05-18T10:12:25 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Benchmarks
Events
Gamer Blogs
News
Top Members
Top Library
Staff Writers
Forums
Motherboards
PSU
Hard Disk Drives
Headsets
Keyboards
Mice
Help Files
Popular Hardware
Best Hardware
Tablets
CPU - Laptop
CPU - New
GPU - Laptop
GPU - New
Fallout New Vegas Recommended System Requirements
Steamworks digital platform (Games for Windows is the certification)
Operating System: XP, Vista, Windows 7
Processor: Dual Core 2Ghz (enhanced for multi-core)
Video Card: Nvidia GeForce 6 Series or similar (ATI 1300 minimum)
Memory: 2GB
Hard Disc Space: 10GB
You will notice that above the system requirements image is the question and answer taken from the Official FAQ. As part of the answer they state that these requirements are the recommended.
Now it seems to us that these recommended requirements are pretty low. Admittedly the game engine came out a couple of years back, Fallout 3. We will get in touch with our contact and double check this and report back.
-----------
Ok, we have had word and these requirements are actually the "required" system specs. So it will make sense that this means we are looking at the Fallout New Vegas minimum system requirements
|
http://www.game-debate.com/news/?news=516&game=Fallout:%20New%20Vegas&title=Fallout%20New%20Vegas%20System%20Requirements
| 2013-05-18T10:42:10 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
GameStream
Live Game in Progress
GameStream
Final League Game
Magnolia West HS
3
Sign In if you already have a GameChanger account.Why do I have to pay?
Our business is supported by parents and fans who pay to access premium team content. Learn More.
Portions of this box score were edited by a Stratford administrator. Stratford team stats should be considered reference, while opponent player stats are unchanged.
Season-to-date AVG and ERA can be viewed in the Season Stats.
Note: Currently Fielding stats are not exported to MaxPreps; we hope to include this feature in the future.
|
http://www.gamechanger.io/game-4d51ad566f35de5e07001ffc/stats
| 2013-05-18T10:13:32 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Majestic_MastermindMember Since 13 Sep 2011
Offline Last Active Apr 16 2013 07:15 PM
About Me
My name is Lavontae. Have been making hiphop/r&b beats since 2004...started composing in 2011. All self-taught. Nothing is better than the feeling of creative flow. I love this. I do custom game composing work just email me majestic8390[at]gmail[dot]com with project details. Also head over to my website for royalty-free music
Community Stats
- Group Members
- Active Posts 92
- Profile Views 2,803
- Member Title Member
- Age Age Unknown
- Birthday Birthday Unknown
- Gender
Male
- LocationThe Moment..always
- Interestsmusic, movies, anime, video games, exercising/weightlifting, fun, life and meditation
Contact Information
- Website URL
197 Neutral
User Tools
Latest Visitors
- Moritz P.G. Katz
31 Jul 2012 - 09:40
- Stormynature
17 Jul 2012 - 00:49
|
http://www.gamedev.net/user/189019-majestic-mastermind/?tab=reputation&app_tab=gallery&type=received
| 2013-05-18T11:03:44 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Overview
- Critic & User
Reviews
- Videos &
Screenshots
News
- Codes
& FAQs
- Gameplay
Controls
- Similar
Games
Answers
Bundles
Videos & Screenshots
Game Details
- Release Date 7/25/2008
- Publisher SNK
- Platform Wii
-. With so many options, you definitely won't get bored!
Critic Reviews
IGN Review (7.2 out of 10)
Hey look, another compilation title from SNK. The company has been cranking out collections as of late and delivering a lot of old Neo Geo titles to modern gamers. Now, SNK Arcade Classics Vol. 1 (originally on the PS2 and PSP) throws sixteen old Neo Geo titles onto one disc. "16" seems like a pret...more
User Reviews
Average Member Rating: 5.3 out of 10
"SNK Classics": Nostalgia goes only so far. (5 out of 10)
posted by JMichaud (BETHESDA, MD) on Aug 2, 2008
Member since Jan 2008
3 out of 4 gamers (75%) found this review helpful
Member since Jan 2008
3 out of 4 gamers (75%) found this review helpful
SNK Arcade Classics Volume One takes some of you back to the arcade games between 1990 and 1996. The rest will take a good look at what games look back eleven to seventeen years ago. This collection has 16 games (which is a lot of games), including favorites such as Samurai Showdown, Metal Slug, and...more
View All Critic & User Reviews
Specs & Requirements
Modes Arcade
Controllers Nunchuk Controller, Wii Classic Controller
|
http://www.gamefly.com/Rent-SNK-Arcade-Classics-Volume-1/131790/
| 2013-05-18T10:53:04 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Rockstar North Ltd. (formerly DMA Design Ltd.) is a Scottish video game developer, best known for creating the Grand Theft Auto and Lemmings franchises in its earlier guise as DMA. The company is a part of Rockstar Games, owned by Take-Two Interactive. It is the primary developer of the Grand Theft Auto series, including Grand Theft Auto III, Grand Theft Auto: Vice City and Grand Theft Auto: San Andreas, which are three of the best-selling games on sixth-generation consoles, in addition to the best-selling Grand Theft Auto IV in the current generation of consoles.
- Date created: 09/16/2010
|
http://www.gamersbook.com/scene/developers/rockstar-north-ltd/about/
| 2013-05-18T10:53:31 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
BlazBlue: Calamity Trigger Portable News
- Square Enix's long-awaited multiplatform role-playing game arrives in stores alongside Yakuza 3, Resident Evil 5 Gold, and Dawn of War II: Chaos Rising.News - Posted Mar 7, 2010 4:53 pm GMT
- Aksys confirms portable edition of Arc Systems Works fighter scheduled for North American launch in March with new content.News - Posted Jan 16, 2010 12:13 am GMT
BlazBlue: Calamity Trigger Portable
- Publisher(s): Aksys Games
- Developer(s): Arc System Works
- Release:
- ESRB: T
Game Stats
Blazblue Portable Navigation
Games You May Like
- TRON: Evolution (PSP)
- Black Robinia (PSP)
- Dear Drops Distortion (PSP)
- Continuum Shift II (PSP)
- Gloria Union (PSP)
Users who looked at content for this game also looked at these games.
|
http://www.gamespot.com/blazblue-calamity-trigger-portable/news/platform/psp/
| 2013-05-18T10:32:56 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://dw.com.com/redir?tag=rbxirg.2.a.20&destUrl=http://image.gamespotcdn.net/b.gif",
null
]
] |
i am a bit late knowing the FF series. I think FF X and FF XII are the best series in the game. It's the only reason i still appreciate my PS2 console.
UK.
Chart uk_sales for date 2007-02-27 02:22:31
- Today's #1 GameFinal Fantasy XII
-
-
-
Final Fantasy is the only reason I have a PS2, haven't got XII yet but I'm still happily playing Wario Smooth Moves and Wii Sports so the PS2 is sitting unused for now.
Another reason that there are no FPS is that as most games are sold on the PS2... FPS's on PS2 suck harder than a $10 whore, the only decent one on there was..... was..... I'm struggling.... certainly wasn't Killzone....
Every country has its differing sales charts, preferences are varied but of course the mass charts do not account for everybody's taste within that region. Lots of folk in the UK (myself included) love fps games. The uneducated views of people from elsewhere are merely false assumptions !
[quote]FPS's never do good in UK. The violence tolerant level is lower there than in north america.[/quote] What?!?!?!?! FPS games do very well in the UK and the only reason none are in the top 10 is because the FPS market has been dry for so long. Wait until Stalker comes out, that'll go straight to the top.
gd gd final fantasy beats the rest and rightly so ..fifa 07 good.. evolution soccer 6 nice to see still there... sega megadrive collection i was expecting at no.2 but fair enough ... and mario still hanging in there.. nice collection of games in the charts this week
'Violence tolerance is lower there'?. Have you ever actually been or met anyone from the UK?. I'd love to see some proof to back-up such a ridiculous claim. FPS's don't sell well in the UK because most of the time they're only released on PC's and PC gaming in the UK is fringe at the extreme (with the exception of the sims franchise). I also don't believe that Crackdown sold because of the Halo 3 beta. I believe it sold because of over-rated media hype and the fact that since the (middling-success) title of Lost Planet there really hasn't been any significant releases on the console since November (GoW).
I dont see what the big deal is with all those final fantasy games. They are all the same and I find them all very boring. On another note it is true that Crackdown will sell well just because of the Halo 3 demo. That is one smart move by Microsoft. I cant wait until Halo 3 come out!
final fantasy 12 is cool, but i cant seem to get into it as i used to with rpgs. and the only reason crackdown sold so high is cuz the halo 3 demo...cant wait till that comes out
FPS's never do good in UK. The violence tolerant level is lower there than in north america. Props to square enix, for making such a sick game.
Yes well done to all the clever Final Fantasy players. I spend most of my free time on it at the moment. Today is the only day I haven't played it, I can feel my hand moving to the controller now... I am level 25, wasted loads of LP :( My only criticism of the whole game is when epensive gambit slots appear on the licence board getting in the way of progress. I really don't need them! Lol @ the Tomato Bandit guy, when I first got to that bit I tried to kill the T-rex thing as well. I hit it and saw it take off 0 damage, I ran like hell but it killed me. Annoyingly I hadn't yet saved it so I had to start from the beginning.
I Bought this game, its awesome. I have bought nearly all of the FFX Games on the PS2 and they have all been fun to play. So far im on the part i have to go out side the city to destroy the Tomoto Bandit lol. :D
I salute each and every person responsible for getting FF12 to the top spot. *salutes* I made sure I bought it on day of release, and haven't stopped playing it since.
I don't think there was quite this much hate for Sony when the PS2 came out though, the competition was Dreamcast who'd sort of made all the mistakes that Sony are making now.... Sega were fond of quoting "up to 6 billion players" and then didn't release a decent on line game for over a year, Sony has just dumped rumble, backward compatability, Dualshock pads that everyone loved, and added a huge price tag and a blu-ray player that not everyone wants.
ragrdoll21 said . "------ yeah i agree but things were differet then, ps2 didn't have any real competition. xbox didn't come untill later and when it did it was more expensive and had far fewer games on it while the gamecube..........well it was a gamecube. now however the tables have turned and sony really need to get their act together and stop hoping that customers are still going to buy their console despite their common sense and rattional thinking telling them otherwise. sony actually have to work to be successfull this time around, both the 360 and the wii are amazing machines.
[This message was deleted at the request of the original poster]
.
i loved Bad Boys 1
"PS3 will never replace the PS2" Remember people saying that about the PS1 when the PS2 was launched, boy were they wrong.
PS3 can never replace the PS2 because the attitude Sony has now is different and that is causing a negative effect. Haters have increased, websites are taking the mic, websites are constantly posting bad info after bad info etc. Never happened to the PS2.
kavadias1981 ''The PS3 will never replace the PS2. Just look at the charts for chrissake!'' Yep, Sony sure have the long term intention of investing more in the PS2 than the PS3 to keep it alive for longer don't they ?
Final Fantasy has made a triumphant come back after the disappointing Final Fantasy 10 and 11. It's so streamlined and accessible to play, great to look at and the voice acting is a lot stronger too. Finally, the UK chart is representing our taste in games. I would love to see the back of FIFA, Need For Speed and The Sims for good but thats not going to happen any time soon :(. It's good to see Sega Mega Drive Collection in the top ten still as well as New Super Mario Bros but the chart is missing a few titles. I would like to know the position of Okami and where it stands in sales as well as Gears Of War. :D But finally, the charts are finally looking like they should do!
By random battles I meant that you can be running along a road nicely and suddenly you find yourself in a battle against 1,2,3,etc creatures that appear as if from nowhere. I did not mean fighting against something on a different screen or whether the outcome was random. It always annoys when you can be travelling from place to place and the game decides you have to fight now, if you run away from the battle 20-30 seconds has passed, so you run away and carry on your journey for another few seconds and wallop... another battle. So despite travelling over clear plains or an empty road suddenly there are creatures around that want a scrap. I've lost count of the number of times travelling from one village or location to another takes 30 minutes because the game decides you should have a scrap.
For those who do not know in FF XII you can see the monster and you fight on the same screen so if u get into a fight u can run away with no hassle IT IS NOT RANDOM thoughg the place where the monster summon and how many are in that spot is random.
TTDog, no it does not have random battles...
Had heard that the story is FF12 falls away a little, due to the bloke in charge of the story itself leaving halfway through development to work on Blue Dragon. I'm assuming FF12 still includes the "Random Battle" element that has put me off playing them too much in the past.
I might pick final fantasy xii
I knew it would sell well, its a great game. Wonder how well it went in Australia.
Good to see that Final Fantasy XII is being recieved so well in the UK.
Only one game in that list deserved to be there, and it got the top spot too. Nice going Square Enix.
Go Final Fantasy XII!
Bad Boys 2? They just got that game now?
yes Crackdown does come with halo3 mp beta over here however i didn't think crackdown was an amazing game it had a really good idea but i just found it a bit boring with no storyline. i can totally see why FF XII outsold crackdown its a better game plus there are still probably at least 10 ps2s to every 360 so the install base is huge. i don't think it was ever going to be the other way round.
this just proves that no matter how good the graphics and no matter how many explosions in however high definition, a good story is always going to sell the games. FF XII is just a very well done overall package.
Bad Boys 2 in the top ten?????? What's really going on in the UK?
FFXII beat Crackdown and FIFA? Guess the stereotype of soccer (football)being above all else only goes for part of the year. One question that I do have though is did the Crackdown come with Halo 3 multiplayer tryout like here? Also, Bad Boys in the top 10? How does that work?
BAD BOYS 2???
No Gears? Thats surprising.
Great to see Final Fantasy atop the charts. Also, how on earth can anyone call Final Fantasy chav-like? I mean, are the fanboys THAT deluded and they would convince themselves that FF appeals to chavs and that's the only way it could top the charts? Please, you people are sad. Final Fantasy topped that chart because it is a great game.
I'm really glad FFXII is being received well, despite all the flak it's been receiving about it's licence/gambit system, and well the game itself. I know that Dirge of Cerberus tanked, but I really hope that this game joins its predecessors (all ps1 ff games from seven (i think it starts with 7) on is in the top ten for the ps1 ranks. How mad is that?) in the halls of glory. And it's nice to note that today its 19 out of all the games in the database... makes me feel all warm and fuzzy inside, even though I had a few reservations about it. Keep it up Square, because I'm gettin my ps3 just for XIII and versus!
bad boys!!!!!! woooooooooo!!!
I see crackdown dropping way down after this week. All of my friends bought crackdown because they were too late signing up on-line. Now the freaking game is collecting dust.
Bad Boys 2? Lol, that game is old and has been for sale brand new for $9.99 since it came out. I'm glad FFXII is number #1, I'm sick of seeing Gears at number all theII
- Publisher(s): Square Enix
- Genre: Role-Playing
- Release:
- ESRB: T
|
http://www.gamespot.com/news/uk-game-charts-february-18-24-6166461
| 2013-05-18T11:04:14 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
The new trailer for Transformers: Fall of Cybertron certainly isn't one of those irritating clips where you get half the story in 90 seconds. Like the game, this video jumps straight into the action at the conclusion of the predecessor - so if you can discern much from the clip other than “badass giant robots are giant and badass,” more power to you indeed. Well, there's also the strong implication that the game will have plenty of varied robot-annihilation and look just fine while doing it, which is always nice – and the clip's most useful fact, an August 28 release date for the game.
If this video's left you with a few blank spots re: Fall of Cybertron, we've 15 things you need to know about the title. When we saw the last Transformers: Fall of Cybertron trailer deconstructed by director Dave Tieger, he promised the game would take pains to have you caring deeply about giant brawling heaps of metal: does this clip bring a lump to your throat, or will you be requiring a little more persuading?
ObliqueZombie - March 29, 2012 1:24 p.m.
codystovall - March 28, 2012 4:56 p.m.
tomthespesh - March 28, 2012 4:18 p.m.
MasterBhater - March 28, 2012 4:15 p.m.
Showing 1-6 of 6 comments
Log in using Facebook to share comments, games, status update and other activity easily with your Facebook feed.
|
http://www.gamesradar.com/transformers-fall-cybertron-trailer-reveals-mid-2012-release-date/
| 2013-05-18T10:22:34 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Marvel Avengers: Battle For Earth Review
In recent months, it’s been more apparent than ever that popular culture is hell bent on eating itself
In recent months, it’s been more apparent than ever that popular culture is hell bent on eating itself. It’s a never-ending glut of movies based on toys, toys based on books, books based on TV shows and games based on all of the above. Movie game tie-ins are often derided as the most soulless of this sorry bunch, and while Marvel Avengers: Battle for Earth doesn’t entirely fly in the face of preconceptions, it at least attempts to. That’s got to count for something when it could have just contented itself as the next in line to an endless procession of bloated and bland gaming cash cows.
Though created to tie in with the film franchise, Battle for Earth takes the majority of its cues directly from the comic books, specifically the 2008 ‘Secret Invasion’ story arc by Brian Michael Bendis and Leinil Yu. Using Kinect’s motion-based controls, players can control up to 20 characters from the Marvel universe as they try to halt a global invasion by shape-shifting alien race, the Skrull. Disguised Skrull sleeper agents have also infiltrated the ranks of Earth’s mightiest heroes, a premise that gives this brightly coloured brawler the perfect excuse to pit good guys against other good guys and the bad guys against, well, everyone.
Though the game clearly has respect and affection for the source material, the campaign mode isn’t afforded much in the way of a story. Despite the wealth of inspiration to draw from, only a few still comic book panels and lines of voiceover tie stages very loosely together. The main attraction is the core gesture-based combat, and luckily there are plenty of additional modes to complete, a versus and co-op feature that allows you to play with or against friends, and costumes and collector’s cards to unlock. The fighting itself is surprisingly satisfying at first. Each character has three unique moves that can be strung together to create combos, and performing these will fill a Special gauge that can then be used to initiate breakers and powerful Ultra moves.
There are some nice touches, such as shouting character-specific phrases during an Ultra sequence to receive damage boosts, but the problem that quickly becomes apparent is that the heroes are essentially tactically identical, with any complexity in their unique actions and Kinect’s ability to recognise them providing the only real variation and challenge in the entire experience. Having so few unique attacks per character simply highlights this issue, and though individual matches are well paced, the campaign soon becomes a tiresome, repetitive and gimmicky slog. There are plenty of good ideas in Battle For Earth, but it’s clear that it has been restricted in what it can offer and ultimately accomplish by its very nature as a motion-based fighter.
Though an overall shallow affair, Marvel Avengers: Battle For Earth displays lot more polish, flair and finesse than your average movie tie-in title, but like those Skrull impostors, it can’t escape its true, uglier nature for too long.
|
http://www.gamestm.co.uk/reviews/marvel-avengers-battle-for-earth-review/
| 2013-05-18T10:41:49 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
NewsNews
League of Legends changes Champion pricing and release schedule; 7800 IP Tier added
Today on the League of Legends site, Riot employee Hippalus discussed their company plans for changes to IP/RP prices and the champion release schedule. There's some big changes coming -- specifically to champion pricing, which will now have tiers where older champions will go down in price whenever a new champion is released. But lets start at the beginning...
Over the past few months, the rate of releasing champions has slowed. For 2013, Riot's goal is to release 14-17 new champions -- around one every three to four weeks. This not only gives their design team more time to polish each new champion, but it gives you more time to save IP in-between champion releases. That's good, because Riot is adding IP and RP price tiers, including a new 7800 IP tier. The tiers are:
To help you understand, there will be a price reduction schedule that Riot is implementing. All brand-new champions will cost 7800 IP/975 RP for the first week only, and will then be reduced to 6300 IP. This should help with everyone buying a new champion and dodging when they don't get to play it. Every time a new champion is released, the oldest 6300 IP/975 RP champion will be reduced to 4800 IP/880 RP -- the next lowest tier. In addition, with every third champion release, an additional champion currently priced at 4800 IP or lower will be reduced to the next lowest tier, based on age and ease of play.
Did you get all that?
To make it easier, Riot provided a Tl;dr:
In addition to all of this, the seven oldest 6300 IP champions are getting an immediate price reduction. These champions are Ezreal, Vladimir, Renekton, Nocturne, Lee Sin, Brand and Vayne. They are all reduced to 4800 IP/880 RP. If you bought these champions in the two weeks prior to today, Riot will automatically refund the difference for you.
I think the new changes are great. In fact, they're amazing, and the 7800 IP tier is genius for the first week. This is how you help deal with overpopulation of a champion at release.
You can follow Senior Editor Lance Liebl on Twitter @Lance_GZ. He likes talking sports, video games, movies, and the stupidity of celebrities. Email at [email protected]
[Source: League of Legends]
|
http://www.gamezone.com/news/2012/12/20/league-of-legends-changes-champion-pricing-and-release-schedule-7800-ip-tier-added
| 2013-05-18T10:42:45 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://download.gamezone.com/uploads/image/data/1131903/IP_Price_Tiers.jpg",
"League of Legends IP RP price tiers"
],
[
"http://download.gamezone.com/uploads/image/data/1131904/tldr_price_schedule.jpg",
"tl;dr league of legends price reduction schedule"
]
] |
NewsNews
Oddworld developer Just Add Water is making a game for PlayStation 4
The company that developed Stranger's Wrath and Munch's Oddysee is working on a PlayStation 4 game.
"By now you’ll have eagerly lapped up all the information from the Sony PlayStation announcement," a representative wrote on Just Add Water's blog. ."
The developer is planning a real-time strategy game called Oddworld: Hand of Odd and a remake titled Oddworld: Abe's Oddysee New N' Tasty! although it's uncertain whether either of these is headed to the PS4.
[via Game Informer]
Page 1
|
http://www.gamezone.com/news/2013/02/22/oddworld-developer-just-add-water-is-making-a-game-for-playstation-4
| 2013-05-18T10:13:18 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
ReviewsReviews
Okamiden Review
Some games don’t get sequels, no matter how patiently we wait. We didn’t get another ICO, we didn’t get another Final Fantasy VII (though many of us are still hoping for a remake), and after playing Okamiden, the long-awaited handheld offshoot to one of Capcom’s most remarkable properties, gamers will find themselves waiting some more.
That’s not to say that Okamiden isn’t a good game. This handheld iteration is, if nothing else, amusing. But the overall package—the good, the bad, and the seriously ugly—is not as impressive as it might have been seven years ago when the Nintendo DS first came out.
For those who have barely touched their DS, this may not be much of a problem. Like the PS2 and Nintendo Wii original, Okamiden provides the player with complete access to a paintbrush tool (called the Celestial Brush) that can be used to color the world. But instead of spray-painting walls (as in Jet Set Radio), revitalizing decayed environments (as in Epic Mickey), or removing sludge/paint from the islands of Super Mario Sunshine, Okamiden allows you to attack, influence, and enhance the world with the simple stroke of a paintbrush.
Or, more specifically, the simple stroke of a finger or stylus across the bottom screen of the DS. This gameplay element makes Okamiden instantly cool, charismatic, and unmistakably irresistible. If you've never experienced anything like this before, you'll be won over for hours.
However, if you have played a game like this before (namely Okami, but either of the handheld Zelda games will do), Okamiden might come across as more of a chore than a work of art to be cherished.
In theory, the gameplay is remarkable. Players control a lone wolf, Chibiterasu, who just happens to be the descendant of Amaterasu. He’s quick, loyal, and has been placed in a world with a more immerse camera than The Legend of Zelda: Phantom Hourglass. The camera is low and pleasantly angled behind Okamiden. But while it's possible to swing the camera around in games like N64 and Nintendo DS versions of the fifteen-year-old Mario 64, for example, there is no such feature available in Okamiden. Thus, when it’s time to backtrack, players will have to endure a stiff camera that makes it appear as if our four-legged friend is running toward the screen. Unfortunately, backtracking is as common in this game as lawsuits are at Activision, so you’ll be running toward the screen a lot.
But wait—now I need to backtrack. I was about to tell you why the gameplay was theoretically remarkable.
As with the N64, GameCube and Nintendo Wii versions of The Legend of Zelda, Okamiden allows you to battle in a world that’s wholly immerse and entirely in 3D. Jump, dodge enemies, launch simple combo attacks—all the staples of a good action/RPG are here. It’s very impressive to see these features, no matter how trivial, in a Nintendo DS game. The cel-shaded art style, which attempts to mimic the beauty of Okami, is even more impressive. Granted, Okamiden completely fails in this regard (the jagged edges and generic cartoon effects have been seen on the DS before). But this is old hardware, and you can tell that the developers put their hearts and souls into making the game look its best. If you haven’t played some of the system’s finer titles, Okamiden should qualify as a very beautiful game.
It seems that I have gotten sidetracked once more. Now I must backtrack to the gameplay, which, according to mathematical calculations that have yet to be proven (aka a “theory”), should be downright spellbinding. So why isn’t it?
Okamiden’s developers (like most other developers) confuse backtracking and rehashing with gameplay length. Have you ever noticed that the longer an RPG is, the more you have to backtrack? Meanwhile, short action games tend to feature very few moments where you have to retread old environments. This is not a coincidence, and it's a glaring flaw that severely detracts from Okamiden’s potential and appeal.
It is not uncommon for players to go out of their way to step on a switch, only to walk back several steps (or feet) to flip another switch, and then be forced to return to the first one. We've done it before, and any interest that was once there is definitely gone by now.
Aside from the mission-specific moments, when a Crazy Taxi-style arrow is used to point us in the right direction, players are required to journey without any helpful hints. In a larger, more open-ended world, this might be acceptable. But Okamiden isn’t exactly a non-linear adventure. There are obstacles (physical and magical) that will keep players from wandering too far outside current path. The problem is, within these confines is a land full of boring characters that must be spoken to and tiring environments that must be revisited in order to trigger the next step.
Frankly, Okamiden is a game that should have done better. Yes, Okami had its share of repetitive moments, but it also featured one of the most compelling presentations of any game of its time. It was a unique alternative to Zelda. Okamiden is not.
If this review has advertised Okamiden as a bad offshoot, then it should be noted that my comments come more from disappointment than anything else. There are some players who will undoubtedly love Okamiden, either because the flaws (such as backtracking) are not as familiar or because they have the capacity to overlook its myriad mistakes. I wish I could do the same.
|
http://www.gamezone.com/reviews/2011/03/21/okamiden_review4
| 2013-05-18T10:45:25 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://cdni.gamezone.com/images/sized/images/screenshots/Okamiden_-_NDS_-_12-300x225.jpg",
null
],
[
"http://cdni.gamezone.com/images/sized/images/screenshots/Okamiden_-_NDS_-_1-300x225.jpg",
null
],
[
"http://cdni.gamezone.com/images/sized/images/screenshots/Okamiden_-_NDS_-_10-300x225.jpg",
null
],
[
"http://cdni.gamezone.com/images/sized/images/screenshots/Okamiden_-_NDS_-_6-300x225.jpg",
null
]
] |
de Blob 2 Impressions
Everyones favorite Blob comes splattering onto all major consoles this time around.. No, what's so weird is that the game alternates between being childishly charming and almost aggravatingly difficult.
In the original Wii exclusive a lot of this difficulty was due to the motion controls which, while not badly done, complicated matters just enough to really screw you up at the worst of times. But the level design in this game is so deceptively simple that the game is an absolute terror if you aren't incredibly patient and navigating carefully. But the core of the gameplay has been much tightened up since the last game, making the process of playing this game much less hair pulling.
Of course some of this is probably helped by the fact that the game is being released on the Xbox 360 and PS3. For those of us that just aren't very good at using the motion controls this comes as quite the blessing although there are sure to be Wii fans (if those still exist) that will cry foul at the loss of a console exclusive. The non-Wii versions are quite responsive thanks to all the actions being mapped to controller inputs allowing for rapid, easy movement around the levels although we weren't able to test out a Wii controlled version of the title sadly.
Everything has improved in de Blob 2 over the first one. The missions are more expansive, the game is more challenging and there are varied obstacles to deal with. With the painting being just as engaging as in the previous title this is more or less a must own for anyone who was a fan of the previous entry.
Climbing the various towers in the demo while defeating the "cops" that were trying to stop us, avoiding the water (which washes away all of your paint) and trying to not accidentally break barrels containing black paint (which undoes your hard work) was quite the enjoyable little trial. The time limit is a pressing concern but not so much so that it feels oppressive, providing an impetus to move quickly but not punishing you if you fall short of perfection. Even when being forced to dodge water and enemies while mixing paints the objectives never become so obscure that you can't suss out what you're supposed to be doing.
Look for de Blob 2 to hit store shelves rather soon, splattering all over the place this February in all regions. Prepare to paint, smash and crash your way across the landscape when this title hits all major consoles, including the Nintendo DS.
|
http://www.gamingexcellence.com/ps3/games/de-blob-2/preview/20110206
| 2013-05-18T10:31:07 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Quote!
(March 05, 2012 01:18:00 AM)Zeruel Wrote: Already Pre-ordered Tales of Graces f, and will be getting it day one! Super psyched! I'll probably be killing a PS3 as I play that game to death.
Also can't wait to stick Disgaea 3 in my Vita. Never played the PS3 version so I'm excited for the port/upgraded one.
(March 05, 2012 12:26:10 PM)YouLovePatrick Wrote: I already own the PAL version of Xenoblade, but I'm going to buy the NA version for one of my friends to support localization efforts. Plus, Xenoblade is just that good.
Once I finish my New Game Plus playthrough on The Last Story I will probably pick up Graces f.
(March 05, 2012 02:42:42 PM)YouLovePatrick Wrote: Yeah, Disgaea 3 is sooo good. It is my favorite in the series.
I wish I had a Vita for the updated version...
|
http://www.gamingunion.net/forums/thread-11068-post-160392.html
| 2013-05-18T10:31:17 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Lebanon Restaurant Guide
Find Lebanon Connecticut Restaurants - Reviews, Coupons and More
Finding the best Lebanon Connecticut restaurants just got easier. No matter what you're in the mood for our Lebanon Restaurant Guide has you covered. Choose restaurants from the list below to read or write reviews, check out their menus, get coupons and more.
|
http://www.ganet.org/connecticut/lebanon-restaurants
| 2013-05-18T10:32:33 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Vermont Insurance Agents
Find a Local Insurance Agent in Vermont
Choosing the best Vermont insurance agent is not always an easy choice to make. That is why we provide consumers with a comprehensive search directory of independent Vermont insurance agents that includes life insurance agents, health insurance agents, auto insurance agents and many more. Get started now - choose a city below to get company and contact info for local insurance agents in Vermont.
B
S
|
http://www.ganet.org/insurance-agents/vermont/
| 2013-05-18T10:13:40 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Occoquan Home Phone Service
Find Local Phone Service Providers in Occoquan, VA
Looking for cheap home phone service in Occoquan, VA? Then you've come to the right place. Use our comprehensive directory of Occoquan home phone service providers to find all of the best home phone deals available in your city. Browse the list below to locate local phone service providers, read reviews and compare plans to get the best offer on home phone services in your area.
|
http://www.ganet.org/virginia/occoquan-home-phone-service
| 2013-05-18T10:21:27 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
In the Garden:
Middle South
July, 2003
Regional Report
Tender baby zucchini deserve to be gathered daily, preferably early in the morning when they are at their best.
Those Crazy Cucurbits
The season is here for following the zucchini diet, which involves eating them for breakfast, lunch, and dinner. But zukes aren't alone in showing their zest for life. There are butternuts tumbling out of my compost, cucumbers rambling beneath my tomatoes, and it's time to plant pumpkins, too. Cucurbits love the summer garden, so it only makes sense to love them back.
Planting Replacements
Whether they are zucchinis, yellow crooknecks, pattypans, or acorns, the summer squash that are filling your harvest basket now won't last forever. Squash borers often take the plants down, or they may simply exhaust themselves. This being the case, why not sow some more plants for late-season harvest? I like to start a few seeds indoors and set them out in late July or early August.
Research from the University of Georgia shows that young summer squash plants, less than three weeks old, produce just as well as direct-seeded crops. And starting seeds indoors often is simpler than keeping them adequately supplied with water in the garden.
Pretty Pumpkins
If you want to grow some pumpkins for fall harvest, there's an easy way to get the plants up and growing. Prepare a furrow for the seeds, dampen it well, lay in a few seeds, and then cover them with an inch of compost or potting soil. Then cover the seeded area with a board for a few days. Because the soil atop the seeds is not watered, it will not form a crust, and the seedlings should pop right through as soon as you remove the board.
Use newspapers or old cardboard to mulch around your pumpkins. Between the paper mulch and the plants' large leaves, weeds will be kept in check. I like to grow small-fruited pumpkins like 'Baby Bear', which produce lots of fruits and require less care than varieties that produce huge fruits.
Care to share your gardening thoughts, insights, triumphs, or disappointments with your fellow gardening enthusiasts? Join the lively discussions on our FaceBook page and receive free daily tips!
|
http://www.garden.org/regional/report/arch/inmygarden/1079
| 2013-05-18T10:42:26 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"/images/App/regional/regionimages/1079.jpg",
"1079"
]
] |
In the Garden:
Northern & Central Midwest
October, 2011
Regional Report
This bed of fall greens is simply awaiting its portable cold frame.
Planting Fall Crops
The cold weather is coming on fast, and I can't stand the idea of giving up my Swiss chard, mustard greens, and lettuce that are thriving right now. So I'm hauling out the cold frame. I still have some small Chinese cabbages and endive also, so I'm going to protect them and see how they go through the winter.
Plant Greens Now and Again in February
Although some gardeners swear they can keep salad greens growing in a cold frame all winter, we can't grow much past end of November in our area since the days are too short to store up enough heat. However, we can start again in mid-to-late February for the early spring greens.
Cold Frame Worth the Effort
I'm always on the lookout for ways to push both ends of the gardening season, and I've had pretty good luck with cold frames. Even if an occasional plant is lost to frost, succulent greens for salad in late fall make a cold frame well worth the extra gardening effort.
Portable Cold Frames Easy to Move
I bought a used cold frame last spring, and it is very portable. I can pop it over anything I want to save. It was built out of plywood with rails to hold two storm window panels and is quite sturdy. I plan to leave it in the garden over the winter. I'm sowing lettuce, mustard, and mixed Asian greens in flats to put in the cold frame. I've left enough room to put in jugs of warm water on the coldest nights, and I plan to bank the sides with bales of straw. I know the greens will not get to full size, but as long as they grow somewhat, I can cut them for a tender salad or stir fry.
Cloches and Bell Jars Work on a Smaller Scale
If you don't have a cold frame, you can use smaller scale season extenders such as cloches and hotcaps. These are bottles or caps to slip over individual plants that allow you to extend the growing season three or four weeks on each end. Traditional cloches such as the beautiful bell jars of French intensive gardening are quite expensive, so it usually makes more sense to use the plastic or paper ones that are readily available commercially or to recycle your own milk jugs.
Disposable Covers
You can purchase simple plastic covers that are meant to be discarded after the season is over or more elaborate ones such as the plastic sleeves with water-filled tubes that surround the plant with insulation, called Wall-O-Water. I also used my Wall-O-Waters last spring to protect my tomatoes from the late cold snap we had.
With a little extra effort, you really can have fresh greens for the Thanksgiving table and perhaps even for the December holidays. Besides, what can it hurt? It's only seeds.
Care to share your gardening thoughts, insights, triumphs, or disappointments with your fellow gardening enthusiasts? Join the lively discussions on our FaceBook page and receive free daily tips!
|
http://www.garden.org/regional/report/arch/inmygarden/3932
| 2013-05-18T11:02:26 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"/images/App/regional/regionimages/3932.jpg",
"3932"
]
] |
Register with us or sign in
hi tinker, hope the dog recovers soon, has it eaten something it doesn't normally
Hi guys, great final of scd thoroughly enjoyed that, a good evenings entertainment, thought the final three all deserved their places and couldn't call the result after the final dances, Hi Jean that jasmine is so close to flowering, as brucie would say keep on misting.
Afternoon forkers "big shop" done, Ouch££££!. Great tree Dean, love the dolls Bjay, very festive conservatory jean, Haven't a clue on the choccie so will guess snowflake , spent a few hours this morning doing the nearest I get to cooking which was starting off some homebrew, if all goes well 5 gallons of fine irish stout will be ready to enjoy sitting out on those long warm summer evenings next year. (I know but we can all dream).
I always lose my car Jo, I'm partially colour blind which doesn't help so an RNLI pennant adorns it's aerial. Looking forward to relaxing watching SCD
sounds lovely, my dream is to move to somewhere more rural, Sadly the wildlife where I am tend to wear hoodies.
if there on your pc click on the oak tree symbol, this should guide you thro finding and uploading them into your post
Aye funny things animals, we don't often associate them with having feelings or emotions but I know from the dogs I've been fortunate enough to have that they definitely do, they have a sense which knows when your coming home, when your sad etc, my old german shepherd supposedly a big tough dog would cry and howl like a baby when I went to work, I used to joke with the missus that she loved me more than she did . I fear were maybe getting a bit morose and apologies if I've been party to that but that story did upset me so as I've now finished work for christmas let's lighten the mood who's organized, zippy has a tree in a plastic bag, Jo or at least I think it's jo has three rings on her hob and were off tommorrow for the "big shop" ouch I fear my wallet will take a bashing.
Just read the story about the poor dog in China, staying with its mate how touching is that, brought a tear to my eye,
Hi Guys, nice to be back in the warmth, just drying out as I have been absolutely soaked through today, It's not stopped here today, some more wonderful trees and decorations on show well done everyone, noted the comment on the coke truck which made me smile as we always think christmas has arrived when that advert is shown, the truck was given to me a few years back by someone who has sadly passed away now and I've never seen another like it, it has flashing lights all over the trailer and has become a cherished part of our decorations. Off for some tea and a noggin of something warming.
Thanks verdun, I'll hopefully try this out too, thanks for the advice.
|
http://www.gardenersworld.com/members/norm2/chat/page/2/
| 2013-05-18T10:32:42 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
...
Learn how to improve the condition of your soil by sowing rye seeds to create green manure, with Monty Don's video demonstration and advice.summer and autumnMore advice on improving soilHow to mulch beds and bordersFeeding plantsImproving soilMaking a soil sieve.
|
http://www.gardenersworld.com/search/articles/-/keywords/veg-plot/author/gardeners-world/date/more-than-12-months/
| 2013-05-18T10:43:04 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
You may have chosen not to accept the Garth's Auctions, Inc. - Auctioneers & Appraisers cookie. Parts of this site will not work correctly unless you accept the cookie.
Please adjust your browsers cookie settings and select an option from the menu.
The Garth's Auctions, Inc. - Auctioneers & Appraisers.
N.B. Where websites are accessible via more than one URL please make sure you are accessing our site at, not simply garths.com, as accessing the site without "www" can also cause this problem.
|
http://www.garths.com/asp/cookiecheck.asp?script=schedule.asp&t=751033
| 2013-05-18T10:41:38 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
[Become A Member]
Twitter
Gas Prices
Price Charts
Gas Price Maps
Points & Prizes
Mobile Apps
Media
Gas Price Report
Media Inquiries
Recent Blog Posts
Control your business' fuel costs
Get paid when fuel prices increase
Texas Gas Prices
Please Select Your Location Below
Texas Gas Prices
- Find the lowest gas prices at TexasGasPrices.com
Amarillo Gas Prices
- Find the lowest gas prices at AmarilloGasPrices.com
Austin Gas Prices
- Find the lowest gas prices at AustinGasPrices.com
College Station Gas Prices
- Find the lowest gas prices at CollegeStationGasPrices.com
Corpus Christi Gas Prices
- Find the lowest gas prices at CorpusChristiGasPrices.com
Dallas Gas Prices
- Find the lowest gas prices at DallasGasPrices.com
El Paso Gas Prices
- Find the lowest gas prices at ElPasoGasPrices.com
Fort Worth Gas Prices
- Find the lowest gas prices at FortWorthGasPrices.com
Houston Gas Prices
- Find the lowest gas prices at HoustonGasPrices.com
Laredo Gas Prices
- Find the lowest gas prices at LaredoGasPrices.com
Lubbock Gas Prices
- Find the lowest gas prices at LubbockGasPrices.com
Midland Odessa Gas Prices
- Find the lowest gas prices at MidlandOdessaGasPrices.com
Rio Grande Valley Gas Prices
- Find the lowest gas prices at RioGrandeValleyGasPrices.com
San Antonio Gas Prices
- Find the lowest gas prices at SanAntonioGasPrices.com
Waco Gas Prices
- Find the lowest gas prices at WacoGasPrices.com
Refugio County Gas Prices By City
Refugio
Woodsboro
Texas Gas Prices By County
Anderson County
Collingsworth County
Glasscock County
Kaufman County
Moore County
Somervell County
Andrews County
Colorado County
Goliad County
Kendall County
Morris County
Starr County
Angelina County
Comal County
Gonzales County
Kenedy County
Motley County
Stephens County
Aransas County
Comanche County
Gray County
Kent County
Nacogdoches County
Sterling County
Archer County
Concho County
Grayson County
Kerr County
Navarro County
Stonewall County
Armstrong County
Cooke County
Gregg County
Kimble County
Newton County
Sutton County
Atascosa County
Coryell County
Grimes County
King County
Nolan County
Swisher County
Austin County
Cottle County
Guadalupe County
Kinney County
Nueces County
Tarrant County
Bailey County
Crane County
Hale County
Kleberg County
Ochiltree County
Taylor County
Bandera County
Crockett County
Hall County
Knox County
Oldham County
Terrell County
Bastrop County
Crosby County
Hamilton County
La Salle County
Orange County
Terry County
Baylor County
Culberson County
Hansford County
Lamar County
Palo Pinto County
Throckmorton County
Bee County
Dallam County
Hardeman County
Lamb County
Panola County
Titus County
Bell County
Dallas County
Hardin County
Lampasas County
Parker County
Tom Green County
Bexar County
Dawson County
Harris County
Lavaca County
Parmer County
Travis County
Blanco County
Deaf Smith County
Harrison County
Lee County
Pecos County
Trinity County
Borden County
Delta County
Hartley County
Leon County
Polk County
Tyler County
Bosque County
Denton County
Haskell County
Liberty County
Potter County
Upshur County
Bowie County
DeWitt County
Hays County
Limestone County
Presidio County
Upton County
Brazoria County
Dickens County
Hemphill County
Lipscomb County
Rains County
Uvalde County
Brazos County
Dimmit County
Henderson County
Live Oak County
Randall County
Val Verde County
Brewster County
Donley County
Hidalgo County
Llano County
Reagan County
Van Zandt County
Briscoe County
Duval County
Hill County
Loving County
Real County
Victoria County
Brooks County
Eastland County
Hockley County
Lubbock County
Red River County
Walker County
Brown County
Ector County
Hood County
Lynn County
Reeves County
Waller County
Burleson County
Edwards County
Hopkins County
Madison County
Refugio County
Ward County
Burnet County
El Paso County
Houston County
Marion County
Roberts County
Washington County
Caldwell County
Ellis County
Howard County
Martin County
Robertson County
Webb County
Calhoun County
Erath County
Hudspeth County
Mason County
Rockwall County
Wharton County
Callahan County
Falls County
Hunt County
Matagorda County
Runnels County
Wheeler County
Cameron County
Fannin County
Hutchinson County
Maverick County
Rusk County
Wichita County
Camp County
Fayette County
Irion County
McCulloch County
Sabine County
Wilbarger County
Carson County
Fisher County
Jack County
McLennan County
San Augustine County
Willacy County
Cass County
Floyd County
Jackson County
McMullen County
San Jacinto County
Williamson County
Castro County
Foard County
Jasper County
Medina County
San Patricio County
Wilson County
Chambers County
Fort Bend County
Jeff Davis County
Menard County
San Saba County
Winkler County
Cherokee County
Franklin County
Jefferson County
Midland County
Schleicher County
Wise County
Childress County
Freestone County
Jim Hogg County
Milam County
Scurry County
Wood County
Clay County
Frio County
Jim Wells County
Mills County
Shackelford County
Yoakum County
Cochran County
Gaines County
Johnson County
Mitchell County
Shelby County
Young County
Coke County
Galveston County
Jones County
Montague County
Sherman County
Zapata County
Coleman County
Garza County
Karnes County
Montgomery County
Smith County
Zavala County
Collin County
Gillespie County
"Consumers working together to save on gas"
|
|
Disclaimer
|
Copyright © 2000-2013 GasBuddy Organization LLC. GasBuddy logos and related marks are registered trademarks. All rights reserved.
|
http://www.gasbuddy.com/Gas_Prices/Texas/Refugio/index.aspx
| 2013-05-18T10:52:19 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
You must earn 10,000 points to post other members' whiteboard
Congratulations on having the dedication to post for 300 consecutive days. Keep up the Great Work and Good Luck in the future! Want to become buddies??? Warren :-)
Congratulations on reaching 200 K points and getting your new purple car!
If you are on FB. Tony Malatesta / Winthrop Harbor
Congratulations on reaching 100 K points and getting your new blue car!
|
http://www.gasbuddy.com/Profile.aspx?member=jvg1206
| 2013-05-18T10:30:52 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Gastronomics.ie is a fully independent food and shopping blog, updated daily, bringing tips and hints on how to cook, eat and drink like a true recessionista. We are mother and daughter, catering for six people and two respectively, and in this blog we share our efforts to lower the grocery bills, while keeping the tummies satisfied! Have a look at the news section for some industry gossip, check out our recipes if you’re looking for inspiration, or have a look at our ‘weekly shop’ and ‘special offers’ menus to see how we’re saving the pennies this week. If you’ve got any tips or hints just drop us a line or leave a comment – we’d love to hear from you!
"The Recessionista Food Blog"
|
http://www.gastronomics.ie/tag/tesco/
| 2013-05-18T10:52:52 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Please Wait …
When writing reviews, share your personal experience. Offer details and tips that others will find helpful in either selecting or using a vendor.
Personal Experience: Please only share your firsthand personal experience, not what you've heard from others.
Accuracy: Make sure your review is factually correct. Reviews with factual errors may be removed. Feel free to air your opinions, but don't overstate or misrepresent your experience.
Business Owners: Business owners can address reviews by posting a reply. Replies shouldn't be used to launch personal attacks, advertise, or offer an incentive to change a review.
|
http://www.gatheringguide.com/event_directory/rc/ca_california/alameda/evl_caterers_catering.html
| 2013-05-18T10:33:58 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
suggestion on converting an outdoor cat to an indoor cat
#1
Posted 05 September 2012 - 08:52 PM
i won't keep it as an outdoor cat.
girl at work suggested finding where it's been going and bringing a sample home.
the only thing i can think of is some type of quarantine - no options situation.
#2
Posted 05 September 2012 - 08:57 PM
But, yeah, putting it in the box and scratching around a little is always the first step. Most cats are smart enough that they just get it, but if this has been an exclusively outdoor cat, then maybe it needs some coaching.
#3
Posted 05 September 2012 - 11:02 PM
maybe 4 - 6 weeks ago w/ one 1/2 + 1/2
#4
Posted 05 September 2012 - 11:25 PM
I tried it a couple of times and gave up, those bastards sat at my door meowing all night to go out, then to come in, then to go out......... It's not worth alcoholism and mental issues IMO, send the cat packing and start fresh.
Good luck
#5
Posted 06 September 2012 - 02:28 PM
so this morning i go to set up a barrier so the cat couldn't stay in the living area, didn't want any part of that - kept thorwing itself at the thing until it gave way - only to bolt outside when i went to leave.
the cat lady suggested keeping it in a dog pen until it figured out the whole box thing - wtf does everyonehove a spare dog pen laying around ?
anywho i think i've got something figured out, but if that lil f'r would just use the damn box, he'd get free run of the place.
#6
Posted 06 September 2012 - 04:26 PM
#7
Posted 06 September 2012 - 04:44 PM
prolly will change now that the food is inside
#8
Posted 06 September 2012 - 04:49 PM
#9
Posted 07 September 2012 - 05:03 AM
I actually do have one laying around, I was going to put it on Ebay soon, but if you need it, its yours! Its pretty big, could fit a medium sized dog, stands about 3ft high or so....
#10
Posted 07 September 2012 - 05:08 PM
i'm hoping to get it into the shelter by the time i leave for VA next week, and unless i give up my living room, i have no place for one indoors.
#11
Posted 07 September 2012 - 06:41 PM
#12
Posted 07 September 2012 - 07:25 PM
#13
Posted 19 September 2012 - 05:16 PM
not when i leave, not when i come home.
once i get to the top of the stairs i'll get a visit, but that's about it.
#14
Posted 20 September 2012 - 12:36 AM
#15
Posted 20 September 2012 - 12:38 PM
2 weeks later and he doesn't even go down the stairs anymore or try to get out.
not when i leave, not when i come home.
once i get to the top of the stairs i'll get a visit, but that's about it.
YAY
#16
Posted 20 September 2012 - 01:37 PM
2 weeks later and he doesn't even go down the stairs anymore or try to get out.
not when i leave, not when i come home.
once i get to the top of the stairs i'll get a visit, but that's about it.
Yay! So happy you and kitty and settled in
#17
Posted 20 September 2012 - 11:55 PM
does this mean you are keeping him, dave?
hope so...
if you can put something he can hang out on next to a window, so he can look outside and sunbathe, he would probably like that
they sell little hammocks that you can attach to the sill but just a chair and a pillow or towel works, too
maybe put some catnip nearby to encourage him to use it
if you have any kitty-poppa questions, post em and we can help!
#18
Posted 21 September 2012 - 03:28 PM
might be having some upper GI issues, but since i have no idea what his diet was - garbage/dry food/critters ?- hopefully they are just related to changes.
since he was out for so long, i was planning to go to the vet anyway - so i'll just move up the plan.
for now he had to go back into segregation -
#19
Posted 22 September 2012 - 11:00 AM
#20
Posted 22 September 2012 - 03:46 PM
i'm headed back out in a few hours, i'll see the results tomorrow
#21
Posted 22 September 2012 - 09:31 PM
and def, the transition from free-range food to other food can make them pukey...
also, if he sheds a lot, he can get hairballs from grooming which end up being puke torpedos
is he showing you affection yet?
i wanna see more pics
#22
Posted 23 September 2012 - 01:26 AM
Doesn't someone sell a converter for that?
that was my first thought
the second thought I had was that he needs some cool places to hang out, but apparently he found it.
There's this pretty cool show on Animal Planet called "My Cat From Hell." It's very interesting and informative... this cat behaviorist goes and helps people with their misbehaving cats.
Basically, cats just need lots of places to climb and hide and they like looking out the window.
If you play with the cat, you might see him more often. You could get one of those feather things on a string, or a laser... but I have mixed feelings on the laser. They love it but maybe a little too much. They seem to look for it long after you stop shining it... makes you feel bad.
I give mine catnip a lot... but for medical reasons
Oh and don't forget something to scratch on... otherwise it'll be something you love. They need to scratch for their nails.
#23
Posted 23 September 2012 - 04:35 PM
since day one - no problems petting, really likes getting brushed - not shedding, scrathes under the chin.
took to the scrathing post thing, chases the toys i put some treats in, has 2 wondow sills for looking out.
i also leave some treats on top of on old chest, on top of the scratch post or one of his hiding places.
not many just one or 2of those temptation things.
will be making vet appt tomorrow.
i met this guy years ago, helped w/ some strays and didn't charge my friend.
that seems like 100 years ago.
photos - will try, once i find the gdmf camera - maybe in the car, ????
i'm on the dl right now, jammed my left elbow preventing a fall - maybe the vet can check me out too ?
#24
Posted 23 September 2012 - 04:52 PM
I'm looking forward to pics.
sorry about your elbow
#25
Posted 23 September 2012 - 06:15 PM
hope your elbow feels better soon
i may just not remember reading it, but did you name him yet?
#26
Posted 24 September 2012 - 12:16 PM
Dr appt is 7:00 PM tonight
#27
Posted 25 September 2012 - 01:39 PM
cat does not like to get put in the box.
are taping up the almost destroyed box from the first 2 attepmts, i did manage to get him out to the car.
where it took the first oppertunity to bolt.
there was a slight chase around the inside if the car, no damage to dashboard etc.
I still went to the vets office and found out they have someone there between 8:00AM and midnight ,7 days a week.
"just bring him in when you can".
cat was a no show all last night - untill 10:00PM anyway
when i went to leave this morning it was 50 degrees out, and the cat was back in the apt as fast as he left the car yesterday.
getting a real carrier today or tomorrow, but i might wait a few days before i try that again.
i have a wake i need to get to tonight, and may need to see dr. about the elbow
update -
hard carrier secured,
#28
Posted 25 September 2012 - 08:40 PM
#29
Posted 26 September 2012 - 01:10 PM
i might try to find a way to spring load the door and make it into a cat trap to use when i'm home.
once the door closes, i can be at the vet in less than 5 min.
he's pretty much keeping his distance from me right now, so it might be a few days.
#30
Posted 26 September 2012 - 01:49 PM
Like nancy said, you have to outsmart them. Let them eat safely in there for a few days or so... leave the thing with the door open so he can go in and out as he pleases, and then on the day you bring him to the vet you shut the door when he least expects it.
That worked for Poncho. Sometimes it even seemed as if she enjoyed being inside the carrier. She'd just go in there and lay down.
#31
Posted 26 September 2012 - 02:38 PM
#32
Posted 26 September 2012 - 03:24 PM
this guy wants no part of any box i've ever put down, so hopefully it just hates cardboard boxes/trips in cardbaod boxes.
i will move the new one inside tonight and see what happens - maybe take off the door + put in some nip and treats.
#33
Posted 26 September 2012 - 03:41 PM
#34
Posted 27 September 2012 - 03:39 PM
the other problem seems to be friming / clearing up, but he is still going to the vet.
|
http://www.gatheringofthevibes.com/forum/topic/11319-suggestion-on-converting-an-outdoor-cat-to-an-indoor-cat/
| 2013-05-18T11:04:47 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://www.gatheringofthevibes.com/forum/uploads/profile/photo-thumb-376.jpg?_r=1366656323",
"Photo"
],
[
"http://memepics.com/wp-content/uploads/2011/03/business-cat-go-in-go-out-600x600.jpg",
"Posted Image"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Smilies/dunno.gif",
":dunno:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/smile.png",
":smile:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/jump.gif",
":jump:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/heart.gif",
":heart:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Smilies/drool.gif",
":drool:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/funny1.gif",
":funny1:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/heart.gif",
":heart:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/smile.png",
":smile:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/smile.png",
":smile:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/lol.gif",
":lol:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/2.gif",
";)"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/clapping.gif",
":clapping:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/heart.gif",
":heart:"
],
[
"http://www.petmate.com/wp-content/uploads/21806_dlx_vari_kennel_jr_small_peacock.jpg",
"Posted Image"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/funny1.gif",
":funny1:"
],
[
"http://www.gatheringofthevibes.com/forum/public/style_emoticons/default/Classics/huh.gif",
":huh:"
]
] |
UPVC SUPPLIERS LTD ESKVALE & CLEVELAND LEAGUE
LEALHOLM won 2-0 at Boosbeck and Lingdale United overwhelmed Great Ayton 11-4 as league teams met in the North Riding Challenge Cup.
Staithes enjoyed a huge 9-0 win at Scalby to join them in going through but Loftus and Stokesley bowed out of the competition.
Lealholm scored twice in two first half minutes to move into the third round, with Darren Harland adding to Phil Brown’s opening goal.
Lingdale had to come from behind to beat Great Ayton, but it was pretty much one-way traffic once they hit top gear.
Anthony Jones scored four times while Wayne Skelton and Andrew Smith both grabbed a brace.
Shane Breckon, Michael Woodhouse and Luke Johnson also got on the scoresheet.
Staithes also spread their goals around as they dominated at Scalby. Chris Harland scored twice and Joe Gibson, James Rice, Ryan Thompson, Gary Gilding, Steve Starsmore, Simon Bowes and Ryan Gibson all chipped in.
Loftus went out in a 4-2 home defeat to well-organised Amotherby and Swinton, while Stokesley lost 4-1 on penalties at Redcar Newmarket following a 2-2 draw.
Jordan Smith and Martin Say scored for Loftus as they went into the final 15 minutes on level terms before being picked off.
Stokesley led 2-1 at Redcar Newmarket with 20 minutes to go but conceded an 87th minute equaliser and lost on penalties.
Brotton Railway Arms beat visiting Hollybush United 2-1 and Goldsborough United were 4-3 winners at Hinderwell in two closely-contested league games.
|
http://www.gazettelive.co.uk/north-east-sport/football/local-teesside-football/2012/11/08/plenty-of-goals-in-north-riding-challenge-cup-ties-84229-32192008/
| 2013-05-18T10:53:31 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
G.
GazetteHS: RT @CoachSeanyMac: @GazetteHS Frontier wins 4-3 in 11th with RBI double
GazetteHS: Frontier-Taconic softball RT @CoachSeanyMac: @GazetteHS Top of the 11th.....3-3
kristinpalpini: @jcstearns digital first training, always a good topic!
mikemoranDHG: Jasper Adams done after 7. 4H, 2BB, 5Ks. Ithaca up 3-2
GazetteHS: EL beats Northampton softball 6-5 in 8 innings. Second straight tough loss for Hamp.
GazetteHS: Northampton ties it up on an RBI bloop single by Mary Greco to score Kristin Gross. Tied 5-5 after 6 with EL.
mikemoranDHG: How's this for a thoroughbred's name: Fiftyshadesofhay. Won Black-Eyed Susan today.
mikemoranDHG: Amherst's Fred Shepard done after 5-2/3. 6H, 3ER, 3BB, 1K. Amherst still trails Ithaca 3-2 but has runner at second in bottom of 6.
GazetteHS: Northampton gets two back on 2-run single by Rachel Sheehan. Trails EL 5-4 after 5.
GazetteHS: East Longmeadow with 2-run triple as part of 4 runs in the top of the 5th to take a 5-2 lead.
mikemoranDHG: Ithaca up 3-2 end of five. Shepard 6H, 3BB, 1K; Adams 2H, 3K, 1BB
GazetteHS: Both teams have had runners on in each inning but Northampton still leads EL 2-1 after 4 innings.
|
http://www.gazettenet.com/artsentertainment/calendar/event?ID=105679
| 2013-05-18T10:12:04 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Winter tonic for Gloucestershire stars (From Gazette Series)
Get involved: send your pictures, video, news and views by texting GS NEWS to 80360, or email
us
Gloucestershire Sport RSS Feed
Bracewell feels foreign shores will benefit Gloucestershire
10:00am Saturday 23rd February 2013 in Gloucestershire Sport By SNJ Sport
JOHN Bracewell is confident that all the Gloucestershire players who have spent this winter abroad will benefit from hugely positive experiences.
Some members of the squad, including newcomer Gareth Roderick and Paul Muchall, have already returned to England to begin pre-season training.
Others, such as Ed Young, Ian Cockbain and Jack Taylor, are continuing to enjoy success with their club sides in Australia and New Zealand.
Bracewell said: "Players are starting to head back from their various winters in the sun. Gareth Roderick arrived from South Africa this week and Paul Muchall has returned from New Zealand.
"James Fuller gets back from New Zealand next week so the squad is starting to build up, although some of the lads who have stayed at home are taking a short break before the start of pre-season."
The highlight of Young's winter has been a T20 century. He blasted 106 off just 49 balls for his club side in Adelaide, much to the delight of Gloucestershire's Director of Cricket.
Bracewell added: "It's good to see that Ed has taken the initiative to get more batting by putting himself up to the top of the order in club cricket in Australia.
"That means he is getting to face the new ball and his position in our team often requires him to face the second new ball, so that is valuable experience.
"Ed is also getting in a lot of bowling and at different stages in an innings. I think he opened the bowling in the same match as he made his T20 century.
"We knew he had it in him to play that sort of innings. It was whether he was prepared to let it out.
"He is a lovely clean striker of a cricket ball, but has tended to soak up a few balls getting in. Obviously he has taken the bowlers on from the word go to get his T20 ton and proved to himself that he can do it."
Elsewhere, Gloucestershire players have been helping their winter sides to successful campaigns with good individual performances.
"A number of guys are going into finals with their respective teams," said Bracewell.
"Ian Cockbain got a hundred a couple of weeks back opening the batting for his club side, which was pleasing.
"It looks as though both Jack Taylor and Benny Howell are going to reach finals with their teams, which, while it might delay them coming back, will ensure they are involved in very competitive cricket right to the end of their winter trips.
"We want the ones not involved in finals back as soon as possible now and, whatever happens, none of the players currently abroad will miss any games at the start of our season.
"James Fuller's winter in New Zealand offered the bonus of being picked for Otago's T20 squad and, although we had to pull him from some games recently because of a knee problem, it was really no more than a precaution. "He also managed to get in a first class game and record his first ten-wicket haul in a game, which is great for his confidence."
|
http://www.gazetteseries.co.uk/sport/gloucestershiresport/10246980.Winter_tonic_for_Gloucestershire_stars/?ref=rss
| 2013-05-18T10:42:27 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Archivist preserves her place
Katherine Demrow
Age: 83
Community: Rural Janesville
Occupation: Retired
Family: Husband of 60 years, Ken Demrow; son, Steven Demrow, 59, of Algonquin, Ill.; daughter, Sharon Clark, 52, of rural Orfordville; and another son, the late William "Bill" Demrow
Hobbies: Golf
Books: Histories of the area written by others, including friends
Philosophy on life: If you're going to do something, do it well, not halfway.
Podcast Episode
JANESVILLE If Kay Demrow isn't at the Luther Valley Historical Society archiving or researching history, she's most likely in her home office doing the same thing.
"It keeps me busy and fills my life up a little bit more with meaning. I don't want to die in a rocking chair doing absolutely nothing," she said.
Odds are that won't happen.
Demrow is archivist, treasurer, newsletter editor and speaker for the society. During the past two years, she has volunteered 2,050 hours and logged more than 10,000 miles traveling between her rural Janesville home and the society in Footville.
Genealogies of Demrow's and her husband's families fill glass-encased bookshelves in their home office. On a card table and on other shelves, between her and her husband's desks and computers, are more historical census records, plat maps, diaries, church, town and cemetery records. She is working on them or already has indexed, transcribed, researched, organized and compiled them into booklets and books.
"The amount of her volunteer time is phenomenal. She is tireless, dedicated, driven and modest," said Margie Douglas Boylen, society president.
Demrow, who has survived two knee replacements and breast cancer and endured the deaths of a son and grandson, is direct. She also is hard working, a trait that was instilled in her at a young age as the oldest of five siblings growing up on the family farm.
After retiring and helping her father chart his family genealogy, Demrow got interested in history and began volunteering in 1991 at the society. Since then, the group's membership has grown from five to 200 members, she said.
Although her time spent collecting and preserving the history of Southwestern Wisconsin benefits others, it also fills an emptiness for Demrow since her son killed himself.
"That's one of the reasons why I do history—to keep my mind occupied," she said as tears pooled in her eyes.
Demrow was on her knees crawling from tombstone to tombstone in Center Cemetery doing historical society research the day her son died. Fourteen years later, she still hasn't gone back.
"I know he's gone, learned to live with it. But going back there brings back immediately the whole chain of events," Demrow said.
Still Demrow has never lost her intrigue with history that she believes must be preserved and shared.
"It's addictive to find out all the stuff," she said. "How can you go ahead if you don't know what happened in the lives of the people before you?"
Demrow also was instrumental in saving Rock County's property tax records, which are now stored in the basement tunnels of the courthouse.
For her efforts, she received the 2008 Governor's Award for Archival Advocacy and also was inducted into the Rock County Hall of Honor in 2007.
"I don't think I'm deserving of any of them," Demrow said. "To get an award for something I enjoy doing is redundant. I don't do it because I want to get an honor. I just like doing it. I was embarrassed."
Boylen said she is deserving.
"Rock County would not have the wealth of genealogy and historical records it does were it not for dedicated historians like Kay."
Before you post a comment, consider this:Note: GazetteXtra.com does not condone or review every comment. Read more in our User Policy Agreement
Post Comment
Commenting requires registration.
|
http://www.gazettextra.com/news/2009/mar/30/archivist-preserves-her-place/
| 2013-05-18T10:43:33 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
(MAC) address burned into each and every Ethernet Network Interface Card (NIC). The MAC, or hardware address, is a 48-bit (6-byte) address written in a hexadecimal format. Fig. 4 shows the 48-bit MAC addresses and how the bits are divided.
Fig. 4
The organizationally unique identifier (OUI) is assigned by the IEEE to an organization. It’s composed of 24 bits, or 3 bytes. The organization, in turn, assigns a globally administered address (24 bits, or 3 bytes) that is unique to each and every adapter they manufacture. Look at the figure and you will see that. The.
|
http://www.gbshop.info/cisco-ccna-ethernet-addressing-uses-the-media-access-control/
| 2013-05-18T11:02:04 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://ciscotests.org/ccna/images/fig.4.png",
"MAC Address MAC Address"
]
] |
Ingalls fights hard, but doesn't advance at state volleyball tournament
Published 10/27/2012
By CONOR NICHOLL
Special to The Telegram
HAYS — The Ingalls High School volleyball team didn't make it out of pool play at the Class 1A, Division II state tournament Friday at Fort Hays State University's Gross Memorial Coliseum. However, Ingalls had plenty to be proud of - both with the season and its play Friday.
"We played as good as we could have," Ingalls coach Kim Batman said.
Ingalls went 1-2 in pool play and finished third behind perennial powerhouses Baileyville B&B and Wheatland-Grinnell. B&B is the No. 1 overall seed and defending state champion. Wheatland-Grinnell was state runner-up two years ago. Those teams qualified to Saturday's semifinals.
Still, Ingalls pushed those teams. The Bulldogs lost 25-20, 23-25, 25-12 to Wheatland-Grinnell in the day's first match and then defeated McPherson-Elyria Christian 25-14, 25-18. In its last match, Ingalls dropped the first set, 25-11, to B&B. At that point, even if Ingalls came back to win the match, it had virtually no chance to pass B&B and Wheatland-Grinnell on tiebreakers.
Still, the Bulldogs, with three seniors and three freshmen on the floor, rebounded to win the second set, 25-23.
"To come back and win the second match was just incredible," Batman said.
Then, it lost the third set, 23-15. Ingalls, the No. 4 seed, finished 31-11.
"I was really proud of them," Batman said. "They did awesome. ... I think we always thought we had the potential (to make state). It's just whether the chemistry was on on the day that we were playing. Because we can play incredibly well, or we can play not so well. But the girls just need to learn to have fun."
In the first match, Ingalls led 9-6 in the third set against Wheatland-Grinnell, but the Thunderhawks finished on a 19-3 run. Wheatland-Grinnell consistently delivered kills from the left side, as Ingalls had trouble shifting its block.
"We always said, 'They get one serve,'" Thunderhawk all-state senior setter Brooke Ostmeyer said. "We always try to sideout as soon as we can. If we mess up, we don't let it bother us."
Junior Tristan Rathgeber collected seven kills in the third set for the Thunderhawks.
"We didn't block her as well as we should have, and we weren't covering exactly where we should have either," Batman said.
Against B&B, Ingalls had what Batman called "some chemistry issues." Ingalls' three freshmen included one who hadn't seen much playing time.
"We had to work through those," Batman said. "End of the first set, there was a lot of friction on the team. Made a few changes and the girls really pulled together and they wanted to win, and represent our school very well, so we wanted to finish strong. We didn't want to end the year on a bad note."
Found 0 comment(s)!
|
http://www.gctelegram.com/prepzone/ingalls-vb-state-10-27-12
| 2013-05-18T10:52:49 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Australian Reserve Bank leaves cash rate unchanged
Sydney: The Reserve Bank of Australia (RBA) Tuesday announced its decision to leave the cash rate unchanged at 3.50 per cent after its July board meeting.
The decision to hold comes after the central bank cut the cash rate by 50 basis points in May and 25 basis points in June, reported Xinhua.
RBA Governor Glenn Stevens said Tuesday that the Australian economy grew faster than expected in first part of 2012, but there were signs of weakening in Europe and slower growth in China.
He said there had been no changes to the RBA’s outlook for inflation.
Stevens said financial markets had initially responded positively to signs of further progress towards longer-term sustainability in European financial affairs. However, he said Europe would still be a potential source of adverse shocks for a while.
“At today’s meeting, the board judged that, with inflation expected to be consistent with the target and growth close to trend, but with a more subdued international outlook than was the case a few months ago, the stance of monetary policy remained appropriate,” Stevens said in a statement accompanying the decision Tuesday.
|
http://www.gdayindia.com.au/australian-reserve-bank-leaves-cash-rate-unchanged-2/
| 2013-05-18T10:13:15 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Prospective Students
Quick Links
Graduate Study at UCLA
Applying to UCLA
Financing a UCLA Education
- Guide to UCLA Funding Options for Entering Students
- Fellowship Application for Entering Students
- Extramural Support GRAPES Database
Commitment to Diversity
- University of California © 2013 UC Regents
- About Our Site / Privacy Policy
|
http://www.gdnet.ucla.edu/prospective.html/search/gasaa/library/gasaa/library/asis/infoserv/asis/infoserv/gss/library/gss/asis/entsup/gasaa/admissions/prospective.html
| 2013-05-18T10:21:27 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"graphics/site2010/prospectivebar.jpg",
"Photo of students on Janss Steps - Did you know that Dr. Martin Luther King Jr. spoke at the bottom of Janns Steps?"
]
] |
Monitors & Displays
You are here: Sales : Home : Products : Monitors & Displays
Filter your search results
Our online search filter system makes it useful for our users who aren't exactly sure what they want. Just click the appropriate attributes and find the right product that meets your specification.
SELECTED FILTERSClick a filter to remove
Service and support
|
http://www.gearhousebroadcast.com/uk/equipment-sales/category/Monitors+'26+Displays/Monitors+'26+Displays/Reference/HD_4/HD-SDI/
| 2013-05-18T10:22:11 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Looking for an skilled and experienced programmer to develop a Joomla component/module which shows the Islamic prayer times for any country.
We will provide the method and logic required to calculate the prayer times, which will have to be based on the users IP and longitude/latitude lines as well as mathematical formulas.
Currently our site - - is running Joomla 1.5, so we are seeking development for this version, and one that will work in the upgraded versions (1.7 - 1.8) in the near future.
An example of the desired final solution should be similar to this - -
1. So when someone goes to our site's prayer section, it will automatically determine their location based on their IP (similar to this - ) but the desired CSS design and view should be similar to the mentioned site -.
So to reiterate, the desired final output should be a replica of this site - - and all its features and design.
Now to calculate the prayer time, this site - and - provide a step by step explanation on the mathematical and logic required to determine the prayer time for any area based on the users location and timezone.
Please base only calculation method as the Leva Research Institute, Qom, Iran.
Hope this is enough explanation of our desired goal and what we wish for it to achieve, but you may ask further questions if the need arises.
Thanks, happy bidding.
|
http://www.geekfreelancers.com/projects/joomla-prayer-times-module-component-289491.html
| 2013-05-18T10:12:07 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Tattooed Barbie: You're No Daughter Of Mine!
Mattel's new 'Totally Stylin' Barbie doll comes with a bunch of sticker tattoos you can apply all over her forehead and neck to make her look way more totally stylin'. Make her a little R2-D2 backpack and that is one fine piece of plastic ass (note to self: verify Barbie's age before using this). Plus, the doll comes with a fake tattoo gun and ink tattoos so your daughters (and sons) can apply tattoos to themselves! Shockingly, some parents aren't cool with the idea.
Barbie-maker Mattel has said the tattooed Barbie provides a way for kids to "be creative" with the doll. Some parents, naturally, see it differently, suggesting that a "Totally Pierced Barbie" or a "Divorce Barbie" could come next.
As for the tattooed Barbie, Mattel says it's selling better than expected and there are no plans to pull it from the product lineup.
Personally, I don't care, but that may just be because I don't have any daughters. No, I'm the proud father of three very handsome boys (woman always on top). Just kidding. But now that you know how they're made, ladies?
Tattooed Barbie Stirs Up Controversy [inquisitr]
and
Amazon Product Page
Thanks to Steven, whose daughters are only allowed to play with G.I. Joe's.
- / Continue →
- / Continue →
- / Continue →
|
http://www.geekologie.com/2009/05/tattooed-barbie-youre-no-daugh.php
| 2013-05-18T10:22:53 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://www.geekologie.com/2009/05/04/tattoo%20barbie.jpg",
"tattoo barbie.jpg"
]
] |
Giant Air-Powered Spider Puppet Backpack Thingy
This is a video of Tim Davies demonstrating his giant air-powered spider puppet. Or is the spider demonstrating him? I have no idea. What I do know is Tim shouldn't be allowed to compete in any Halloween costume contests this year.
Hit the jump for the short but worthwhile video.
This Realistic Giant Spider Puppet is Like Wearing Shelob from LOTR [obviouswinner]
and
Tim's Website (with a bunch of other wacky shit)
- / Continue →
- / Continue →
- / Continue →
|
http://www.geekologie.com/2012/01/giant-air-powered-spider-puppet-backpack.php
| 2013-05-18T10:42:44 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://www.geekologie.com/2012/01/24/giant-spider-puppet-thingy.jpg",
"giant-spider-puppet-thingy.jpg"
]
] |
Access, Share and Enjoy It Everywhere.
Easy to AccessWhen EverywhereAtEnablingMake your smartphones or tablet PC to your NSA325 virtually anywhere.
Superior performancePowered-interfaceThroughWhenWant.
Dropbox support offers remote backup and downloading everywhereThe new mobile applications of the NSA325 make it easy for you to backup and download files freely. Through the Dropbox App , you can backup files or send torrents from your smartphones or tablet PC to your NSA325 from virtually anywhere.
P2P Download ServiceThe NSA325 features a P2P download service for fast downloading and sharing large files. With high-speed DHT (Distributed Hash Tables) mode and TCP/UDP tracker protocols support, the NSA325 overcomes the drawbacks of slow and disrupted downloading.
RSSAfter you subscribe to RSS feeds and add the links to the NSA325, the built-in RSS client enables the NSA325 to automatically download the latest digital contents, such as TV programs and Podcasts. With RSS server support, the NSA325 makes it easy for you to share the files with your friends by subscribing to the RSS feeds you set.
FTP serverWith the NSA325, you can establish your own FTP server and manage access authorization for it. The auto-upload function can automatically upload files stored in the NSA to FTP servers; it’s a very efficient way to update multiple FTP servers simultaneously and share with your friends and family.
One-click hosting sites downloadingIn addition to serving as an eMule/P2P Download/FTP server, our one-click hosting download manager makes it easy for you to manage large files downloads from RapidShare.
Organize media at your fingertips The zPilot™ file auto-classification function of the NSA325 enables you to easily store and manage media files through simple drag-and-drop operations. With zPilot™ software installed on your computer, you can drag one or more files or folders to the zPilot™ icon on the desktop, and they will be identified and delivered automatically to music, photo, video or other designated folders on the NSA325.
Smart fanWith smart fan technology, the NSA325 can run at slower speeds to reduce power consumption when the system temperature is low.
Wake-on-LANA new green feature dubbed "Wake-on-LAN" enables users turn on the NSA325 and access media files remotely anytime and anywhere, even when the device at home is powered off.
Hard disk hibernationThe internal hard disks in the NSA325 can automatically spin down when there is no data transmission after a period of time.
Power schedulingWith the power scheduling function, the NSA325 can be turned off automatically based on your usage patterns and needs to conserve power and expense.
REVIEW SNAPSHOT®
(based on 2 reviews)
Ratings Distribution
5 Stars
(2)
4 Stars
(0)
3 Stars
2 Stars
1 Stars
Reviewed by 2 customers
Sort by
Displaying reviews 1-2
Back to top
Sweet
By gwiz
from Aurora,il
About Me Power user
Pros
Cons
Best Uses
Comments about ZyXEL NSA325 2-Bay Power Plus Media Server w/SuperSpeed USB 3.0 & Dropbox Support:
Use this device to store photos, videos and movies. Very easy for these to be set up. Only con so far is that fact that there is not a hdmi port on the device. that would be very easy to plug into the non-dlna smart tv. I am sure there is a usb-hdmi adapter just havent got that far yet. Very satisfied with the unit.
Bottom Line Yes, I would recommend this to a friend
Was this review helpful? Yes / No
- You may also flag this review
Comment on this review
ZyXel NSA325 is a very nice NAS box!
By Gilligan
from Overland Park, KS
Very nice NAS box with many cool features. Western Digital red 3tb drives work perfect, I have them in RAID 1. Manufacturer support seems good. There was a firmware update needed, super easy to install. No problems streaming large (.mkv) HD movies to TV or computer.CONS: Large file transfers max out the processor. Transfer speed is around 50 to 60mb/sec on a gigabit network. Wish that was higher. Overall I am very happy. It's fun to play with all it's features. It's well worth it's price!
|
http://www.geeks.com/details.asp?InvtId=NU-632-227-0001
| 2013-05-18T11:02:26 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Back to Normal View
Little Giant ® Steel Platform Trucks
These heavy-duty steel platform trucks have a 12-ga. formed steel deck
welded to a sturdy sub-frame and a removable pipe handle with cross
braces for added strength. Height from the top of the platform to the
top of the handle is 29". 6"-dia. rubber wheel model has a load capacity
of 2,000 lbs., while the 8"-dia. rubber wheel model has a load capacity
of 2,400 lbs. 8"-dia., non-marking polyurethane wheel models have
a larger load capacity of 3,600 lbs. Models are available with wheel
brakes or floor lock to prevent unwanted movement. Also includes two
swivel and two rigid casters. USA made. Specify load capacity, wheel diameter/style and platform size from the drop down boxes above.
NOTE: Shipped by motor freight. Charges to be determined when order is placed.
|
http://www.gemplers.com/product/214862/Little-Giant-Steel-Platform-Trucks
| 2013-05-18T10:41:45 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Your Selection
(Clear All)
Narrow Your Results
Precious Metal
Price
Gemstone Shape
Setting Style
Amethyst Delicately Detailed Necklaces
Crown Gem Pendant $630
Cabochon Round Amethyst 14K Yellow Gold NecklaceSee This Design »Create Your Own
Forget Me Knot Pendant $333
Round Amethyst Sterling Silver Necklace with DiamondSee This Design »Create Your Own
Triscele Pendant $156
Round Amethyst Sterling Silver NecklaceSee This Design »Create Your Own
About Amethyst Delicately Detailed Necklaces
Buying Guide
At Gemvara, we believe that the amethyst amethyst delicately detailed necklaces with meticulous attention to detail. Our precious metals are recycled or responsibly mined. Our growing selection of amethyst delicately detailed necklaces by Ruzanna Davtian, Martha Gomez Gutierrez, David West, and other talented designers means you can find a necklace that's exactly your style. amethyst delicately detailed necklaces with mild dish soap: use a soft brush where dust collects. Gemvara's fine quality amethyst delicately!
|
http://www.gemvara.com/Amethyst-Delicately-Detailed-Necklaces/jewelry/b/?cat=Pendant&gem=Amethyst&pts=1537
| 2013-05-18T10:34:03 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
],
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
],
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
]
] |
Your Selection
(Clear All)
Narrow Your Results
Gemstone Shape
Category
Birthday Gift Ideas: Rose Gold Rose de France Jewelry
Pure Cushion Pendant $419
Checkerboard Cushion Pavilion Rose de France 14K Rose Gold NecklaceSee This Design »
Pure Cushion Gem Charm $460
Checkerboard Cushion Double-sided Rose de France 14K Rose Gold CharmSee This Design »
Pure Round Gem Charm $462
Checkerboard Round Double-sided Rose de France 14K Rose Gold CharmSee This Design »
About Birthday Gift Ideas: Rose Gold Rose de France Jewelry
Buying Guide rose gold rose de france jewelry design owes its lovely color to additional copper mixed in with 58.5% pure gold. Its glowing pink color flatters skin tones. Our wide selection of rose gold rose de france jewelry by Ji Hwang, David West, Bijoux & Bijoux, and other talented designers means you can find jewelry that's exactly your style. You can also shop by style, choosing our Vintage-Inspired, Geometric, or Romantic Collections. Gemvara's fine quality rose gold rose de france jewelry!
|
http://www.gemvara.com/Birthday-Gift-Ideas-Rose-Gold-Rose-de-France-Jewelry/jewelry/b/?ameth=Amethyst+rose+de+france&gem=Amethyst&met=14RG&pto=3
| 2013-05-18T10:43:33 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
],
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
],
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
]
] |
Your Selection
(Clear All)
Narrow Your Results
Wedding Day Gift Ideas: Platinum Mothers Necklaces
- Us Two Pendant$2,330 in platinum / Emerald / Black Diamond
Platinum Necklace with Emerald & Black Diamond
- Us Two Pendant$1,747 in platinum / Red Garnet / Peridot
Platinum Necklace with Red Garnet & Peridot
- Us Two Pendant$1,747 in platinum / Peridot / Red Garnet
Platinum Necklace with Peridot & Red Garnet
- Us Two Pendant$1,723 in platinum / Red Garnet / Green Amethyst
Platinum Necklace with Red Garnet & Green Amethyst
- Us Two Pendant$1,717 in platinum / Amethyst / Blue Topaz
Platinum Necklace with Amethyst & Blue Topaz
- Us Two Pendant$2,194 in platinum / Amethyst / Ruby
Platinum Necklace with Amethyst & Ruby
- Us Two Pendant$1,718 in platinum / Amethyst
Platinum Necklace with Amethyst
- Us Two Pendant$2,158 in platinum / Red Garnet / Emerald
Platinum Necklace with Red Garnet & Emerald
- Us Two Pendant$2,273 in platinum / White Sapphire / Emerald
Platinum Necklace with White Sapphire & Emerald
About Wedding Day Gift Ideas: Platinum Mothers Necklaces
Buying Guide
At Gemvara, we believe that the platinum platinum mothers necklaces with meticulous attention to detail. Our precious metals are recycled or responsibly mined. Our growing selection of platinum mothers necklaces by Ji Hwang, David West, Damon Washington, mothers!
|
http://www.gemvara.com/Wedding-Day-Gift-Ideas-Platinum-Mothers-Necklaces/jewelry/b/?cat=Pendant&met=Plat&pto=10&pts=22
| 2013-05-18T10:55:56 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
],
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
],
[
"http://sd2.gemvara.net/assets8-2-1-GA_b/images/hr940.png",
null
]
] |
Visual Effect Plugins
Sapphire by Host Platform
Sapphire Edge by Host Platform
Popular Video Effects
Sapphire 7 is now available! See What's New
Sapphire Plugins for After Effects are also available for Adobe Premiere Pro and Autodesk Combustion 250 visual effects, along with the speed and ease of use offered by Sapphire for After Effects, not only frees up time to craft each piece of work exactly as you want it but also deliver the creative impact that engage viewers and delivers superior results. To see for yourself, download a Free Trial of our Adobe After Effects plugin.
Experience what's new in Sapphire 7
|
http://www.genarts.com/software/sapphire/after-effects
| 2013-05-18T10:32:18 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Dean Paul McCullough
Ph.D. University of Illinois at Urbana-Champaign 1970
Dissertation: Model Connectives and Intutionistic Model Logic W.R. to the Kripke Model
Mathematics Subject Classification: 03—Mathematical logic and foundations
Advisor: William Werner Boone
No students known.
If you have additional information or corrections regarding this mathematician, please use the update form. To submit students of this mathematician, please use the new data form.
|
http://www.genealogy.math.ndsu.nodak.edu/id.php?id=4023
| 2013-05-18T11:03:38 |
CC-MAIN-2013-20
|
1368696382261
|
[
[
"img/flags/UnitedStates.gif",
"UnitedStates UnitedStates"
]
] |
1,409 Records in Newspaper Archives
Subscribe Now for Instant Access to Newspaper Archives.
Historical Newspaper Archives Search Tips
Newspaper Archives Last & First Name Search
-.
- However, if the person's name is popular, like Smith, try using some of the available search options such as location, date range, and keyword, in order to narrow your search to the specific Smith you are looking for (see below).
Using Advanced Search in the Newspaper Archive Database
- There are two keyword search boxes to narrow your search for newspaper articles: "Include keywords" box and "Exclude keywords" box (see below).
- Use the Date search box to enter a specific date or date range of the newspaper content you want to search online.
Using Keywords & Quotation Marks to Search Newspapers
- All the searches for historical newspaper articles are full-text keyword searches against OCR-generated ASCII text.
- By using the "Include keywords" box and/or "Exclude keywords" box, you can narrow or expand your online newspaper article search.
- Put phrases in quotes like "John Adams" in the "Include" keyword box to limit the newspaper article search to that exact name—versus using the last/first name search that brings back results matching John near2 Adams.
- If you find too many names in the newspaper archive search results, narrow your search even more by typing names or places you do NOT want in your search in the "Exclude" box.
Using Boolean Operators to Search Newspaper Archives
- Use AND, OR, ADJx (order specific), NEARx (order non-specific) and Wildcards, such as "?" and "*")
Broaden or narrow newspaper search queries
- by emptying filled-in fields to broaden your search, or filling in empty fields to narrow your search.
Display newspaper search results in different ways, such as:
- Best matches (this is the newspaper search default)
- Oldest items (based on newspaper publication dates)
- Newest items (based on newspaper publication dates)
- Once changed, the selection will remain the default until you change it again.
Search Newspapers by Date Range
- If you know the date of the newspaper content you are seeking, then use the "Date" search box.
- Enter a specific date or a date range—a variety of date formats are accepted.
- Examples: June 2, 1804, or 1804 - 1849, or June 1804 - August 1949.
Using Colonial English Variant Spellings to Search Old Newspapers
- Many of the newspapers in the historical newspaper archives are very old, and the searches must deal with Colonial English.
- The long "s" character was almost identical to the "f" in many texts.
- When searching old newspaper articles on words containing the letter "s," use the "?" wildcard in place of the "s."
- Note: this can occur whether it is the first letter, a letter within a word, or at the end of a word.
- The double "s" is in words like Massachusetts needs to be replaced with two wildcards in historical newspaper searches.
Examples of Searching for Old Newspaper Articles with Colonial English
- In addition, type was set by hand for early American newspapers and printers did not always have enough pieces of type to include all of the letters in a word. This resulted in letters being omitted, or sometimes letters that looked similar were used as substitutions.
- Much of this historic newspaper material did not use standard spellings.
- Examples of some conventions that were common in old newspapers:
- letter e to word endings
- Brown - Browne
- Chesapeake - Chefopeak or Chefopeake
- Clark - Clarke
- highways - highwayes
- Examples of interchanging use of the letters "i" and "y"
- adjoining - adjoyning
- Pennsylvania - Pensilvania or Penfilvania
- rails - rayls
Colonial Newspaper Search Notes
- If in doubt, use wildcards such as the question mark "?" or the asterisk "*" in your colonial newspaper search.
- A question mark is a single-character wildcard and an asterisk multi-character (allows for up to 5 characters) wildcard.
|
http://www.genealogybank.com/gbnk/newspapers/?kwinc=Long+Beach+Earthquake&formDate=1933&pg=2&pg=3&pg=18
| 2013-05-18T10:17:28 |
CC-MAIN-2013-20
|
1368696382261
|
[] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.