text
stringlengths 0
128k
|
|---|
package libhealth
import (
"bytes"
"encoding/json"
"net/http"
"strings"
)
// Paths to info healthchecks.
const (
InfoHealthCheck = `/info/healthcheck`
InfoHealthCheckLive = `/info/healthcheck/live`
infoBad = `{"condition":"info healthcheck error"}`
)
// Info is an http.Handler for
// /info/healthcheck
// /info/healthcheck/live.
type Info struct {
deps DependencySet
}
// NewInfo will create a new Info handler for a given DependencySet set.
func NewInfo(d DependencySet) *Info {
return &Info{d}
}
// InfoResult represents the body of an info healthcheck.
type InfoResult struct {
Condition string `json:"condition"`
Hostname string `json:"hostname"`
Duration int64 `json:"duration"`
}
func (i *Info) generate(live bool, hostname string) ([]byte, int) {
var s Summary
if live {
s = i.deps.Live()
} else {
s = i.deps.Background()
}
r := InfoResult{
Condition: s.Overall().String(),
Hostname: hostname,
Duration: int64(s.Duration()) / 1000000,
}
bytes, err := json.Marshal(r)
if err != nil {
return []byte(infoBad), http.StatusInternalServerError
}
return bytes, ComputeStatusCode(true, s)
}
// ServeHTTP is intended to be used by a net/http.ServeMux for serving formatted json.
func (i *Info) ServeHTTP(w http.ResponseWriter, r *http.Request) {
w.Header().Set("Content-Type", "text/plain")
live := strings.HasSuffix(r.URL.String(), "/live")
healthcheckJSON, code := i.generate(live, hostname())
var prettyJSON bytes.Buffer
if err := json.Indent(&prettyJSON, healthcheckJSON, "", " "); err != nil {
http.Error(w, err.Error(), http.StatusInternalServerError)
return
}
w.WriteHeader(code)
if _, err := w.Write(prettyJSON.Bytes()); err != nil {
http.Error(w, err.Error(), http.StatusInternalServerError)
return
}
}
|
Thread:Alwaysmore2hear/@comment-6417519-20181019221252/@comment-24851773-20181107000300
Hi there! Just checking in to see if you are still interested.
|
Page:The Journal of Classical and Sacred Philology, Volume 1, 1854.djvu/332
322 Journal of Philology. will be remorseful, when you have reached the term of your wrath." I more than doubt the correctness of this interpretation, (1) because I do not think fSapvs can be used in the sense ascribed, (2) because it appears, from the yielding of (Edipus, that his 6up6s is over, though it has left a-rvyos behind, and, if so, fiapvs cannot refer to his future feeling. I do not, therefore, interpret Bvpov n-epav "to come to the end of anger," but "to exceed in anger," " to be enraged beyond measure ;" and I render, " You shew yourself malignant when you yield, and violent, when you are enraged." For the sense of nepav, see (Ed. Col. 155, nepas yap nepas. In short, Ovpov ncpav = 6vpovcr6ai irkpa ftiKrjs. 688, rovpbv rrapieiy /cat KarapftXvvcov iceap. Wunder and Schneidewin concur in putting a comma after napicU, regarding rovpov and <eap as objects of the participles severally, but the former understands to <rbv neap (" neglecting my interest and weakening your affection"), the other, to ipbv Map ("neglecting my interest and taking off the edge of my feeling"). I unhesitatingly dissent from both, and render : " disregarding and deadening the feelings of my heart ;" i. e. " indifferent to, and disposed to suppress, my just resentment." That Ktap would be used by the poet so nakedly as the German critics imagine, I cannot believe. In every other place he has joined with it the pronoun. Track. 629, coot' K7rayrjvat rot pop Tjdovfj neap. 10. 1246, rovpbv et Tfpyjfcts Ktap. Aj. 686, rovpbv &v ipa Ktap. (Ed. Col. 655, rovpbv ovk 6kv(1 Kcap. 698, 'Ioac. 7rp6f $ea>v 8l8aov KapH ui>a, orov nore prjvtv Too-qvdc npdyparos o-rrjaas fxS'. Old. ipa>' o-c yap rSavh aJ yvvat, ir(ov * Kpcovros, old poi /Se/SoyXfVAcwy e^e*. Wunder prints these last two lines thus : epa> (r fy t * explaining the last verse as equal to Kpeovros povXtvpara, and as object of e'pcS. Schneidewin, though he does not print thus, seems to explain in the same way ; for he merely annotates on v. 701, KpeovTo: povXcvpara. A strange " nodus in scirpo." It seems evident, reading the four lines consecutively, that v. 701 is a direct answer
|
using System;
using System.Collections;
using System.Collections.Generic;
using System.Text;
using JsonFx.Json;
using Midworld;
partial class GoogleDrive
{
static T TryGet<T>(Dictionary<string, object> dict, string key)
{
object v;
if (dict.TryGetValue(key, out v) && v is T)
return (T)v;
else
return default(T);
}
}
|
Page:Travels to Discover the Source of the Nile - In the Years 1768, 1769, 1770, 1771, 1772, and 1773 volume 4.djvu/235
named a black servant of hers, a Mahometan, from whom she had bought it; and the reason was, her fears that her grandfather, Ras Michael, whom die had always looked upon as the murderer of her father, should force her when he returned to Gondar. He seemed exceedingly attentive to all I said, and mused for a couple of minutes after I had done speaking.
A plentiful breakfast was then brought us, and many of his officers sat down to it. I observed like wise some people of Gondar, who had formerly fled to Fasil at Michael's first coming. He said he wished me to bleed him before I went away, which I assured him I would by no means do, for if he was well, as I then saw he was, the unnecessary bleeding him might occasion sickness; and, if he was dangerously ill, he might die, when the blame would be laid upon me, and expose me to mischief afterwards. "No, says he, I could certainly trust you, nor would any of my people believe any harm of you; but I am glad to see you so prudent, and that you have a care of my life, for the reason I shall give you afterwards." I bowed, and he made me then tell him all that passed in my visit to Fasil, which I did, without concealing any circumstance. All the company laughed, and he more than any, only saying, "Fasil, Fasil, thou wast born a Galla, and a Galla thou shalt die."
Breakfast being over, the tent was cleared, and we were again left alone, when he put on a very serious countenance. "You know, says he, you are my old acquaintance. I saw you with Michael after the battle of Fagitta, as also the presents you brought, and heard the letters read, both those that came from Metical Aga, and those of
|
Microsoft KB Archive/831610
= Information about the Form Web Part in FrontPage 2003 =
Article ID: 831610
Article Last Modified on 9/27/2006
-
APPLIES TO
* Microsoft Office FrontPage 2003
-
SUMMARY
MORE INFORMATION
Text boxes
Check box
Select control
choice1
choice2
Option button
Text area
Keywords: kbinfo KB831610
-
<EMAIL_ADDRESS>Send feedback to Microsoft]
© Microsoft Corporation. All rights reserved.
|
import { withFormik } from 'formik';
import { compose } from 'redux';
import { connect } from 'react-redux';
import * as Yup from 'yup';
import AuthForm from '../../AuthForm.js';
import { resetPassword } from '../../../../actions/resetPassword.js';
export const changePasswordFormConfig = {
mapPropsToValues: () => ({
password: '',
passwordConfirm: ''
}),
validationSchema: Yup.object().shape({
password: Yup.string()
.required('Password is required')
.min(6),
passwordConfirm: Yup.string()
.oneOf([Yup.ref('password'), null], "Passwords don't match!")
.required('Password confirmation is required')
}),
handleSubmit: async (values, { setSubmitting, props }) => {
setSubmitting(true);
const resetToken = props.pathname.split('/').pop();
const resetDetails = {
password: values.password,
resetToken
};
await props.dispatch(resetPassword(resetDetails));
setSubmitting(false);
}
};
const mapStateToProps = state => ({
type: 'changepassword',
pathname: state.router.location.pathname
});
export default compose(
connect(mapStateToProps),
withFormik(changePasswordFormConfig)
)(AuthForm);
|
patroni to pgo migration
@dleard it's been run on -dev. It should automatically run on -test upon merging to main, we'll need to monitor that closely
|
Talk:Electric Eel Lamp/@comment-43661230-20190829141044
My user is Lobinhoaj2005 I have the red one.
If u have pirates treasures, barrel sponges, or CLAM WITH PEARL plz jag me here or on aj.
LOOKING SEVERAL FOR CLAM WITH PEARL!!! WHO HAVE THAT?
|
1. Introduction {#sec1-materials-16-07369}
Pressure vessel steel is used to manufacture pressure vessels or other similar equipment, such as petroleum, gas storage, and transportation \[[@B1-materials-16-07369],[@B2-materials-16-07369]\]. As production demands increase, traditional welding methods can no longer meet the requirements. In contrast, high-energy welding can significantly improve welding efficiency \[[@B3-materials-16-07369]\], reduce the number of passes, and shorten the welding cycle due to its advantage of higher heat input \[[@B4-materials-16-07369],[@B5-materials-16-07369]\]. However, the higher wire energy and slower cooling rate lead to a weakening of the low-temperature impact properties of pressure vessel steels in the welding heat-affected zone. This has led to increasing demands on the weldability of metallic materials \[[@B6-materials-16-07369],[@B7-materials-16-07369]\]. Therefore, it is necessary to develop a large wire energy welding pressure vessel steel \[[@B8-materials-16-07369],[@B9-materials-16-07369]\].
To improve the weldability of pressure vessel steels and achieve the objective of increasing the toughness of the welding HAZ, the addition of particles to form dispersed and fine inclusions has been successful. As summarized in the literature \[[@B10-materials-16-07369],[@B11-materials-16-07369],[@B12-materials-16-07369]\], there are two main ways of achieving this objective: firstly, during welding thermal cycling, the pinning effect of fine inclusions dispersed into the base material is used to inhibit the growth of austenite grains, thereby refining the grains and improving the toughness of the welding HAZ. Secondly, in the post-weld cooling stage, in the austenite to ferrite phase transition process, some of the suitably sized inclusions promote the nucleation of IAF. The splitting effect of IAF subsequently causes the grain size to be refined. The IAF structure not only has a good toughness but also helps to improve the toughness of the pressure vessel steel welding HAZ.
To obtain the right type of inclusions to induce IAF, many researchers have controlled the formation of inclusions by adding deoxidizing elements, such as Ti, Zr, and Mg, to steel \[[@B13-materials-16-07369],[@B14-materials-16-07369],[@B15-materials-16-07369]\]. For instance, Qi et al. \[[@B16-materials-16-07369]\] investigated the effect of Ti treatment on inclusions in the laser-MAG hybrid welds of X100 pipeline steel. The results showed that with increasing Ti content, the composition of the outer inclusions evolved from mainly Al~2~O~3~ to Ti~2~O~3~ and finally to TiC. Acicular ferrite was induced to nucleate by Ti~2~O~3~ to form Mn-depleted zones, whereas Al~2~O~3~ and TiC could not nucleate via this mechanism. Yao et al. \[[@B17-materials-16-07369]\] investigated the effect of Zr addition on the inclusions of high-Ti low-alloy steel in a simulated HAZ. The main reason for the increase in toughness in the HAZ of coarse-grained Zr-containing steels is the formation of acicular ferrite-refined grains from 1--3 μm Al-Ti-Zr-O inclusions. However, the element Mg is more stable at high welding temperatures than the oxide of Ti. And compared to Ti and zirconium, elemental magnesium offers better economics and more effective resource conservation. Xu et al. reported the effect of MgO nanoparticles on the inclusions of the HAZ of shipplate steel \[[@B18-materials-16-07369]\]. The results showed that the addition of nanoparticles significantly optimized the structure of the inclusions, and the average size of inclusions was significantly reduced. The (Mg-Al-Ti)O inclusions of 1.2 μm size could effectively induce acicular ferrite and at the same time, improve the strength and toughness of HAZ. Lou et al. \[[@B19-materials-16-07369]\] researched the effect of a Ti-Mg-Ca treatment on the HAZ properties of C-Mn steels welded with high wire energy. It was found that the number density of the inclusions in Ti-Mg-Ca steel were significantly greater than those in Ti-Ca and C-Mn steels. In situ observations showed that MgO-containing oxide particles were more effective in inhibiting grain growth and providing a nucleation core in Ti-Mg-Ca steel than in Ti-Ca steel. However, there are very few studies on the effect of Mg treatment on the inclusions of steel HAZs for pressure vessels. And the mechanism of IAF nucleation induced by Mg-containing inclusions in pressure vessel steels is not yet fully understood and requires further theoretical analysis.
The formation of a microstructure in the welding HAZ of pressure vessel steels is affected by the type and size of the inclusions that serve as the core of IAF nucleation \[[@B20-materials-16-07369],[@B21-materials-16-07369],[@B22-materials-16-07369]\]. When welding a HAZ, IAF nucleation mainly involves four mechanisms: the minimum mismatch mechanism, the stress-strain energy mechanism, the local component change mechanism, and the inert surface mechanism. These four IAF nucleation mechanisms are intrinsically related to the presence of inclusions. Relying on only one mechanism often fails to fully elucidate the true nucleation process of IAF in the welding HAZ. Thus, it is unlikely that IAF nucleation occurs through a single mechanism, but it is certainly the result of a combination of these mechanisms.
In this paper, the effects of Mg elements on the inclusion characteristics (shape, composition, quantity, and size distribution) of the welding HAZs for pressure vessel steels were studied. The mechanisms of IAF nucleation induced by the inclusions containing Mg in the welding HAZ of pressure vessel steels were investigated, and a reference is provided for the design of the composition of pressure vessel steels for high-heat input welding.
2. Materials and Methods {#sec2-materials-16-07369}
This experiment used the BJ-VIM-5 vacuum induction melting furnace (Dalunte Vaccum Technology, Shenyang, China) to smelt the experimental steel. The device is shown in [Figure 1](#materials-16-07369-f001){ref-type="fig"}. The designed and actual smelting chemical compositions of the experimental steels are listed in [Table 1](#materials-16-07369-t001){ref-type="table"}.
In this experiment, the alkaline earth element Mg was added as the deoxidizer. According to the different mass fractions of Mg elements in the experimental steels, three groups of experimental steels were designed to be smelted, and each group smelted 5 kg. The designed addition amount (wt.%) of Mg for each group of experimental steels is shown in [Table 2](#materials-16-07369-t002){ref-type="table"}. The experimental steels without Mg addition, added 1 wt.% Mg, added 3 wt.% Mg, and added 5 wt.% Mg are called R, M1, M3, and M5, respectively.
The controlled rolling and cooling equipment (Northeastern University, Shenyang, China) are shown in [Figure 2](#materials-16-07369-f002){ref-type="fig"}. The experimental steel billet was rolled on a hot-rolling test machine with a roll diameter of 450 mm. In the controlled rolling and cooling process, the billet was first heated to 900 °C in a heat treatment furnace and held for 35 min. After this, the furnace temperature was raised to 1200 °C and held for one hour. After seven controlled rolling passes, the billet was cooled to 380 °C via water cooling. Finally, the billets were cooled to room temperature in the air.
In order to obtain a sample of the designated area of the welding HAZ of sufficient size and to analyze it, the method of welding heat simulation is usually used \[[@B23-materials-16-07369],[@B24-materials-16-07369]\]. It can simulate not only the process of a welding thermal cycle but also the stress and strain during welding according to the actual welding process. At the same time, it has the advantages of high accuracy, complete functions, and rapid warming and cooling.
As shown in [Figure 3](#materials-16-07369-f003){ref-type="fig"}, the Gleeble-2000 welding thermal simulation test machine(DSI, St. Paul, MN, USA) was used in this experiment. The machine utilizes resistance wire heating to achieve dynamic specimen thermal simulation through the effective control of the temperature. During the thermal simulation process of the experimental steels, firstly, the welding heat input was set to 100 kJ/cm, and the specimen was fixed. The second step was to preheat to 100 °C. The third step was to heat, with a heating speed of 200 °C/s. After 6 s, the peak temperature reached 1320 °C. The fourth step was to cool, and the cooling time t~8/5~ was set to 80 s. The fifth step was to gradually cool down from 500 °C to room temperature.
The inclusions in the welding HAZ were visualized using an OLYMPUS-CK40M optical microscope (Olympus, Tokyo, Japan), as shown in [Figure 4](#materials-16-07369-f004){ref-type="fig"}. According to GB/T10561-2005 \[[@B25-materials-16-07369]\], the steel determination of the content of nonmetallic inclusions is achieved via the micrographic method of standard diagrams. IPP (Image-Pro Plus) 6.0 professional image analysis software was used to achieve a two-dimensional analysis of the quantity and size distribution of the inclusions in each experimental steel welding HAZ. It uses the 'count and measure' tool in IPP 6.0 software to measure the number and area of the inclusions and imports the measured data into an Excel table through the 'data to clipboard' action for the statistical analysis of the size distribution of the inclusions. The appearance and composition of the inclusions in welding HAZ of each experimental steel were observed and analyzed using an S-4800 SEM (Hitachi, Tokyo, Japan) and a supporting EDS (Hitachi, Tokyo, Japan).
3. Results {#sec3-materials-16-07369}
3.1. Inclusions of the Experimental Steel in the Welding HAZ {#sec3dot1-materials-16-07369}
The inclusions in the experimental steel welding HAZ were studied in terms of the number and size of the inclusions. Combining the results of related studies \[[@B26-materials-16-07369],[@B27-materials-16-07369]\], the experiment specially adopted a method to measure the inclusion area, aiming for a more accurate reflection of the influence of inclusions on material welding HAZ properties while minimizing the inevitable statistical errors caused by inclusion shape factors. This was used as the basis for the size classification of the inclusions. The size distribution of the inclusions in the experimental steels is shown in [Table 3](#materials-16-07369-t003){ref-type="table"}.
The sum of the number density of the inclusions of each size is called the total number density of inclusions. As seen in [Table 3](#materials-16-07369-t003){ref-type="table"}, the number density of the inclusions in R is the lowest, only 133 pieces/mm^2^. The total number density of the inclusions in the welding HAZ of experimental steels M1, M3, and M5 with magnesium as the deoxidizer is higher than that in R, which is 291 pieces/mm^2^, 408 pieces/mm^2^, and 657 pieces/mm^2^, respectively. This shows that the addition of Mg elements promotes the formation of fine inclusions in the experimental steel welding HAZ to a certain extent under the present experimental conditions. Combining the results of related studies \[[@B28-materials-16-07369],[@B29-materials-16-07369]\], it could be deduced that when the area of inclusions is less than 5 μm^2^, it is the most suitable size of inclusions to play the role of pinning grain boundaries and inducing IAF nucleation. These are called the effective inclusions.
The changing trend of the number density of the total inclusions and the number density of effective inclusions of each experimental steel is shown in [Figure 5](#materials-16-07369-f005){ref-type="fig"}. As shown in [Figure 5](#materials-16-07369-f005){ref-type="fig"}, the number density of the effective inclusions is 122 pieces/mm^2^ for R. In addition, as the Mg content increases, the density number of the effective inclusions in the welding HAZ of the experimental steel increases: 255 pieces/mm^2^ for M1 and 316 pieces/mm^2^ for M2. When the mass fraction of 5wt.% Mg is added in the welding HAZ of the experimental steel, and the number density of the effective inclusions is also the largest, with 579 pieces/mm^2^.
Only the number density of the total inclusions and effective inclusions is discussed above. To reflect more specifically the effect of inclusions on the strength and toughness of the welding HAZ in each experiment, the inclusions are categorized according to their different roles in different size ranges. When the area of the inclusion is less than 0.5 μm^2^, these nanoscale size inclusions could play the role of pinning grain boundaries and inhibit grain growth and coarsening in the welding HAZ. When the area of the inclusion is 0.5--5 μm^2^, these micro-grade inclusions are at the most suitable size for inducing IAF nucleation. The more IAF microstructures in the welding HAZ, the better the strength and toughness. When the area of the inclusion is greater than 5 μm^2^, these larger-sized inclusions are not very effective in pinning grain boundaries and inducing IAF nucleation \[[@B30-materials-16-07369]\]. Therefore, the number density of inclusions of this size in the experimental steel welding HAZ should be minimized. The distribution of inclusions with different effects per unit area in the HAZ of each experimental steel is shown in [Figure 6](#materials-16-07369-f006){ref-type="fig"}.
As shown in [Figure 6](#materials-16-07369-f006){ref-type="fig"}, the total number density of inclusions is the least in the R steel welding HAZ. The number density of inclusions is 68 pieces/mm^2^ for areas less than 0.5 μm^2^ and 54 pieces/mm^2^ for areas in the 0.5--5 μm^2^ range. Therefore, the number density of inclusions that both pin and induce IAF nucleation is relatively minimal, which leads to the poor strength and toughness of the R steel. In contrast, in the three experimental steels with Mg elements, the number of inclusions that perform the role of pinning and inducing IAF nucleation increases gradually, and both are significantly higher than the R steel, except that the number of pinning inclusions in the welding HAZ of the experimental steel with 3 wt.% Mg is higher than that of the inclusions which induce IAF nucleation. The inclusions in the remaining two groups of experimental steels with Mg elements are mainly used for inducing IAF nucleation. Among them, the 116 pieces/mm^2^, 171 pieces/mm^2^, and 242 pieces/mm^2^ inclusions with an area less than 0.5 μm^2^ were found in the M1, M3, and M5 steels, respectively. The number density of the inclusions in the 0.5--5 μm^2^ interval was 139 pieces/mm^2^, 145 pieces/mm^2^, and 337 pieces/mm^2^ for M1, M3, and M5, respectively. It was observed that the addition of Mg elements facilitates the production of more inclusions that induce IAF nucleation in the experimental steel welding HAZ.
3.2. EDS Analysis of the Main Inclusion Composition {#sec3dot2-materials-16-07369}
In this experiment, an S-4800 SEM and a supporting EDS were used to research the R steel following emery paper grinding and mechanical polishing, as well as the specimen of the welding HAZ in the experimental steel containing Mg. The main inclusions were found for the shape observation and composition analysis. The results are shown in [Figure 7](#materials-16-07369-f007){ref-type="fig"}.
As shown in [Figure 7](#materials-16-07369-f007){ref-type="fig"}a,b, the main inclusion in the welding HAZ of R steel is the oxide inclusion of Ti or Al elements, and it has a very irregular shape, large size, and irregular quadrangles with edges or even triangular angles. The oxide of Al (Al~2~O~3~) is prone to accumulate in steel fluid to form coarse inclusions. This inclusion has no induction effect on IAF, and it is easy to form cracks during processing, which damages the toughness of the welding HAZ of the material to a certain extent and is an undesirable inclusion. As shown in [Figure 7](#materials-16-07369-f007){ref-type="fig"}c,d, the inclusions in the experimental steel welding HAZ with the Mg elements added as a deoxidant are mainly MgO or composite inclusions of Mg, Zr, and Al. There are also some MnS inclusions. Mg belongs to an alkaline earth metal element. Combined with [Figure 7](#materials-16-07369-f007){ref-type="fig"}c, the shape of the MgO inclusion is generally spherical or elliptical. It favors the IAF nucleation of a ductile microstructure in the welding HAZ. Therefore, the addition of an Mg element could improve the toughness of the welding HAZ of experimental steels.
The alkaline earth metal Mg causes the shape of the inclusion to be mostly spherical, with a very small size of approximately 1.5 μm, which is in the most suitable size range of inclusions for IAF nucleation as described above. Moreover, there are more inclusions of this size in the experimental steel welding HAZ, and the amount of IAF induced, therefore, is also large, which is conducive to the improvement of the strength and toughness of the experimental steel welding HAZ.
4. Discussion {#sec4-materials-16-07369}
4.1. The Effect of Adding Mg on the Welding HAZ of Experimental Steels {#sec4dot1-materials-16-07369}
The morphology and line scanning analysis of typical inclusions in the welding HAZ of experimental steels with Mg are shown in [Figure 8](#materials-16-07369-f008){ref-type="fig"}. The X-axis of [Figure 8](#materials-16-07369-f008){ref-type="fig"} represents the line scanning distance centered on the inclusions. It was observed that the content of Mg elements is the highest in the central area of the inclusion line scanning, and the content gradually decreases from the center to the sides. Both the Zr and O elemental content show an apparent increasing trend in the center region. The variation trend of the Mn and S elements is roughly the same, and the positions of higher-content Mn and S elements are slightly behind the central area of the Mg, Zr, and O elements. Therefore, the basic morphology of the inclusions could be identified as a compound inclusion mainly containing (Mg-Zr-O) formed in the central position, with MnS inclusions precipitating to the right of the center of the inclusions. Under the condition of line scanning, the typical inclusions in the welding HAZ of the experimental steels with Mg elements are elliptical (Mg-Zr-O) + MnS compound inclusions. The Mg and their compound inclusions in the welding HAZ mainly play the role of fine-grain strengthening and dispersion strengthening.
By observing the morphology and line scanning results of the typical inclusions in the welding HAZ of the experimental steel with Mg added, the following results were found: firstly, from the morphology of the inclusions, spherical or nearly spherical inclusions are produced. The reason is that the spheroidization of Mg elements as alkaline earth metals changes the morphology of the inclusions in the welding HAZ of all experimental steels. Secondly, from the line scanning distribution of the elements in the inclusions, Mg elements are generally combined with other elements to form (Mg-Zr-O) + MnS composite inclusions.
4.2. The Mechanism of IAF Nucleation Induced by Mg Elements in the Welding HAZ {#sec4dot2-materials-16-07369}
After corroding the welding HAZ metallographic specimen of the experimental steels with Mg added to them, the typical IAF microstructure formed by the fine circular inclusions was found, as shown in [Figure 9](#materials-16-07369-f009){ref-type="fig"}.
The addition of Mg could promote the spheroidization of the inclusions. The (Mg-Zr-O) composite inclusions containing Mg could effectively induce IAF nucleation and improve the strength and toughness of the welding HAZ in experimental steels. It can be clearly seen from the position of the inclusion that two more 'bulky' primary IAF microstructures are formed. Secondary IAF microstructures are formed via the inductive nucleation mode of primary IAF microstructures. The relatively 'thick' primary IAF microstructure is the main trunk, and, at the same time, many branch IAF microstructures continue to be induced on the trunk. This is the refinement effect of the IAF microstructure itself. Many IAF microstructures are intertwined and firmly combined with each other, playing a role in improving the strength and toughness of the HAZ in experimental steel welding.
### 4.2.1. IAF Nucleation Mechanism Induced via minimum Lattice Mismatch {#sec4dot2dot1-materials-16-07369}
The inclusions that promote IAF nucleation are affected by the interface energy of themselves or between the precipitates and the ferrite, and the interface energy between them is determined via lattice mismatch. It is shown that \[[@B31-materials-16-07369],[@B32-materials-16-07369]\] the inclusions with a good coherent relationship with the IAF microstructure or the precipitates on them could effectively reduce the interface energy between the inclusions and ferrite and promote IAF nucleation. The lattice mismatch of the inclusions and ferrite in experimental steels is shown in [Table 4](#materials-16-07369-t004){ref-type="table"}.
As shown in [Table 4](#materials-16-07369-t004){ref-type="table"}, there is a good coherent relationship between the inclusions of some body-centered cubic microstructures, such as MnS and ferrite. The lattice mismatch degree is small, which is beneficial for becoming the core of IAF nucleation and promoting the formation of IAF microstructures in the welding HAZ. In this experiment, the lattice mismatch between MgO inclusions and ferrite is only 2.8%, which is even smaller than that of MnS. Furthermore, through the line scanning analysis of the composite inclusions containing Mg elements in the welding HAZ, it was found that MnS inclusions are precipitated from the surface of Mg-containing composite inclusions, which reduces the mismatch between the composite inclusions and ferrite and promotes the formation of the IAF microstructure in the welding HAZ. Therefore, the minimum mismatch mechanism is suitable for the induction of IAF nucleation in the welding HAZ of Mg-containing steels.
### 4.2.2. IAF Nucleation Mechanism Induced via Stress-Strain Energy {#sec4dot2dot2-materials-16-07369}
Due to the high density of dislocations in the IAF microstructure, the average coefficient of the thermal expansion of the inclusions during high-heat input welding is small, whereas the coefficient of thermal expansion of the austenitic matrix is relatively large. Thus, a stress-strain field is formed around the inclusion, causing a certain degree of distortion. The resulting distortion could provide activation energy to induce IAF nucleation. Data \[[@B36-materials-16-07369],[@B37-materials-16-07369]\] shows that, as shown in [Table 5](#materials-16-07369-t005){ref-type="table"}, the average thermal expansion coefficient of austenite is 23.0 × 10^−6^ K^−1^, while that of the MgO is 13.8 × 10^−6^ K^−1^, which is only close to half of that of austenite. Thus, a large stress-strain field is generated around the inclusion to power IAF nucleation. However, it is also taken into account that the energy required for ferrite nucleation is often one to two orders of magnitude larger than the activation energy generated by thermal expansion differences alone. Therefore, stress-strain energy only exists as an auxiliary mechanism to induce IAF nucleation in the welding HAZ of experimental steels with Mg elements.
### 4.2.3. IAF Nucleation Mechanism Induced via Local Compositional Change {#sec4dot2dot3-materials-16-07369}
Mn elements are poor around inclusions. The Mn content is significantly reduced within a certain range, and a poor Mn area is formed. This would produce local composition changes and induce IAF nucleation \[[@B38-materials-16-07369],[@B39-materials-16-07369]\]. Therefore, the inclusions in the experimental steel with the addition of the Mg element were analyzed using EDS composition point analysis. The position map of the inclusion points analysis of the welding HAZ in added Mg steels is shown in [Figure 10](#materials-16-07369-f010){ref-type="fig"}. Point 1 is at the center of the circular inclusions, point 2 is at the edge of the inclusions, point 3 is closer to the outside of the inclusions, and point 4 is at the matrix. The inclusion of chemical composition point analysis results of the welding HAZ in the Mg-added steels are shown in [Table 6](#materials-16-07369-t006){ref-type="table"}.
As shown in [Table 6](#materials-16-07369-t006){ref-type="table"}, the content of the Mn element at point 1 is lower than the Mn content at point 4, indicating that the Mn element is not enriched on the inclusions. The Mn content at point 2 is equivalent to that of the matrix. The Mn elemental content at point 3 is slightly higher than the Mn content of the matrix, but the change is not obvious. Therefore, it could be concluded that there is no Mn-poor area around the inclusions containing Mg, and this theory cannot be used as a mechanism to explain the induction of IAF nucleation in the welding HAZ of Mg-containing steels.
### 4.2.4. IAF Nucleation Mechanism Induced via Inert Interface Energy {#sec4dot2dot4-materials-16-07369}
Ricks et al. \[[@B40-materials-16-07369]\] suggested that the inclusion of a surface in steel as an inert interface provides energy to induce IAF nucleation. The interface between the inclusions and the matrix plays a role in reducing the nucleation barrier of IAF, and it is only related to the number and size of the inclusions, not their composition. Large amounts of small spherical inclusions formed by adding Mg elements are distributed dispersedly in the welding HAZ. It could partly provide a high-energy inert surface for IAF nucleation to some extent. It could reduce the IAF nucleation barrier and promote IAF nucleation. According to the relevant literature \[[@B40-materials-16-07369],[@B41-materials-16-07369]\], the inert interface energy of complex inclusions with diameters of 0.5--2.0 μm is approximately 10^5^ to 10^6^ J/mol. This value is close to the lowest energy required for inducing IAF nucleation (approximately 10^6^ J/mol). However, simply relying on an inert interface energy mechanism is not enough to fully explain the nucleation mechanism of IAF microstructures.
5. Conclusions {#sec5-materials-16-07369}
With increasing Mg content, the number density of the total inclusions and the number density of the effective inclusions in the experimental steel welding HAZ show an upward trend. The total number density of the inclusions and the number of effective density inclusions in the welding HAZ of the experimental steel without added Mg are the lowest, with 132 pieces/mm^2^ and 122 pieces/mm^2^, respectively. In contrast, the welding HAZ of the experimental steel with 5 wt.% Mg added exhibits the highest total number density of inclusions and the number density of effective inclusions, amounting to 656.39 pieces/mm^2^ and 579.10 pieces/mm^2^, respectively.
In the three experimental steels with Mg elements, the number density of the inclusions that play the role of pinning and inducing IAF nucleation increases gradually and is markedly higher than that of the R steel. The addition of Mg elements is beneficial to produce more inclusions inducing IAF nucleation in the welding HAZ of the experimental steel under the experimental conditions.
The inclusions in the experimental steel welding HAZ with Mg elements are mainly elliptical composite inclusions composed of (Mg-Zr-O) + MnS with a very small size of approximately 1.5 μm. The inclusions with such shape and size are conducive to the nucleation and growth of ductile IAF microstructures.
After the addition of Mg elements, MnS is precipitated on the surface of Mg-containing inclusions in the welding HAZ. IAF nucleation is induced mainly via a minimum lattice mismatch mechanism, supplemented by stress-strain energy and inert interface energy mechanisms.
We sincerely appreciate the support provided by Shenyang University in the preparation of this manuscript.
Conceptualization, Y.L. and W.Z.; methodology, Y.L., W.Z. and K.W.; software, W.Z., K.W. and A.D.; validation, Y.L.; formal analysis, W.Z., K.W. and A.D.; investigation, Y.L., W.Z. and K.W.; resources, Y.L.; data curation, W.Z. and A.D.; writing---original draft preparation, Y.L. and W.Z.; writing---review and editing, Y.L., W.Z., K.W. and A.D.; visualization, K.W.; supervision, Y.L. and W.Z.; project administration, Y.L.; funding acquisition, Y.L. All authors have read and agreed to the published version of the manuscript.
Data are included in the article.
The authors declare no conflict of interest.
::: {#materials-16-07369-f001 .fig}
BJ-VIM-5 type vacuum induction melting furnace.
::: {#materials-16-07369-f002 .fig}
Controlled rolling and cooling equipment: (**a**) hot-rolling experimental unit with a diameter of 450 mm; (**b**) controlling cooling system of hot rolling.
::: {#materials-16-07369-f003 .fig}
The Gleeble-2000 welding thermal simulation machine.
::: {#materials-16-07369-f004 .fig}
The OLYMPUS-CK40M optical microscope.
::: {#materials-16-07369-f005 .fig}
The number of total inclusions and effective inclusions per unit area in the experimental steel welding HAZ.
::: {#materials-16-07369-f006 .fig}
Distribution of inclusions with different effects per unit area in the HAZ of each experimental steel.
::: {#materials-16-07369-f007 .fig}
The main inclusion composition of the HAZ in each experimental steel: (**a**,**b**) are R steel, while (**c**,**d**) are steels with added Mg.
::: {#materials-16-07369-f008 .fig}
Typical inclusion morphology and line scanning results of the Mg-added steel.
::: {#materials-16-07369-f009 .fig}
Typical microstructure of IAF in the experimental steel welding HAZ.
::: {#materials-16-07369-f010 .fig}
Position map of the inclusion point analysis of the welding HAZ in Mg-added steels.
::: {#materials-16-07369-t001 .table-wrap}
Actual melting chemical compositions of experimental steels.
Items Chemical Compositions (wt.%)
--------------------- ------------------------------ ------------ ------------ -------- -------- ------------ ------------ -------------- ------------ ------------ ------- ------------ --------
Design compositions 0.06--0.09 0.10--0.20 1.45--1.60 ≤0.015 ≤0.006 0.25--0.35 0.20--0.30 0.045--0.055 0.01--0.02 0.10--0.30 ≤0.01 0.01--0.02 ≤0.005
Actual compositions 0.10 0.13 1.4 0.012 0.005 0.28 0.202 0.047 0.015 0.19 0.007 0.016 /
::: {#materials-16-07369-t002 .table-wrap}
Designed magnesium content of the experimental steels.
Items R M1 M3 M5
------------------ --- -------- --------- ---------
Mg (wt.%) 0 1 3 5
Mg-Zr alloys (g) 0 71.754 215.261 358.770
::: {#materials-16-07369-t003 .table-wrap}
Size distribution of HAZ inclusions in each experimental steel.
Items R M1 M3 M5
------------ ------- ----- ----- ----- ----
\<0.5 68 116 171 242
0.5--1.0 26 77 76 137
1.0--2.0 12 44 33 82
2.0--3.0 9 8 13 60
3.0--5.0 7 10 23 58
5.0--10.0 7 9 23 36
10.0--20.0 2 22 37 24
\>20 2 5 32 18
::: {#materials-16-07369-t004 .table-wrap}
Lattice mismatch of the inclusions and ferrite in experimental steels \[[@B33-materials-16-07369],[@B34-materials-16-07369],[@B35-materials-16-07369]\].
Inclusion Lattice Constant/(10^−8^ cm) Mismatch (%)
----------- ------------------------------ -------------- ------- -----
MnS 5.224 5.224 5.224 8.8
MgO 4.216 4.216 4.216 2.8
::: {#materials-16-07369-t005 .table-wrap}
Contrast of the average thermal expansion coefficients.
Substance Austenite MgO
---------------------------------------------- ----------- ------
Thermal expansion coefficient (10^−6^ K^−1^) 23.2 13.8
::: {#materials-16-07369-t006 .table-wrap}
Inclusion of chemical composition point analysis results of the welding HAZ in Mg-added steels.
Position S Mn Mg Fe
---------- ------ ------ ------ -------
1 0.66 0.59 2.66 39.34
2 0.80 0.71 2.23 60.37
3 0.69 0.82 0.56 79.69
4 \- 0.75 \- 98.34
|
using Microsoft.AspNetCore.Mvc;
using System;
using System.Collections.Generic;
using System.Linq;
using System.Threading.Tasks;
using AutoMapper;
using Swashbuckle.AspNetCore.Annotations;
using TPC_UPC.Domain.Services;
using TPC_UPC.Resources;
using TPC_UPC.Domain.Models;
using TPC_UPC.API.Extensions;
namespace TPC_UPC.Controllers
{
[ApiController]
[Route("/api/universities/{universityId}/faculties")]
public class UniversityFacultiesController : ControllerBase
{
private readonly IFacultyService _facultyService;
private readonly IMapper _mapper;
public UniversityFacultiesController(IFacultyService facultyService, IMapper mapper)
{
_facultyService = facultyService;
_mapper = mapper;
}
[SwaggerOperation(
Summary = "List all faculties of a university",
Description = "List of faculties of a specific university",
OperationId = "ListAllfacultiesOfAUniversity")]
[SwaggerResponse(200, "List of all faculties of a university", typeof(IEnumerable<FacultyResource>))]
[HttpGet]
[ProducesResponseType(typeof(IEnumerable<FacultyResource>), 200)]
public async Task<IEnumerable<FacultyResource>> GetAllAsync(int universityId)
{
var faculties = await _facultyService.ListByUniversityIdAsync(universityId);
var resources = _mapper
.Map<IEnumerable<Faculty>, IEnumerable<FacultyResource>>(faculties);
return resources;
}
}
}
|
package org.beanpod.switchboard.util;
import static org.junit.jupiter.api.Assertions.assertEquals;
import static org.mockito.ArgumentMatchers.any;
import static org.mockito.Mockito.when;
import java.nio.file.attribute.UserPrincipal;
import java.util.Date;
import java.util.List;
import java.util.TimeZone;
import javax.servlet.http.HttpServletRequest;
import org.beanpod.switchboard.dao.DeviceDaoImpl;
import org.beanpod.switchboard.dao.UserDaoImpl;
import org.beanpod.switchboard.dto.DeviceDto;
import org.beanpod.switchboard.dto.StreamDto;
import org.beanpod.switchboard.dto.mapper.DeviceMapper;
import org.beanpod.switchboard.dto.mapper.UserMapper;
import org.beanpod.switchboard.entity.EncoderEntity;
import org.beanpod.switchboard.entity.UserEntity;
import org.beanpod.switchboard.fixture.EncoderFixture;
import org.beanpod.switchboard.fixture.LogFixture;
import org.beanpod.switchboard.fixture.StreamFixture;
import org.beanpod.switchboard.fixture.UserFixture;
import org.beanpod.switchboard.repository.LogRepository;
import org.junit.jupiter.api.BeforeEach;
import org.junit.jupiter.api.Test;
import org.mockito.InjectMocks;
import org.mockito.Mock;
import org.mockito.MockitoAnnotations;
class MaintainDeviceStatusTest {
public static UserEntity user;
private static List<EncoderEntity> encodersList;
private static EncoderEntity encoderEntity;
private static StreamDto streamDto;
private final DateUtil dateUtil = new DateUtil();
@Mock HttpServletRequest httpServletRequest;
@Mock UserPrincipal userPrincipal;
@Mock UserDaoImpl userDao;
@Mock UserMapper userMapper;
@InjectMocks private MaintainDeviceStatus maintainDeviceStatus;
@Mock private DeviceDaoImpl deviceService;
@Mock private DeviceMapper deviceMapper;
@Mock private LogRepository logRepository;
@BeforeEach
public void setup() {
encodersList = EncoderFixture.getListOfEncoder();
encoderEntity = encodersList.get(0);
streamDto = StreamFixture.getStreamDto();
user = UserFixture.getUserEntity();
MockitoAnnotations.initMocks(this); // to be able to initiate maintainDeviceStatus object
UserMockUtil.mockUser(user, httpServletRequest, userPrincipal, userDao);
}
@Test
final void testMaintainStatusFieldForDecodersAndEncoders() {
// TEST CASE 1: status field should be updated to offline
// update device information
encoderEntity.getDevice().setStatus("online");
TimeZone.setDefault(TimeZone.getTimeZone("UTC"));
Date date = dateUtil.getCurrentDate();
// -15 minutes from now
date.setTime(System.currentTimeMillis() - 900000);
encoderEntity.setLastCommunication(date);
DeviceDto deviceDto = deviceMapper.toDto(encoderEntity.getDevice());
when(deviceService.save(user, deviceDto)).thenReturn(deviceDto);
when(logRepository.save(any())).thenReturn(LogFixture.getLogEntity());
maintainDeviceStatus.maintainStatusField(encodersList);
assertEquals("offline", encoderEntity.getDevice().getStatus());
// TEST CASE 2: status field should be updated to online
// -8 minutes from now
date.setTime(System.currentTimeMillis() - 480000);
(encodersList.get(0)).setLastCommunication(date);
maintainDeviceStatus.maintainStatusField(encodersList);
assertEquals("online", encodersList.get(0).getDevice().getStatus());
// The following tests are testing the conditions in the if-else statement
// TEST CASE 3
// -8 minutes from now
date.setTime(System.currentTimeMillis() - 480000);
(encodersList.get(0)).setLastCommunication(date);
maintainDeviceStatus.maintainStatusField(encodersList);
assertEquals("online", encodersList.get(0).getDevice().getStatus());
// TEST CASE 4
// -8 minutes from now
date.setTime(System.currentTimeMillis() - 900000);
encodersList.get(0).getDevice().setStatus("offline");
(encodersList.get(0)).setLastCommunication(date);
maintainDeviceStatus.maintainStatusField(encodersList);
assertEquals("offline", encodersList.get(0).getDevice().getStatus());
}
@Test
final void testMaintainStreamStatusFieldOffline() {
DeviceDto deviceDto = streamDto.getInputChannel().getDecoder().getDevice();
deviceDto.setStatus("offline");
DeviceDto deviceDto1 = streamDto.getOutputChannel().getEncoder().getDevice();
deviceDto1.setStatus("offline");
maintainDeviceStatus.maintainStatusField(streamDto);
assertEquals("online", deviceDto.getStatus(), "Status attribute is expected to be online");
assertEquals("online", deviceDto1.getStatus(), "Status attribute is expected to be online");
}
@Test
final void testMaintainStreamStatusOnline() {
DeviceDto deviceDto = streamDto.getInputChannel().getDecoder().getDevice();
deviceDto.setStatus("online");
DeviceDto deviceDto1 = streamDto.getOutputChannel().getEncoder().getDevice();
deviceDto1.setStatus("online");
maintainDeviceStatus.maintainStatusField(streamDto);
assertEquals("online", deviceDto.getStatus(), "Status attribute is expected to be online");
assertEquals("online", deviceDto1.getStatus(), "Status attribute is expected to be online");
}
}
|
filtering by domain
I want to filter my pcap file by their domains. I mean, I want to see the packets comes on a website ends with ".com", ".org" or ".net".
I tried:
dns contains "com",
ip.src_host == com,
ip.src_host == com,
http contains "com". None of them worked correctly.
Are these saved capture files your are trying to filter or running capture files? from http://www.wireshark.org/docs/wsug_html_chunked/ChAdvNameResolutionSection.html The resolved names are not stored in the capture file or somewhere else. Resolved DNS names are cached by Wireshark.
They are already captured files. Thank you for ur answer Thaddeus.
Assuming it's http web traffic, try http.host contains ".com"
Better yet, try http.host matches "\.com$"
Neither one will require DNS resolution since they search on the web host.
From http://wiki.wireshark.org/DisplayFilters
The matches operator makes it possible to search for text in string fields
and byte sequences using a regular expression, using Perl regular expression
syntax. Note: Wireshark needs to be built with libpcre in order to be able to
use the matches operator.
May I ask, when I write "http" as filter, I cant see any packet. However, when I write "tcp.port == 80", i can see many packet. Do u think why it happens like that?
|
User:Elvtf99/citing sources
|
package org.wikipedia.savedpages;
import android.os.Parcel;
import android.os.Parcelable;
import org.json.JSONException;
import org.json.JSONObject;
import org.wikipedia.page.PageTitle;
import org.wikipedia.Utils;
import org.wikipedia.WikipediaApp;
import org.wikipedia.page.Page;
import java.io.*;
import java.util.Date;
public class SavedPage implements Parcelable {
public static final SavedPagePersistenceHelper PERSISTENCE_HELPER = new SavedPagePersistenceHelper();
private final PageTitle title;
private final Date timestamp;
public SavedPage(PageTitle title, Date timestamp) {
this.title = title;
this.timestamp = timestamp;
}
public SavedPage(PageTitle title) {
this(title, new Date());
}
public PageTitle getTitle() {
return title;
}
public Date getTimestamp() {
return timestamp;
}
@Override
public boolean equals(Object o) {
if (!(o instanceof SavedPage)) {
return false;
}
SavedPage other = (SavedPage) o;
return title.equals(other.title);
}
@Override
public int hashCode() {
return title.hashCode();
}
@Override
public String toString() {
return "SavedPage{"
+ "title=" + title
+ ", timestamp=" + timestamp.getTime()
+ '}';
}
@Override
public int describeContents() {
return 0;
}
@Override
public void writeToParcel(Parcel dest, int flags) {
dest.writeParcelable(getTitle(), flags);
dest.writeLong(getTimestamp().getTime());
}
private SavedPage(Parcel in) {
this.title = in.readParcelable(PageTitle.class.getClassLoader());
this.timestamp = new Date(in.readLong());
}
public static final Creator<SavedPage> CREATOR
= new Creator<SavedPage>() {
public SavedPage createFromParcel(Parcel in) {
return new SavedPage(in);
}
public SavedPage[] newArray(int size) {
return new SavedPage[size];
}
};
/**
* Gets the base directory for all saved pages.
* (will be something like /data/data/org.wikimedia/files/savedpages)
* @return Base directory for saved pages, inside the app's private storage space.
*/
public static String getSavedPagesDir() {
return WikipediaApp.getInstance().getFilesDir() + "/savedpages";
}
/**
* Gets the base directory for this page's saved files.
* The name of the directory is the MD5 sum of the page title (to account for special
* or unicode characters in the title).
* @return Base directory for the saved files for this page, inside the
* overall base directory for saved pages.
*/
String getBaseDir() {
// Make the folder name be based on the complete PageTitle object,
// which includes title, site info, etc.
String dir = getSavedPagesDir() + "/" + title.getIdentifier();
(new File(dir)).mkdirs();
return dir;
}
/**
* Gets a File object that represents the JSON contents of this page.
* @return File object used for reading/writing page contents.
*/
private File getContentsFile() {
return new File(getBaseDir() + "/content.json");
}
/**
* Gets the file that has the URL mappings in JSON of this page.
* @return File object used for reading/writing page contents.
*/
private File getUrlMapFile() {
return new File(getBaseDir() + "/urls.json");
}
/**
* Writes the contents of this page to storage.
* (Each page is stored in a separate directory)
* @param page Page object with the contents of the page to be written.
* @throws IOException
*/
public void writeToFileSystem(Page page) throws IOException {
Utils.writeToFile(getContentsFile(), page.toJSON());
}
/**
* Writes a map of all URL mappings to a file inside the saved page directory.
* @param jsonObject contains mapping of URLs (originals to file paths)
* @throws IOException
*/
public void writeUrlMap(JSONObject jsonObject) throws IOException {
Utils.writeToFile(getUrlMapFile(), jsonObject);
}
/**
* Reads the contents of this page from storage.
* @return Page object with the contents of the page.
* @throws IOException
* @throws JSONException
*/
public Page readFromFileSystem() throws IOException, JSONException {
return new Page(Utils.readJSONFile(getContentsFile()));
}
public JSONObject readUrlMapFromFileSystem() throws IOException, JSONException {
return Utils.readJSONFile(getUrlMapFile());
}
/**
* Deletes any stored files that are associated with this page.
* (Removes the entire directory and any files in it)
*/
public void deleteFromFileSystem() {
Utils.delete(new File(getBaseDir()), true);
}
}
|
When Mr. Rothschild aslu'd me to give an account of tlie niorpliology of C'/ifrra.i-es and allies, he did so with the special view of ascertaining such facts as might help, on the one hand, to define the genera that form the snlijert of this monograph more accnratelj' than had hitherto been done, and, on the other hand, to find ont the affinities of the species within each genus. As the obje('t of this account is thus restricted, I have dealt with those parts of the body only wliich exhibit peculiar characters that can be understood without an extensive comparison with the structure of other liutterflies aud of which the bearing on classification is also more obvious. Besides the wing, I have taken into account the structure of the legs and the end of the abdomen, in so far as these parts furnish distinguishing characters whicli are of value for the purposes to be served by this monograph.
It is well known that the scales of the wings are arranged in rows which run at right angles (or nearly so) to the veins. On the npperside the veins of GIutraa-eK and other Xymphalids are little prominent in the outer region of the wing, being longitudinally impressed, as shown by f 10 (PI. XIIL). The rows of scales nm right across the veins, though the scales themselves are mostly more elongate npon and near the veins. The costal edge of the wing is somewhat thickened in front of the costal nervure, this vein-like thickening, or false vein, as well as the extreme edge of the wing being densely scaled in most Lepidoptera. In the denuded wing (PI. XIIL f. 8, Parthp.nos) one sees the rows of scale-sockets extend close to the costal edge ; the edge itself is entire, thin, membraneous, in the normal Nymphalid wing. The scales at the costal edge are strongly inserted and cannot easily be rubbed off.
On the underside the veins are convex, except the second submediau one of the hindwing, which is concave below. In most Lepidoptera the rows of scales cross the veins, as in f. (S (PI. XIIL), but in a great many instances, namely in most (not all) Lepidoptera with very prominent neuration, the veins are scaleless ; in some cases the sockets of the scales, or the impressed punctures into wliich the scales are inserted, are still traceable, while in others {Charaxes, Palla, Kulepis, Euxanthe, PapiUo, etc.) all traces of the scaling are lost on the veins, at least in the distal region of the wings. The costal edge of the forewing appears generally more vein-like below than above ; the vein-like structure is divided by a furrow into an anterior narrow and a posterior wider portion. The rows of scales, which are regular, extend also below to the very edge of the wing (PI. XIIL f. 9).
In Eulrpix, Charaxes, Euxanthe, and Palla the costal edge has undergone a v ry peculiar modification, the edge not being entire, but serrate, as has been noticed by several authors (Trimen, Moore, etc.).* The rows of scale-sockets are seen in f. 3 (PI. XIIL) to extend to the very edge of the wing, which is not membraneous as in f. 8 ; the scale-sockets are deeply impressed and the vein-like edge of the wing is somewhat raised behind them, so that in a view from above the costal margin appears serrate nr toothed, the serration being formed by ridges running round the thickened costal edge to tlie underside. In V.nxantht' and Palla,
* Snellen remarks in lijdsch: r. Ent. XXXVHI. p. ir. (189,'i) that the serration of the costal edge of the forewing of Charaxes iias, to his knowledge, not liccn noticed by other nnthors. Trimen, however, mentioned that peculiarity of " C7i«ra.r(»" already in his SkuIIi African litiHerJiiet, ed. 1 1.
|
Use the new NoContractsFromMethod
Depends on https://github.com/eisop/checker-framework/pull/878
Also tests whether the EISOP CI picks up this corresponding branch in the reference checker.
EISOP CI build correctly picks up this branch and is successful.
I'll merge the two PRs together once they're approved.
In CI I notice this failure:
FAILURE: Build failed with an exception.
* What went wrong:
Circular dependency between the following tasks:
:jspecify:classes
\--- :jspecify:compileJava
\--- :jspecify:jar
+--- :jspecify:classes (*)
+--- :jspecify:compileJava (*)
+--- :jspecify:compileJava9Java
| \--- :jspecify:jar (*)
\--- :jspecify:java9Classes
\--- :jspecify:compileJava9Java (*)
(*) - details omitted (listed previously)
The same problem can be reproduced with main, meaning it doesn't depend on this PR and doesn't depend on changes in EISOP.
I can reproduce it with jspecify-reference-checker in the main branch using an --include-build ../jspecify configuration.
However, I didn't figure out how to trigger the circular dependency directly in the jspecify build.
When I go into jspecify and execute git checkout 0394cfed29ae86d75ad327dc9df9697e0b9b90a6, that is, if I use the state before https://github.com/jspecify/jspecify/pull/605, the build of the reference checker succeeds.
So something about https://github.com/jspecify/jspecify/pull/605 is breaking the build of the reference checker.
@cpovirk Any idea?
I'll merge this PR to make main-eisop compile against the updated EISOP. I'll turn the previous comment into a new issue.
|
Thompson (weapon)
Campaign
Multiplayer
Call of Duty: Finest Hour
Campaign
Multiplayer
Call of Duty 2: Big Red One
Call of Duty 3
Campaign
Multiplayer
Call of Duty: Roads to Victory
Call of Duty: World at War
- Create a class description.
Campaign
Multiplayer
It can be bought for 1200 points, and ammo costs 600 points. It is a good weapon, especially in the early to mid rounds, due to its good accuracy, fire rate and high short-range power. In higher rounds it loses its effectiveness quickly, and requires several shots to take down a single Zombie, making headshots a priority.
Weapon Attachments
* Suppressor
* Aperture Sight
* Round Drum
Call of Duty: World at War: Final Fronts
Call of Duty World at War (DS)
Campaign
Multiplayer
Call of Duty: Black Ops
Trivia
* In a third person view the player model holds the weapon by the stock.
* In Call of Duty 2, two versions of the Thompson can be found; semi-auto, and full-auto.
* The Thompson is the first automatic weapon to be used in the Call of Duty series.
Video
cKeR-IWDdj8=18!
Gameplay with the Thompson in Call of Duty: World at War
|
Method and system for database management for data mining
ABSTRACT
Customer data is displayed to a user for making decisions in dealing with customers. The displayed data is generated based upon characteristic rules that are generated with respect to predetermined data definition information on the customer data. After confirming the effect of adding or deleting certain conditions to and from characteristic data segments as specified by the characteristic rules, the user selects a segment of particular interest. Subsequently, the user specifies certain similar customers from the selected segment to be used for speculation based upon a speculation model so that the speculation model has a relatively high precision level. Additionally, the user modifies the conditions on the speculation results to further understand the bases for the inclusion of the customers in the speculation. The user considers the future course of action towards certain customers based upon the above understandings.
This is a continuation of prior application Ser. No. 09/994,951 filed on Nov. 27, 2001 under 35 C.F.R. 1.53(b).
FIELD OF THE INVENTION
The current invention is generally related to a database analysis technology, and more particularly related to the generation of a customer list based upon a certain predetermined purpose using a speculation model.
BACKGROUND OF THE INVENTION
In the recent years, magnetic cards and IC cards have been widely used in combination with computer equipment. With the above cards, customer databases have been developed and maintained in various industries such as department stores, specialty boutiques, consumer electronics retailers and super markets. The above databases include customer characteristic information such as names and addresses as well as other information such as accumulated purchase data. Similarly, transactions are maintained in the databases for the financial industry while data called call detail data are maintained in the databases for the telecommunication industry. For example, the call detail data include a caller number, a recipient number and call duration for each call. Based upon the above described databases, one exemplary service is Customer Relationship Management (CRM) for providing quality service.
Another exemplary use of the above described databases is data mining that semi automatically extracts certain information by analyzing a large volume of database data. In particular, data mining includes rule induction, Memory Based Reasoning (MBR), On-Line Analytical Processing (OLAP), and the these exemplary data mining methods are disclosed in “Data Mining Techniques For Marketing, Sales and Customer Support,” pp. 120-123, John Wiley & Sons, Inc (1997). Rule induction generally extracts certain International Conference on Systems, Man, and Cybernetics,” p.V.-882-886. For one example of MBR, as disclosed in the above “Data Mining Techniques For Marketing, Sales and Customer Support” at p.120, a certain future event is evaluated based upon similar to a known event in the database. For example, the occurrence of the future event is quantified based upon the known similar event or the future event is classified based upon the known similar event. Finally, for OLAP, as disclosed in the above “Data Mining Techniques For Marketing, Sales and Customer Support” at p.123, a significant pattern in the data is explored, and the result is displayed based upon a multidimensional database. By combining the induction rule and OLAP techniques, one way to improve the precision of the MBR-based prediction is disclosed in “Customer Relationship Management Through Data Mining,” Proceedings of Informs Seoul, P1956-1963, (2001).
In the above described combination of prior art, the last exemplary prior art is designed to predict or speculate on a certain segment of the data based upon a predetermined rule. However, in the last exemplary prior art, a user is not able to specify an additional rule and or to delete any existing rules based upon his or her opinion or other circumstances. The user is not able to ascertain certain characteristics of the segment such as a number of customers. For the above reasons, it is desired that a user specifies an additional rule and or to delete any existing rules based upon his or her opinion or other circumstances to ascertain certain characteristics of the data segment. It is also desired to display or identify any user-specified conditions on the results.
SUMMARY OF THE INVENTION
In order to solve the above and other problems, according to a first aspect of the current invention, a method of database management includes the steps of: generating characteristic rules based upon data definition information and data, the data definition information including items specifying analysis and conditions; generating a multidimensional database based upon the characteristic rules, the data and the data definition information, the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension; selecting one of the characteristic rules; extracting a selected segment and a speculation data list from the data based upon the condition items and the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list; generating a speculation model base upon the data, the selected segment and the speculation data list; selecting one of the speculation models; and outputting speculation results based upon the speculation model and the speculation data list.
According to a second aspect of the current invention, a system for data mining a database includes: a data storage unit for storing data definition information and data, the data definition information including items specifying analysis and conditions; a characteristic rule generation unit connected to the data storage unit for generating characteristic rules based upon the data definition information and the data, the characteristic rules being stored in the data storage unit; a segment selection unit connected to the data storage unit for generating a multidimensional database based upon the characteristic rules, the data and the data definition information, the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension, the multidimensional database being stored in the data storage unit; a user interface unit connected to the data storage unit for selecting one of the characteristic rules and one of the speculation models; and a speculation processing unit connected to the storage unit and the processing unit for extracting a selected segment and a speculation data list from the data based upon the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list, the speculation processing unit generating a speculation model based upon the data, the selected segment and the speculation data list, the speculation processing unit outputting speculation results based upon the selected one of the speculation models and the speculation data list.
A third aspect of the current invention provides a storage medium for storing computer executable instructions for managing a database. The computer executable instructions perform the steps of: generating characteristic rules based upon data definition information and data, the data definition information including items specifying analysis and conditions; generating a multidimensional database based upon the characteristic rules, the data and the data definition information, the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension; selecting one of the characteristic rules; extracting a selected segment and a speculation data list from the data based upon the condition items and the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list; generating a speculation model base upon the data, the selected segment and the speculation data list; selecting one of the speculation models; and outputting speculation results based upon the speculation model and the speculation data list.
These and various other advantages and features of novelty which characterize the invention are pointed out with particularity in the claims annexed hereto and forming a part hereof. However, for a better understanding of the invention, its advantages, and the objects obtained by its use, reference should be made to the drawings which form a further part hereof, and to the accompanying descriptive matter, in which there is illustrated and described a preferred embodiment of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagram illustrating one preferred embodiment of the system for generating speculation results according to the current invention.
FIG. 2 is a table illustrating one example of the customer data used in the current invention.
FIG. 3 is a diagram illustrating one example of the data definition information used in the current invention.
FIG. 4 is a table illustrating one example of the characteristic rule sets used in the current invention.
FIG. 5 is a diagram illustrating an exemplary multidimensional display according to the current invention.
FIG. 6 is a diagram illustrating one exemplary display screen certain conditions are modified in one preferred embodiment of the system according to the current invention.
FIG. 7 is a flow chart illustrating steps involved in a preferred process of the speculation model generation/selection according to the current invention.
FIG. 8 is a diagram illustrating exemplary speculation results that are obtained by one preferred process according to the current invention.
FIG. 9 is a diagram illustrating exemplary results of the selected speculation model 110 according to the current invention.
FIG. 10 is a diagram illustrating one example of the speculation result according to the current invention.
FIG. 11 is a diagram illustrating a flow of one example of the collective speculation process with one preferred embodiment according to the current invention.
FIG. 12 is a diagram illustrating another preferred embodiment of the system for generating speculation results according to the current invention
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT(S)
In the drawings, a same reference numeral designates a same element throughout all the views of the same element. Now referring to FIG. 1, one preferred embodiment of a system for generating speculation results according to the current invention includes a characteristic rule generation processing unit 103, a segment selection unit 106, a speculation model generation unit 109 and a speculation processing unit 111. In general, customer data 101 and data definition information 102 are inputted into the characteristic rule generation processing unit 103, and the characteristic rule generation processing unit 103 outputs characteristic rule sets 104. Based upon the customer data 101, the data definition information 102, the characteristic rule sets 104 and user-defined data 105, the segment selection unit 106 outputs speculation data lists or selected customer lists 107 and selected segments 108. Subsequently, based upon the customer data 101, the data definition information 102 and the selected segment 108, the speculation model generation unit 109 generates speculation models 110. Finally, based upon the selected customer lists 107 and the speculation models 110, the speculation processing unit 111 generates speculation results 112.
Still referring to FIG. 1, each of the above processing units 103 processes information in a predetermined sequence and manner. According to a predetermined rule such as an if-then, the characteristic rule generation processing unit 103 extracts certain characteristic information to generate the characteristic rules 104 based upon the customer data 101, which includes at least one record, each of which contains at least one record entry. After the characteristic rules 104 are generated by the characteristic rule generation processing unit 103, the segment selection unit 106 determines the structure of the multi-dimensional database based upon the data definition information 102. The condition items in the data definition information 102 correspond to the key dimensions in the multi-dimensional database while the conclusion items correspond to the analysis dimensions. After the dimensional structure is determined, the characteristic rule generation processing unit 103 loads the customer data 101 and generates the multi-dimensional database. In other words, the above segment selection process includes two types of tasks. One task is to generate multidimensional database using the condition items as columns and rows, and the conclusion items as analysis results. The other task is to output the selected customer list with the selected segment data into the above created multidimensional cells. A user 105 is now involved to select one of the condition items in the characteristic rules 104. In response to the above user selection, a display screen is generated to display cell values as the conclusion items in the columns and rows which specify the condition items.
One example of the customer data 101 is illustrated in FIG. 2. The exemplary customer data 101 is generally organized by the month, including March, April and May. Within each month, the first column is a customer number or ID to identify a customer, and for each identified customer, a record including information on predetermined items such as gender, age, profit amount and cancellation status. Within March, the cancellation status reflects an event between the beginning and the end of March. On the other hand, information other than the cancellation status for the March records is based upon the information at the end of January. For example, the customer having ID=00002 has cancelled the continuous activity or subscription during the month of March as indicated by “1” in the cancelled customers column. Similarly, data in April and May have the above described time frame. Because of the non-cancellation information of the customer having ID=0002 from March, the April record contains the customer information for ID=0002. However, every one of the April record lacks the information on the cancellation status. Furthermore, in the May record, the customer information for ID=0002 is no longer included based upon the above two-month rule. Based upon the above exemplary data in April, June data will not be constructed.
Now referring to FIG. 3, one example of the data definition information 102 is illustrated. The data definition information 102 is used for generating the characteristic rule sets 104, for selecting the selected customer list 107 and for generating speculation models 110. The items used in generating the characteristic rule sets 104 include conditions items such as gender, age, profit amount, product model and residence. The above rule generation items in generating the characteristic rule sets 104 also include conclusion items such as cancellation customers. In the characteristic rule generation processing unit 103, the condition items include an “IF” portion of the IF-THEN rule while the conclusion items include a “THEN” portion. Under the layer structure, gender and age are used. Under gender and age, there are number of member classifications. Gender has male and female member classifications while age has five age categories or member classifications. A combination of the above condition items and the above member classifications of the layer structure defines a speculated segment that is a portion of data to be speculated. In the above example, the speculated segment is a portion of the customer data that is defined by the above described combined conditions. For example, the speculated segment is expressed by age=20˜24 & gender=female & profit amount=$300˜$400. One rule generation technique is disclosed in “Proceedings of 1999 IEEE International Conference on Systems, Man, and Cybernetics,” p.V.-882-886, which is incorporated by reference herewith.
Now referring to FIG. 4, one example of the characteristic rule sets 104 is illustrated based upon the March data of the customer data 101. A first column includes entry items such as numbers while the rest of the columns each includes one rule. A rule sentence in the second column is written in the “if . . . then” format. For example, if the age is between twenty and twenty-four and the gender is female, license is cancelled. A rule/condition in the third column is a ratio between the number of records that satisfy the 200 people satisfy the rule portion while 50 people satisfy both the rule and condition portions rule and the number of records that satisfy only the condition portion of the rule. A precision level in the fourth column is a ratio between the number of records satisfying the rule and the number of records satisfying the condition.
Now referring to FIG. 5, an exemplary multidimensional display is illustrated. In this example, the rule No. 1 in FIG. 4 is selected. The selected rule is that if the age is between twenty and twenty-four and the gender is female, license is cancelled. Based upon the above selected rule, a multidimensional display screen displays condition items as well as conclusion items. The multidimensional display includes rows for displaying age groups and columns for displaying gender. In each cell of the multidimensional display, the above ratio between the number of cancelled customers according to the rule and a total number of customers is displayed as a conclusion item. The above ratio value is automatically calculated by the system according to the current invention. The cells that meet the conditions used in the selected rule are in a particular predetermined color in order to distinguish at a first glance from other conditions that are not used in the rule. Other conditions are displayed as pages of the multidimensional database.
Still referring to FIG. 5, the display is modifiable. A user compares the cell values of particular interest under the selected conditions to other cell values in order to determine the validity or significance of the selected rule. Furthermore, the user constructs other displays or speculation models and selects a segment to be used for the speculation models by observing cell value changes after adding and deleting the conditions. The addition and deletion of the conditions are generally based upon the user's opinion and experience or even by trials and errors. The conditions are changed by multi-dimensional database functions such as drill up, drill down, slice and dice. One way to add a condition is to drill down a page of the multi-dimensional database and to select a slice. To delete a condition, either a column or a row of a page in the multi-dimensional database is drilled up. For example, the user moves a pointing device such as a mouse on a triangle or an area indicating “ALL” in the profit amount and clicks the right mouse button on the mouse to drill down to display drill down selection items such as “over $400,” “$300-$400,” “$200-$300,” “$100-$200,” “$50-$100,” “$0-$50” and “less than $0.” A new condition is added by selecting a slice or a menu selection item of $300-$400 with the left mouse button to replace the currently selected all amounts. After a combination of the conditions is modified, the system of according to the current invention immediately displays the recalculated results based upon the changes.
Now referring to FIG. 6, one exemplary display screen illustrates immediately calculated results after certain conditions are modified in one preferred embodiment of the system according to the current invention. Through the above exemplary change in conditions, the user has added a new condition by drilling down the profit amount to select a slice of $300-$400 from the currently selected all amounts. After the above addition of a new condition, the user has observed that the cell value of particular interest such as female between twenty years old and twenty-four years old has changed from 27% to 24%. In comparison to other cell values such as 16% for the counter part males of between twenty years old and twenty-four years old and 9% for females between twenty-five years old and thirty-four years old, the above 24% figure is still too high for cancellation. The above percentage figure in each cell is converted into a number of customers by changing the analysis item. Based upon the percentage figure and the customer numbers, the user constructs speculation models to determine whether or not the segment is worthwhile for predictions. An example of deleting a condition in the above example to restore the profit amount to the originally selected all-amount condition. As described above, the user focuses upon a certain cell after he or she adds or deletes conditions to see the cell values in the certain cells and cells around the certain cells.
Still referring to FIG. 6, after the user added the condition on the profit amount of $300-$400 in combination with the existing conditions of age=20 through 24and the gender=female, the above conditions determine the selected segment 108 as shown in FIG. 1. Using a pointing device such as a mouse, a particular cell is selected as a target cell for speculation. Furthermore, a set of predetermined functions is also displayed for the selected cell when the user initiates the menu. For example, the menu display is initiated by a right mouse button while the cell is selected by a left mouse button. Within the function menu, the user selects a desired function by the left mouse button. Assuming that the user selects the selected customer list generation in the function menu and the March data is currently being displayed, the selected customer list 107 is selected from the customer data 101 from May or two months after the current data and only from a portion that satisfies the imposed conditions 108. The month for the above analysis is automatically selected to be two months after the currently selected month. As described above with respect to FIG. 2, certain portions of the data other than a specified data such as the cancellation status are automatically taken from two month earlier. Next, assuming that the user selects the speculation mode generation in the function menu, the speculation model generation unit 109 automatically generates an optimal speculation model based upon the conditions that the user has selected for the above described segment selection process or unit 106. Lastly, assuming that the user selects the speculation in the function menu, the speculation processing unit 111 automatically concludes the speculation results 112 based upon the selected customer list 107 and the speculation models 110. The speculation algorithm is substantially the same as the algorithm used for speculating the potential cancelled customers or possibility for the cancelled customers. The speculation algorithms include the prior art techniques that have been disclosed in the background section of the current application. The speculation item in the function menu remains disabled until the selected customer list 107 and the speculation models 110 have been selected and successfully completed.
Now referring to FIG. 7, a flow chart illustrates steps involved in a preferred process of the speculation model generation/selection according to the current invention. The steps are described with respect to the units and the data as shown in FIG. 1. In a step 701, a portion of the customer data 101 is selected according to the data definition information 102. In the step 701, the selected portion is further refined to extract records that satisfy the conditions as set forth in the selected segments 108. In a step 702, the extracted records in the step 701 are divided into model candidate data and validating data. For example, the division is accomplished by randomly sampling sixty percent of the records as the model candidate data while the remaining forty percent as the validation data. Alter the division in the step 702, the conditions as defined in the data definition information 102 are comprehensively combined to generate in combination with the conclusion items in a step 703. For example, the above generated combinations of the conditions include a) gender & age; b) gender & profit amount and c) gender & age & profit amount. Based upon the above combined conditions as inputs and the conclusion items of the data definition information 102 as outputs, speculation models are generated in the step 703. In a step 704, it is determined whether or not each of the above generated speculation models in the step 703 has been already verified in a verification step 706. If it is determined in the step 704, the model has not been already validated, a model candidate selection process is performed in a step 705. In the model candidate selection step 705, an unverified model is selected for verification. In the verification step 706, only data corresponding to the items in the model selected in the step 705 is extracted from the model candidate data from the division step 702. Based upon the above extracted data, the memory based reasoning (MBR) model is constructed in the step 706. Finally, for each of the records in the validation data that has been generated in the division step 702, speculation is performed in the verification step 706. On the other hand, if it is determined in the step 704 that the model has been already validated, the preferred process proceeds to a step 707 where a model selection takes place. Based upon the mean square error comparison, the speculation model with the least mean square error value is selected in the model selection step 707, and the preferred process terminates in a step 708.
Now referring to FIG. 8, a diagram illustrates exemplary speculation results that are obtained by the step 706 of the preferred process according to the current invention. A point in the graph is marked by a double-circle to indicate a piece of data that has been speculated by the above described process. Four points in the graph are each marked by a single circle within a dotted circle to indicate four pieces of data that are adjacent to the above speculated data point. Among the four adjacent data records, three records represent cancelled customer No. 1 while one record represents cancelled customer No. 0. Based upon the above results, the probability for cancellation by the customer No. 1 is ¾ or 75%. Similarly, the cancellation probability is speculated for each customer in the verification data. To evaluate the speculation models, the mean square error is determined for each model based upon the verification data and the actual customer cancellation data. Based upon the mean square error comparison, the speculation model with the least mean square error value is selected in the model selection step 707.
Now referring to FIG. 9, exemplary results of the selected speculation model 110 are illustrated in a diagram. The used data is data that is used for speculation while the used speculation items are items that are used as condition items and conclusion items for speculation. The segment condition is a set of conditions that are to be satisfied by the records for the speculation model. In the above example, March data from the customer data 101 is used for speculation. In the same example, the condition items include occupation, profit amount and residence while the conclusion items include cancelled customers. The segment conditions include age=20˜24, gender=female and profit amount=$300˜$400.
Now referring to FIG. 10, one example of the speculation results 112 is illustrated in a diagram. The exemplary speculation results 112 generally include a speculation value for a cancelled customer ID number and selection conditions such as segment conditions for a speculation model. The segment condition values from the segment model 110 are substituted in the selection conditions. It is optional to include other customer characteristics such as age and profit amount from the selected customer list. For example, a second row is a record for the customer ID=00036 and its customer cancellation probability is 100% or 1.0. The same customer has become a part of the selected data for speculation since she met the following conditions that age is between 20 and 24, gender is female and the profit amount is between $300 and $400. In fact, the customer is a twenty-one year-old female who generated a profit amount of $320. As described above, the selection condition column is one of the patentable features of the current invention. Based upon the above selection conditions or reasons for selecting a particular customer for speculation, the user determines a course of action for the particular customer. In an alternative embodiment, instead of executing the speculation process 111 after each of the selected segment process 106, more than one segment is selected at a time, and the speculation process 111 speculates to generate the results collectively based upon the above plurality of the selected segments.
Now referring to FIG. 11, one example of the collective speculation processes is illustrated in a flow diagram. The selected customer list 107 includes all the customers that are included in any one of a plurality of the selected segments. Although not shown in FIG. 11, the rule generation items in the data definition information 102 are all included. A speculation model selection process or unit 1101 selects one record at a time from the selected customer list 107 and also selects one speculation model from a speculation model set 1102 for each of the above selected record. The speculation model set 1102 is a collection of more than one speculation model 110 that has been generated in advance based upon the selection segment 108. The speculation model selection process or unit 1101 determines whether or not the selected record meets the segment conditions of each of the speculation models in the speculation model set 1102. The speculation model selection process or unit 1101 inputs any one of the speculation models that meet the segment conditions into a speculation process or unit 111. The speculation process or unit 111 outputs the speculation results 112. The format of the speculation results 112 is illustrated in FIG. 10, and the selection conditions may vary for each record. In one preferred embodiment, the above described steps or flows are associated with a single command from a user rather than separate commands as shown in the function menu items as shown in FIG. 6.
In summary, in the above described preferred embodiments of the data mining system according to the current invention, after confirming the effect of adding or deleting conditions to and from characteristic data segments as specified by the characteristic rules, the user selects a segment of particular interest. Subsequently, the user specifies certain similar customers from the selected segment to be used for speculation so that the speculation model has a relatively high precision level. Additionally, the user modifies the conditions on the speculation results to further understand the bases for the inclusion of the customers in the speculation. The user considers the future course of action towards certain customers based upon the above understandings.
Now referring to FIG. 12, another preferred embodiment of the system for generating speculation results according to the current invention includes a characteristic rule generation processing unit 103, a segment selection unit 106, a speculation model generation unit 109 and a speculation processing unit 111. In general, customer data 101 and data definition information 102 are inputted into the characteristic rule generation processing unit 103, and the characteristic rule generation processing unit 103 outputs characteristic rule sets 104. Based upon the customer data 101, the data definition information 102, the characteristic rule sets 104 and user-defined data 105, the segment selection unit 106 outputs speculation data lists or selected customer lists 107 and selected segments 108. In the second preferred embodiment, based upon the customer data 101, the data definition information 102 and the selected segment 108, the speculation model generation unit 109 generates a predetermined number of speculation models 110 in advance and store them before the user selects a particular speculation model for use. In the second preferred embodiment, the user 105 independently selects one of the speculation models 110. Finally, based upon the selected customer lists 107 and the user selected speculation model 110, the speculation processing unit 111 generates speculation results 112.
It is to be understood, however, that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description, together with details of the structure and function of the invention, the disclosure is illustrative only, and that although changes may be made in detail, especially in matters of shape, size and arrangement of parts, as well as implementation in software, hardware, or a combination of both, the changes are within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed.
1. A method of database management, comprising the steps of: generating characteristic rules based upon data definition information and data, the data definition information including items specifying analysis and conditions; generating a multidimensional database based upon the characteristic rules, the data and the data definition information, the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension; selecting one of the characteristic rules via a predetermined user-interface; extracting a selected segment and a speculation data list from the data based upon the condition items and the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list; generating a speculation model based upon the data, the selected segment and the speculation data list; selecting one of the speculation models while reviewing the extracted and selected segment via the predetermined user-interface; and outputting speculation results based upon the selected one of the speculation models and the speculation data list.
2. The method of database management according to claim 1 further comprising: displaying a portion of the multidimensional database that is corresponding to the selected one of the characteristic rules, the displayed portion being organized in rows and columns to define cells based upon the condition items of the selected one of the characteristic rules, the cells each having a value for the analysis dimension.
3. The method of database management according to claim 1 wherein the data is customer data for maintaining a predetermined subscribed service while the analysis dimension is probability of cancellation of the predetermined subscribed service.
4. The method of database management according to claim 1 wherein said modifying the condition items is accomplished by displaying a predetermined set of the condition items in a pull-down menu and selecting one of the condition items by a pointing device.
5. The method of database management according to claim 1 wherein said generating the speculation model further including additional steps of: dividing the speculation data list into candidate model data and verification data; generating candidate speculation models based upon inputs as specified by combinations of the conditions in the data definition information and outputs as specified by the analysis in the data definition information; verifying each of the candidate speculation models by extracting information from the candidate model data according to the candidate speculation model and speculating based upon the verification data; evaluating the candidate speculation models based upon said verifying to generate evaluation values; and selecting the speculation model from the candidate speculation models based upon the evaluation values.
6. The method of database management according to claim 5 wherein the evaluation values are mean square errors.
7. A method of database management, comprising the steps of: generating characteristic rules based upon data definition information and data, the data definition information including items specifying analysis and conditions; generating a multidimensional database based upon the characteristic rules, the data and the data definition information, the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension; selecting one of the characteristic rules via a predetermined user-interface; extracting a selected segment and a speculation data list from the data based upon the condition items and the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list; generating a speculation model based upon the date the selected segment and the speculation data list; selecting one of the speculation models while reviewing the extracted and selected segment via the predetermined user-interface; and outputting speculation results based upon the selected one of the speculation models and the speculation data list, wherein the speculation results include the selected segment.
8. A system for data mining a database comprising: a data storage unit for storing data definition information and data; a characteristic rule generation unit connected to said data storage unit for generating characteristic rules based upon the data definition information and the data, the data definition information including items specifying analysis and conditions, the characteristic rules being stored in said data storage unit; a segment selection unit connected to said data storage unit for generating a multidimensional database based upon the characteristic rules, the data and the data definition information, the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension, the multidimensional database being stored in said data storage unit; a user interface unit connected to said data storage unit for providing a predetermined user-interface for selecting one of the characteristic rules and one of speculation models while reviewing a selected segment; and a speculation processing unit connected to said storage unit and said processing unit for extracting the selected segment and a speculation data list from the data based upon the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list, said speculation processing unit generating one of the speculation models based upon the data, the selected segment and the speculation data list, said speculation processing unit outputting speculation results based upon the selected one of the speculation models and the speculation data list.
9. The system for data mining a database according to claim 8 further comprising: a processing unit connected to said storage unit and said user interface unit for outputting to said storage unit a first portion of the multidimensional database that is corresponding to the selected one of the characteristic rules, the first portion being organized in rows and columns to define cells based upon the condition items of the selected one of the characteristic rules, the cells each having a value for the analysis dimension, said processing unit also outputting a second portion of the multidimensional database that is corresponding to the modified condition items; and a displaying unit connected to said processing unit and said storage unit for displaying the first portion of the multidimensional database and the second portion of the multidimensional database.
10. The system for data mining a database according to claim 8 wherein the data is customer data for maintaining a predetermined subscribed service while the analysis dimension is probability of cancellation of the predetermined subscribed service.
11. The system for data mining a database according to claim 8 wherein said user interface unit modifying the condition items by displaying a predetermined set of the condition items in a pull-down menu and selecting one of the condition items by a pointing device.
12. The system for data mining a database according to claim 8 wherein said speculation processing unit further comprises: a data dividing unit for dividing the speculation data list into candidate model data and verification data; a candidate model generation unit for generating candidate speculation models based upon inputs as specified by combinations of the conditions in the data definition information and outputs as specified by the analysis in the data definition information; and a verification unit for connected to said candidate model generation unit for verifying each of the candidate speculation models by extracting information from the candidate model data according to the candidate speculation model and speculating based upon the verification data, said verification unit evaluating the candidate speculation models based upon said verifying to generate evaluation values and selecting the speculation model from the candidate speculation models based upon the evaluation values.
13. The system for data mining a database according to claim 12 wherein the evaluation values are mean square errors.
14. A system for data mining a database comprising: a data storage unit for storing data definition information and data; a characteristic rule generation unit connected to said data storage unit for generating characteristic rules based upon the data definition information and the data, the data definition information including items specifying analysis and conditions, the characteristic rules being stored in said data storage unit; a segment selection unit connected to said data storage unit for generating a multidimensional database based upon the characteristic rules, the data and the data definition information, the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension, the multidimensional database being stored in said data storage unit; a user interface unit connected to said data storage unit for providing a predetermined user-interface for selecting one of the characteristic rules and one of speculation models while reviewing a selected segment; and a speculation processing unit connected to said storage unit and said processing unit for extracting the selected segment and a speculation data list from the data based upon the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list, said speculation processing unit generating a one of the speculation models based upon the data, the selected segment and the speculation data list, said speculation processing unit outputting speculation results based upon the selected one of the speculation models and the speculation data list, wherein the speculation results include the selected segment.
15. A storage medium for storing computer executable instructions for managing a database, the computer executable instructions performing the steps of: generating characteristic rules based upon data definition information and data, the data definition information including items specifying analysis and conditions; generating a multidimensional database based upon the characteristic rules, the data and the data definition information, the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension; selecting one of the characteristic rules via a predetermined user-interface; extracting a selected segment and a speculation data list from the data based upon the condition items and the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list; generating a speculation model based upon the data, the selected segment and the speculation data list; selecting one of the speculation models while reviewing the extracted and selected segment via the predetermined user-interface; and outputting speculation results based upon the selected one of the speculation models and the speculation data list.
16. The storage medium for storing computer executable instructions according to claim 15 further comprising: displaying a portion of the multidimensional database that is corresponding to the selected one of the characteristic rules, the displayed portion being organized in rows and columns to define cells based upon the condition items of the selected one of the characteristic rules, the cells each having a value for the analysis dimension.
17. The storage medium for storing computer executable instructions according to claim 15 wherein the data is customer data for maintaining a predetermined subscribed service while the analysis dimension is probability of cancellation of the predetermined subscribed service.
18. The storage medium for storing computer executable instructions according to claim 15 wherein said modifying the condition items is accomplished by displaying a predetermined set of the condition items in a pull-down menu and selecting one of the condition items by a pointing device.
19. The storage medium for storing computer executable instructions according to claim 15 wherein said generating the speculation model further including additional steps of: dividing the speculation data list into candidate model data and verification data; generating candidate speculation models based upon inputs as specified by combinations of the conditions in the data definition information and outputs as specified by the analysis in the data definition information; verifying each of the candidate speculation models by extracting information from the candidate model data according to the candidate speculation model and speculating based upon the verification data; evaluating the candidate speculation models based upon said verifying to generate evaluation values; and selecting the speculation model from the candidate speculation models based upon the evaluation values.
20. The storage medium for storing computer executable instructions according to claim 19, wherein the evaluation values are mean square errors.
21. A storage medium for storing computer executable instructions for managing a database, the computer executable instructions performing the steps of: generating characteristic rules based upon data definition information and data, the data definition information including items specifying analysis and conditions; generating a multidimensional database based upon the characteristic rules, the data and the data definition information the multidimensional database being organized based upon conclusion items and condition items of the characteristic rules, the conclusion items specifying an analysis dimension, the condition items specifying a key dimension; selecting one of the characteristic rules via a predetermined user-interface; extracting a selected segment and a speculation data list from the data based upon the condition items and the selected one of the characteristic rules, the selected segment specifying conditions for selecting the speculation data list; generating a speculation model based upon the data, the selected segment and the speculation data list; selecting one of the speculation models while reviewing the extracted and selected segment via the predetermined user-interface; and outputting speculation results based upon the selected one of the speculation models and the speculation data list, wherein the speculation results include the selected segment.
|
Detect substituted glyphs
Here is how U+261E (manicule) and U+00B6 (pilcrow) are displayed in Pages:
As you can see, all the U+261E and U+00B6 glyphs looks pretty the same across Menlo, Monaco and Courier New (with the exception of pilcrow in Courier New) and across Helvetica Neue and Gill Sans, and for this reason it is not clear to me whether these glyphs are really from their respective fonts or macOS has "borrowed" them from some another font or from multiple fonts (a technique which is known as font substitution).
How I can verify it?
Selecting a character in Pages or TextEdit should show the font being used in the font window.
You can also open Character Viewer and find each of these and then look at the Font Variation panel at bottom right and you can see exactly how each font displays it.
Thanks, this works. The 1st way is not really convenient, though, and the second, whereas it is more practical, is somewhat ad-hoc. If there are "better" solutions, it will be great to know about them. Or maybe it it possible to disable font substitution instead somehow.
@jsx97 For web pages there's an extension WhatFont https://whatfont.en.softonic.com
@jsx97 I don't think you can disable font substitution in general, but some apps probably don't support it and show a square or question mark instead. Is there a particular reason you would want such behavior?
One such an app is Adobe InDesign. The reason why I prefer such behavior is that I prefer to have clear understanding which fonts are really used in each document.
Font Book will show you what glyphs are contained in any given font. Double-click on an individual typeface (e.g. Regular), and it will show you all the glyphs under the "Repertoire" section.
Clicking on a glyph will show you its Unicode value.
Third-party software, such as PopChar, can provide a better interface and more features for viewing and selecting glyphs within a font.
You are right, however, that macOS does have a 'fall-back' substitution for missing glyphs.
From what I can see, Menlo is the only font in your list that includes U+261E. So macOS is providing different replacements, perhaps based on serif, sans, fixed width. All the fonts contain U+00B6.
An important note: Despite Font Book is intended to test fonts and it gives us an opportunity to enter arbitrary characters to see how they appear, it does not disable font substitution.
@jsx97 Yes, I don't think there's a way to disable the character substitution.
|
//
// FanRefreshHeaderGIF.swift
// FanRefresh
//
// Created by 向阳凡 on 2017/4/21.
// Copyright © 2017年 凡向阳. All rights reserved.
//
import UIKit
public class FanRefreshHeaderGIF: FanRefreshHeader {
//MARK: - 外部可以修改成员变量
//防止频繁创建加载，所以把这个活跃内存长期拥有
public var fan_gifImages:Dictionary<FanRefreshState, UIImage> = Dictionary<FanRefreshState, UIImage>()
//gif与时间控件的上下间隔
public var fan_labelInsetTop:CGFloat = 5
//MARK: - 外部调用方法
//设置不同状态的GIF图片
public func fan_setGifName(name:String?,gifState:FanRefreshState){
if (name != nil) {
let image = UIImage.fan_gif(name: name!)
if (image != nil) {
self.fan_gifImages[gifState] = image
}
}
}
//MARK: - 内部成员变量+只读的
fileprivate var lodingGifTimes = 0
/// iOS8.0+当前日历
public var fan_currentCalendar:NSCalendar{
return NSCalendar(calendarIdentifier: .gregorian)!
}
/// 时间Label
public lazy var fan_lastUpdatedTimeLabel:UILabel = {
let timeLabel = UILabel.fan_label()
self.addSubview(timeLabel)
return timeLabel
}()
//MARK: - GIF自定义UI
///懒加载属性，类似OC的get方法懒加载
public lazy var fan_gifImageView:UIImageView = {
let gifView = UIImageView()
self.addSubview(gifView)
return gifView
}()
//MARK: - 本类方法
fileprivate func fan_gifRefreshUI(){
let centerPoint = CGPoint(x: self.fan_width*0.5, y: self.fan_height*0.5)
self.fan_gifImageView.center = centerPoint
let gifImage = self.fan_gifImages[self.state]
if (gifImage != nil) {
self.fan_gifImageView.image = gifImage
}
}
//MARK: - 重写父类方法
/// 重写设置时间key，用来更新Label
///
/// - Parameter timeKey: timeKey
public override func fan_setLastUpdatedTimeKey(timeKey:String) {
super.fan_setLastUpdatedTimeKey(timeKey: timeKey)
if (self.fan_lastUpdatedTimeLabel.isHidden) {
return
}
let lastUpdatedTime:Date?=UserDefaults.standard.object(forKey: timeKey) as? Date
//外部回调更新时间Label内容
if (self.fan_lasUpdateTimeText != nil) {
self.fan_lastUpdatedTimeLabel.text=self.fan_lasUpdateTimeText?(lastUpdatedTime)
return
}
if (lastUpdatedTime != nil) {
let calendar = self.fan_currentCalendar
let options:NSCalendar.Unit = [.year,.month,.day,.hour,.minute]
let cmp1 = calendar.components(options, from: lastUpdatedTime!)
let cmp2 = calendar.components(options, from: Date())
//格式化日期
let formatter = DateFormatter()
var isToday:Bool=false
if cmp1.day == cmp2.day {
//今天
isToday=true
formatter.dateFormat="HH:mm"
}else if cmp1.year == cmp2.year {
//今年
formatter.dateFormat="MM-dd HH:mm"
}else{
formatter.dateFormat="yyyy-MM-dd HH:mm"
}
let time=formatter.string(from: lastUpdatedTime!)
self.fan_lastUpdatedTimeLabel.text = Bundle.fan_localizedString(key: FanRefreshHeaderLastTimeText)! + (isToday ? Bundle.fan_localizedString(key: FanRefreshHeaderDateTodayText)! : " ") + time
}else{
self.fan_lastUpdatedTimeLabel.text = Bundle.fan_localizedString(key: FanRefreshHeaderLastTimeText)! + Bundle.fan_localizedString(key: FanRefreshHeaderNoneLastDateText)!
}
}
public override func fan_prepare() {
super.fan_prepare()
//初始化UI,放在最前面(已经用懒加载)
self.fan_gifImageView.contentMode = .scaleAspectFit
self.fan_gifImageView.fan_size = CGSize(width: 60, height: 60)
}
override public func fan_placeSubviews() {
super.fan_placeSubviews()
if lodingGifTimes < 2 {
lodingGifTimes += 1
self.fan_gifRefreshUI()
}
// //外部修改
if self.fan_lastUpdatedTimeLabel.isHidden == false {
//更新时间
if self.fan_lastUpdatedTimeLabel.constraints.count == 0 {
self.fan_lastUpdatedTimeLabel.fan_x=0.0
self.fan_lastUpdatedTimeLabel.fan_y=self.fan_gifImageView.fan_y+self.fan_gifImageView.fan_height+fan_labelInsetTop
self.fan_lastUpdatedTimeLabel.fan_width=self.fan_width
self.fan_lastUpdatedTimeLabel.fan_height=20
}
}
}
override public func fan_changeState(oldState: FanRefreshState) {
//每次继承都要判断，防止多次调用执行代码
if self.state == oldState {
return
}
super.fan_changeState(oldState: oldState)
self.fan_gifRefreshUI()
//重新显示时间，重新设置Key
self.fan_lastUpdatedTimeKey = self.fan_lastUpdatedTimeKey
}
/*
// Only override draw() if you perform custom drawing.
// An empty implementation adversely affects performance during animation.
override func draw(_ rect: CGRect) {
// Drawing code
}
*/
}
|
Just click any blue "Edit" link and start writing!
Bosra
From Wikitravel
Jump to: navigation, search
Bosra is a city in Syria. Magnificent ruins of Roman city, in the middle of the desert. It is one of the main attractions in Syria.
Understand[edit]
Get in[edit]
Get around[edit]
See[edit][add listing]
Do[edit][add listing]
Buy[edit][add listing]
Eat[edit][add listing]
Drink[edit][add listing]
Sleep[edit][add listing]
Contact[edit]
Get out[edit]
WikiPedia:Bosra
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
|
Talk:1980 United States presidential debates
Videos
I removed this section because the links are already in the infoboxes, so there's no need to have duplicate links. --Walk Like an Egyptian (talk) 21:22, 21 January 2019 (UTC)
* That makes sense. Thanks. DougHill (talk) 00:17, 25 January 2019 (UTC)
Canceled debates
Does anyone have (with sources of course) the info; dates and locations of the canceled debates ? — Preceding unsigned comment added by <IP_ADDRESS> (talk) 23:19, 9 October 2020 (UTC)
* From New York Times, Aug. 24 1980: Sep. 18, Baltimore; Oct. 13, Portland, OR; Oct. 27, Cleveland. The VP debate was going to be October 2, in Louisville.Mcrsftdog (talk) —Preceding undated comment added 00:02, 10 October 2020 (UTC)
Thank you !! — Preceding unsigned comment added by <IP_ADDRESS> (talk) 01:24, 10 October 2020 (UTC)
|
Need to force tar to throw an error
Solaris 10.
I am trying to test a fix to a purchased application. Previously the application did not correctly handle the error from tar when an input file was > 8 GB. The application has been patched to use the E option for tar, so it will no longer get this error. That piece is easy to test.
However, I also want to test that the application will correctly process an error when tar returns one. Since I can't use the file > 8 GB, I am now looking for another way to get tar to throw an error.
Any suggestions?
Thanks,
Jim
How about:
% echo wibble >t.tar
% tar tvf t.tar
tar: Unrecognized archive format: Inappropriate file type or format
tar: Error exit delayed from previous errors.
% echo $?
1
%
...or is that too obvious, or perhaps the wrong sort of error?
Or here's an error produced when creating a tarball (edited following OP's comment):
% mkdir foo
% chmod 0 foo
% ls -ld foo
d--------- 2 norman wheel 68 10 Jul 18:13 foo/
% tar cf foo.tar foo
tar: foo: Couldn't visit directory: Permission denied
tar: Error exit delayed from previous errors.
% echo $?
1
%
I should have specified that this is in creating a tarball. The application was previously coded to perform tar cf foo * . Now it is patched to perform tar cEf foo * . So the error must be in creating a tarball with this same syntax.
Thanks. Somebody on a Solaris list suggested a similar approach of changing permission of one of the files within the directory. I did that, and successfully recreated the error. Now I am waiting for my colleague to apply the patch, and will run a post-test to confirm the fix.
|
Talk:List of 1900 Summer Olympics medal winners
Equestrian jumping
The IOC website https://olympics.com/en/olympic-games/paris-1900/results/equestrian-jumping/individual-mixed shows the medalists for the Jumping and Long jump events switched compared to the results shown in the table in the article. Which is correct? Jeff in CA (talk) 22:19, 5 September 2021 (UTC)
* This is what Olympedia has listed. Lugnuts Fire Walk with Me 08:41, 6 September 2021 (UTC)
|
ATV, Big Boss
Speed
(#) Type ft (Maneuverability) [mph]
Size
??? (Footprint) # ft tall, # ft wide, # ft long, # lbs
Defenses
Resist Fire #, Resist Radiation #, --- MR, DR#/--
Name
|
I have ten alpacas and they behave so oddly.
Hahah, that's cute. Do you have them for their wool or just as pets?
I use their fur to knit sometimes.
Cool, I have a pair of Alpaca socks. They're super comfortable. Do you know how long we've had Alpaca on farms/
I do not but I do know they are native to South America.
That's great. Where did you get yours? Just from another farmer? What do they eat?
I feed them mac and cheese and soda. They are very similar to llamas.
I don't know if it's healthy for them to eat that! Are they very fat?
They are enormous. One of them bred with the neighbor's llama.
Did he escape and jump the fence or something?
Yes he's a horse jumping llama.
|
leaves.
Energy has been defined as " the power of doing work, or over coming resistance/' and its varied transformations into heat, motion, electricity, etc., without gain or loss, are expressed by the general term conservation of energy. In the nutrition and growth of plants an expenditure of energy is evidently required in the work involved in a number of distinct, but correlated, processes, the most important of which are constructive metabolism, or the building of organic substance; the exhalation of water by the leaves, which is constantly taking place in their processes of nu trition ; the evaporation of water from the surface soil ; and the warming of the soil to provide optimum conditions of tempera ture.
The energy expended in constructive metabolism, or tissue building, is stored up as potential energy, and reappears as heat when the plant is decomposed by any process, as, for example, when it is burned. The mechanical force exhibited by growing plants is a phase of the constructive process that has often been noticed. President Clark's squash raised a weight of 4,120 pounds in its processes of growth. Sprouts from the roots of a tree push ing their way through an asphalt pavement have been observed by myself, and many similar exhibitions of the force exerted by growing plants are often seen.
These obvious manifestations of energy in constructive metab olism are, however, so familiar that they require but a passing notice, and we will proceed to consider the much larger expendi tures of energy involved in vaporizing the water exhaled by the leaves of plants and evaporated from the surface soil, as these un obtrusive and incidental processes, as they might be termed, are quite as significant factors in plant growth as the direct work of building organic substance, to which the attention of physiologists is more particularly directed. In field experiments the results obtained with manures must largely depend on the expenditure of energy, under the prescribed conditions, in the work of exhalation by the plants and the evaporation of water from the surface soil. The supply of plant food in the manure may, in fact, be a matter of secondary importance to the growing crop.
Experiments at Rothamsted, England, and on the continent by Hellriegel, on the exhalation of water by a variety of farm crops, including wheat, oats, peas, beans, and clover, show that about three hundred pounds of water are exhaled by the leaves for each pound of dry organic substance formed by the plants. It was estimated by Lawes and Gilbert that the average annual ex halation from the wheat grown on some of the experimental plots
|
---
toc: false
id: 279
title: JQuery in Visual Studio
date: 2009-05-18T00:00:45+00:00
author: Ajay Matharu
layout: post
guid: https://ajaymatharu.wordpress.com/?p=279
permalink: /jquery-in-visual-studio/
ljID:
- 235
dsq_thread_id:
- 465358134
categories:
- ASP.Net
- Javascript
- Visual Studio
- Web
tags:
- .Net
- ASP.Net
- CSS
- Developer
- Development
- Dot Net
- Javascript
- Jquery
- Visual Studio
---
A big part of the appeal of jQuery is that it allows you to elegantly (and efficiently) find and manipulate HTML elements with minimum lines of code. jQuery supports this via a nice “selector” API that allows developers to query for HTML elements, and then apply “commands” to them. One of the characteristics of jQuery commands is that they can be “chained” together – so that the result of one command can feed into another. jQuery also includes a built-in set of animation APIs that can be used as commands. The combination allows you to do some really cool things with only a few keystrokes.
For example, the below JavaScript uses jQuery to find all <div> elements within a page that have a CSS class of “product”, and then animate them to slowly disappear:
<pre class="javascript">$("div.product").slideUp('slow').addClass("removed");</pre>
As another example, the JavaScript below uses jQuery to find a specific <table> on the page with an id of “datagrid1”, then retrieves every other <tr> row within the datagrid, and sets those <tr> elements to have a CSS class of “even” – which could be used to alternate the background color of each row:
<pre class="javascript">$("#datagrid1 tr:nth-child(even)").addClass("even");</pre>
The jQuery library also works well on the same page with ASP.NET AJAX and the ASP.NET AJAX Control Toolkit.
Visual Studio figures out external script references, such as to JQuery, by following special reference comments it finds at the top of .js files:
<pre>/// <reference path="jquery-1.2.3.js" /></pre>
You can download the JQuery from <a href="https://code.google.com/p/jqueryjs/downloads/detail?name=jquery-1.2.6.js&downloadBtn=%3CSPAN%3EDownload%3C%2FSPAN%3E" target="_blank">here</a>. You can get more details on JQuery from [https://jquery.com/](https://jquery.com/api/) .
For intellisense support for JQuery you need to install this <a href="https://connect.microsoft.com/VisualStudio/Downloads/DownloadDetails.aspx?DownloadID=10826" target="_blank">Hotfix</a>.
Comment for javascript is written inside for intellisense support. JavaScript has the interesting feature that calling toString on a function returns the code of this function including the comments and thus the doc comments. Here’s a similar example in JavaScript where the documentation is written inside of a class constructor:
[<img class="aligncenter size-full wp-image-280" title="jsintellisense" src="https://ajaymatharu.files.wordpress.com/2008/10/jsintellisense.png" alt="" width="450" height="59" />](https://ajaymatharu.files.wordpress.com/2008/10/jsintellisense.png)
Another difference with C# or VB.NET is that property and event accessors are two different entities in JavaScript. For this reason, to choose where the documentation should be for those members. Properties should be documented in the getter and events in the “adder” for this reason:
[<img class="aligncenter size-full wp-image-281" title="js" src="https://ajaymatharu.files.wordpress.com/2008/10/js.png" alt="" width="450" height="133" />](https://ajaymatharu.files.wordpress.com/2008/10/js.png)
|
Add files via upload
trying to add The Other List playlist to the code, not sure if this is what I'm supposed to do
Close, but not quite. Rather than adding a new file that contains 'playlists/plain/...' you should just create a new file with that path (without the angle brackets). It doesn't matter what's in the file - the contents will get replaced the next time the script runs. See if you can use the existing files as a reference, and let me know if you have any questions.
Thanks, think I figured it out!
|
Board Thread:Speculation House/@comment-6500074-20130829103240/@comment-10380701-20131211051324
^While that is logical, Ruby is also almost as fast as Oobleck, and she's carrying a scythe.
So the size of the weapon may not be as relevant.
...Now I'm imagining Oobleck with a nodachi...
|
For all your dictionary needs!
Tip. You can look up words, expressions, names, titles...
Adolphe-Charles Adam
Adolphe-Charles Adam is a tautogram (all words start with the same letter). View more tautograms!
Person
Who is Adolphe-Charles Adam?
Adolphe-Charles Adam: Adolphe Charles Adam was a French composer and music critic. A prolific composer of operas and ballets, he is best known today for his ballets Giselle and Le corsaire, his operas Le postillon de Lonjumeau, Le toréador and Si j'étais roi and his Christmas carol Minuit, chrétiens!, later set to different English lyrics and widely sung as "O Holy Night". Adam was a noted teacher, who taught Delibes and other influential composers.
Online dictionaries and encyclopedias with entries for Adolphe-Charles Adam
Click on a label to prioritize search results according to that topic:
Share this page
Privacy Policy | Cookies Policy
Keyword Tool | Romanian-English Dictionary
|
248 THE JOURNAL OF GEOLOGY.
the same stage ought to be referred those Pleistocene marine beds of Sicily which are charged with a northern fauna. The Saxonian thus includes the ‘lower bowlder-clay” of the British Islands; the ‘“‘lower diluvium”’ of Holland, central and southern Germany and central Russia; the ground-moraines and terminal moraines of the ‘‘outer zone” (Alpine Lands), and their associated gravels; the older moraines of many mountain ~ tracts in middle and southern Europe; the lower breccias of Gibraltar and much of the “rubble-drift”’ of other regions. IV. HELVETIAN (OR ELEPHAS-ANTIQUUS STAGE). The interglacial deposits of this stage having been first detected in-Switzerland suggest the term selected. The Helvetian includes a number of well-known deposits, some being marine, while others are of fresh-water and terrestrial origin. The flora and fauna are indicative of varying climatic conditions. Some of the British beds, for example, have yielded a northern and temperate flora, the mammals including mammoth, woolly rhinoceros and reindeer, while others contain the relics of temperate and southern forms, such as Llephas antiquus, Rhinoceros leptorlinus, Eippopotamus, etc. In like manner, the equivalent beds in middle Europe have yielded northern and temperate floras and faunas — the latter including mammoth, Elephas antiquus, Irish deer, horse, etc., while the flora betokens a more genial climate than now obtains but subsequently deteriorating. In central and southern Europe the Helvetian stage is characterized by a temperate flora and fauna—-the latter marked by the presence of Llephas antiquus, Hippopotamus, Rhinoceros Merckit, mammoth, etc. Amongst the more prominent members of the Helvetian group are the interglacial beds of the British area, as in the maritime tracts of the Moray Firth and the Irish Sea, in Lanarkshire, Ayrshire, Edinburghshire, etc.; the Hessle gravels of East Anglia; the beach-deposits of Sussex; the accumulations of Settle Cave, etc. On the Continent, we have certain marine and fresh-water interglacial beds occurring in the Baltic coast-lands ;
|
var Promise = require('es6-promise').Promise;
var PromisePiper = require('./PromisePiper');
function getRouter(){
var routes = {};
var actionsRouter = function(data, context){
var actionNames = context.actionName instanceof Array?context.actionName:[context.actionName];
var promises = actionNames.reduce(function(promises, actionName){
if(routes[actionName]) promises.push(routes[actionName].call(context, data, context));
return promises;
}, []);
var result = promises.length>0?Promise.all(promises):Promise.resolve(data);
return result;
}
actionsRouter.create = function(name, pipe){
routes[name] = pipe || PromisePiper();
return routes[name];
}
return actionsRouter;
}
module.exports = getRouter;
|
How do you start a fire?
How would you like me to start the fire? You can tell me what sort of fire you’d like me to make. Do you want a warm fire in a woodstove, or something on the beach, or a wildfire, or a campfire, or what?
I want to start a fire in my firepit.
Okay, so when you want to start a fire in a firepit, the most important thing is to get it nice and dry. Sometimes people try to set a fire with a whole bunch of kindling, that’s not very helpful! You want to lay a little bit of dry wood to get things going, so you can work out how hot the fire will burn.
|
The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts.
The angiogenic inducers cysteine-rich angiogenic protein 61 (Cyr61) and connective tissue growth factor (CTGF) are structurally related, extracellular matrix-associated heparin-binding proteins. Both can stimulate chemotaxis and promote proliferation in endothelial cells and fibroblasts in culture and induce neovascularization in vivo. Encoded by inducible immediate early genes, Cyr61 and CTGF are synthesized upon growth factor stimulation in cultured fibroblasts and during cutaneous wound healing in dermal fibroblasts. Recently, we have shown that adhesion of primary human fibroblasts to immobilized Cyr61 is mediated through integrin alpha(6)beta(1) and cell surface heparan sulfate proteoglycans (HSPGs) (Chen, N., Chen, C.-C., and Lau, L.F. (2000) J. Biol. Chem. 275, 24953-24961), providing the first demonstration of an absolute requirement for HSPGs in integrin-mediated cell attachment. We show in this study that CTGF also mediates fibroblast adhesion through the same mechanism and demonstrate that fibroblasts adhesion to immobilized Cyr61 or CTGF induces distinct adhesive signaling responses consistent with their biological activities. Compared with fibroblast adhesion to fibronectin, laminin, or type I collagen, cell adhesion to Cyr61 or CTGF induces 1) more extensive and prolonged formation of filopodia and lamellipodia, concomitant with formation of integrin alpha(6)beta(1)-containing focal complexes localized at leading edges of pseudopods; 2) activation of intracellular signaling molecules including focal adhesion kinase, paxillin, and Rac with similar rapid kinetics; 3) sustained activation of p42/p44 MAPKs lasting for at least 9 h; and 4) prolonged gene expression changes including up-regulation of MMP-1 (collagenase-1) and MMP-3 (stromelysin-1) mRNAs and proteins sustained for at least 24 h. Together, these results establish Cyr61 and CTGF as bona fide adhesive substrates with specific signaling capabilities, provide a molecular basis for their activities in fibroblasts through integrin alpha(6)beta(1) and HSPG-mediated signaling during attachment and indicate that these proteins may function in matrix remodeling through the activation of metalloproteinases during angiogenesis and wound healing.
The recent emergence of the CCN family of angiogenic regulators has called attention to their functional versatility and mechanisms of actions (1). This family of secreted proteins consists of six members: Cyr61, CTGF 1 , Nov, WISP-1, WISP-2, and WISP-3 (1,2), with the first three members of the family identified providing the acronym CCN. These structurally conserved proteins share four modular domains with sequence similarities to insulin-like growth factor-binding proteins, von Willebrand factor type C repeat, thrombospondin type 1 repeat, and growth factor cysteine knots (1,3). Each of these domains is encoded by a separate exon, suggesting that CCN genes arose through exon shuffling of preexisting genes to form proteins with multiple functional domains.
Cyr61 and CTGF are both encoded by immediate early genes and are coinduced by serum, bFGF, platelet-derived growth factor, and TGF-1 in fibroblasts (4 -7). Cyr61 and CTGF share ϳ45% amino acid sequence identity (4,8), and both proteins bind heparin, associate with the ECM, and exhibit remarkable functional versatility (9,10). Purified Cyr61 and CTGF mediate cell adhesion, stimulate cell migration, and augment growth factor-induced DNA synthesis (10 -12). Cyr61 and CTGF can promote chondrogenic differentiation, consistent with their expression in prechondrogenic mesenchyme during embryogenesis (13)(14)(15). Both Cyr61 and CTGF stimulate chemotaxis in endothelial cells through an integrin ␣ V  3 -dependent pathway and induce neovascularization in vivo (16,17). Expression of Cyr61 in tumor cells enhances tumorigenicity by increasing tumor size and vascularization (16), whereas expression of CTGF has been correlated with both systemic and localized fibrotic diseases (18 -20). Both proteins are also coinduced in granulation tissues during cutaneous wound healing (19,21). Thus, Cyr61 and CTGF may participate in wound repair by acting as angiogenic inducers upon endothelial cells and by acting as chemotactic, proliferative, and matrix remodeling factors upon fibroblasts.
Through what mechanism(s) might Cyr61 and CTGF act to execute such a diversity of biological functions? Inasmuch as CTGF was first identified as a growth factor (8), it has been tempting to postulate that it might function as a classical growth factor, although a cell surface receptor for CTGF that resembles a classical growth factor receptor has not been identified to date. By contrast, both Cyr61 and CTGF share char-acteristics of ECM-associated signaling proteins in several compelling ways (1,22): 1) they are heparin-binding, ECMassociated proteins; 2) they contain sequence similarities to matrix proteins including von Willebrand factor and thrombospondin; and 3) they regulate cell adhesion, migration, proliferation, differentiation, and survival, all functions that can be modulated through cell and matrix interactions, especially through integrin receptors (23,24). Indeed, we have demonstrated that Cyr61 and CTGF are ligands of, and bind directly to, the integrins ␣ V  3 and ␣ IIb  3 (25,26). Recently, we showed that Cyr61 supports the attachment, or the early phase of cell adhesion, of human skin fibroblasts through integrin ␣ 6  1 and HSPGs (27).
To understand their mechanism of actions, we have investigated the cellular responses to and signaling consequences of cell adhesion to immobilized Cyr61 and CTGF. We present herein the first conclusive evidence that Cyr61 and CTGF function as adhesive signaling molecules. In the absence of any other stimulus, fibroblast adhesion to either protein is sufficient to generate signaling events resulting in morphological changes, activation of intracellular kinases, and activation of gene expression consistent with the biological activities of these CCN proteins. These findings establish Cyr61 and CTGF as inducible, ECM-associated adhesive substrates capable of signaling through integrin-mediated pathways, provide a mechanistic interpretation for the chemotactic and mitogenic activities of these proteins, point to unique signaling capabilities of integrin ␣ 6  1 and HSPGs, and indicate a potential function for Cyr61 and CTGF in matrix remodeling through the activation of metalloproteinases during angiogenesis and wound healing.
MATERIALS AND METHODS
Cell Culture and Adhesion Assay-Normal human fibroblasts (1064SK) from skin biopsy of healthy newborn were obtained from the American Type Culture Collection (ATCC; number CRL-2076). The culture was maintained in IMDM (Life Technologies, Inc.) with 10% fetal bovine serum (Intergen, Purchase, NY) at 37°C with 5% CO 2 and used for experiments before passage 8. Cell adhesion assays were carried out largely as described (10,25). Briefly, 96-well microtiter plates (Becton Dickinson, Franklin Lakes, NJ) were coated with test proteins diluted in PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na 2 HPO 4 , 1.4 mM KH 2 PO 4 , pH 7.3) at 50 l/well, incubated at 4°C for 16 h, and blocked with 1% BSA at room temperature for 1 h. 1064SK fibroblasts were harvested in PBS with 2.5 mM EDTA and resuspended in IMDM with 0.5% BSA at 5 ϫ 10 5 cells/ml and allowed to adhere to protein-coated wells at 50 l/well. After incubation at 37°C for 30 min, wells were washed twice with PBS. Adherent cells were fixed with 10% formalin, stained with methylene blue, and quantified by dye extraction and measurement of absorbance at 620 nm (28). Where indicated, EDTA or peptides were mixed with cells prior to plating. Antibodies were incubated with cells at room temperature for 1 h before plating. Inhibition of glycosaminoglycan sulfation was achieved by growing cells in medium containing sodium chlorate (40 mM) for 24 h; cells were then detached and plated for cell adhesion assays as described above (29). To show the specificity of sulfation blockage, 10 mM sodium sulfate was included in the culture medium together with sodium chlorate.
Immunoprecipitation, SDS-PAGE, and Immunoblotting-For studies on intracellular signaling (see Figs. 5 and 6), 100-mm nontissue culture plastic dishes were precoated with various proteins at 10 g/ml, 4 ml per dish, at 4°C for 16 h, followed by blocking with 1% BSA at room temperature for 1 h. Cells were serum-starved and collected as described above. Protein-coated 100-mm dishes were kept at 37°C and cells were plated at 2-3 ϫ10 6 cells/dish in 4 ml of 0.5% BSA-IMDM. Dishes and media were prewarmed at 37°C, which helped to ensure consistent results with respect to cell adhesion and spreading within 5-15 min after plating.
To study protein secreted by cells adhered on various substrates (as in Fig. 8), the conditioned media were collected after 24 h of cell incubation. The media were first centrifuged to remove cellular debris. Protein in the media was concentrated using Centricon YM-10 (molecular mass cut-off 10 kDa). An equal amount of conditioned media was loaded on SDS-PAGE and analyzed by immunoblotting with monoclonal antibodies against human MMP-1 (clone 41-1ES), MMP-2 (clone 42-5D11), and MMP-3 (clone 55-2A4).
p42/p44 MAPK Activation-1064SK fibroblasts were serum-starved for 24 h, harvested, and plated on 35-mm dishes precoated with proteins as described above. Total cell lysates were prepared and applied on SDS-PAGE, and immunoblotting was carried out using rabbit polyclonal antibodies against the dually phosphorylated active form p42/ p44 MAPK (Thr(P) 183 /Tyr(P) 185 ) at a 1:5000 dilution as suggested by the manufacturer (Promega, Madison, WI).
Rac Activation-1064SK fibroblasts were serum-starved for 24 h, harvested, and plated on plastic dishes precoated with various proteins as described above. The Rac activation assay was done using Rac activation kit according to the manufacturer's protocol (Upstate Biotechnology, Inc.).
RNA Analysis-1064SK fibroblasts were serum-starved 24 h, mildly trypsinized, and replated on protein-coated 100-mm plastic dishes in serum-free IMDM as described above. After incubation at 37°C for various times, total cellular RNA was isolated and subjected to RNA blot analysis using various [ 32 P]dCTP-labeled cDNA probes (32). Human MMP-1 and MMP-2 full-length cDNA clones were obtained from the American Type Culture Collection. MMP-3 probe was generated using reverse transcriptase-polymerase chain reaction with a primer pair corresponding to human MMP-3 cDNA nucleotides 1493-1521 and 1736 -1763. The blots were washed at high stringency (0.2ϫ SSC, 0.1% SDS at 65°C) and analyzed by a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA).
Adhesion of Primary Human Skin
Fibroblasts to CTGF Requires both Integrin ␣ 6  1 and Cell Surface HSPGs-We previously showed that adhesion of primary human skin fibroblasts to Cyr61 is mediated through both integrin ␣ 6  1 and cell surface HSPGs (27). Given that CTGF is also a heparin-binding protein with strong sequence homology with Cyr61, we surmised that CTGF may also support fibroblast adhesion through a similar mechanism. To test this hypothesis, we prepared microtiter wells coated with purified recombinant CTGF onto which primary human skin fibroblasts were allowed to adhere under serum-free conditions. Fibroblast adhesion to CTGF was dose-dependent and saturable and was completely abrogated by the presence of 2 g/ml heparin in the plating medium (Fig. 1A). These results suggest that occupancy of the CTGF heparin-binding site by soluble heparin may prevent its interaction with cell surface HSPGs, thus inhibiting cell adhesion. To test this possibility, we cultured human fibroblasts in the presence of sodium chlorate, an inhibitor of 3-phosphoadenosine 5Ј-phosphosulfate synthesis, to block sulfation of proteoglycans (29).
Adhesion to CTGF was inhibited under this condition, whereas adhesion of the same cells to fibronectin and vitronectin was unaffected (Fig. 1B). The inhibitory effects of sodium chlorate on cell adhesion to CTGF was reversed by the inclusion of 10 mM Na 2 SO 4 in the culture medium, verifying that this inhibitory effect is mediated through a sulfation block (29). To substantiate the finding that cell surface sulfated proteoglycans are required for cell adhesion to CTGF, fibroblasts were treated with heparinase I, an enzyme that targets highly sulfated heparan sulfate proteoglycans (33,34). Heparinase I-treated cells were unable to adhere to CTGF, whereas the same treated cells adhered to fibronectin or vitronectin indifferently (Fig. 1C). Treatment of fibroblasts with chondroitinase ABC had no effect. These results show that CTGF, like Cyr61, requires cell surface HSPGs to mediate adhesion of fibroblasts.
Fibroblast adhesion to CTGF was inhibited by the presence of EDTA or Ca 2ϩ in the assay media, but not by Mg 2ϩ (Fig. 2A).
In control experiments, cell adhesion to type I collagen showed the same divalent cation sensitivity as to CTGF, whereas cell adhesion to vitronectin was not inhibited by Ca 2ϩ , as previously observed (27). This divalent cation sensitivity of fibroblasts adhesion to CTGF is consistent with the involvement of an integrin receptor. To help distinguish the specific integrin involved, we examined the inhibitory effects of RGD-containing peptides. The peptide GRGDSP was unable to inhibit fibroblast adhesion to CTGF even when present at 2 mM, a concentration that abrogated cell adhesion to either fibronectin or vitronectin, ligands of the integrin ␣ 5  1 and the ␣ V integrins, respectively (Fig. 2B). The control peptide GRGESP was unable to inhibit cell adhesion to any substrate. Thus, adhesion of fibroblasts to CTGF is unlikely to be mediated through the major RGD-sensitive integrins in these cells, namely the ␣ V integrins and integrin ␣ 5  1 .
To define the specific integrin that mediates cell adhesion to CTGF, we tested the ability of a panel of function-blocking mAbs to inhibit adhesion. Preincubation of cells with mAbs against integrin subunits ␣ 1 , ␣ 2 , ␣ 3 , or ␣ 4 or the integrins ␣ 5  1 (JBS5) and ␣ V  3 (LM609) had no effect on fibroblast adhesion to CTGF (data not shown). By contrast, mAb against integrin ␣ 6 subunit (GoH3) completely abrogated cell adhesion to CTGF, whereas adhesion to fibronectin was not affected (Fig. 2C). Adhesion to laminin, a known ligand for integrin ␣ 6  1 , was only minimally affected. This is most likely because skin fibroblasts utilize ␣ 2  1 , rather than ␣ 6  1 , as the major receptor for laminin (35). Likewise, mAb against the integrin  1 subunit strongly inhibited cell adhesion to CTGF but not to vitronectin (Fig. 2D). Similar inhibitory effect was observed in adhesion to type I collagen, a known substrate for  1 integrins. Together, these results show that adhesion of human skin fibroblasts to CTGF, like adhesion to Cyr61, requires both integrin ␣ 6  1 and cell surface HSPGs.
Fibroblast Adhesion to Cyr61 or CTGF Induces Extensive and Prolonged Formation of Filopodia and Lamellipodia-Interaction of integrins and their adhesive ligands leads to intracellular signaling, resulting in a range of cellular responses including cytoskeletal reorganization, focal adhesion complex formation, and cell spreading (36,37). Fibroblasts adhered to matrix proteins such as fibronectin or laminin are known to transiently form filopodia, lamellipodia, and pseudopod extensions indicative of cell motility, although these structures usually retreat within 30 min after plating, both in reports by others and in our own observations (38).
To understand the signaling responses as cells adhere to Cyr61 and CTGF, we have examined the morphological changes and signaling responses in cells adhered to these proteins. More than 90% of cells attached to and spread on cover-FIG. 1. Adhesion of human skin fibroblasts to CTGF requires cell surface HSPGs. A, washed 1064SK fibroblasts were detached with 2.5 mM EDTA and resuspended in serum-free IMDM at 2.5 ϫ 10 5 cells/ml. 50 l of cell suspension was plated on each microtiter well coated with the indicated amounts of CTGF. After incubation at 37°C for 30 min, adherent cells were fixed and stained with methylene blue. Extracted dye was quantified by absorbance at 620 nm. Where indicated, soluble heparin (2 g/ml) was added to the plating medium. B, cells were treated with 40 mM sodium chlorate or with sodium chlorate plus 10 mM sodium sulfate, for 24 h before plating on wells coated with CTGF (1 g/ml), vitronectin (VN, 0.4 g/ml), or fibronectin (FN, 2 g/ml), and adhesion experiments were performed as above. C, cells were treated with 2 units/ml heparinase I or 2 units/ml chondroitinase ABC at 37°C for 30 min, washed, and then plated on wells coated with CTGF (1 g/ml), fibronectin (FN, 2 g/ml), or vitronectin (VN, 0.4 g/ml). Data shown for all panels are mean Ϯ S.D. of triplicate determinations and are representative of three experiments. slips coated with Cyr61 or CTGF within 10 min after plating, as was the case when cells were allowed to adhere to fibronectin or laminin, whereas cells plated on coverslips coated with BSA never spread even after 1 h of incubation (Fig. 3). Adherent fibroblasts were fixed with 3% paraformaldehyde and stained with rhodamine-conjugated phalloidin to reveal their actin cytoskeleton structures. Fluorescence microscopy showed that 30 min after plating, fibroblasts adhered to Cyr61 or CTGF had numerous extended pseudopods (Fig. 3). Arrays of actin filaments existed inside the cells, and microspikes of actin filaments protruded from the cell surface in actin-containing membrane ruffling, typical of filopodia and lamellipodia (39,40). These structures became even more prominent at later times, and by 60 min after plating, cells displayed complex contours due to their abundance. In contrast, filopodia and lamellipodia formed in fibroblasts plated on fibronectin or laminin are fewer in number and more transient in nature, giving the cells a smoother overall shape by 30 -60 min after plating (Fig. 3). Thus, fibroblast adhesion to Cyr61 or CTGF resulted in cytoskeleton changes and cell spreading including formation of filopodia and lamellipodia, consistent with the chemotactic activities of both proteins (11,17).
Formation of Focal Complexes upon Adhesion to Cyr61 or CTGF-Ligation of integrins to their adhesive substrates can lead to their association with actin cytoskeleton through their intracellular cytoplasmic domains. Depending on the nature of F-actin organization, integrins may be clustered into focal adhesions or focal complexes. Focal adhesions are large integrincontaining protein complexes at the end of prominent actin stress fibers, whereas focal complexes are smaller, integrincontaining protein complexes at the tips of filopodia and lamellipodia (41). To investigate whether focal adhesions or focal complexes are formed upon adhesion to Cyr61 or CTGF, human skin fibroblasts were plated on coverslips coated with various proteins. Since both Cyr61 and CTGF mediate fibroblasts adhesion through integrin ␣ 6  1 , the resultant focal complexes should include this integrin. Consistent with this expectation, indirect immunofluorescence microscopy revealed that fibro-blasts adhered to either Cyr61 or CTGF form focal complexes that contain both integrin ␣ 6 and  1 subunits (Fig. 4A). Moreover, ␣ 6  1 integrin was localized in needle head-shaped structures at the tips of filopodia and lamellipodia characteristic of focal complexes. Cell adhesion to fibronectin, which binds integrin ␣ 5  1 , resulted in focal adhesions that included integrin  1 but not integrin ␣ 6 , as expected. Likewise, cells adhered to laminin, which interacts with integrins ␣ 2  1 and ␣ 6  1 , formed focal adhesions involving both integrins ␣ 6 and  1 (42)(43)(44). Immunofluorescence with control IgG gave only weak and diffused background staining and did not reveal any discrete structure (Fig. 4A).
Associated with focal adhesions and focal complexes are numerous signaling proteins including FAK, and structural proteins including paxillin and vinculin (41,45,46). When cells adhered to fibronectin or laminin, paxillin and talin are found in typical focal adhesion structures distributed over the cell bodies, as previously reported (30,44,47) (Fig. 4B). When cells adhered to Cyr61 or CTGF, however, both paxillin and talin were also localized at the tips of filopodia and lamellipodia characteristic of focal complexes.
Focal complexes are sites of intracellular signaling and are rich in protein kinases and tyrosine-phosphorylated proteins (36,37). Immunofluorescence staining with mAb against phosphotyrosine revealed a pattern of numerous needle headshaped protein complexes in cells adhered to Cyr61 or CTGF, similar to the pattern of paxillin and talin localization (Fig. 4B). As expected, tyrosine-phosphorylated proteins were detected in protein complexes in cells adhered to fibronectin or laminin. Together, these data show that fibroblast adhesion to Cyr61 or CTGF is mediated through integrin ␣ 6  1 and cell surface HSPGs, resulting in cell spreading and actin cytoskeleton reorganization, as well as formation of focal complexes involving integrin ␣ 6  1 , paxillin, and talin at the leading edges of resultant filopodia and lamellipodia.
Cell Adhesion to Cyr61 or CTGF Activates FAK, Paxillin, and Rac-Of the many protein kinases activated by integrins and localized in focal complexes, FAK plays a central role in inte-FIG. 2. Adhesion of human fibroblasts to CTGF is mediated through integrin ␣ 6  1 . 1064SK human fibroblasts were plated on a microtiter well coated with either CTGF (1 g/ml), type I collagen (Coll-I, 0.4 g/ml), fibronectin (FN, 2 g/ml), laminin (LN, 5 g/ml), or vitronectin (VN, 0.4 g/ml), and adhesion assays were performed as above. A, where indicated, cells were suspended in medium containing EDTA (2.5 mM), Ca 2ϩ , or Mg 2ϩ (5.0 mM each) before plating, and the adhesion assays were performed. B, where indicated, synthetic peptide GRGDSP or GRGESP was present in the plating medium at 2 mM. C, cells were preincubated with either control mouse IgG or mAb against integrin ␣ 6 (GoH3) at 50 g/ml for 60 min before the adhesion assay. D, as indicated, cells were preincubated with either mAb against integrin  1 subunit (JB1A) or control normal mouse IgG at 50 g/ml at room temperature for 30 min before the adhesion assay. Data shown for all panels are mean Ϯ S.D. of triplicate determinations and are representative of three experiments. grin-mediated signaling (48). To examine whether Cyr61 and CTGF can activate FAK, human skin fibroblasts were allowed to adhere on plastic dishes coated with either protein for various durations and harvested. FAK was immunoprecipitated from the resulting cell lysates with mAb against FAK and analyzed by immunoblotting with mAb recognizing phosphotyrosine residues. Increased levels of tyrosine phosphorylation on FAK were observed in cells adhered on either Cyr61 or CTGF as compared with cells plated on poly-L-lysine (Fig. 5A), indicating activation of FAK. The induction occurred within 30 min and was maintained for 1 h at a level comparable with those induced by other ECM proteins such as fibronectin, laminin, and type I collagen (Fig. 5A). These data indicate that Cyr61 and CTGF are both capable of activating FAK signaling, a property that is consistent with their ability to support cell adhesion and spreading.
To establish that FAK signaling pathway is activated by Cyr61 and CTGF, we tested whether paxillin, a major substrate of FAK, is tyrosine-phosphorylated upon cell adhesion to either protein. Paxillin is a structural protein having multiple tyrosine phosphorylation sites and plays integral roles in the 1064SK fibroblasts were washed with PBS and harvested with 2.5 mM EDTA and 0.025% trypsin. The enzyme was neutralized immediately, and cells were resuspended in serum-free IMDM at 5 ϫ 10 5 cells/ml. Cells were plated on coverslips precoated with 50 g/ml each of Cyr61, CTGF, fibronectin, or laminin at 10 4 cells/cm 2 of coverslip area. Cells were incubated at 37°C for either 30 min or 1 h, and adherent cells were fixed with 3% paraformaldehyde in PBS followed by permeabilization with 0.5% Triton X-100 in PBS. Actin filaments were stained with rhodamine-conjugated phalloidin. Data shown are typical of three experiments. Bar, 20 m.
assembly and regulation of integrin-mediated signaling complexes (37). Once tyrosine-phosphorylated, paxillin is recruited into focal adhesions or focal complexes and binds to various signaling protein molecules including FAK, Src, and Csk (49 -51). In experiments similar to those performed to examine FAK activation, we found that paxillin was also tyrosine-phosphorylated upon fibroblasts adhesion to Cyr61 or CTGF (Fig. 5B). The time course of paxillin phosphorylation was similar to that of FAK activation, and the level was also comparable with that induced by other ECM proteins tested, including fibronectin, laminin, and type I collagen (Fig. 5B). This result is consistent with localization of paxillin in focal complexes upon cell adhesion to Cyr61 or CTGF (Fig. 4B). Thus, fibroblast adhesion to Cyr61 or CTGF activates the FAK signaling pathway.
The Rho family GTPase Rac regulates actin dynamics, leading to formation of lamellipodia and clustering of ligand-bound integrins into focal complexes (52,53). Of the effector protein kinases regulated by Rac, p21-activated kinases bind directly to the active form of Rac, leading to autophosphorylation and kinase activation (54). To study if Rac is activated in cells adhered on Cyr61 and CTGF, an affinity precipitation assay using PDB (p21 binding domain from human PAK-1)-glutathione S-transferase fusion protein was employed in a pull-down assay to capture activated Rac from cell lysates (55). A similar approach has been used to show that 3T3 fibroblast adhesion to fibronectin promotes transient activation of Rac and more prolonged activation of Rho (56,57), consistent with the actin cytoskeletal organization and lamellipodia formation that follow adhesion (58,59). As shown in Fig. 6, the levels of activated Rac captured by the pull-down assay were minimal 5-10 min after replating, during which cell spreading had just begun to occur. By 30 min after plating and when most cells were actively spreading, Rac was activated to maximal levels that were maintained through 60 min after plating and then declined thereafter (Fig. 6). The level of activated Rac at the zero time point was higher than during the first 5-10 min after replating (Fig. 6), which may be due to perturbation of actin cytoskeleton by the physical events of detaching and attaching cells. A similar pattern of Rho activation was also reported when Swiss 3T3 cells were detached and replated on fibronectin-coated surfaces (57). Together, these results are consistent with the role of Rac in cell spreading and in the formation of lamellipodia.
Sustained Activation of MAPKs Induced by Cell Adhesion to Cyr61 or CTGF-MAPKs are known to be transiently activated by integrin-mediated signaling upon cell adhesion to matrix proteins such as collagen, fibronectin, vitronectin, and laminin (60 -62). To address whether cell adhesion to Cyr61 or CTGF can activate MAPKs, serum-starved human skin fibroblasts were allowed to adhere to these proteins or control ECM proteins for various durations in serum-free medium. Cell lysates were electrophoresed and immunoblotted with phosphospecific antibodies against p42/p44 MAPKs. When fibroblasts adhered to fibronectin, laminin, or type I collagen, p42/p44 MAPK activation was rapid and transient, reaching maximal levels by 15 min and declining thereafter to background levels within 1 h (Fig. 7A). In contrast, p42/p44 MAPK activation in cells adhered to Cyr61 or CTGF was maintained at a high level for at least 9 h after cell plating. The same blots were stripped and probed with antibodies against p42/p44 MAPKs, and the results indicated that the total amount of MAPK proteins was unchanged (Fig. 7B). Thus, fibroblasts adhered to Cyr61 or CTGF exhibit strong and prolonged activation of p42/p44 MAPKs observed 3-9 h after plating, in sharp contrast to the rapid and transient activation in cells plated on fibronectin, laminin, or type I collagen (Fig. 7). This sustained activation of MAPKs upon fiboblast adhesion to Cyr61 or CTGF appears to be unique among immobilized matrix substrates and may reflect distinct signaling capabilities mediated through integrin ␣ 6  1 .
Adhesion of Human Skin Fibroblasts to Cyr61 or CTGF Induces Expression of MMP-1 and MMP-3-Expression of both
cyr61 and CTGF is highly induced in granulation tissues during cutaneous wound healing (21,63), leading to the possibility that Cyr61 and CTGF may act to facilitate matrix degradation and remodeling. To test this hypothesis, serum-starved primary fibroblasts were harvested and allowed to adhere on immobilized Cyr61 or type I collagen in serum-free medium for various durations, and steady state levels of MMP-1 and MMP-2 mRNAs were analyzed by RNA blots. As shown in Fig. 8A, MMP-1 mRNA level was minimal 2 h after replating but increased to a high level between 6 and 12 h after replating on Cyr61 or collagen. By 24 h after plating, MMP-1 mRNA level in cells plated on Cyr61 was 5-fold higher than cells plated on type I collagen. By contrast, MMP-2 mRNA level remained the same under all conditions. We next examined if CTGF can also lead FIG. 5. Fibroblasts adhesion to Cyr61 or CTGF leads to activation of FAK and paxillin. Serum-starved and washed 1064SK fibroblasts were detached with 2.5 mM EDTA plus 0.025% trypsin in PBS and resuspended in serum-free IMDM at 5 ϫ 10 5 cells/ml. 4 ml of cell suspension was plated on each 100-mm plate coated with 10 g/ml each of poly-L-lysine (B), Cyr61, CTGF, fibronectin (FN), laminin (LN), or type I collagen (Col.I). Cells were incubated at 37°C for either 30 min or 1 h, lysed, and immunoprecipitated with mAb against either FAK or paxillin as described under "Materials and Methods." A, FAK was immunoprecipitated from lysates, electrophoresed on 6% SDS-PAGE, and immunoblotted with mAb (clone 4G10) against phosphotyrosine (P i -Tyr). The blot was then stripped of antibodies and reblotted with mAb against FAK. B, paxillin was immunoprecipitated from cell lysates, electrophoresed on 8% SDS-PAGE, and immunoblotted sequentially with anti-phosphotyrosine mAb and anti-paxillin mAb. Data shown are representative of at least three independent experiments.
FIG. 6. Cyr61 and CTGF activate the small GTPase Rac in human skin fibroblasts. 1064SK fibroblasts were serum-starved, collected, and resuspended in serum-free IMDM and plated at 2-3 ϫ 10 6 cells/100-mm dish precoated with Cyr61 (10 g/ml) or CTGF (10 g/ml) for various times as indicated. The dishes were prewarmed to 37°C immediately before use. Time 0 indicates cells kept in suspension. Adherent cells were lysed at the indicated times, and activated Rac was affinity-precipitated and then immunoblotted with mAb against Rac protein. 50 l of the clarified lysate from each sample was reserved for immunoblotting of total Rac protein. Data shown are representative of two independent experiments. to elevated MMP-1 mRNA level in fibroblasts by acting as an adhesion substrate. As shown in Fig. 8B, cells adhered to either CTGF or Cyr61 displayed 5-7-fold higher steady levels of MMP-1 mRNA 24 h after plating compared with cells adhered to fibronectin, laminin, or type I collagen. Likewise, MMP-3 mRNA levels were 7-9-fold higher in cells adhered to either Cyr61 or CTGF compared with cells adhered to fibronectin, laminin, or type I collagen (Fig. 8B). It is noteworthy that in normal diploid fibroblasts, MMP-1 and MMP-3 genes are regulated coordinately by growth stimuli, whereas MMP-2 expression is inducible by phorbol ester but not responsive to growth factors (64).
To show that MMP-1 and MMP-3 protein synthesis is actually induced upon cell adhesion to Cyr61 or CTGF, we examined the conditioned media of cells plated on various substrates 24 h after plating by immunoblotting. As shown in Fig. 8C, both MMP-1 and MMP-3 are readily detected in conditioned media when human fibroblasts were plated on Cyr61 or CTGF, but none was detectable when these cells were plated on fibronectin, laminin, or collagen. The level of MMP-2 protein in the conditioned media remains the same in cells plated on all substrates, consistent with the levels of mRNAs expressed in these cells (Fig. 8B). Since serum-starved normal skin fibroblasts express minimal levels of MMP-1 and MMP-3 (65) (Fig. 8, A and C), we conclude that adhesion of fibroblasts to Cyr61 or CTGF results in the up-regulation of these metalloproteinases at the levels of both mRNA and protein synthesis (Fig. 8). DISCUSSION Although a multitude of activities has been described for Cyr61 and CTGF, the mechanisms of their actions have not been elucidated. Results in this study present the first conclusive evidence that Cyr61 and CTGF can function through adhesive signaling. The adhesion of fibroblasts to immobilized Cyr61 or CTGF, in the absence of any other stimulus, is sufficient to induce distinct cellular responses consistent with the activities of both proteins and different from those induced by other known matrix ligands. Based on the high degree of homology among members of the CCN family, we anticipate that other proteins in this family may also function through adhesive signaling.
Several unexpected findings emerged through examination of Cyr61 and CTGF as ECM-associated adhesive ligands. First, the absolute requirement for cell surface HSPGs for cell attachment to Cyr61 or CTGF appears to be unique. Although increasing evidence indicates that HSPGs can function with integrins as coreceptors in cell and matrix interactions (66,67), HSPGs thus far have been observed to influence only the cell spreading phase of adhesion following cell attachment (27,68,69). Second, fibroblast adhesion to Cyr61 and CTGF induces FIG. 7. Adhesion of human skin fibroblasts leads to prolonged MAPK activation. A, 1064SK fibroblasts were serum-starved and resuspended in serum-free IMDM at 6 ϫ 10 5 cells/ml. Cells were plated at 1 ml/dish (35-mm dishes) precoated with 10 g/ml each of Cyr61, CTGF, fibronectin (FN), laminin (LN), or type I collagen (Col.I) for various times as indicated. Clarified lysates were loaded on SDS-PAGE at 50 l/sample. Immunoblotting of activated p42/p44 MAPKs was done using affinity-purified polyclonal antibodies against dually phosphorylated (pTEpY) p42/p44 MAPKs. B, the same blots as in A were stripped and reprobed with antibodies against the indicated proteins. Data shown are representative of three independent experiments.
FIG. 8. Fibroblasts adhesion on Cyr61 and CTGF enhances expression of MMP-1 and MMP-3.
A, 1064SK fibroblasts were serum-starved for 24 h before being collected and resuspended in serumfree IMDM at 5 ϫ 10 5 cells/ml. 2 ϫ 10 6 cells were plated on 100-mm dishes precoated with Cyr61 (10 g/ml) or type I collagen (Col.I, 10 g/ml) for various times as indicated. Total cellular RNA was extracted and analyzed by Northern blotting using full-length human MMP-1 and MMP-2 cDNA as probes as described under "Materials and Methods." Data shown are representative of two independent experiments. B, cells were plated on dishes precoated with 10 g/ml each of Cyr61, CTGF, fibronectin (FN), type I collagen (Col.I), or laminin (LN) for 24 h before lysis and total RNA extraction. Data shown are representative of three independent experiments. C, conditioned media from cells plated on various substrates as indicated above were collected 24 h after plating and resolved by SDS-PAGE followed by immunoblotting with antibodies against MMP-1, MMP-2, and MMP-3. Lane B, conditioned medium collected from cells not subjected to detachment and replating. Results were representative of two independent experiments. persistent formation of filopodia and lamellipodia with focal complexes rather than focal adhesions. Third, cell adhesion to Cyr61 or CTGF induces signaling responses with unusual kinetics, including sustained activation of MAPKs and prolonged induction of MMP-1 and MMP-3 expression. Together, these findings provide new insight into the biological functions of Cyr61 and CTGF as well as a mechanistic interpretation of these activities through integrin-mediated signaling.
Both Cyr61 and CTGF have been shown to support the attachment phase of cell adhesion through integrin receptors, and the specific integrins involved appeared to be cell type-dependent. Thus, Cyr61 and CTGF support the attachment of endothelial cells through integrin ␣ V  3 (17,25), blood platelets through integrin ␣ IIb  3 (26), and fibroblasts through integrin ␣ 6  1 and cell surface HSPGs (27) (Figs. 1 and 2). The present study extends these observations to document the cellular responses as a result of cell attachment to Cyr61 and CTGF. One of the most prominent responses upon integrin engagement to Cyr61 or CTGF is actin cytoskeleton reorganization, leading to cell spreading and formation of filopodia and lamellipodia (Fig. 3). Whereas fibroblast adhesion to matrix proteins such as fibronectin and laminin also results in formation of filopodia and lamellipodia, these structures are transient in nature, and they largely retreat within 30 min after plating. By contrast, these pseudopods persist for at least 1 h after cell plating on Cyr61 or CTGF and in fact grew more prominent with time (Fig. 3). In agreement with recent studies indicating that Rac is a critical activator for lamellipodia (41,45), cell adhesion on Cyr61 and CTGF also leads to activation of Rac (Fig. 6). Lamellipodia are required for cell motility, while filopodia are indispensable for migration toward a chemogradient (70,71). Inasmuch as the chemotactic activities of soluble Cyr61 and CTGF have been previously documented in a Boyden chamber assay (16,17), these observations suggest that both proteins may function as haptotactic factors when tethered to the ECM to stimulate cell migration within tissues.
Concomitant with cell spreading and actin cytoskeleton reorganization, fibroblasts adhered to Cyr61 or CTGF formed integrin ␣ 6  1 -containing focal complexes localized to the leading edges of filopodia and lamellipodia (Fig. 4). Similar patterns of focal complexes can be discerned by immunostaining for paxillin and talin, consistent with the known association of paxillin with focal adhesion complexes, and with the demonstrated direct interaction between talin and the cytoplasmic domains of engaged integrins (72). Furthermore, both FAK, a tyrosine kinase that plays central roles in integrin signaling, and its substrate paxillin were activated by tyrosyl phosphorylation when cells were adhered to Cyr61 or CTGF (Fig. 5). Together, these data show that fibroblast adhesion to Cyr61 or CTGF is mediated through integrin ␣ 6  1 and cell surface HSPGs, leading to formation of integrin ␣ 6  1 -containing focal complexes, cytoskeleton reorganization, and cell spreading with the formation of lamellipodia and filopodia. These morphological changes are accompanied by signaling events including the activation of FAK, paxillin, and Rac. These observations provide compelling evidence that Cyr61 and CTGF function as bona fide adhesive signaling molecules.
The activities of MAPKs are central to a variety of cell functions, in particular cell proliferation, differentiation, and gene expression (73). Cells in suspension have no contact with solid surface and therefore are round in shape, and MAPK activity is down-regulated. Once reattached, cell spreading occurs and MAPKs are transiently activated. In the present study, we employed this cell detachment-reattachment scheme to test if Cyr61 and CTGF will also lead to MAPK activation. Remarkably, cell adhesion to Cyr61 and CTGF caused a marked and sustained activation of p42/p44 MAPKs in skin fibroblasts lasting for at least 9 h, compared with the transient activation observed when cells were plated on type I collagen, fibronectin, or laminin (Fig. 7). To our knowledge, this sustained activation of MAPK by Cyr61 and CTGF is unique among adhesive substrates in fibroblasts. This prolonged activation of MAPK following adhesion is consistent with the ability of Cyr61 and CTGF to enhance proliferation through augmentation of growth factor-induced DNA synthesis (10,11).
There exist conflicting reports about whether integrin ␣ 6  1 can activate MAPK. Cross-linking of the mAb GoH3 to integrin ␣ 6  1 in fibroblasts kept in suspension did not induce MAPK (74). However, expression of integrin ␣ 6a and ␣ 6b subunits separately in the P388D1 mouse macrophage cell line, which normally does not express endogenous ␣ 6 integrins (75), showed activation of MAPK only in ␣ 6a -expressing cells but not in ␣ 6b -expressing cells when both were plated on laminin-1 (76). One of the major differences between these studies is the agents used to activate integrin. While the former study used mAb that binds to the extracellular domain of integrin ␣ 6 , the other employed a natural ␣ 6  1 ligand that also binds to cell surface HSPGs. It has been observed that a heparin-binding peptide derived from thrombospondin-1 can synergize with T-cell receptor to enhance activation of MAPKs (77). It is possible that integrin ␣ 6  1 requires costimulation of cell surface HSPGs to activate MAPKs and that Cyr61 and CTGF may sustain more prolonged activation of MAPKs by virtue of their dual affinity for integrin ␣ 6  1 and HSPGs.
Aside from Cyr61 and CTGF, natural ligands for integrin ␣ 6  1 include laminin, invasin (78), and fertilin (79). Invasin is a bacterial protein involved in invasion of mammalian tissues, and fertilin is a sperm surface protein involved in the binding of sperm to egg. Since neither invasin nor fertilin is an endogenous substrate, these proteins are not likely to play a role in wound repair. The presence of laminin is restricted to the basement membrane of epidermis and associated with vascular structures in dermis (80,81). Given its confined presence in the basement membrane, laminin is unlikely to have important roles in the majority of skin fibroblasts in the granulation tissue. In contrast, both Cyr61 and CTGF are induced in granulation tissues during cutaneous wound repair and are likely to be the principal adhesion ligands of integrin ␣ 6  1 during wound healing. In addition, unlike laminin, which interacts with a multitude of integrins, Cyr61 and CTGF appear to utilize only integrin ␣ 6  1 in adhesion of dermal fibroblasts, thus providing a unique paradigm for studying integrin ␣ 6  1mediated adhesive signaling in a natural context, free of interference from other interacting integrins.
As adhesive substrates, proteolytic fragments of fibronectin containing the cell binding domain have been observed to induce MMP-1 and MMP-3 through integrin ␣ 5  1 (82). Other ECM substrates, such as vitronectin, laminin, type I collagen, and intact fibronectin, either have no effect on MMP-1 and MMP-3 expression or induce their expression only transiently (82,83) (Fig. 8). Fibroblast adhesion to Cyr61 or CTGF, on the other hand, induces a more prolonged activation of MMP-1 and MMP-3 lasting for at least 24 h, resulting in accumulation of MMP-1 and MMP-3 proteins in the conditioned media (Fig. 8, B and C). Since CTGF expression has been associated with fibrosis and subcutaneous injection of CTGF induces granulation tissue (12), our finding that both Cyr61 and CTGF can up-regulate MMP gene expression may appear paradoxical. However, the induction of metalloproteinases is indeed consistent with a role for these proteins in matrix remodeling of granulation tissue during wound healing, where the degrada-tion of a provisional matrix and the synthesis of new matrix must occur simultaneously (84,85). Moreover, degradation of the ECM can promote the migration of endothelial cells in angiogenesis.
Several lines of evidence support the roles of Cyr61 and CTGF in wound healing: 1) expression of cyr61 and CTGF genes are minimal in normal dermis and becomes highly induced in dermal fibroblasts in granulation tissue during wound repair; 2) both Cyr61 and CTGF are angiogenic inducers and may recruit new blood vessels to supply nutrients to sites of wound healing; and 3) Cyr61 and CTGF promote chemotaxis and proliferation in fibroblasts. Encoded by immediate early genes, Cyr61 and CTGF are induced by serum growth factors implicated in wound healing, including bFGF and TGF-1 (4,7). It is interesting to note that in fibroblasts TGF-1 suppresses the expression of MMP-1 and MMP-3 (86,87), whereas both are induced by bFGF, Cyr61, and CTGF (Fig. 8) (86, 88). Thus, although it has been suggested that CTGF can mediate some of the activities of TGF-1 (89,90), their effects on gene expression are not identical. With respect to induction of MMP-1 and -3, the activities of Cyr61 and CTGF closely parallel those of bFGF instead of TGF-1. The interplay between the actions of bFGF, TGF-1, and the induced effectors, Cyr61 and CTGF, is likely to be complex and remains to be investigated.
|
Talk:Fashion journalism
Merge Fashion public relations into this article
Fashion public relations should either be deleted or merged into this article. Pdcook (talk) 17:15, 12 November 2009 (UTC)
Fashion PR is a completely different field with fashion journalism. There is a course in the london college of fashion call 'Fashion PR' This article should stay independent. Fashion PR is a whole industry subject with thousands Fashion PR company which is call xxxPR. Thanks —Preceding unsigned comment added by Freelylw (talk • contribs) 17:29, 12 November 2009 (UTC)
* I might agree with you if you can provide independent references that comply with WP:reliable sources. Also, please check out WP:5 pillars for more information about Wikipedia. Thanks, Pdcook (talk) 18:31, 12 November 2009 (UTC)
* The article has been deleted due to copyright infringement. Pdcook (talk) 16:35, 21 November 2009 (UTC)
Fashion and the Internet
As it stands, that section is pretty useless. However, I'm reluctant to remove it completely. With a bit of knowledge, it could be helpful to write a short summary about fashion blogging (with link to main article). Or alternatively, how fashion publications are adapting online via the use of apps and digital mags. Both would be great, I suppose. I would do this myself, but I don't really have the expertise to do it all completely. Anyone have suggestions? Lauren9360 (talk) 10:57, 27 December 2013 (UTC)Lauren9360
Merge from Modern fashion journalism
* That article's subject is a complete subset of this one.
* As it exists, it is comprised almost solely of material cannibalized from other articles combined with insipid high school essay-isms.
* It therefore offers absolutely nothing that this article can't while also being extremely clunky and unfocused to a point of near-uselessness.
* I will be making sure worth saving is merged.
* Modern fashion journalism will become a redirect.
TheTechnician27 (Talk page) 11:12, 8 June 2023 (UTC)
To be merged
Images
* Bambi Magazine Issue X Cover.jpg
Sources
* [currently blank]
Excerpts
* [currently blank]
Topics
* Fashion blogging and vlogging
* People: Carmel Snow, Grace Mirabella, Franca Sozzani, Suzy Menkes, Anna Wintour (descriptions of these in the source article as well as the section heading are essentially unusable due to extremely unencyclopedic prose)
TheTechnician27 (Talk page) 11:20, 8 June 2023 (UTC)
|
How to make a swipe view screens without tab layout in android?
I am trying to figure out how to make a swipe view without a tab layout.
In the figure above,
1. I want to make a swipe view that can navigate page left and right.
2. Icon 1 is a global menu that needed to be there all the time while swipping.
3. Icon 3 is a bottom bar. How can I make like that way?
Any kind of suggestions and tutorial links would be appreciated. Thanks in advance.
use this lib http://viewpagerindicator.com/
If u got it pls tell me
use this https://github.com/pakerfeldt/android-viewflow
i don't have any links for the same,but still i will tell you the very simple logic to create:
1.First remove the title bar using
this.requestWindowFeature(Window.FEATURE_NO_TITLE);
2.Use the following Structure
<RelativeLayout>
<ViewPager android:layout_height="fill_parent"
android:layout_width="fill_parent"> //full screen
<RelativeLayout android:id="@+id/header"> -->for header
android:layout_alignParentTop="true"
</RelativeLayout>
<RelativeLayout> -->for inicators
android:below="@+id/header"
</RelativeLayout>
<RelativeLayout> --> for footer
android:layout_alignParentBottom="true"
</RelativeLayout>
</ViewPager>
</RelativeLayout>
3.now make the images for header and footer and set as background.
4.for view pager indicator go Through This Post.just download it and import in your eclipse and set as a lib in your project. how to use circle pager indicator Check My Answer.
and you are done now!!
You can simply use for example a ViewPager as explained in the official documentation because it's not mandatory to have tabs.
http://developer.android.com/training/animation/screen-slide.html
There's a full example available in that link.
If you need also to display dots for your slides, you can take advantage of this library as pointed out by other users: http://viewpagerindicator.com/
Check this library I think this is what you need
and you can customize it as per your needs
https://github.com/pakerfeldt/android-viewflow
|
import React, { useEffect } from "react";
import { useLocation, useNavigate } from "@reach/router";
const Redirect = ({ to, location, replace }) => {
const navigate = useNavigate();
useEffect(() => {
let path = `${to}${location.search}${location.hash}`;
for (let [x, y] of Object.entries(replace)) {
path = path.replaceAll(x, y);
}
navigate(path);
}, []);
return <span>redirecting</span>;
};
export default Redirect;
|
<?php
namespace App\Repositories\Eloquent;
use App\Models\Opportunity;
use App\Repositories\Interfaces\OpportunityRepositoryInterface;
class OpportunityRepository extends BaseRepository implements OpportunityRepositoryInterface
{
/**
* UserRepository constructor.
*
* @param Opportunity $model
*/
public function __construct(Opportunity $model)
{
parent::__construct($model);
}
public function wonCounts()
{
return $this->model->wonOpportunities()->count();
}
public function holdCounts()
{
return $this->model->holdOpportunities()->count();
}
public function lostCounts()
{
return $this->model->lostOpportunities()->count();
}
public function canceledCount()
{
return $this->model->canceledOpportunities()->count();
}
public function opportunitiesCount()
{
return $this->model->count();
}
public function search($name, $stage, $status)
{
$q = $this->model->latest()->with('client','contact');
if ( $name and !empty($name) )
{
$q = $q->where('name','like',"%". $name .'%');
}
if ( $stage and !empty($stage) )
{
$q = $q->whereStage($stage);
}
if ( $stage and !empty($status) )
{
$q = $q->whereStatus($status);
}
return $q->paginate();
}
public function statusByStage($stageNumber)
{
return $this->model->statusByStage($stageNumber);
}
public function stages()
{
return $this->model->stages();
}
public function getStatus()
{
return $this->model->getStatus();
}
public function getStatusByStage($stage_id)
{
return $this->model->statusByStage($stage_id);
}
public function opportunityReport($from, $to, $stage, $status, $client)
{
if ( empty($from) and empty($to) and empty($stage) and empty($status) and empty($client) )
{
return null;
}
$q = $this->model->latest();
if ( $from and !empty($from) )
{
if ( $to and !empty($to) )
{
$q = $q->whereBetween('created_at',[$from,$to]);
} else {
$q = $q->whereBetween('created_at',[$from,now()->toDateString()]);
}
}
if ( $stage and !empty($stage) )
{
$q = $q->whereStage($stage);
}
if ( $status and !empty($status) )
{
$q = $q->whereStatus($status);
}
if ( $client and !empty($client) )
{
$q = $q->whereClientId($client);
}
return $q->with('client','contact')->paginate();
}
// public function invoiceReport($from, $to, $client)
// {
// if ( empty($from) and empty($to) and empty($client) )
// {
// return null;
// }
// $q = $this->model->wonOpportunities()->latest()->has('invoices','!=',0);
// if ( $from and !empty($from) )
// {
// if ( $to and !empty($to) )
// {
// $q = $q->whereBetween('created_at',[$from,$to]);
// } else {
// $q = $q->whereBetween('created_at',[$from,now()->toDateString()]);
// }
// }
// if ( $client and !empty($client) )
// {
// $q = $q->whereClientId($client);
// }
// return $q->with('invoices.receipt','contact')->paginate();
// }
public function wonOpportunities($search)
{
if (empty($search))
{
return $this->model->with('client', 'contact')->WonOpportunities()->latest()->paginate();
}
$q = $this->model->WonOpportunities()->latest();
$q->where('name', 'like', "%". $search ."%");
return $q->with('client', 'contact')->paginate();
}
}
|
using System;
namespace Raytracer.Textures
{
class CheckerTexture : ITexture
{
private readonly ITexture odd;
private readonly ITexture even;
public CheckerTexture(ITexture odd, ITexture even)
{
this.odd = odd;
this.even = even;
}
public Vector GetColor(float u, float v, Vector p)
{
var sin = Math.Sin(10 * p.X) * Math.Sin(10 * p.Y) * Math.Sin(10 * p.Z);
return sin < 0
? odd.GetColor(u, v, p)
: even.GetColor(u, v, p);
}
}
}
|
"""Connect
Aids in the process of creating a passwordless ssh connection.
"""
import os
import sys
import pysftp
import getpass
import textwrap
import promus.core.ssh as ssh
import promus.core.git as git
DESC = """
Create a passwordless ssh connection to a remote machine. By providing
an alias for the host you create a shorcut.
example:
promus connect user@some-server some-shortcut
you will be able to do
ssh some-shortcut
instead of
ssh user@some-server
"""
def add_parser(subp, raw):
"Add a parser to the main subparser. "
tmpp = subp.add_parser('connect',
help='make a passwordless ssh connection',
formatter_class=raw,
description=textwrap.dedent(DESC))
tmpp.add_argument('host', type=str,
help='host to connect to')
tmpp.add_argument('alias', type=str,
help='host alias')
def check_ssh_config(user, host, alias):
"""Ajust the ssh configuration file. """
config = ssh.read_config()
found = False
for entry in config:
if alias in entry.split():
found = True
sys.stdout.write('Alias already in use: `Host %s`\n' % entry)
break
if not found:
entry = '%s %s' % (alias, host)
config[entry] = dict()
config[entry]['HostName'] = host
config[entry]['User'] = user
ssh.write_config(config)
def run(arg):
"""Run command. """
host = arg.host
alias = arg.alias
tmp = host.split('@')
if len(tmp) == 2:
user = tmp[0]
host = tmp[1]
else:
user = os.environ['USER']
host = tmp[0]
idkey, _ = ssh.get_keys()
idkey = ssh.get_public_key(idkey)
key = idkey.split()[1]
cn_ = pysftp.Connection(host,
username=user,
password=getpass.getpass())
try:
with cn_.open('.ssh/authorized_keys', 'r') as fp_:
authorized_keys = fp_.read()
except IOError:
authorized_keys = ''
disp = sys.stdout.write
if key in authorized_keys:
disp("Connection has been previously established\n")
else:
try:
cn_.mkdir('.ssh')
except IOError:
pass
cn_.chmod('.ssh', 700)
if authorized_keys and authorized_keys[-1] != '\n':
authorized_keys += '\n'
line = "%s %s@%s\n" % (idkey,
os.environ['USER'],
git.config('host.alias'))
authorized_keys += line
try:
with cn_.open('.ssh/authorized_keys', 'w') as fp_:
fp_.write(authorized_keys)
cn_.chmod('.ssh/authorized_keys', 700)
except IOError:
disp("ERROR: unable to write the authorized_keys file\n")
finally:
check_ssh_config(user, host, alias)
disp('You may now connect to %s using: `ssh %s`\n' % (host, alias))
|
import { Observable } from 'rxjs/Observable';
import { UsersService } from './../../../services/users.service';
import { User } from './../../../models/user.model';
import { Component, OnInit, OnChanges } from '@angular/core';
@Component({
selector: 'app-users',
templateUrl: './users.component.html',
styleUrls: ['./users.component.css']
})
export class UsersComponent implements OnInit, OnChanges {
public users: Observable<User[]>;
constructor(private usersService: UsersService) { }
ngOnInit() {
this.users = this.usersService.getUsers();
}
ngOnChanges() {
this.users = this.usersService.getUsers();
}
}
|
Edwin Moody vs. The State of Mississippi.
In a suit brought in the superior court of chancery against the state, for the value of work and labor done, and materials furnished in the erection of the State-house, the chancellor ordered an issue to the circuit court of Hinds county, to ascertain the amount due; the jury found a verdict in favor of complainant, to which no exception was taken in the circuit court by either side, though the state moved unsuccessfully there for a new trial; the chancellor, however, set the verdict aside on its return to his court, and ordered a new trial at his bar, from which order the complainant prayed, but did not prosecute, an appeal; the second issue was tried at the bar of the chancery court, and resulted in a second verdict for complainant, which the chancellor also set aside, and directed a new trial; to this the complainant excepted, and embodied the evidence in a bill of exceptions, and prayed, but the chancellor refused, an appeal: Held, first, that the appeal being from the refusal to confirm the second verdict, and the allowance of the second new trial, the high court could not inquire into the propriety of the order of the chancellor setting aside the first verdict.
Held further, that the whole appeal was premature ; there was no decree either final or interlocutory appealed from; the power of the chancellor to grant the new trial was unquestioned; its rightful exercise was another matter, which could only be inquired into on the final determination of the case; perhaps both parties might be satisfied with the next verdict.
On appeal from the superior court of chancery ; Hon. Stephen Cocke, chancellor.
The facts will be found stated in the opinion.
Lea, for appellant.
Clifton, on same side.
Glenn, attorney-general, for the state.
Mr. Justice Clayton
delivered the opinion of the court.
This was a bill filed in the superior court of chancery by the appellant, to recover damages from the state, for an alleged breach of contract in reference to building the capítol of the state. The bill was filed in 1838; issues were made up and directed to be tried in the circuit court of Hinds county, subject to the rules of law, and the regulations of the court. At the March term, 1842,- the issues were tried, and a verdict rendered in behalf of the complainant for $26,936. A motion was made in the circuit court for a new trial, which was overruled, but no bill of exceptions was taken. The verdict, however, was set aside by the chancellor, and another trial of the issues directed to be had at the bar of the chancery court, at the January term, 1S45. The complainant being dissatisfied with the order granting a new trial, prayed an appeal to this court, which was refused by the chancellor. No farther steps were taken in regard to this appeal.
In February, 1847, the new trial was had, and a verdict rendered for the complainant for the sum of $16,769.50. The complainant moved for a confirmation of this verdict, and the defendant for another trial. Upon consideration of these motions, the chancellor directed the verdict to be set aside, and another trial of the issues to be had. A bill of exceptions was thereupon filed setting out the testimony, and this appeal was taken “from the order refusing to confirm the verdict of the jury, and ordering a new trial.”
We have been thus careful in setting out the proceedings, and the several orders, that it might be clearly seen what was the matter appealed from, and consequently what is in this court to be decided.
It is urged here with great zeal and earnestness, that the act of the chancellor in setting aside the first verdict was arbitrary and unauthorized, and that this court ought now to disregard all the subsequent proceedings, and direct a final decree'to be entered in accordance with that verdict. The plain answer to this argument is, that this order of the chancellor thus complained of, has in no way been brought before this court. Yfe have, therefore, no power to pass upon it. It is true, an appeal was prayed, but it was refused by the chancellor, and no effort was made, in any other mode, to get it into this court. The party proceeded to another trial, and being dissatisfied with the action of the chancellor, in reference to the last trial, he took an appeal from the order “refusing to confirm the verdict, and directing another trial.” This appeal, in its terms, -attempts to bring up nothing but this order, and if we were to consider of any thing else, it would be of something not appealed from.
The next question which meets us is, whether the whole appeal is not premature. There is no decree of the chancery court, either interlocutory or final. There is nothing but an order setting aside a verdict, and directing a new trial. Had the court the power to make such order? The statute of 1846 directs all issues in the chancery court to be tried in that court, with a single exception, and provides, “ that the verdict of the jury shall be conclusive of the facts found, subject to the rules and regulations of a court of law. Hutch. Code, 7S6.
The power to set aside a verdict and grant a new trial, is one of the unquestionable rules of a court of law, and is exercised daily without challenge. That the power existed in the chancellor is thus beyond dispute; its rightful exercise is another matter. Can that question be now entertained?
It is settled in this court, that neither an appeal, nor a writ of error will lie, from a court of law, from an order granting or refusing to grant a new trial, until there has been a final judgment in the court below.- After such judgment, the case may be brought up, but not before. Bank of Lexington v. Taylor, 2 S. & M. 28; Terry v. Robins, 5 Ib. 291. All parties might be satisfied with the result of the next trial. But the legal principle on which the rule rests, is, that there is no judgment of the court, from which the writ of error will lie.
Is the same rule applicable in chancery? We think it is, because the statute makes the verdict subject to the rules of a court of law; and because, though the verdict'may become the basis of the decree, yet until the court adopts it, and founds a a decree upon it, there is no decree from which an appeal can be sustained. See Stebbins v. Niles, ante, 307. Here there was no decree, either interlocutory or final. The consequence is, that the appeal was premature, and must be dismissed, and the cause remanded for further proceedings.
|
254 THE WONDERS OF INSTINCT
evitable. The female Osmiae, thongh nearly always larger than the males, present marked differences among one another: some are bigger, some are smaller. I had to adjust the width of the narrow galleries to Bees of average dimensions. It may happen therefore that a gallery is too small to admit the large-sized mothers to whom chance allots it. When the Osmia is unable to enter the tube, obviously she will not colonize it. She then closes the entrance to this space which she cannot use and does her laying beyond it, in the wide tube. Had I tried to avoid these useless apparatus by choosing tubes of larger caliber, I should have encountered an other drawback : the medium-sized mothers, finding them selves almost comfortable, would have decided to lodge females there. I had to be prepared for it: as each mother selected her house at will and as I was unable to interfere in her choice, a narrow tube would be colonized or not, according as the Osmia who owned it was or was not able to make her way inside.
There remain some forty pairs of tubes with both galleries colonized. In these there are two things to take into consideration. The narrow rear tubes of 5 or 55^2 millimeters ^ — and these are the most numerous — con tain males and males only, but in short series, between one and five. The mother is here so much hampered in her work that they are rarely occupied from end to end ; the Osmia seems in a hurry to leave them and to go and colonize the front tube, whose ample space will leave her the liberty of movement necessary for her operations.
|
Bulb Zone
The Koosh Zone is a biome located to the North of the Crash Zone.
A Wreck can be located within the Koosh Zone.
Resources
* Bone Shark Egg
* Bioreactor Fragment
* Coral Sample
* Gold
* Koosh Sample
* Lithium
* Mesmer Egg
* Pygmy Fan Seed
* Salt Deposit
* Shocker Eggs
* Table Coral Sample
* Writhing Weed Seed
* Water Filtration Machine Fragment
Fauna
* Bone Shark
* Boomerang
* Eyeye
* Hoopfish
* Mesmer
* Shocker
* Shuttlebug
Flora
* Koosh Bush
* Pygmy Koosh
* Pygmy Fan
* Sea Crown
* Writhing Weed
Corals
* Purple Brain Coral
* Shell Plate
* Slanted Shell Plate
* Table Coral
Gallery
For a more complete gallery, visit Koosh Zone/Gallery.
Trivia
|
Create a ASP.Net web service and deploy on a remote server
I need to create a web service in either 3.4 or 4.5 version of .net framework and deploy it into a windows server 2012 R2 OS.
IIS is been configured on the 2012 SEREVR R2 OS already.
Can anyone provide step-by-step information for this?
This web service would be consumed by a java client for my project.
Also, would like to know what should be the approach, whether i need to wcf service & deploy the same in target server's IIS.
If I create:
asp.net web application in 4.5 framework and add a web service -asmx -file will that be sufficient for me to deploy onto the target server?
How to take the web service code from my dev machine to another machine also.
Why don't use web api?
Please elaborate, am somewhat new to this .net web api terminology.Any links / source code / tutorials is appreciated!
Do you know asp.net mvc? Here is a good recource : https://www.youtube.com/watch?v=t090py6b0lM
|
Talk:Bowser VS Ganon/@comment-28091806-20160330225241/@comment-16919137-20160330233158
Research is leaps and bounds better but it has inferior animation. Stalemate tbh.
|
Image forming apparatus
ABSTRACT
An image forming apparatus, wherein the following formulae are satisfied:
0.22 ≤ ( M / S ) L ≤ 0.4 ,
( Q M ) L = Vc ( Lt 2 ɛ 0 ɛ t + Ld ɛ 0 ɛ d ) × ( M S ) L ( Dt max - Dt 0.1 ) { λ × ( M S ) L - 0.1 } ( Lt 2 ɛ 0 ɛ t + Ld ɛ 0 ɛ d ) × ( M S ) L 500 ≤ αβ ≤ ( Dt max - Dt 0.1 ) { λ × ( M S ) L - 0.1 } ( Lt 2 ɛ 0 ɛ t + Ld ɛ 0 ɛ d ) × ( M S ) L 150 αβ ≥ ( Dt max - Dt 0.1 ) { λ × ( M S ) L - 0.1 } 150
where (M/S) L : a toner bearing amount in a maximum density image portion of a photosensitive drum, (Q/M) L : an average charge amount of the toner in the maximum density portion, Vc: an absolute value of a potential difference between a DC-component of a developing bias and the maximum density portion, Lt: a toner layer thickness of the maximum density portion, Ld: a drum thickness, εt: a relative permittivity of the toner layer, εd: a relative permittivity of the drum, ε 0: a vacuum permittivity, Dtmax: a transmission density in a maximum density image portion on the paper after fixation, Dt 0.1 : a transmission density in an image on the paper when the toner bearing amount on the paper after fixation is 0.1 mg/cm 2 , and λ: a transfer efficiency of the toner,
α
=
(
Dt
max
-
Dt
0.1
)
{
λ
×
(
M
S
)
L
-
0.1
}
,
and
β
=
1
/
(
Q
/
M
)
L
.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to an image forming apparatus such as a copying machine or a printer that produce images by visualizing electrostatic images formed on an image bearing member.
2. Description of the Related Art
Recently, as a POD (print on demand) market expands, an electrophotographic image forming apparatus makes an attempt to enter the POD market. An apparatus of higher productivity (a larger number of output prints per unit time) is expected to be introduced.
On the other hand, however, since reduction of power consumption is also required in order to cope with environmental issues, it is not allowed to increase the power consumption largely for increasing the printing speed. Therefore, it is desired to achieve an increase in printing speed and reduction in power consumption at the same time. It is needless to say that a high quality image formation is expected also in terms of image quality.
Under such circumstances, there are large differences between the printing and the electro photography that uses a toner to form images. One of the differences is a “toner relief” which occurs during image forming. Unlike the printing which uses an ink as a liquid, in the electro photography in which a toner of powder in nature is fused and fixed onto a transfer material such as a paper by a fixing device with pressure and heat, even the fixed toner has a volume to a certain extent. Consequently, when a high-density portion of a larger toner amount is adjacent to a low-density portion of a smaller toner amount, in a large case, a toner relief of 10 μm or more occurs resulting in an uneven touch on images. The uneven touch may give an undesirable feeling to users who are accustomed to a substantially plane print surface. Therefore, it is desired to be capable of forming images with less toner relief.
In the POD market, particularly, there are requests to use thin papers. For example, it is conceivable that there may be a case that full color images are formed on a thin paper of 40 to 50 g/m² or less without changing the throughput. However, when images are formed on such a thin paper using a conventional toner amount (toner bearing amount), elasticity of the paper tends to get defeated by a force, which is generated due to a phase change of the toner during fixing process, resulting in a curl generated on the paper. The “phase change of the toner” is a phenomenon in which a powder toner is fused once, and then solidified again to be fixed on a transfer material like a paper. Also the “curl” is a phenomenon such that a transfer material such as a paper fixed with the toner forms a curvature; and generally refers to a phenomenon such that the side, on which the toner exists, of the transfer material such as a paper fixed with the toner forms a curvature into a concave or downwardly rounded surface.
Further, it is strongly requested to reduce the running cost per sheet of color images.
The inventors examined and found that, in order to respond such requests, it is one of the extremely effective techniques to largely reduce the toner amount (toner bearing amount) needed for image forming.
For example, the fixing temperature may be reduced by several dozen degrees by reducing the toner bearing amount to a half. Further, by utilizing the power equivalent to the reduction effect of the fixing temperature, the printing speed can be increased with the same power consumption as that of the conventional art. By reducing the total amount of the toner necessary for forming images to a half, a large effect to reduce the toner relief and the curl is obtained. Furthermore, by reducing the amount of the toner used per an output image sheet, the running cost can be also largely reduced.
Thus, reducing the toner bearing amount is extremely effective to increase the productivity and the applicability to thin papers and to achieve an image quality with a smaller toner relief closer to the image quality of the ordinary printing, by use of the electrophotographic method.
Conventionally, a technique to reduce the toner bearing amount by increasing tinting strength of the toner has been proposed (Japanese Patent Application Laid-Open No. 2005-195674).
However, the examination by the inventor et al. revealed that, for example, after enhancing the tinting strength of the toner by increasing the amount of coloring agent contained in the toner, simply reducing the developing contrast by the amount corresponding thereto to reduce the toner bearing amount may cause the following disadvantages to occur.
Referring to FIG. 12A, a relationship between potential and developing bias on an electrophotographic photosensitive member (hereinafter referred to as “photosensitive member”) is illustrated. Developing contrast (Vcont) is a difference between a latent image electrical potential (exposed portion potential) formed on the photosensitive member and a potential Vdc of a DC-component of developing bias in an image forming per one color. The developing bias may be a superimposed voltage of an AC voltage and a DC voltage. Further, a difference between a latent image electrical potential VL formed on the photosensitive member to obtain a maximum toner bearing amount (i.e., maximum density) and the Vdc; i.e., |Vdc−VL| is particularly represented with “Vc” as a maximum value of the developing contrast Vcont (hereinafter also referred to as “maximum developing contrast”). Charge potential (potential in an unexposed portion) of the photosensitive member is represented by “Vd”. Potential difference between charge potential Vd in the photosensitive member and potential Vdc of DC-component of the developing bias; i.e., |Vdc−Vd| is referred to as a fog removal bias (Vb).
(1) Increase of γ
FIG. 2 illustrates a relationship between a transmission density Dt and a developing contrast Vcont in a gradation image formed on a paper as a transfer material through the development, transfer and fixing processes (FIG. 3 is the similar graph). A line “a” in FIG. 2 represents a γ-characteristic (gradation characteristic) obtained using a conventional common toner, which is controlled to obtain a maximum density (Dtmax=1.8) at Vc=150 V (point-p).
In this specification, the density of an image is indicated as a transmission density Dt measured on the fixed image using a transmission densitometer TD904 manufactured by the GretagMacbeth AG. In order to describe a relationship between the toner bearing amount and the density under a condition that the influence of gloss caused from a surface condition of a toner layer on a transfer material was removed, the transmission density ⊃t was used. As for the paper as the transfer material, OK Topcoat (73.3 g/m²) from Oji Paper Co., Ltd was used. In the following descriptions, all the paper used was the above coat paper.
The developing contrast Vcont on the abscissa in FIG. 2 is obtained as a difference between the potential of a digital latent image, which is continuously formed on the photosensitive member with varying gradation, and the potential Vdc of DC-component of the developing bias. In order to facilitate the description, FIG. 14 illustrates the potential of a latent image in the case where the latent image electrical potential of the digital latent image of the gradation image is varied in 17 steps. FIG. 14 also schematically illustrates enlarged images in several gradations. That is, (a) in FIG. 14 represents a maximum density image (solid image). Each of (b), (c) and (d) in FIG. 14 also represents a half-tone image respectively, the density of which is lowered in this order. Further, (e) in FIG. 14 represents a minimum density image (blank copy image); i.e. an area to which no toner should be adhered.
As shown in FIG. 13A, a desired latent image is formed on a photosensitive member 1 with an exposing device 3, and the latent image electrical potential thereof was measured with a surface electrometer Vs disposed at the downstream side than the exposing device 3 in a rotational direction of the photosensitive member 1.
The γ-characteristic indicated with the line “a” in FIG. 2 was obtained when the toner was used in which the tinting strength was adjusted so as to obtain the maximum density (Dtmax=1.8) at approximately 0.56 mg/cm² of the toner bearing amount on the paper. The value of 0.56 mg/cm² was the toner bearing amount on the paper. The toner bearing amount here was the value after the toner layer of approximately 0.6 mg/cm² was formed on the photosensitive member in the developing process and after completing the developing process, and the toner layer was transferred on the paper through the transfer process twice via an intermediate transfer member. In this case, the transfer efficiency after the twice transfer processes was approximately 93%. Also, it is assumed that after the fixing process, there has been no change in the toner bearing amount after the completion of transfer process.
In the case of the γ-characteristic indicated with the line “a” in FIG. 2, when the developing contrast Vcont changes, for example, by 25 V (ΔVcont=25 V), the density Dt changes by 0.15 (Δdt=0.15). That is, when the developing contrast changes by ΔVcont=10 V, the density changes by Δdt=0.06.
Ordinarily, an electrophotographic image forming apparatus has various mechanical or electrical fluctuations. For example, ordinarily, the distance (S-D gap) between the developer carrying member and the photosensitive member varies depending on a mechanical tolerance. Also, ordinarily, the value of the bias applied to the developer carrying member subtly changes. That is, the developing contrast Vcont changes a little due to the mechanical or electrical fluctuation.
Therefore, for example, when an image of fully uniform density is formed, the large change in density with respect to the subtle change of the developing contrast Vcont as described above will cause an uneven image in the same area.
Currently, for the density change of Δdt=0.15 or so with respect to the developing contrast change of ΔVcont=25 V, generally, uniformity in an image area can be ensured.
Contrarily, a line “a′” in FIG. 3 indicates the γ-characteristic in the following case. That is, a toner with a double density of a conventional toner (i.e., tinting strength is twice) was used; the developing contrast was set to a half of a conventional contrast (Vc′=(½)×Vc); and the toner bearing amount was set to approximately a half (maximum toner bearing amount on the paper: 0.28 mg/cm²). In FIG. 3, the identical line “a” shown in FIG. 2 is also illustrated.
The inclination of the γ-characteristic indicated with the line “a′” in FIG. 3 is sharper than that of the line “a”, in order to achieve Dtmax=1.8 by a half toner bearing amount (point-p′) of the case in the γ-characteristic indicated with the line “a”.
In the case of the γ-characteristic indicated with the line “a′”, it is extremely difficult to obtain the gradation. Further, the density change becomes too high as Δdt′=2 Δdt with respect to the above-mentioned developing contrast change of ΔVcont=25 V. As a result, an image including a large unevenness may be resulted in.
(2) Increase of Coarseness
Between the case of the -characteristic indicated with line “a” in FIG. 2 and FIG. 3 and the case of the -characteristic indicated with the line “a” in FIG. 3, coarseness (smoothness of image) in low density portions (halftone portions) each having the same density was compared. As a result, it was found that, in the low density portion (halftone portion) having the -characteristic indicated with the line “a”, the coarseness was largely worsened. The reason of this is understood as described below.
The image in the low density portion (halftone portion) was obtained by developing the latent image electrical potential having a potential indicated with Vh in FIG. 14.
Since Vcont=|Vdc−Vh|≈0, the image has a transmission density at a point in the vicinity of Vcont=0; i.e., approximately Dt=1 in FIG. 2.
The gradation electric potentials in FIG. 14 are latent image electrical potentials of digital latent images obtained while changing the emitting width by PWM (pulse width modulation) in laser exposure. FIG. 14 shows gradation electric potentials obtained based on gradation data of two hundred lines. Therefore, the latent image electrical potential Vh of the actual half-tone image forms non-image areas and image areas alternately, for example, as shown in FIG. 15A. FIG. 15A schematically illustrates an enlarged half-tone image. FIG. 15B schematically illustrates the latent image electrical potential of the half-tone image shown in FIG. 15A.
FIG. 16 schematically illustrates a space electrical potential between the photosensitive member and the developer carrying member. Hereinafter descriptions will be made using the following coordinate system shown in FIG. 16. That is, the main scanning direction (corresponding to the laser scanning direction) is the y-axis; the sub-scanning direction (corresponding to a surface movement direction of the photosensitive member) is the z-axis; and the straight-line direction connecting between the surfaces of the photosensitive member and the developer carrying member is the x-axis. The x-axis, the y-axis and the z-axis are perpendicular to one another.
When the latent image electrical potential Vh on the half-tone image is expressed more precisely, the potential is represented with a repeated potential of Guassian distribution as shown in FIG. 15B. That is, a potential distribution, which has a potential Vha (hereinafter, referred to as “a peak latent image electrical potential in an image area”) as a peak potential at the VL side at substantially central point in the main scanning direction of one image area, is repeated. Average potential Vh is obtained by measuring the latent image electrical potential illustrated in FIG. 15B while maintaining a limited distance using a surface electrometer Vs shown in FIG. 13A.
FIGS. 17A and 17B are diagrams each illustrating a potential (space electrical potential) between the photosensitive member and the developer carrying member, which is plotted from the surface of the photosensitive member to the surface of the developer carrying member. In FIGS. 17A and 17B, the plane “y-z” at x=0 represents the potential distribution shown in FIG. 15B.
In FIGS. 15A, 15B, 16, 17A and 17B, Y1 indicates the identical position in the y-axis direction; i.e., particularly, the substantially central point (a peak of a latent image electrical potential in an image area) in the main scanning direction in one image area of a half-tone image.
FIG. 17A illustrates, as an example, changes of the potential when a developing bias of Vdc=300 V is applied to the latent image electrical potential of Vd=450 V, VL=150 V, Vh=310 V, Vha=170 V (calculated value). In this case, from the following formulae: Vc=|Vdc−VL|=150 V; and Vb=|Vdc−Vd|=150 V, Vc is 150 V, and Vb is 150 V.
Actually, a developing bias of a superimposed AC voltage and DC voltage is applied to the developer carrying member. However, the Vdc may be used as an average potential.
FIG. 17B illustrates, as an example, changes of the potential when a developing bias of Vdc=225 V is applied to a latent image electrical potential of Vd=375 V, VL=150 V, Vh=310 V and Vha=170 V (calculated value). In this case, from the following formulae: Vc=|Vdc−VL|=75 V; and Vb=|Vdc−Vd|=150 V, Vc is 75 V, and Vb is 150 V.
That is, FIG. 17B illustrates a distribution of the latent image electrical potential when the charge potential Vd and potential Vdc in the DC-component of the developing bias are controlled so that, at the same fog removal bias Vb, Vc′=(½)×Vc with respect to the same image area peak potential Vha as the case of FIG. 17A.
FIG. 18 illustrates an electrical potential distribution, which is extracted at x=40 μm in the space electrical potential shown in FIGS. 17A and 17B; i.e., in a plane (y-z plane) 40 μm away from the photosensitive member toward the developer carrying member. A line “C” in FIG. 18 represents an electrical potential in the y-z plane at x=40 μm in FIG. 17A; while a line “C′” in FIG. 18 represents an electrical potential in the y-z plane at x=40 μm in FIG. 17B. Referring to FIG. 18, it is found that, in the y-direction, the line “C′” has more moderate and wider inclination of the changes of the electrical potential than the line “C”.
FIG. 19 illustrates the changes of the electrical potential, which is extracted from a plane of y=Y1 (x-z plane) in the space electrical potential shown in FIGS. 17A and 17B. A line “b” in FIG. 19 represents the changes of the electrical potential in the x-z plane at y=Y1 in FIG. 17A; while a line “b′” in FIG. 19 represents the changes of the electrical potential in the x-z plane at y=Y1 in FIG. 17B. Referring to FIG. 19, it is found that the line “b′” has more moderate and wider inclination of the changes of the electrical potential in the x-direction than the line “b”.
That is, when Vc′=(½)×Vc, the inclination of the changes of the electrical potential decrease (become smaller) in a boundary area between the image area and the non-image area in the y-direction and the x-direction. Therefore, the developing position (adhering position) of the toner becomes unstable near the boundary area as shown in FIG. 20B. It is understood that the unstable ness is the cause of the “coarseness”.
Therefore, when reducing the toner bearing amount, in order to prevent the coarseness from worsening, it is preferable to perform the image forming at a maximum developing contrast Vc equal to or greater than the conventional level.
(3) Worsening of Fogged Image
As for the fogged image; i.e., about a phenomenon of toner adhesion to the non-image area during developing process, the following fact was found. That is, since the toner bearing amount is reduced and the tinting strength of the toner is increased at the same time, the frequency of fogged images tends to be the same as or worse than the conventional art.
As described above, in order to reduce the toner bearing amount, just simply reducing the developing contrast to reduce the toner bearing amount by increasing the tinting strength of the toner and utilizing the thus increased density may decrease the stability and image quality. That is, such problems as unstable ness, worsening of coarseness and fogged images may occur. As described above, it is requested to increase the productivity, to reduce the power consumption, the toner relief and the running cost while enabling the reduction of the toner bearing amount without decreasing the conventional stability and the image quality.
SUMMARY OF THE INVENTION
An object of the invention is to provide an image forming apparatus capable of reducing toner bearing amount while preventing decrease of the stability and image quality.
Another object of the invention is to provide an image forming apparatus that prevents an image density from changing with respect to the change in developing contrast.
Still another object of the invention is to provide an image forming apparatus that prevents the developing contrast from reducing when the toner bearing amount is reduced.
Yet another object of the invention is to provide an image forming apparatus that prevents the worsening of fogged image even if the toner bearing amount is reduced.
Objects and characteristics of the invention will be further clarified by reading the following detailed descriptions while referring to accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a graph for illustrating a range of a toner bearing amount and a range of a toner charge amount according to the invention.
FIG. 2 is a graph illustrating an example of γ-characteristic.
FIG. 3 is a graph for illustrating an example of γ-characteristic for showing a conventional technique to reduce the toner bearing amount by increasing tinting strength of a toner.
FIG. 4 is a graph for illustrating a relationship between a maximum toner bearing amount and a toner layer electrical potential depending on the toner charge amount.
FIG. 5 is a graph for illustrating a relationship between a maximum toner bearing amount and a toner layer electrical potential depending on the toner charge amount.
FIG. 6 is a graph for illustrating a relationship between the toner bearing amount and the toner charge amount.
FIG. 7 is a graph for illustrating a range of the toner bearing amount and the toner charge amount according to the invention.
FIG. 8 is a graph for illustrating a relationship between a tinting strength of the toner and the toner bearing amount.
FIG. 9 is a graph for illustrating a relationship between tinting strength of the toner and the toner charge amount.
FIG. 10 is a graph for illustrating a range of the tinting strength of the toner and the toner charge amount according to the invention.
FIG. 11 is a graph for illustrating the toner bearing amount and toner height after fixation.
FIGS. 12A and 12B are schematic views for illustrating a relationship between the latent image electrical potential and the developing bias.
FIGS. 13A and 13B are schematic views for illustrating measurement by a surface electrometer.
FIG. 14 is an explanatory view for illustrating latent image electrical potential digitally formed on a photosensitive member.
FIGS. 15A and 15B are explanatory views for illustrating latent image electrical potential digitally formed on the photosensitive member.
FIG. 16 is an explanatory view for illustrating a space electrical potential between the photosensitive member and a developer carrying member.
FIGS. 17A and 17B are graphs for illustrating a space electrical potential between the photosensitive member and the developer carrying member.
FIG. 18 is a graph for illustrating a space electrical potential between the photosensitive member and the developer carrying member.
FIG. 19 is a graph for illustrating a space electrical potential between the photosensitive member and the developer carrying member.
FIGS. 20A and 20B are schematic views for illustrating differences in the way of bearing toner depending on the different developing contrast.
FIG. 21 is a schematic cross sectional view of one embodiment of an image forming apparatus to which the invention is applicable.
FIG. 22 is a graph for illustrating a result of an experimental example.
FIG. 23 is a graph for illustrating a result of an experimental example.
FIGS. 24A, 24B, 24C, and 24D are schematic views for illustrating a range of the toner bearing amount.
FIG. 25 is a schematic sectional view for illustrating an example of layer structure of a photosensitive member.
FIGS. 26A, 26B, 26C and 26D are schematic sectional views for illustrating other examples of layer structure of a photosensitive member.
FIG. 27 is a schematic view of a Faraday gauge used for obtaining a toner charging amount and a toner bearing amount.
FIG. 28 is a schematic view of an instrument used for measuring toner permittivity.
DESCRIPTION OF THE EMBODIMENTS
Referring now to the drawings, an image forming apparatus according to the invention will be described in detail below.
Embodiment 1
[Entire Constitution and Operation of the Image Forming Apparatus]
First of all, an entire constitution and an operation of the image forming apparatus according to one embodiment of the invention will be described. FIG. 21 schematically illustrates a sectional constitution of relevant parts of an image forming apparatus 100 of the embodiment.
The image forming apparatus 100 has a cylindrical photosensitive member (photosensitive drum) 1 as an image bearing member. Around the photosensitive member 1, a charging device 2 as a charging unit, an exposing device 3 as an exposing unit, a rotary developing apparatus 40, an intermediate transfer unit 50, a cleaner 7 as a cleaning unit, a pre-exposing device 8 as a pre-exposing unit are disposed.
The rotary developing apparatus 40 has developing devices 4Y, 4M, 4C and 4K as developing units each performing development using toners of yellow (Y), magenta (M), cyan (C) and black (K) respectively. In this embodiment, the developing devices 4Y, 4M, 4C and 4K for respective colors are substantially identical to one another in constitution and operation excepting a point that each of the devices uses toner of a color different from one another. Therefore, hereinafter, if not particularly specified, the suffixes Y, M, C and K each attached to the reference numeral for indicating a particular color will be omitted and the description of the developing devices will be given as a whole.
The intermediate transfer unit 50 has an intermediate transfer member (an intermediate transfer belt) 5 of an endless belt-state disposed being opposite to the photosensitive member 1. The intermediate transfer member 5 is laid around on a drive roller 53, a secondary transfer opposed-roller 54 and a tension roller 55 as a plurality of supporting members. On the inner periphery side of the intermediate transfer member 5, a primary transfer roller 51 is disposed as a primary transfer device at a position opposite to the photosensitive member 1. The primary transfer roller 51 presses the intermediate transfer member 5 onto the photosensitive member 1 to form a nip (a primary transfer nip) at a primary transfer portion N1 where the photosensitive member 1 and the intermediate transfer member 5 are in contact with each other. Also, at a position opposite to the secondary transfer opposed-roller 54, a secondary transfer roller 52 is disposed as a secondary transfer device being interposed by the intermediate transfer member 5. The secondary transfer roller 52 is disposed in contact with the intermediate transfer member 5 to form a nip (a secondary transfer nip) at a secondary transfer portion N2. In this embodiment, a transfer unit includes the primary transfer roller 51, the intermediate transfer member 5 and the secondary transfer roller 52; thereby an image formed with toner on the photosensitive member 1 is transferred to a transfer material S.
Further, the image forming apparatus 100 has a fixing device 6 as a fixing unit for fixing the toner to the transfer material S at the downstream than the secondary transfer portion N2 in a conveying direction of the transfer material S.
For the photosensitive member 1, a common OPC (an organic photoconductor) photosensitive member or an a-Si (amorphous silicon) photosensitive member may be employed. The OPC photosensitive member has a photosensitive layer (a photosensitive film) formed on a conductive base. The photosensitive layer has a photoconductive layer formed of an organic photoconductor as a main component. As illustrated in FIG. 25, the OPC photosensitive member generally includes a charge generation layer 12 formed of an organic material, an charge transport layer 13 and a surface protection layer 14 which are stacked on a metal base (a support member for a photosensitive member) 11 as a conductive base. The a-Si photosensitive member has a photosensitive layer (a photosensitive film) that includes a photoconductive layer of amorphous silicon as a major component formed on a conductive base. Generally, the a-Si photosensitive member has the following layer structures. That is, an a-Si photosensitive member illustrated in FIG. 26A is provided with a photosensitive film 22 formed on a photosensitive member support (conductive base) 21. The photosensitive film 22 is composed of a-Si: H, X (H is hydrogen atom, X is halogen atom) and includes a photoconductive layer 23 having photoconductivity. An a-Si photosensitive member illustrated in FIG. 26B is provided with the photosensitive film 22 formed on the photosensitive member support 21. The photosensitive film 22 is composed of a-Si: X, X and includes a photoconductive layer 23 having photoconductivity and an amorphous silicon surface layer 24. An a-Si photosensitive member illustrated in FIG. 26C is provided a photosensitive film 22 formed on the photosensitive member support 21. The photosensitive film 22 is composed of a-Si: H, X and includes a photoconductive layer 23 having photoconductivity, an amorphous silicon surface layer 24 and an amorphous silicon charge injection blocking layer 25. An a-Si photosensitive member illustrated in FIG. 26D is provided with a photosensitive film 22 formed on the photosensitive member support 21. The photosensitive film 22 includes a photoconductive layer 23 and an amorphous silicon surface layer 24. The photoconductive layer 23 includes a charge generation layer 26 composed of a-Si: H, X and a charge transport layer 27.
The layer structure of the photosensitive member 1 is not limited to the above-described layer structures, but any photosensitive member of a different layer structure may be used.
It should be noted that the film thickness of the photosensitive member means the thickness of the photosensitive layer (the photosensitive film) including the photoconductive layer; herein, the total thickness of the layers formed on the conductive base.
The capacitance (capacitance per unit area) C of the photosensitive member is preferred to be within a range expressed by the following calculation: 0.7×10⁻⁶ F/M² <C<2.7×10⁻⁶ F/M²
The reason of this is described below.
For example, in the case of common OPC photosensitive member, the film thickness to obtain the above capacitance is; approximately 11 μm<film thickness of photosensitive member<40 μm.
For the OPC photosensitive member, it is known that the thicker the film, the poorer the thin line reproducibility. That is, when the film is too thick, electrical potentials generated by the adjoining lines interfere with each other. As a result, the potential gets shallow and looses its sharpness; and as a result, the thin line reproducibility may be degraded. According to examinations conducted by the inventors, in an OPC photosensitive member of 40 μm or more in film thickness under a desired electrical potential setting, for example, thin lines formed at a resolution of about 1200 dpi may not reproduced satisfactorily. Contrarily, when the film thickness of the OPC photosensitive member is 11 μm or less, the film hardly assumes a uniform coating. Therefore, unevennesses in charging characteristic and photoconductivity characteristic are generated resulting in a problem like an uneven density. Further, when the toner bearing amount is (M/S)_(L)=0.22 mg/cm², the charge amount of the toner required for satisfying the charging efficiency of 100%, which will be described later, exceeds approximately −150 μC/g at Vcont=150 V developing contrast setting required for obtaining a desired density stability. Therefore, it may be extremely difficult to ensure develop ability.
On the other hand, for the a-Si photosensitive member, the film thickness of photosensitive member that satisfies the above capacitance is approximately 33 μm<film thickness of photosensitive member<120 μm.
The a-Si photosensitive member has the permittivity almost three times as large as that of the OPC photosensitive member. Therefore, for example, under the same electrical potential setting, the a-Si photosensitive member requires a charge density almost three times as large as that of the OPC photosensitive member for generating the electrical potential. Also, compared to the OPC photosensitive member, the a-Si photosensitive member has the charge generating position closer to the surface of the photosensitive member. Therefore, little charge diffuses within the photosensitive member. From the above-described facts, the following is found. That is, even when the photosensitive member has a large film thickness, the a-Si photosensitive member is less likely to loose the sharpness of the electrostatic potential on the photosensitive member. However, when the film thickness of the a-Si photosensitive member is 120 μm or more, the charge density for forming the latent image electrical potential is substantially equal to that of the OPC photosensitive member of 40 μm in film thickness. Therefore, the thin line reproducibility may decrease. Also, since when the film thickness of the a-Si photosensitive member becomes large, a dark decay amount also increases, the charge potential may be hardly controlled. Contrarily, when the film thickness of the a-Si photosensitive member becomes 33 μm or less, same as the case of the OPC photosensitive member, unevenness is generated in the photoconductivity characteristic resulting in a problem such as unevenness of the density. Further, when the toner bearing amount is (M/S)_(L)=0.22 mg/cm², under Vcont=150 V developing contrast setting required for obtaining a desired density stability, the charge amount of the toner required for satisfying the charging efficiency of 100% exceeds approximately −150 μC/g. Therefore, it may become extremely difficult to ensure develop ability.
Consequently, the capacitance (capacitance per unit area) C of the photosensitive member can be within a range expressed by the following calculation: 0.7×10⁻⁶ F/m² <C<2.7×10⁻⁶ F/m².
The photosensitive member 1 is driven to rotate at a predetermined circumferential speed in a direction indicated by an arrow R1 (counterclockwise direction) in FIG. 21. The surface of the rotating photosensitive member 1 is electrically charged to a predetermined polarity (in this embodiment, negative polarity) substantially uniformly by the charging device 2. Then, at a position opposite to the exposing device 3, the photosensitive member 1 is irradiated with a laser beam emitted from the exposing device 3 according to an image signal. Thus, an electrostatic image (latent image electrical potential) corresponding to an original image is formed on the photosensitive member 1.
When the electrostatic image formed on the photosensitive member 1 reaches the position opposite to the developing device 4 due to the rotation of the photosensitive member 1, the electrostatic image is developed as a toner image by the developing device 4. In this embodiment, the developing device 4 uses a two-component developer as the developer that mainly includes non-magnetic toner particles (toner) and magnetic carrier particles (carrier) (two component developing system). The electrostatic image is developed with substantially only the toner of the two-component developer.
In this embodiment, a plurality (in the embodiment: four) of developing devices 4Y, 4M, 4C and 4K is mounted onto a developing device support member (rotor) 40A rotatable about a rotation center G, each of the developing devices contains a different color toner respectively. By rotating the developing device support member 40A, a desired developing device can be positioned at the developing position opposite to the photosensitive member 1. By positioning a desired developing device at the developing position opposite to the photosensitive member 1 by rotating the developing device support member 40A, and by performing the development of the electrostatic image on the photosensitive member 1 sequentially, the respective color toner images can be formed on the photosensitive member 1.
The developing device 4 has a developing container (a developing device body) 44 containing the two-component developer. The developing container 44 is provided with a hollow cylindrical developing sleeve 41 as a developer carrying member. The developing sleeve 41 is disposed rotatably so that a part thereof is exposed from an opening of the developing container 44. The developing sleeve 41 includes a magnet 42 therein as a magnetic field generating unit. According to the embodiment, the developing sleeve 41 is driven to rotate so that the surface thereof moves to the same direction as the movement direction of the surface of the photosensitive member 1 at a portion opposite to the photosensitive member 1 (developing portion).
The two-component developer in the developing container 44 is supplied onto the surface of the developing sleeve 41, and then the amount thereof is controlled by a regulating member 43 disposed opposite to the surface of the developing sleeve 41. Then, the two-component developer is carried on the developing sleeve 41 and transported to the developing portion opposite to the photosensitive member 1. The carrier has a function to support and transport the charged toner to the developing portion. Being mixed with the carrier, the toner is charged to a predetermined charge amount of a predetermined polarity by the frictional charge.
At the developing portion, the two-component developer takes the shape of “ears of rice” on the developing sleeve 41 by a magnetic field generated by the magnet 42, thereby a magnetic brush is formed. Then, according to the embodiment, the magnetic brush is brought into contact with the surface of the photosensitive member 1 and a predetermined developing bias is applied to the developing sleeve 41, thereby substantially only the toner is transferred to the electrostatic image on the photosensitive member 1 from the two-component developer. The magnetic brush may be arranged to position adjacent to the photosensitive member 1 being opposed thereto.
According to the embodiment, a developing bias in which an AC bias of Vpp=2.0 kV is combined with (superimposed on) a desired DC bias is used. The closest distance (S-D gap) between the photosensitive member 1 and the developing sleeve 41 is set to 300 μm.
For example, when a full color image is formed, each of the toner images of the respective colors formed in order on the photosensitive member 1 is transferred (primary transfer) onto the intermediate transfer member 5 at the primary transfer portion N1. While the intermediate transfer member 5 rotates desired times in a direction indicated by an arrow R2, the respective color toner images are superimposed on the intermediate transfer member 5 in order and thus the full color toner image is formed. At the primary transfer, a primary transfer bias with the polarity opposite to the proper charged polarity of the toner is applied to the primary transfer roller 51 as the primary transfer device. After that, the full color toner image on the intermediate transfer member 5 is transferred collectively onto the transfer material S at the secondary transfer portion N2 (secondary transfer). When the secondary transfer is carried out, a secondary transfer bias with the polarity opposite to the proper charged polarity of the toner is applied to secondary transfer roller 52 as the secondary transfer device.
After that, the transfer material S is transported to the fixing device 6 as a fixing unit, and is heated and pressed thereby the toner image is fixed to the surface thereof. Then, the transfer material S is discharged out of the apparatus as an output image.
After the primary transfer process, the cleaner 7 removes the residual toner on the surface of the photosensitive member 1. Then, the photosensitive member 1 is irradiated with a light emitted from the pre-exposing device 8 and is electrically initialized to be ready for the next image forming. Thus, the photosensitive member 1 is repeatedly used for the image forming. After the secondary transfer process, the intermediate transfer member 5 is also cleaned by an intermediate transfer member cleaner 9 to be ready for the next image forming. Thus, the intermediate transfer member 5 is repeatedly used for image forming.
The image forming apparatus 100 is capable of forming a single color image or a multi color image by using a desired single developing device or plural (not all) developing devices.
According to the embodiment, the image forming apparatus 100 is provided with a plurality of developing devices each using a different color toner for the single photosensitive member. By repeating the developing process and the transfer process via the single photosensitive member, the respective color toner images are superimposed on one another on the intermediate transfer member 5 as the body to be transferred with the color toner images. However, the invention is not limited to the above-described embodiment. A tandem type image forming apparatus such that a plurality of developing devices each using a different color toner is provided to a plurality of photosensitive members; and each of the respective color toner images formed on each of the plurality of the photosensitive members is superimposed on one another on the intermediate transfer members may be employed. The image forming apparatus is also not limited to an intermediate transfer type image forming apparatus using an intermediate transfer member. For example, a direct transfer type image forming apparatus, in which a transfer member support for supporting and transporting a transfer material is provided in place of the above-described intermediate transfer member; toners are directly transferred to the transfer material on the transfer member support from the photosensitive member; and the respective color toner images are superimposed on one another on the transfer material, may be employed. That is, in this case, the transfer process by the transfer device is performed only once.
[Principle of the Invention]
As described above, to obtain the same stability as the conventional while reducing the toner bearing amount using a toner the tinting strength of which is higher than that of the conventional, the γ-characteristic is required to be at least the same as the conventional art.
That is, even when a toner having a higher tinting strength is used, if the developing contrast to obtain the maximum density Dtmax is not the same, the same stability as the conventional is hardly obtained. To obtain such γ-characteristic, it is effective to set a higher absolute value for the charge amount (amount of electric charge) of the toner. The reason is as described below.
The solid line in FIG. 12A represents the latent image electrical potential on the photosensitive member, while the broken line represents the developing bias (developing bias in which an AC voltage of a rectangular waveform is superimposed on a DC voltage). A symbol Vdc represents an electrical potential of the DC-component of the developing bias, and a symbol Vd represents a charge potential of the photosensitive member (i.e., electrical potential in non-image portion). A symbol VL represents an electrical potential on the photosensitive member for obtaining the maximum toner bearing amount (i. e., maximum density Dtmax). A symbol Vc represents a difference (maximum developing contrast) between the VL and Vdc. A symbol Vb represents a difference (fog removal bias) between the Vd and Vdc.
In this embodiment, the following image exposure system is employed. That is, a photosensitive member is uniformly charged to a predetermined polarity (particularly, in this embodiment, to the negative polarity) and to a part to be developed an image is exposed with a laser beam or the like, thereby the desired electrical potential of exposed portion is obtained. As for the developing method, a reverse development method is employed. That is, the toner charged to a polarity identical to the charged polarity of the photosensitive member is adhered to the exposed portion.
In this specification, if not otherwise specified, the charge amount (amount of electric charge) of the toner is expressed with an absolute value thereof. Actually, the charge of the toner has a predetermined polarity (in this embodiment, negative polarity).
As illustrated in FIG. 12B, generally, the development is performed so that the electrical potential Vt in the outermost layer of the toner layer formed on the photosensitive member (hereinafter referred to as “outermost layer electrical potential”) fills in the maximum developing contrast Vc. Here, the toner bearing amount (toner weight per unit area) of the VL electrical potential part on the photosensitive member; i.e., the maximum toner bearing amount on the photosensitive member is defined as (M/S)_(L).
Here, an index for indicating how much the electrical potential (hereinafter, referred to as “toner layer electrical potential”) ΔVt formed by the toner layer, which is expressed by the following formula: |Vt−VL|=ΔVt, fills in the developing contrast Vcont is defined as charging efficiency. That is, the charging efficiency is expressed by the formula:
charging efficiency=(ΔVt/Vc)×100. In other words, it means that when the charging efficiency is 100%, the toner layer electrical potential ΔVt fills in the developing contrast Vcont completely.
It is known that when the charging efficiency is low; i.e., when the development is terminated in a state that the toner layer electrical potential does not fully fill in the developing contrast (charge failure), various defective images are generated.
For example, generally, the distance (S-D gap) between the developing sleeve and the photosensitive member changes subtly due to a mechanical tolerance. Corresponding to this, a developing electric field also subtly changes. At this time, when the development is terminated while the toner layer electrical potential does not fully fill in the developing contrast, it may cause unevenness in the toner bearing amount due to the fluctuation of the developing electric field. As a result, the uniformity and the stability may be decreased.
Also, there may be a case that, since the toner layer electrical potential fails to fill in the developing contrast in a solid image portion located in a boundary area between a solid image (maximum density image) portion and a half-tone image portion, a contrast difference is generated with respect to the electrical potential of the half-tone image portion. Due to this, a defective image such as a blank area may be generated.
Therefore, to prevent the generation of such defective image, it is essential to ensure a state that the charging efficiency is 100%; i.e., the calculation: ΔVt=Vc is satisfied.
As a specific example, a development, which was actually performed under the following conditions, will be described.
A VL electrical potential portion (maximum density portion) formed on an organic photosensitive member (OPC photosensitive member) of 26 μm in film thickness was developed using a toner of 30 μC/g in charge amount (amount of electric charge per unit weight). The maximum developing contrast Vc at this time was controlled to be 200 V. In this case, the toner bearing amount in the VL electrical potential portion on the photosensitive member was 0.6 mg/cm², and the outermost layer electrical potential Vt in the toner layer was −199 V. More specifically, Vd=−450 V, VL=−100 V, Vdc=−300 V and ΔVt=198 V.
The outermost layer electrical potential Vt was measured at a position immediately after the development using a surface electrometer Vs (MODEL 347 manufactured by TREK, INC) as illustrated in FIG. 13B. ΔVt was obtained as a difference with respect to the VL electrical potential measured by the surface electrometer Vs without disposing any developing device as illustrated in FIG. 13A.
That is, in this case, the charge efficiency is expressed by the following calculation: ΔVt/Vc×100=99%
It is understood that the toner layer electrical potential substantially fills in the developing contrast.
The toner layer electrical potential ΔVt may be expressed with the following formula.
$\begin{matrix} {{\Delta\;{Vt}} = {\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L} \times \left( \frac{Q}{M} \right)_{L}}} & (1) \end{matrix}$
- (M/S)_(L): toner bearing amount in a maximum density image portion of the photosensitive member (toner weight per unit area) [mg/cm²] - (Q/M)_(L): average charge amount of toner in a maximum density image portion on the photosensitive member (toner charge amount per unit area) [μC/g] - Lt: toner layer thickness in a maximum density image portion on the photosensitive member [μm] - Ld: film thickness of photosensitive film on the photosensitive member [μm] - ε_(t): relative permittivity of the toner layer - ε_(d): relative permittivity of the photosensitive member - ε₀: permittivity in vacuum
In the above specific example, the actually measured height of the toner layer adhered to the VL electrical potential portion on the photosensitive member was approximately 9.2 μm. The above formula (1) was calculated while substituting the parameters with the following values. The toner layer electrical potential Δvt was resulted in 198 V.
- (M/S)_(L)=0.6 mg/cm² - (Q/M))_(L)=30 μC/g - Lt=9.2 μm - Ld=26 μm - ε_(t)=2.5 - ε_(d)=3.3 - ε₀=8.854×10⁻¹² F/m
That is, the measured ΔVt and the value calculated with the formula (1) are substantially identical to each other.
FIG. 4 illustrates the dependency on the toner-charge amount Q/M of the relationship between the (M/S)_(L) and the ΔVt obtained through an actual image output operation, (FIG. 5 is the same). For example, a line S2 of a solid line in FIG. 4 represents the Δvt when the (M/S)_(L) was changed using a toner of 30 μC/g in charge amount. It represents that, as described above, at a point-P on the line S2; i.e., (M/S)_(L) is 0.6 mg/cm², the toner layer electrical potential ΔVt is 198 V.
Likewise, each of the line S1, line S3, line S4 and line S5 represents the (M/S)_(L) obtained using the following toner of 20 μC/g, 40 μC/g, 60 μC/g and 80 μC/g respectively in charge amount.
For example, at a point-Q on the line S2 in which the toner charge amount is 30 μC/g as it is, while (M/S)_(L) is reduced to 0.3 mg/cm² a half of the conventional, the toner layer electrical potential ΔVt is 90 V.
It should be noted that the abscissa (M/S)_(L) in FIG. 4 represents the changes of the toner bearing amount on the photosensitive member obtained by the following manner. That is, the flat VL potential as the latent image electrical potential was changed by controlling the Vd, laser power and Vdc, thereby Vc was changed with respect to the flat VL potential. That is, the graph shown in FIG. 4 is different from a gradation curve illustrated in FIG. 2, which was obtained from the digital latent image of a desired number of lines.
As described above, when the toner charge amount is 30 μC/g as it is, and the toner bearing amount (M/S)_(L) on the photosensitive member is set to ½, the required Vc is approximately 90 V. As a result, the inclination of the γ-characteristic is precipitous as described above.
On the other hand, referring to FIG. 5, like a line S4 of a chain line, when the toner of 60 μC/g in charge amount is used, at a point-R on a line S4 where the (M/S)_(L) is 0.33 mg/cm², the toner layer electrical potential ΔVt is 200 V. That is, the required Vc is 200 V, and the γ-characteristic is the substantially the same as the conventional art.
Further, based on FIG. 4 and FIG. 5, FIG. 6 illustrates the relationship between the (Q/M)_(L) and (M/S)_(L), which is required to obtain ΔVt=Vc with respect to the desired Vcont (FIG. 7 is the same).
In FIG. 6, line L1 represents ΔVt required for achieving 100% of charging efficiency at Vc=150 V; i.e., the relationship between (Q/M)_(L) and (M/S)_(L) required to achieve ΔVt=150 V. From the above formula (1), the line L1 fulfills the following formula.
${L\; 1\text{:}\left( \frac{Q}{M} \right)_{L}} = \frac{150}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}$
Likewise, each of line L2, line L3, line L4 and line L5 represents the relationship between the (Q/M)_(L) and (M/S)_(L) for obtaining the ΔVt required for achieving 100% charging efficiency at Vc=200 V, Vc=300 V, Vc=400 V and Vc=500 V respectively. From the above formula (1), each of the line L2, line L3, line L4 and line L5 fulfills the following formulae.
${L\; 2\text{:}\left( \frac{Q}{M} \right)_{L}} = \frac{200}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}$ ${L\; 3\text{:}\left( \frac{Q}{M} \right)_{L}} = \frac{300}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}$ ${L\; 4\text{:}\left( \frac{Q}{M} \right)_{L}} = \frac{400}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}$ ${{L\; 5}:\left( \frac{Q}{M} \right)_{L}} = \frac{500}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}$
For example, in the line L2 (in the case that Vc=200 V is required), when the (M/S)_(L) is 0.6 mg/cm², the (Q/M)_(L) required for obtaining ΔVt=200 V, is approximately 30.4 μC/g (point-a in FIG. 6). When the (M/S)_(L) is 0.3 mg/cm², the (Q/M)_(L) required for obtaining ΔVt=200V is approximately 66.5 μC/g (point-b in FIG. 6).
For example, in the line L4 (in the case that Vc=400 V is required), when the (M/S)_(L) is 0.6 mg/cm², the (Q/M)_(L) required for obtaining ΔVt=400 V is approximately 61 μC/g (point-c in FIG. 6). When the (M/S)_(L) is 0.3 mg/cm², the (Q/M)_(L) required for obtaining ΔVt=400 V is approximately 133 μC/g (point-d in FIG. 6).
That is, when the Vc for obtaining 100% of the charging efficiency and a desired γ-characteristic is determined, the (Q/M)_(L) required for the (M/S)_(L) is determined
[Range of (M/S)_(L) and (Q/M)_(L)]
Referring to FIG. 7, ranges of various characteristics required for reducing the toner bearing amount will be described.
A. Range of (Q/M)_(L)
First of all, a range of the (Q/M)_(L) will be described.
As described above, to ensure image stability and image quality, the inclination of the γ-characteristic is preferred to be the same as or more moderate than that of the γ-characteristic for obtaining the maximum density ⊃tmax at Vc=150 V.
Therefore, in FIG. 7, the (Q/M)_(L) can be set to a range above the line L1 indicating the relationship between the (M/S)_(L) and (Q/M)_(L) required to obtain ΔVt=150 V.
Needless to say, the more moderate the inclination of the γ-characteristic; i.e., the larger Vc for obtaining the maximum density, the more effectively stability and contrast can be obtained. However, the inclination of the γ-characteristic has a limit depending on the other processing conditions (charge process conditions or the like) and a limit value of the toner-charge amount.
For example, referring to FIG. 12, when the Vb potential is about 150 V and the VL potential is about 100 V, the charge potential Vd on the photosensitive member requires to be set to 750 V or more to obtain Vc=500 V or more. However, an extremely large current is required to uniformly charge the surface of the photosensitive member with 750 V or more using a charging unit such as a corona charger. Therefore, a practical range is Vc=500 V or less. That is, the (Q/M)_(L) can be set to a range of the line L5 or below in FIG. 7, which represents the relationship between the (M/S)_(L) and (Q/M)_(L) required to obtain ΔVt=500 V.
In other words, taking practical value into consideration, the maximum developing contrast Vc can be within a range of 150 V≦Vc≦500 V.
There is a limit value as the charge amount of the toner. It is known that, in a dry developing, the actually available toner charge amount is about 150 μC/g. That is, when the toner charge amount exceeds 150 μC/g, the toner is hardly released from the carrier. As a result, the development itself may be difficult to perform. Further, since charge amount at the carrier side becomes higher, the carrier may adhere to the photosensitive member. Therefore, the (Q/M)_(L) can be limited to a range of the line K1 or below representing (Q/M)_(L)=150 μC/g in FIG. 7.
B. Range of (M/S)_(L)
Next, a range of the (M/S)_(L) will be described below.
Generally, the electrophotographic full color image forming apparatus is provided with the following process. That is, total amount of the toner in a part forming an image with multi color is controlled to be 2.0 to 2.5 times or less as much as a maximum toner bearing amount per single color. That is, in the case that the maximum toner bearing amount per single color is 0.6 mg/cm² on the photosensitive member, and approximately 0.56 mg/cm² on the paper, when the total amount of the toner in a part to be formed with multi color is 2.5 times as much as the maximum toner bearing amount per single color, the upper limit value thereof on the paper is calculated by the following calculation: 0.56×2.5=1.4 mg/cm².
The toner of this amount is fused and fixed onto the paper by the fixing device. The above amount of the toner was actually fixed onto paper using, for example, Image press C1 fixing device manufactured by Canon Inc. The toner layer height after fixation was approximately 13 μm. It was found that when the toner layer height was approximately 13 μm, a large toner relief was caused between the image portion and the non-image portion.
FIG. 11 illustrates the relationship between the total amount of the toner and the toner height after fixation (i.e., toner relief). When the maximum toner bearing amount per single color on the photosensitive member is reduced to 0.4 mg/cm²; and to approximately 0.37 mg/cm² on the paper, the total amount of the toner on the paper can be reduced to approximately 1 mg/cm² based on the following calculation: 0.37×2.5=0.93 mg/cm².
It was found that the toner layer height after fixation was approximately 8 μm as illustrated in FIG. 11. Further, it was found that when the toner layer height becomes approximately 8 μm, visual sensitivity on the toner relief to the non-image portion is reduced and the toner relief becomes inconspicuous.
Therefore, the maximum toner bearing amount per single color can be set to 0.4 mg/cm² or less on the photosensitive member; and to 0.37 mg/cm² or less on the paper. That is, the (M/S)_(L) can be limited to a range of the line G1 or below in FIG. 7, which indicates that the (M/S)_(L)=0.4 mg/cm².
Defining an intersection of the line L1 with the line G1 indicating the upper limit of the (M/S)_(L) in FIG. 7 as point-e; and defining an intersection of the line L5 with the line G1 indicating the upper limit of the (M/S)_(L) in FIG. 7 as point-g. The values of (M/S)_(L) and (Q/M)_(L) at the point-e and the point-g are as follows.
- point-e: (M/S)_(L)=0.4 mg/cm², (Q/M)_(L)=36 μC/g - point-g: (M/S)_(L)=0.4 mg/cm², (Q/M)_(L)=121 μC/g
There is further a theoretical limit value (lower limit value) in the toner bearing amount for obtaining a desired maximum density corresponding to the particle diameter of the toner. That is, to obtain a desired maximum density with a smaller toner bearing amount, it is ideal that the fixed toner completely fills in the entire of the transfer material such as a paper. To achieve the above, it is known that the toner bearing amount of 0.22 mg/cm² or more on the photosensitive member, and approximately 0.20 mg/cm² or more on the paper are required. The reason of this will be described below with reference to FIGS. 24A, 24B, 24C and 24⊃.
Assuming now that the particle diameter of the toner is 5 μm, a projected area of the toner is approximately 19.6 μm² (radius r=2.5 μm) (refer to FIG. 24A). Now the case where the toner is ideally flattened to 2 μm in height by fixing process is considered. In this case, the area of the toner becomes approximately 32.7 μm² (radius r′=32.3 μm) (refer to FIG. 24B). That is, the area is expanded to approximately 1.6 times as wide as the original area per particle of the toner.
When the toner of 0.2 mg/cm² of the toner bearing amount is spread over a unit area (refer to FIG. 24C), the ratio of the projected area occupied by the toner in the unit area is approximately 57% of the whole. Further, the case where the toner is entirely flattened ideally is considered (refer to FIG. 24D). In this case, the area per particle of the toner is expanded to approximately 1.6 times as wide as the original area. Therefore, the area ratio becomes approximately 1 as obtained by the following calculation: 0.57×1.67=0.95. Accordingly, the toner can fill in substantially 100% of the unit area.
That is, when the toner bearing amount on the paper is smaller than 0.2 mg/cm², even when an ideal fixing is achieved, a space is left among the flattened particles of the toner. As a result, a part of the transfer material such as a base paper is exposed, and thereby the desired maximum density cannot be obtained efficiently.
Therefore, when the particle diameter of the toner is 5 μm or greater, the toner bearing amount on the photosensitive member is desirable to be 0.22 mg/cm² or more; 0.20 mg/cm² or more on the paper. That is, the (M/S)_(L) is desirable to be the line G2 or more in FIG. 7, which indicates (M/S)_(L)=0.22 mg/cm².
An intersection of the line L1 with the line G2 indicating the lower limit of the (M/S)_(L) in FIG. 7 is defined as a point-f. Also, an intersection of the line L5 with the line G2 indicating the lower limit of the (M/S)_(L) in FIG. 7 is defined as a point-h. Further, an intersection of the line L5 with the line K1 indicating the upper limit of the (Q/M)_(L) in FIG. 7 is defined as a point-i. The values of (M/S)_(L) and (Q/M)_(L) at the point-f, point-h and point-i are as follows.
- point-f: (M/S)_(L)=0.22 mg/cm², (Q/M)_(L)=70.1 μC/g - point-h: (M/S)_(L)=0.22 mg/cm², (Q/M)_(L)=234 μC/g - point-i: (M/S)_(L)=0.33 mg/cm², (Q/M)_(L)=150 μC/g (calculated value)
Here, the particle diameter of the toner is acceptable to be 5.0 μm or more. When the particle diameter of the toner is less than 5.0 μm, the develop ability may decrease. On the other hand, the particle diameter of the toner is acceptable to be 7.5 μm or less. When the particle diameter of the toner is larger than 7.5 μm, the image portion which requires a high resolution such as the thin line reproducibility of image may be degraded.
C. Relational expression of a range between the (M/S)_(L) and the (Q/M)_(L)
As described above, the range of the (M/S)_(L) and the (Q/M)_(L) for obtaining the γ-characteristic that can reduce the toner bearing amount and ensure the stability is the range indicated with slant lines in FIG. 1. FIG. 1 illustrates the same relationship between the (M/S)_(L) and the (Q/M)_(L) as those in FIG. 6 and FIG. 7. The range indicated by the slant lines in FIG. 1 can be expressed as follows.
The (M/S)_(L) satisfies the following calculation: 0.22 mg/cm²≦(M/S)_(L)≦0.4 mg/cm².
From the above formula (1), the following formula is derived.
$\begin{matrix} {\left( \frac{Q}{M} \right)_{L} = \frac{\Delta\;{Vt}}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}} & {(1)\text{-}2} \end{matrix}$
To achieve 100% of the charging efficiency the following calculation holds: ΔVt=Vc (1)-3.
Taking a practical value into consideration, the maximum developing contrast Vc is desirable to be within the following range: 150 V≦Vc≦500 V (1)-4
The (M/S)_(L) is within the above range, and the (Q/M)_(L) with respect to each (M/S)_(L) satisfies the following formulae (1)-5 and (2).
From the formulae (1)-2 and (1)-3:
$\begin{matrix} {\left( \frac{Q}{M} \right)_{L} = \frac{Vc}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}} & {(1)\text{-}5} \end{matrix}$
From the formulae (1)-4 and (1)-5,
$\begin{matrix} {\frac{150}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}} \leq \left( \frac{Q}{M} \right)_{L} \leq \frac{500}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}} & (2) \end{matrix}$
Further, the (Q/M)_(L) satisfies the following formula: (Q/M)_(L)≦150 μC/g . . . (2)-2
[Toner Bearing Amount and Density After Fixation]
Next, the tinting strength of the toner, toner bearing amount and relationship with (Q/M)_(L) will be described.
A. Toner
Preferable modes of the toner applicable to the invention include a toner of a first mode and a toner of a second mode described below.
The toner of the first mode, which is used for a two-component developer and a supplemental developer, is a toner composed of toner particles containing a resin including a polyester unit as a principal component and a coloring agent. The wording “polyester unit” means a part derived from polyester; while the wording “resin including a polyester unit as a principal component” means a resin in which many of repeated units constituting the resin are the repeated units having an ester bond, which will be described later in detail.
The polyester unit is formed by the poly condensation of an ester-based monomer. The ester-based monomer includes poly alcohol compounds, and carboxylic acid compounds such as polycarboxylic acid, polycarboxylate anhydride, or polycarboxylate ester having two or more carboxyl groups.
As of polyhydric alcohol compounds, the dihydric alcohol component includes: an alkylene oxide additive of bisphenol A, such as polyoxypropylene(2,2)-2,2-bis(4-hydroxyphenyl)propane, polyoxypropylene(3,3)-2,2-bis(4-hydroxyphenyl)propane, polyoxyethylene(2,0)-2,2-bis(4-hydropxyphenyl)propane, polyoxypropylene(2,0)-polyoxyethylene(2,0)-2,2-bis(4-hydroxyphenyl)propane, and polyoxypropylene (6)-2,2-bis(4-hydroxyphenyl)propane; ethylene glycol; diethylene glycol; tri ethylene glycol; 1,2-propylene glycol; 1,3-propylene glycol; 1,4-butane diol; neopenthyl glycol; 1,4-butene diol; 1,5-pentane diol; 1,6-hexane diol; 1,4-cyclohexane dim ethanol; dipropylene glycol; polyethylene glycol; polypropylene glycol; polytetramethylene glycol; bisphenol A, and hydrogenated bisphenol A.
As of polyhydric alcohol compounds, the tri- and higher alcohol component includes sorbitol, 1,2,3,6-hexane tet rol, 1,4-sorbitan, pentaerythritol, dipentaerythritol, tripentaerythritol, 1,2,4-butane trio l, 1,2,5-pentane trio l, glycerol, 2-methyl propane trio l, 2-methyl-1,2,4-butane trio l, trimethylol ethane, trimethylol propane, and 1,3,5-trihydroxymethyl benzene.
Applicable carboxylic acid component structuring the polyester unit includes: aromatic dicarboxylic acid such as phthalic acid, isophthalic acid, and terephthalic acid, and an anhydride thereof; alkyl dicarboxylic acid such as succinic acid, adipic acid, sebacic acid, and azeraic acid, and an anhydride thereof; succinic acid substituted by C6-C12 alkyl group, and an anhydride thereof; and unsaturated dicarboxylic acid such as fumaric acid, maleic acid, and citraconic acid, and an anhydride thereof.
A preferable resin containing the polyester unit, existing in the toner particle of the first mode includes a polyester resin which is obtained by poly condensation of a bisphenol-derivative having a structure represented by the following chemical formula, as the alcoholic component, with a carboxylic acid component composed of a di- or higher carboxylic acid or an anhydride thereof, or a lower alkyl ester thereof, (such as fumaric acid, maleic acid, maleic acid anhydride, phthalic acid, terephthalic acid, dodecenyl succinic acid, trimelitic acid, and pyrromelitic acid). The polyester resin has good charging characteristic. The charging characteristic of the polyester resin further effectively functions when the resin is used as a resin existing in a color toner in a two-component developer.
[where R is one or more of ethylene group and propylene group, x and y are each an integer of 1 or larger, and an average value of (x+y) is in a range from 2 to 10.]
A preferable resin having the polyester unit, existing in the toner particle of the first mode, includes a polyester resin having a crosslinking position. The polyester resin having crosslinking position is prepared by poly condensation of a polyhydric alcohol with a carboxylic acid component which contains tri- or higher carboxylic acid. Examples of the tri- or higher carboxylic acid are 1,2,4-benzene tricarboxylic acid, 1,2,5-benzene tricarboxylic acid, 1,2,4-naphthalene tricarboxylic acid, 2,5,7-naphthalene tricarboxylic acid, 1,2,4,5-benzene tetracarboxylic acid, an anhydride thereof, and an ester thereof. The content of the tri- or higher carboxylic acid component in the ester-based monomer being polycondensated is preferably in a range from 0.1 to 1.9% by mole based on the total monomer quantity.
Examples of preferred resin having the polyester unit in the toner particle of the first mode are: (a) a hybrid resin having the polyester unit and a vinyl-based polymer unit; (b) a mixture of the hybrid resin with the vinyl-based polymer; (c) a mixture of the polyester resin and the vinyl-based polymer; (d) a mixture of the hybrid resin and the polyester resin; and (e) a mixture of the polyester resin, the hybrid resin, and the vinyl-based polymer.
The hybrid resin is prepared by binding the polyester unit with the vinyl-based polymer by the ester interchange reaction, which vinyl-based polymer is prepared by polymerization of a monomer component having a carboxylic acid ester group such as acrylic acid ester. The hybrid resin includes a graft copolymer or a block copolymer, composed of the vinyl-based polymer as the main polymer and the polyester unit as the branched polymer.
The vinyl-based polymer unit indicates the portion originated from the vinyl-based polymer. The vinyl-based polymer unit or the vinyl-based polymer is prepared by polymerization of a vinyl-based monomer which is described later.
The toner of the second mode in the two-component developer and the supplemental developer is a toner having the toner particles prepared by direct polymerization or in aqueous medium. The toner according to the second embodiment may be prepared by direct polymerization or may be prepared by forming emulsified fine particles in advance, followed by coagulating thereof with a coloring agent and a coagulator. The toner having the toner particles prepared by the latter method is also referred to as the “toner obtained in aqueous medium” or “toner obtained by emulsion coagulation method”.
The toner according to the second mode is obtained by direct polymerization method or emulsion coagulation method. The toner of the second embodiment preferably has toner particles having a resin mainly composed of a vinyl-based resin. The vinyl-based resin which is the main component of the toner particles is prepared by the polymerization of vinyl-based monomer. The vinyl-based monomer includes a styrene-based monomer, an acryl-based monomer, a methacryl-based monomer, an ethylene unsaturated mono-olefinic monomer, a vinyl ester monomer, a vinyl ether monomer, a vinylketone monomer, an N-vinyl compound monomer, and other vinyl monomer.
The styrene-based monomer includes styrene, o-methyl styrene, m-methyl styrene, p-methyl styrene, p-methoxy styrene, p-phenyl styrene, p-chlor styrene, 3,4-dich lor styrene, p-ethyl styrene, 2,4-dimethyl styrene, p-n-butyl styrene, p-tert-butyl styrene, p-n-hexyl styrene, p-n-octyl styrene, p-n-nonyl styrene, p-n-decyl styrene, and p-n-dodecyl styrene.
The acryl-based monomer includes: acrylic acid ester such as methyl acrylate, ethyl acrylate, n-butyl acrylate, isobutyl acrylate, propyl acrylate, n-octyl acrylate, dodecyl acrylate, 2-ethylhexyl acrylate, stearyl acrylate, dimethylaminoethyl acrylate, and phenyl acrylate; acrylic acid; and acrylic acid amide.
The methacryl-based monomer includes: methacrylic acid ester such as ethyl methacrylate, propyl methacrylate, n-butyl methacrylate, isobutyl methacrylate, n-octyl methacrylate, dodecyl methacrylate, 2-ethylhexyl methacrylate, stearyl methacrylate, phenyl methacrylate, dimethylaminoethyl methacrylate, and diethylaminoethyl methacrylate; methacrylic acid; and methacrylic acid amide.
The monomer of ethylene unsaturated mono-olefin includes ethylene, propylene, butylenes, and isobutylene.
The monomer of vinyl ester includes vinyl acetate, vinyl propionate, and vinyl benzoate.
The monomer of vinyl ether includes vinyl methyl ether, vinyl ethyl ether, and vinyl isobutylether.
The monomer of vinyl ketone includes vinyl methyl ketone, vinyl hexyl ketone, and methyl isopropenyl ketone.
The monomer of N-vinyl compound includes N-vinylpyrrole, N-vinylcarbazol, N-vinylindol, and N-vinylpyrrolidone.
Other vinyl monomer includes: an acrylic acid derivative and a methacrylic acid derivative, such as vinyl naphthalene, acrylonitrile, methacrylonitrile, and acrylamide.
These vinyl-based monomers can be used separately or in combination of two or more thereof.
The polymerization initiator applied to manufacture the vinyl-based resin includes: azo or diazo group polymerization initiator such as 2,2′-azobis-(2,4-dimethyl valeronitrile), 2,2′-azobis isobutylonitrile, 1,1′-azobis(cyclohexane-1-carbonitrile), 2,2′-azobis-(4-methoxy-2,4-dimethyl valeronitrile), and azobisisobutylonitrile; peroxide-based initiator or initiator having peroxide at the side chain thereof, such as benzoyl peroxide, methylethylketone peroxide, di-isopropylperoxy carbonate, cumene hydroperoxide, t-butyl hydroperoxide, di-t-butyl peroxide, di-acylperoxide, 2,4-dich lorobenzoyl peroxide, lauroyl peroxide, 2,2-bis(4,4-t-butylperoxy cylohexyl)propane, and tris-(t-butylperoxy)triazine; persulfate such as potassium persulfate and ammonium persulfate; and hydrogen peroxide.
Further, as for tri functional or more radical polymeric polymerization initiators, there may be given those such as, radical polymeric multifunctional polymerization initiators such as tris(t-butylperoxy) triazine, vinyl tris(t-butylperoxy) silane, 2,2-bis(4,4-di-t-butylperoxy cyclohexyl) propane, 2,2-bis(4,4-di-t-amyl peroxy cyclohexyl) propane, 2,2-bis(4,4-di-t-octyl peroxy cyclohexyl) propane and 2,2-bis(4,4-di-t-butylperoxy cyclohexyl) butane.
The first mode toner and second mode toner preferably include wax as a release agent and charge control agent such as organic metal complex.
The toner used for the two-component developer and the supplemental developer includes a coloring agent. The coloring agent here may be a pigment or dye or a combination thereof.
The dye includes C.I. Direct Red 1, C.I. Direct Red 4, C.I. Acid Red 1, C.I. Basic Red 1, C.I. Mordant Red 30, C.I. Direct Blue 1, C.I. Direct Blue 2, C.I. Acid Blue 9, C.I. Acid Blue 15, C.I. Basic Blue 3, C.I. Basic Blue 5, C.I. Mordant Blue 7, C.I. Direct Green 6, C.I. Basic Green 4, and C.I. Basic Green 6.
The pigment includes Mineral Fast Yellow, Naval Yellow, Naphthol Yellow S, Han za Yellow G, Permanent Yellow NCG, Tartrazine Lake, Molybdenum Orange, Permanent Orange GTR, Pyrrazolon Orange, Benzidine Orange G, Permanent Red 4R, Watching Red Potassium Salt, Eo cine Lake, Brilliant Carmine 3B, Manganese Purple, Fast Violet B, Methyl violet Lake, Cobalt Blue, Alkali Blue Lake, Victoria Blue Lake, Phthalocyanine Blue, Fast Sky Blue, Indanthrene Blue BC, Chrome Green, Pigment Green B, Malachite Green Lake, and Final Yellow Green G.
When the two-component developer and the supplemental developer are used as the developer for full-color image-forming, the toner can contain a coloring pigment for magenta. The coloring pigment for magenta includes C.I. Pigment Red 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 30, 31, 32, 37, 38, 39, 40, 41, 48, 49, 50, 51, 52, 53, 54, 55, 57, 58, 60, 63, 64, 68, 81, 83, 87, 88, 89, 90, 112, 114, 122, 123, 163, 202, 206, 207, 209, and 238, C.I. Pigment Violet 19, C.I. Vat Red 1, 2, 10, 13, 15, 23, 29, and 35.
The toner particles may contain only the coloring pigment for magenta. However, if they contain a combination of dye with pigment, they improve the color definition of developer and improve the quality of full-color image. Examples of the dye for magenta are: oil-soluble dye such as C.I. Solvent Red 1, 3, 8, 23, 24, 25, 27, 30, 49, 81, 82, 83, 84, 100, 109, and 121, C.I. Disperse Red 9, C.I. Solvent Violet 8, 13, 14, 21, and 27, C.I. Disperse Violet 1; Basic dye such as C.I. Basic Red 1, 2, 9, 12, 13, 14, 15, 17, 18, 22, 23, 24, 27, 29, 32, 34, 35, 36, 37, 38, 39, and 40, C.I. Basic Violet 1, 3, 7, 10, 14, 15, 21, 25, 26, 27, and 28.
The coloring pigment for cyan includes: C.I. Pigment Blue 2, 3, 15, 15:1, 15:2, 15:3, 16, and 17; C.I. Acid Blue 6; C.I. Acid Blue 45; and copper phthalocyanine pigment prepared by partially substituting the phthalocyanine skeleton with 1 to 5 phthalimidemethyl groups.
The coloring pigment for yellow includes: C.I. Pigment Yellow 1, 2, 3, 4, 5, 6, 7, 10, 11, 12, 13, 14, 15, 16, 17, 23, 65, 73, 74, 83, 93, 97, 155, and 180, and C.I. Vat Yellow 1, 3, and 20.
The black pigment includes: carbon black such as Furnace Black, Channel Black, Acetylene Black, Thermal Black, and Lamp Black; and magnetic powder such as magnetite and ferrite.
Furthermore, the toning may be done by combining Magenta dye and pigment, Yellow dye and pigment, Cyan dye and pigment, and they may be used together with above carbon black.
B. Inclination of the Transmission Density with Respect to the Toner Bearing Amount
FIG. 8 illustrates relationship between the toner bearing amount M/S on the paper and the transmission density Dt. FIG. 8 illustrates relationships of several kinds of toners, the tinting strength of which is changed using the above-described material and manufacturing method.
It should be noted that the abscissa in FIG. 8 indicates changes of the toner bearing amount on the paper when the Vc is changed with respect to a flat VL potential by changing the flat VL potential as the latent image electrical potential by controlling the Vd, laser power and the Vdc. That is, the graph illustrated in FIG. 8 is different from the gradation curve with respect to a digital latent image illustrated in FIG. 2, which is obtained from a desired number of lines.
The case of, for example, cyan toner will be described. Line A in FIG. 8 represents changes in density of a conventional common toner (relationship between the toner bearing amount and the transmission density Dt on the paper). The line A represents a result of an image which was output using a toner prepared by mixing, for example, a coloring agent of pigment blue, which was a cyan pigment of 15:3, 4 to 5 parts by mass with respect to the mass of entire toner.
Line B in FIG. 8 represents a result of an image, which was output using a toner prepared by adding the coloring agent 1.5 times as much as the toner with which the result of the line A was obtained. Line C in FIG. 8 represents a result of an image, which was output using a toner prepared by adding the coloring agent two times as much as the toner with which the result of the line A was obtained. Line D in FIG. 8 represents a result of an image, which was output using a toner prepared by adding the coloring agent three times as much as the toner with which the result of the line A was obtained.
Each of point-A1, point-B1, point-C1 and point-D1 in FIG. 8 represents a maximum toner bearing amount (M/S)_(La) on the paper to obtain the Dtmax=1.8 using the toner with which the respective results of the line A, line B, line C and line D were obtained. The (M/S)_(La) represents the toner bearing amount on the paper after the (M/S)_(L) on the photosensitive member was transferred and fixed onto the paper with the transfer efficiency λ(≦1) (which will be described later). In this embodiment, the (M/S)_(La) represents the toner bearing amount after the toner layer formed on the photosensitive member through the developing process was transferred onto the paper via the intermediate transfer member through the transfer process twice after the developing process was completed. It is assumed that, after the fixing process, there was no change in toner bearing amount after the transfer process was completed. The toner bearing amounts (M/S)_(La) on the paper at the point-A1, point-B1, point-C1 and point-D1 were as listed below. The transmission densities at each of the point-A1, point-B1, point-C1 and point-D1 (i.e., equivalent to the maximum density Dtmax=1.8) will be also referred to as DtA1, DtB1, DtC1 and DtD1 respectively.
- Point-A1: 0.56 mg/cm² - Point-B1: 0.37 mg/cm² - Point-C1: 0.28 mg/cm² - Point-D1: 0.20 mg/cm²
Each of point-A2, point-B2, point-C2 and point-D2 in FIG. 8 represents transmission density Dt when the toner bearing amount on the paper was 0.1 mg/cm², using the toner with which the respective results of the line A, line B, line C and line D were obtained. The transmission densities Dt at the point-A2, point-B2, point-C2 and point-D2 were as listed below. The transmission densities at the point-A2, point-B2, point-C2 and point-D2 will be also referred to as DtA2, DtB2, DtC2 and DtD2 respectively.
- Point-A2: 1.14 - Point-B2: 1.22 - Point-C2: 1.29 - Point-D2: 1.41
The inclinations α of the respective lines A to D are expressed by the following formulae.
$\begin{matrix} \begin{matrix} {\alpha = \frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}} \\ {= \frac{\left( {1.8 - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}} \end{matrix} & (3) \end{matrix}$
λ×(M/S)_(L) in the formula (3) representing the inclination α can be substituted with the following formula:
${\lambda \times \left( \frac{M}{S} \right)_{L}} = \left( \frac{M}{S} \right)_{La}$
The Dt_(0.1) in the formula (3) representing the inclination α represents the transmission density Dt when the toner bearing amount on the paper is 0.1 mg/cm². Also, the λ in the formula (3) representing the inclination α represents the transfer efficiency. In this embodiment, as an example, the total transfer efficiency λ including the primary transfer device and the secondary transfer device is approximately 93%.
Therefore, the inclination αA of the line A in FIG. 8 is calculated as the following calculation. The transmission density at the point-A1 is DtA1=1.8; and DtA2=1.14 at the point-A2. The toner bearing amount on the paper is 0.56 mg/cm² at the point-A1; and 0.1 mg/cm² at the point-A2. The maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.6 mg/cm². αA=(1.8−1.14)/(0.56−0.1)=1.43 cm²/mg
The inclination αB of the line B in FIG. 8 is calculated as the following calculation. The transmission density at the point-B1 is DtB1=1.8; and DtB2=1.22 at the point-B2. The toner bearing amount on the paper at point-B1 is 0.37 mg/cm²; and 0.1 mg/cm² at the point-B2. The maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.4 mg/cm². αB=(1.8−1.22)/(0.37−0.1)=2.15 cm²/mg
The inclination αC of the line C in FIG. 8 is calculated as the following calculation. The transmission density at the point-C1 is DtC1=1.8; and DtC2=1.29 at the point-C2. The toner bearing amount on the paper at the point-C1 is 0.28 mg/cm²; and 0.1 mg/cm² at the point-C2. The maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.3 mg/cm². αC=(1.8−1.29)/(0.28−0.1)=2.83 cm²/mg
The inclination αD of the line D in FIG. 8 is calculated as the following calculation. The transmission density at the point-D1 is DtD1=1.8; and DtD2=1.41 at the point-D2. The toner bearing amount on the paper at the point-D1 is 0.20 mg/cm²; and 0.1 mg/cm² at the point-D2. The maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.22 mg/cm². αD=(1.8−1.41)/(0.2−0.1)=3.9 cm²/mg
That is, in the toner which is prepared using X times of the coloring agent, the inclination of the transmission density Dt is substantially X times with respect to the toner bearing amount M/S on the paper. It is understood that the inclination α represents the tinting strength of the toner.
As described in detail below, the invention prescribes a range of (M/S)_(L), (Q/M)_(L), and a product of the inclination α (i.e., tinting strength of the toner) of the transmission density Dt with respect to the toner bearing amount on the transfer material and an inverse number of the (Q/M)_(L). That is, the invention prescribes the range of parameters representing the relationship between the tinting strength of the toner that permits the reduction of the toner bearing amount and the toner charge amount that can ensure the image stability and image quality.
C. Inclination α and Inverse Number of (Q/M)_(L)
Next, the relationship among (M/S)_(L), (Q/M)_(L) and the inclination α will be described.
For example, when the maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.6 mg/cm² at Vc=150 V, from the results illustrated in FIG. 1, the (Q/M)_(L) required for achieving 100% of the charging efficiency is approximately 22.8 μC/g. Defining the inverse number (M/Q)_(L) of (Q/M)_(L) as β, the β is obtained by the following calculation. In this specification, if not otherwise specified, similarly to the charge amount of the toner (amount of electric charge), the β as the inverse number thereof is also expressed with the absolute value thereof. β=1/(Q/M)_(L)=1/22.8 μC/g
To obtain the maximum density Dtmax=1.8 using the toner of the toner bearing amount (M/S)_(La)=0.56 mg/cm² (the line A) after an image of the maximum density of (M/S)_(L)32 0.6 mg/cm² on the photosensitive member is transferred onto the paper, the inclination αA is 1.43 cm²/mg.
The product of the inclination αA and the β is obtained by the following calculation. αA×β=1.43 cm²/mg×1/22.8 μC/g=62.7 cm²/μC
Likewise, for example, when the maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.4 mg/cm² at Vc=150 V, from the results illustrated in FIG. 1, the (Q/M)_(L) required for achieving 100% of the charging efficiency is approximately 36.2 μC/g. The β at this time is obtained by the following calculation. β=1/(Q/M)_(L)=1/36.2 μC/g
To obtain the maximum density Dtmax=1.8 using the toner of the toner bearing amount (M/S)_(La)=0.37 mg/cm² (line B) after an image of the maximum density of (M/S)_(L)=0.4 mg/cm² on the photosensitive member is transferred onto the paper, the inclination αB is 2.15 cm²/mg.
The product of the inclination αB and the β is obtained by the following calculation. αB×α=2.15 cm²/mg×1/36.2 μC/g=59.4 cm²/μC
Likewise, for example, when the maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.3 mg/cm² at Vc=150 V, from the results illustrated in FIG. 1, the (Q/M)_(L) required for achieving 100% of the charging efficiency is approximately 50 μC/g. The β at this time is obtained by the following calculation. β=1/(Q/M)_(L)=1/50 μC/g
To obtain the maximum density Dtmax=1.8 using the toner of the toner bearing amount (M/S)_(La)=0.28 mg/cm² (line C) after an image of the maximum density of (M/S)_(L)=0.3 mg/cm² on the photosensitive member is transferred onto the paper, the inclination αC is 2.83 cm²/mg.
The product of the inclination αC and the β is obtained by the following calculate. αC×β=2.83 cm²/mg×1/50 μC/g=56.6 cm²/μC
Likewise, for example, when the maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.22 mg/cm² at Vc=150 V, from the results illustrated in FIG. 1, the (Q/M)_(L) required for achieving 100% of the charging efficiency is approximately 70.1 μC/g. The β at this time is obtained by the following calculation. β=1/(Q/M)_(L)=1/70.1 μC/g
To obtain the maximum density Dtmax=1.8 using the toner of the toner bearing amount (M/S)_(La)=0.2 mg/cm² (line D) after an image of the maximum density of (M/S)_(L)=0.22 mg/cm² on the photosensitive member is transferred onto the paper, the inclination αD is 3.9 cm²/mg.
The product of the inclination αD and the β is obtained by the following calculation. αD×⊕=3.9 cm²/mg×1/70.1 μC/g=55.6 cm²/μC
FIG. 9 illustrates a relationship between the (M/S)_(L) and the αβ obtained as described above.
Line E in FIG. 9 is a line obtained by plotting the αA×β, αB×β, αC×β and αD×β at Vc=150V. That is, the line E is a line obtained by multiplying the inclination α for obtaining ⊃tmax=1.8 with a desired (M/S)_(L) and the inverse number β of the (Q/M)_(L) required for achieving 100% of the charging efficiency at Vc=150 V. Each of point E1, point E2, point E3 and point E4 in FIG. 9 indicates the value of the αA×β, αB×β, αC×β and αD×β respectively at Vc=150 V.
In the same manner as the case of the line E (Vc=150 V), for each cases of Vc=200 V, Vc=300 V, Vc=400 V and Vc=500 V, a line represents the relationship between the (M/S)_(L) and the αβ can be obtained respectively. In FIG. 9, a line F represents the case of Vc=200 V, a line H represents the case of Vc=300 V, a line I represents the case of Vc=400 V and a line J represents the case of Vc=500 V.
The case of the line J will be further described in detail.
At Vc=500 V, when the maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.6 mg/cm², the (Q/M)_(L) required for achieving 100% of the charging efficiency is, from the results illustrated in FIG. 1, approximately 76.1 μC/g. The β at this time is obtained by the following calculation. β=1/(Q/M)_(L)=1/76.1 μC/g
After an image of the maximum density (M/S)_(L)=0.6 mg/cm² on the photosensitive member is transferred onto the paper, the inclination αA to obtain the maximum density Dtmax=1.8 using the toner of the toner bearing amount (M/S)_(La)=0.56 mg/cm² (line A) is 1.43 cm²/mg.
The product of the inclination αA and the β is obtained by the following calculation. αA×β=1.43 cm²/mg×1/76.1 μC/g=18.8 cm²/μC
Likewise, at Vc=500 V, when the maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.4 mg/cm², the (Q/M)_(L) required for achieving 100% of the charging efficiency is, from the results illustrated in FIG. 1, approximately 120 μC/g. The β at this time is obtained by the following calculation. β=1/(Q/M)_(L)=1/120 μC/g
After an image of the maximum density (M/S)_(L)=0.4 mg/cm² on the photosensitive member is transferred onto the paper, the inclination αB to obtain the maximum density Dtmax=1.8 using the toner of the toner bearing amount (M/S)_(La)=0.37 mg/cm² (line B) is 2.15 cm²/mg.
The product of the inclination αB and the β is obtained by the following calculation. αB×β=2.15 cm²/mg×1/120 μC/g=17.9 cm²/μC
Likewise, at Vc=500 V, when the maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.3 mg/cm², the (Q/M)_(L) required for achieving 100% of the charging efficiency is, from the results illustrated in FIG. 1, approximately 166 μC/g. The β at this time is obtained by the following calculation. β=1/(Q/M)_(L)=1/166 μC/g
After an image of the maximum density (M/S)_(L)=0.3 mg/cm² on the photosensitive member is transferred onto the paper, the inclination αC to obtain the maximum density Dtmax=1.8 using the toner of the toner bearing amount (M/S)_(La)=0.28 mg/cm² (line C) is 2.83 cm²/mg.
The product of the inclination αC and the β is obtained by the following calculation. αC×β=2.83 cm²/mg×1/166 μC/g=17.0 cm²/μC
Likewise, at Vc=500 V, when the maximum toner bearing amount (M/S)_(L) on the photosensitive member is 0.22 mg/cm², the (Q/M)_(L) required for achieving 100% of the charging efficiency is, from the results illustrated in FIG. 1, approximately 234 μC/g. The β at this time is obtained by the following calculation. β=1/(Q/M)_(L)=1/234 μC/g
After an image of the maximum density (M/S)_(L)=0.22 mg/cm² on the photosensitive member is transferred onto the paper, the inclination αD to obtain the maximum density Dtmax=1.8 using the toner of the toner bearing amount (M/S)_(La)=0.2 mg/cm² (line D) is 3.9 cm²/mg.
The product of the inclination αD and the β is obtained by the following calculation. αD×β=3.9 cm²/mg×1/234 μC/g=16.7 cm²/μC
Each of point J1, point J2, point J3 and point J4 in FIG. 9 indicates a value of αA×β, αB×β, αC×β and αD=33 β at Vc=500 V respectively.
D. Range of αβ
The range of αβ will be described below.
As described above, the (M/S)_(L) is desirably within a range of 0.22 mg/cm²≦(M/S)_(L)≦0.4 mg/cm². With this, the toner bearing amount can be reduced effectively.
Therefore, the (M/S)_(L) is within a range of a line G4 indicating 0.22 mg/cm² or above and a line G3 indicating 0.4 mg/cm² or below in FIG. 9.
Further, as described above, taking a practical value into consideration, the maximum developing contrast Vc is desirable to be within the following range: 150 V≦Vc≦500 V (1)-4.
Therefore, the αβ is within a range of the line J at Vc=500 V or above and the line E at Vc=150 V or below in FIG. 9.
Here, as described above, the inclination α is expressed by the following formula.
$\begin{matrix} {\alpha = \frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}} & (3) \end{matrix}$
As described above, the β is an inverse number of the (Q/M)_(L), and is expressed by the following formula: β=1/(Q/M)_(L)=(M/Q)_(L).
Therefore, the αβ is expressed by the following formula.
$\begin{matrix} {{\alpha\beta} = {\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}} \times \left( \frac{M}{Q} \right)_{L}}} & (4) \end{matrix}$
From the above formula (2) and the above formula (4), the range of the line J or above and the line E or below in FIG. 9 can be expressed by the following formula.
$\frac{\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}{500} \leq {\alpha\beta} \leq \frac{\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}{150}$
That is, the above formula can be also derived from the formula (1)-4 and formula (4).
Further, since the toner charge amount possible to be actually handled is 150 μC/g or more, the following formula is derived from the above formula (4).
$\left( \frac{Q}{M} \right)_{L} = {{\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}} \times \frac{1}{\alpha\beta}} \leq 150}$
Therefore, the αβ satisfies the following formula.
$\begin{matrix} {{\alpha\beta} \geq \frac{\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}}{150}} & (5) \end{matrix}$ That is, the above formula can be also derived from the formula (2)-2 and formula (4).
Here, a line expressed by the following formula is defined as a line G5.
${\alpha\beta} = \frac{\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}}{150}$
In this case, the range indicated by the above formula (5) is a range of the line G5 or above in FIG. 10. FIG. 10 illustrates the same relationship between the (M/S)_(L) and the αβ as with FIG. 9. Therefore, as described above, the range of the αβ and (M/S)_(L) for obtaining the γ-characteristic capable of reducing the toner bearing amount and ensuring the stability is a range marked with shadow enclosed by a line E, line J, line G3, line G4 and line G5 in FIG. 10.
In FIG. 10, the αβ and (M/S)_(L) at an intersection E2 of the line E and line G3, an intersection E4 of the line E and line G4, an intersection J2 of the line J and line G3, and an intersection J5 of the line J and line G5 are as listed below. Further, the αβ and (M/S)_(L) at an intersection G5 ₁ of the line G4 and line G5 and an intersection G5 ₂ of the line I and line G5 are as listed below.
- E2: αβ=59.4 cm²/μC, (M/S)_(L)=0.40 mg/cm² - E4: αβ=55.6 cm²/μC, (M/S)_(L)=0.22 mg/cm² - J2: αβ=17.9 cm²/μC, (M/S)_(L)=0.40 mg/cm² - J5: αβ=17.43 cm²/μC, (M/S)_(L)=0.33 mg/cm² - G5 ₁: αβ=26.1 cm²/μC, (M/S)_(L)=0.22 mg/cm² - G5 ₂: αβ=21.3 cm²/μC, (M/S)_(L)=0.27 mg/cm²
The transmission density Dt has been described above in the case where the OK Topcoat (73.3 g/m²) manufactured by Oji Paper Co., Ltd is used as a typical transfer material. The inventors found that, although there is a small deviation, the inclination depends little on the kind of the transfer material (paper type).
The inclination α has been described taking the cyan toner as an example. However, an object of the invention can be achieved by using the toners of magenta toner, yellow toner and black toner, which are prepared while optimizing the amount of the coloring agents so as to obtain the same α as the above. When an image forming apparatus is designed to perform image forming using multiple color toners, in each single color toner, only the relationship among the Vc, (M/S)_(L) and (Q/M)_(L) according to the above-described invention has to be satisfied.
EXPERIMENTAL EXAMPLES
Next, comparative experiments were conducted using the following toners I to VI.
For toner I, when the charge amount (Q/M)_(L) was 30 μC/g, the maximum toner bearing amount (M/S)_(L) on the photosensitive member was 0.6 mg/cm² at Vc=200 V. The toner bearing amount (M/S)_(La) on the paper after transferring was 0.56 mg/cm², and the maximum density Dtmax after fixation was 1.8. When the toner bearing amount on the paper was 0.1 mg/cm², the transmission density Dt_(0.1) was 1.14. Therefore, the inclination α indicating the tinting strength of the toner I was 1.43 cm²/mg and the αβ was 47.7 cm²/μC. That is, the toner I is at the position of the point P1 in FIG. 22 and FIG. 23. That is, the point P1 is located within a range where a toner having the conventional tinting strength is used.
For toner II, when the charge amount (Q/M)_(L) was 33 μC/g, the maximum toner bearing amount (M/S)_(L) on the photosensitive member was 0.3 mg/cm² at Vc=100 V. The toner bearing amount (M/S)_(La) on the paper after transferring was 0.28 mg/cm², and the maximum density Dtmax after fixation was 1.8. When the toner bearing amount on the paper was 0.1 mg/cm², the transmission density Dt_(0.1) was 1.29. Therefore, the inclination α indicating the tinting strength of the toner II was 2.83 cm²/mg and the αβ was 85.9 cm²/μC. That is, the toner II is at the position of point-P2 in FIG. 22 and FIG. 23. That is, the point P2 is located within a range where a toner having a high tinting strength is used, and the toner bearing amount is reduced by reducing the Vc, which is the conventional technique.
For toner III, when the charge amount (Q/M)_(L) was 66 μC/g, the maximum toner bearing amount (M/S)_(L) on the photosensitive member was 0.3 mg/cm² at Vc=200 V. The toner bearing amount (M/S)_(La) on the paper after transferring was 0.28 mg/cm², and the maximum density Dtmax after fixation was 1.8. When the toner bearing amount on the paper was 0.1 mg/cm², the transmission density Dt_(0.1) was 1.29. Therefore, the inclination α indicating the tinting strength of the toner III was 2.83 cm²/mg and the αβ was 42.9 cm²/μC. That is, the toner III is at the position of point P3 in FIG. 22 and FIG. 23. That is, the point P3 is located within a range where a toner having a high tinting strength is used, and the toner bearing amount is reduced under the same setting of the Vc as the conventional (i.e., without reducing Vc).
For toner IV, when the charge amount (Q/M)_(L) was 100 μC/g, the maximum toner bearing amount (M/S)_(L) on the photosensitive member was 0.3 mg/cm² at Vc=300 V. The toner bearing amount (M/S)_(La) on the paper after transferring was 0.28 mg/cm², and the maximum density Dtmax after fixation was 1.8. When the toner bearing amount on the paper was 0.1 mg/cm², the transmission density Dt_(0.1) was 1.29. Therefore, the inclination α indicating the tinting strength of the toner IV was 2.83 cm²/mg and αβ was 28.3 cm²/μC. That is, the toner IV is at the position of point-P4 in FIG. 22 and FIG. 23. That is, the point-P4 is located within a range where a toner having a high tinting strength is used, and the toner bearing amount is reduced under the setting of the Vc greater than that of the conventional art.
For toner V, when the charge amount (Q/M)_(L) was 160 μC/g, the maximum toner bearing amount (M/S)_(L) on the photosensitive member was 0.2 mg/cm² at Vc=400 V. The toner bearing amount (M/S)_(La) on the paper after transferring was 0.14 mg/cm², and the maximum density Dtmax after fixation was 1.8. When the toner bearing amount on the paper was 0.1 mg/cm², the transmission density Dt_(0.1) was 1.63. Therefore, the inclination α indicating the tinting strength of the toner V was 4.3 cm²/mg and αβ was 26.9 cm²/μC. That is, the toner V is at the position of point P5 in FIG. 22 and FIG. 23. That is, the point P5 is located within a range where a toner having a high tinting strength is used, and the toner bearing amount is reduced under the setting of the Vc greater than the conventional art.
For toner VI, when the charge amount (Q/M)_(L) was 66 μC/g, the maximum toner bearing amount (M/S)_(L) on the photosensitive member was 0.3 mg/cm² at Vc=400 V. The toner bearing amount (M/S)_(La) on the paper after transferring was 0.28 mg/cm², and the maximum density Dtmax after fixation was 1.8. When the toner bearing amount on the paper was 0.1 mg/cm², the transmission density Dt_(0.1) was 1.29. Therefore, the inclination α indicating the tinting strength of the toner VI was 2.83 cm²/mg and αβ=42.9 cm²/μC. That is, the toner VI is at the position of point P3 in FIG. 22 and FIG. 23 as with the toner III. That is, the point P3 is located within a range where a toner having a high tinting strength is used, and the toner bearing amount is reduced under the setting of the Vc greater than the conventional art.
Using the toners I to VI, evaluation was made on the stability and defective image. The results will be summarized below.
Blank area and coarseness as the evaluation items were subjectively evaluated (classified as A, B, C, D in descending order of good state). As for the stability of the density, in a halftone image of Dt=1.0, with respect to the developing contrast change ΔVcont at 10 V, when the density change Δdt was not less than 0.1, the density stability was evaluated as defective (D), when the density change Δdt was less than 0.1, acceptable (B) or excellent (A). As for the fogged image, when the fog density was 2% or more at Vb=150 V, the fogged image was evaluated as defective (D); when less than 2%, the fogged image was evaluated as acceptable (B) or excellent (A). As for the carrier adhesion, when adhered particles are 3/cm² or more, the carrier adhesion was evaluated as defective (D), when less than 3/cm², the carrier adhesion was evaluated as acceptable (B) or excellent (A).
The fogged image density was qualitatively evaluated based on the values obtained by measuring the density in a blank area using a reflection densitometer manufactured by Macbeth (SERIES 1200). The carrier adhesion was qualitatively evaluated based on the values obtained by collecting carriers adhered on the photosensitive member using a piece of “Mylar” tape and by counting the number of the carriers per 1 cm² through a microscope.
TABLE 1 Charging (Q/M)_(L) Vc (M/S)_(L) efficiency Blank Density Fogged Carrier (μC/g) (V) (mg/cm²) (%) area stability coarseness image adhesion Toner I 30 200 0.6 100 B B B B B Toner II 30 100 0.3 100 B D D D B Toner 60 200 0.3 100 B B B A B III Toner IV 100 300 0.3 100 B A A A C Toner V 160 400 0.2 75 D A C C D Toner VI 60 400 0.3 50 D B B B B
Toner I (Comparative example) was a conventional common toner. An image was formed using the toner I with conventional general toner bearing amount. Although no effect to reduce the toner bearing amount was obtained, a generally stable and satisfactory image was formed as with the conventional art.
Toner II (comparative example) was a toner having a higher tinting strength than that of the toner I. Using the toner II, the toner bearing amount was reduced by reducing the maximum developing contrast Vc. In this case, the level of density stability, coarseness and fogged image was reduced compared to the case where toner I was used as described above.
Toner III (embodiment) was a toner having a higher tinting strength than that of the toner I. Using the toner III, the maximum developing contrast Vc was controlled to be the same as that of the case where the toner I was used. In this case, the effect to ensure the density stability and to reduce the coarseness was obtained and fogged image was also improved. The reason that the fogged image was improved than in the example where the toner I was used is understood as below. That is, since the toner charge amount was made higher, the number of toner particles with low charge amount due to the fogged image was reduced.
For the toner IV (embodiment), the toner charge amount was made to be higher than that of the toner III, the inclination of the Vc (γ-characteristic) was reduced. Therefore, the density stability, coarseness and fogged image were improved better than those in the example where the toner III was used.
For the toner V (comparative example), the toner charge amount was made further higher than that of the toner IV to reduce the inclination of the Vc (-characteristic). In this case, blank area was generated and remarkable carrier adhesion was found. The reason of this is understood as described below. First, the charge amount of the toner was too high resulting in a defective development in which, the toner was not released from the carrier; and then the blank area was generated accompanying the reduction of the charging efficiency. That is, the toner V failed to satisfy the relationship among the Vc, (M/S)L and (Q/M)L according to the above-described invention. Also, since the charge amount at the carrier side was also increased, the carrier adhesion in non-image portion was increased. Further, accompanying this, the coarseness in the halftone area increased and the fogged image in the blank area also increased.
Toner VI (comparative example) has the same toner charge amount as that of the toner III. However, even when (Q/M)_(L)=66 μC/g, Vc=400 V was required to develop (M/S)_(L)=0.3 mg/cm². Therefore, the develop ability was low and the charging efficiency was reduced resulting in a generation of blank area. Therefore, the toner VI, as with the toner V, failed to satisfy the relationship among the Vc, (M/S)_(L) and (Q/M)_(L) according to the above-described present invention.
As describe above, according to the embodiment, the problem of poor in stability and degrading of the image quality, which conventionally occurred when the toner bearing amount was reduced, is prevented. The toner bearing amount can be reduced while ensuring the same or higher stability and image quality than the conventional art. Thus, high productivity of the image forming apparatus can be achieved while reducing the power consumption, toner relief and running cost.
[Measuring Method]
Toner Bearing Amount and Toner Charge Amount (Average Charge Amount) on the Photosensitive Member
The toner bearing amount and the toner charge amount (average charge amount) on the photosensitive member were measured as described below.
To facilitate the measurement of the toner on the photosensitive member, during an image forming operation, immediately after the toner was developed on the photosensitive member, the power source for the image forming apparatus was turned off. Using a Faraday gauge including outer and inner metal cylinders each having a different axial diameter disposed coaxially and further including a filter for taking the toner into the inner cylinder as shown in FIG. 27, the toner on the photosensitive member was sucked by an air. The inner cylinder and the outer cylinder of the Faraday gauge are isolated from each other. When the toner is sucked into the filter, electrostatic induction due to the amount of electric charge Q of the toner is generated. The induced amount of electric charge Q was measured using a Coulomb meter (KEITHLEY 616 DIGITAL ELECTROMETER). The measured value was divided by the toner weight M within the inner cylinder; thereby charge amount Q/M (μC/g) of the toner was obtained. The sucked area S on the photosensitive member was measured and the toner weight M was divided by the value; thereby the toner bearing amount M/S (mg/cm²) was obtained.
Toner Bearing Amount on the Paper
The toner bearing amount on the paper was measured using the same technique as that of the toner bearing amount on the photosensitive member.
Thickness of the Toner Layer (Height)
The thickness (height) of the toner layer was measured as described below.
Using a three-dimensional configuration measuring laser microscope (VK-9500 manufactured by KEYENCE), the height was measured at a portion where the toner layer existed and at a portion where no toner layer existed on the photosensitive member, and difference therebetween was calculated to obtain the thickness Lt of the toner layer.
Relative Permittivity of the Toner Layer
The relative permittivity of the toner layer was measured as described below.
Using an apparatus shown in FIG. 28, electrical potential change waveform at turning ON/OFF the switch was measured. Based on the measured waveform, the permittivity εt of the toner was obtained.
To describe more in detail, in the apparatus in FIG. 28, the toner of approximately 30 mm in thickness was uniformly attached to and sandwiched between two flat electrodes; the lower electrode was connected to the ground; and the upper electrode was connected to a high voltage power source via the switch and a resistor R (30 MΩ). In order to record the potential at the upper electrode, a surface electrometer and an oscilloscope were disposed adjacent to the upper electrode.
By turning ON the switch on the apparatus, several hundred voltage was applied to the upper electrode potential, and the curve of rising potential was measured at the upper electrode.
The permittivity ε of the toner layer can be expressed by the following formula 6, which is an equation of charge transport. Based on the curve of the rising potential at the upper electrode, the permittivity ε of the toner layer was obtained. In the following formula 6, L: toner layer height, S: electrode area, R: resistance between the power source and the switch, V_(i): power source voltage, V_(T): potential at upper electrode, and τ: relaxation time of toner layer.
$\begin{matrix} {ɛ = {\frac{L}{SR} \cdot \frac{V_{i} - V_{T}}{\frac{V_{T}}{\tau} + \frac{\mathbb{d}V_{T}}{\mathbb{d}t}}}} & (6) \end{matrix}$
Differential coefficient of the voltage V_(T) was obtained based on a descending curve of the potential at the upper electrode, which was previously measured, (transition of the potential as time passes at the upper electrode, which was measured when the switch was turned OFF from a state of ON).
The relaxation time of the toner layer can be calculated by the following formula 7. Using the differential coefficient obtained from the descending curve of the potential at the upper electrode, the relaxation time τ of the toner layer at the voltage V_(T) was calculated.
$\begin{matrix} {\tau = {- \frac{V}{\left( {{\mathbb{d}V}/{\mathbb{d}t}} \right)}}} & (7) \end{matrix}$
The permittivity ε of the toner layer obtained as described above was divided by the permittivity ε₀ in vacuum; thereby the relative permittivity εt in the toner layer was obtained.
Film Thickness of Photosensitive Member
The film thickness of the photosensitive member was measured as described below.
A plane photosensitive plate having the same layer structure as that of the actual photosensitive layer was prepared on a metal base. The thickness before and after forming the photosensitive layer was measured using a film thickness measure, and the difference therebetween was calculated to obtain the film thickness Ld of the photosensitive layer.
Relative Permittivity of the Photosensitive Member
Relative permittivity and capacitance of the photosensitive member were measured as described below.
A plane photosensitive plate having the same layer structure as that of the actual photosensitive layer was prepared on a metal base. An electrode smaller than the photosensitive plate was brought into contact with the plane photosensitive plate and a DC voltage was applied to the electrode. The electric current was monitored and the obtained current was integrated with time, thereby the amount of electric charge q accumulated in the photosensitive layer was obtained. The above measurement was carried out while changing the value of the DC voltage. Based on the change amount of the electric charge q, the capacitance C of the photosensitive plate was obtained. Using the measured capacitance C, the electrode area S and the film thickness of photosensitive member Ld obtained by the above method, the permittivity ε of the photosensitive member was obtained based on C=εS/Ld. By dividing the obtained permittivity of the photosensitive member by the permittivity ε₀ in vacuum, the relative permittivity εd of the photosensitive member was obtained. In this example, the measurement was made using the plane photosensitive plate. However, by arranging the configuration of the electrode so as to have the same curvature as that of the photosensitive member, the relative permittivity εd of a drum-shaped photosensitive member can be measured.
Transfer Efficiency
The transfer efficiency of the toner from the photosensitive member onto the transfer material is defined as “λ”. Defining the toner weight per unit area in the maximum density portion on the photosensitive member as m1 [mg/cm²]; and the toner weight per unit area on the transfer material when the maximum density image is finally transferred to the transfer material from the photosensitive member as m2 [mg/cm²], the transfer efficiency λ is expressed as λ=m2/m1.
The m2 and m1 in the above formula were measured respectively using the technique described in the above toner bearing amount measurement on the photosensitive member; thereby the transfer efficiency λ was obtained.
Particle Diameter of the Toner
In this specification, the particle diameter of the toner is represented with a weight-averaged particle diameter. The weight-averaged particle diameter of the toner was measured by the following manner.
100 to 150 ml of electrolysis solution added with several ml of interfacial active agent (preferably, alkyl benzene sulfonate) (for example, approximately 1% NaCl solution) was prepared, to which 2 to 20 mg of the toner was added, and dispersed for several minutes with an ultrasonic disperser. The solution was measured using a Coulter counter (TA-II manufactured by COULTER); thereby the weight averaged particle diameter was obtained.
As described above, according to the invention, it is possible to reduce the toner bearing amount while preventing a reduction of the stability and image quality.
This application claims the benefit of Japanese Patent Application No. 2007-024925, filed Feb. 2, 2007, which is hereby incorporated by reference herein in its entirety.
1. An image forming apparatus, comprising: a photosensitive member; a developing device which develops an electrostatic image formed on the photosensitive member with a developer having a toner and a carrier, the developing device including a developer carrying member which carries and conveys the developer to a developing position; a transfer device which transfers a toner image formed on the photosensitive member to a transfer material; and a fixing device which fixes the toner image on the transfer material to the transfer material, wherein assuming that a toner bearing amount in a maximum density image portion of the photosensitive member is (M/S)_(L) [mg/cm²], an average charge amount of the toner in the maximum density image portion of the photosensitive member is (Q/M)_(L) [μC/g], an absolute value of a potential difference between a potential of a DC-component of a developing bias applied to the developer carrying member and a potential of the maximum density image portion on the photosensitive member is Vc [V], a toner layer thickness of the maximum density image portion on the photosensitive member is Lt [μm], a thickness of the photosensitive member is Ld [μm], a relative permittivity of the toner layer is εt, a relative permittivity of the photosensitive member is εd, a permittivity in vacuum is ε0, a transmission density in a maximum density image portion on the transfer material after being fixed by the fixing device is Dtmax, a transmission density in an image portion on the transfer material when the toner bearing amount on the transfer material after being fixed by the fixing device is 0.1 mg/cm² is Dt_(0.1), and a transfer efficiency of the toner from the photosensitive member onto the transfer material is λ, the following formulae are satisfied: 0.22≦(M/S)_(L)≦0.4, ${\left( \frac{Q}{M} \right)_{L} = \frac{Vc}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}},$ and assuming that ${\alpha = \frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}},$ and β=1/(Q/M)_(L), the following formulae are satisfied: ${\frac{\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}{500} \leq {\alpha\beta} \leq \frac{\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}}{150}}\;$ ${\alpha\beta} = {\frac{\frac{\left( {{{Dt}\mspace{11mu}\max} - {Dt}_{0.1}} \right)}{\left\{ {{\lambda \times \left( \frac{M}{S} \right)_{L}} - 0.1} \right\}}}{150}.}$
2. An image forming apparatus according to claim 1, wherein an average particle diameter of the toner is 5.0 μm or more.
3. An image forming apparatus according to claim 1, wherein a capacitance C of the photosensitive member satisfies the following formula: 0.7×10⁻⁶[F/m^(2 ]<C<)2.7×10⁻⁶[F/m²].
4. An image forming apparatus according to claim 1, wherein the image is formed by using a plurality of color toners, and each of the plurality of color toners satisfies the formulae.
5. An image forming apparatus, comprising: a photosensitive member; and a developing device which develops an electrostatic image formed on the photosensitive member with a developer having a toner and a carrier, the developing device including a developer carrying member which carries and conveys the developer to a developing position, wherein assuming that a toner bearing amount in a maximum density image portion of the photosensitive member is (M/S)_(L) [mg/cm²], an average charge amount of the toner in the maximum density image portion of the photosensitive member is (Q/M)_(L) [μC/g], an absolute value of a potential difference between a potential of a DC-component of a developing bias applied to the developer carrying member and a potential of the maximum density image portion of the photosensitive member is Vc [V], a toner layer thickness of the maximum density image portion of the photosensitive member is Lt [μm], a thickness of the photosensitive member is Ld [μm], a relative permittivity of the toner layer is εt, a relative permittivity of the photosensitive member is εd, and a permittivity in vacuum is ε0, the following formulae are satisfied: 0.22≦(M/S)_(L)≦0.4, ${\left( \frac{Q}{M} \right)_{L} = {\frac{Vc}{\left( {\frac{Lt}{2ɛ_{0}ɛ_{t}} + \frac{Ld}{ɛ_{0}ɛ_{d}}} \right) \times \left( \frac{M}{S} \right)_{L}} \le qq 150}},$ 150≦Vc≦500.
6. An image forming apparatus according to claim 5, wherein an average particle diameter of the toner is 5.0 μm or more.
7. An image forming apparatus according to claim 5, wherein a capacitance C of the photosensitive member satisfies the following formula: 0.7×10⁻⁶[F/m² ]<C<2.7×10⁻⁶[F/m²].
8. An image forming apparatus according to claim 5, wherein the image is formed by using a plurality of color toners, and each of the plurality of color toners satisfies the formulae.
|
Convert sync handler to env variables
Continuation of this issue: https://github.com/rancher/rancher/issues/34875
Add all settings from sync handler (currently 4) as env vars.
Remove the settings sync handler: https://github.com/rancher/rancher/blob/release/v2.6/pkg/controllers/managementuser/settings/controller.go
Are there any concerns regarding updating of a downstream agent when one of these environment variables is changed? For example if I spin up a local and a downstream cluster, and helm upgrade ... --set env.CATTLE_SERVER_VERSION=v2.5.9, will the cluster agent be redeployed because it's deployment depends on the variable?
You can check this method. https://github.com/rancher/rancher/blob/5c2933173bc07a1cd260d6e07fd9459243afc45d/pkg/controllers/management/clusterdeploy/clusterdeploy.go#L184
I don't think it will reploy agent if you just change the env variable. We only redeploy acccording certain conditions above. ^^ If you upgrade rancher it will redeploy agent since agent image changes and that will trigger cluster-agent upgrade.
Setting up something to discuss.
Root cause
What was fixed, or what changes have occurred
Settings are no longer synced downstream, and instead passed from the local cluster to the cluster-agent deployment template as environment variables.
The following settings are used to trigger a redeployment:
server-version
install-uuid
ingress-ip-domain
Areas or cases that should be tested
Changing server-version, install-uuid, or ingress-ip-domain in the local cluster triggers a redeployment of the downstream agent. Likewise, changing any other setting should not trigger a redeployment of the downstream agent.
What areas could experience regressions?
N/A
Are the repro steps accurate/minimal?
Deploy a downstream cluster, and then edit one of the settings, either through API or externally (i.e. kubectl, lens, etc.). The cluster agent should be redeployed.
on 2.6-head (78b25c3) I've tested the following:
example of how to change one of these vars: go to <your_server_ip>/v3/settings/<your_variable> -> edit -> send request
update install-uuid (random name) -> cattle-cluster-agent pod is redeployed -- pass
update ingres-ip-domain (to nip.io) -> cattle-cluster-agent pod is redeployed -- pass
validate that new domain propagates to downstream resources by deploying a new ingress using the auto-generated name -- pass
update a setting that is not one of the 3 mentioned in the comment above -> no redeployment of any agent pod(s) -- pass
some variables are protected, and give a 405 with message is readOnly because its value is from environment variable, other variables allow an edit through the API and the cluster agent is not restarted
note: from what I could find, there isn't a way to update the server-version through the UI, so instead I did an update of the local cluster and used a newer version from there, which also resulted in an update to the downstream cluster agent -- pass
|
Unable to map coordinates on Google Maps
I have a list of coordinates that I want to plot on Google Maps, but I can't figure out how to do that. The coordinates, depending on how I plot them, appear to be all around the globe, while they should be placed in Trondheim, Norway. (And the application I have extracted them from successfully places them in Trondheim, so I know they are correct.)
A normal Google Maps coordinate from Trondheim looks like this:
63.4304, 10.395069
My coordinates, however, look like this:
long, lat
1154262, 9182277
1143762, 9184473
1157168, 9194133
1157375, 9200167
1164505, 9209786
I believe that these are in some kind of WGS84 format, but as I am a complete novice on this field, I am not completely sure. I think so because of the headers in the XML I have extracted them from:
<rss version="2.0"
xmlns:geo="http://www.w3.org/2003/01/geo/wgs84_pos#"
xmlns:georss="http://www.georss.org/georss"
xmlns:gml="http://www.opengis.net/gml"
xmlns:mappoint="http://virtualearth.msn.com/apis/annotate#">
When I try to use this coordinate converter, it returns coordinates in Kazakhstan. I am utterly confused. All other converters I have tried either returns locations in strange countries or in the middle of the oceans, or they fail to convert my data at all.
Does anybody here know what kind of coordinates I have, and how I can convert them to normal latitude and longitude degrees?
A formula is enough, but if there exists any libraries for this, I am using C# as development language. Any other languages would suffice, however, as I am probably able to convert them to my own anyway.
WGS-84 is Spherical Mercator, the projection system used by Google, so the coordinates you have provided are obviously not. Unfortunately for any formula to work you will need to find out the projection that your points are in.
Some more detailed information on projection is available here: http://courses.washington.edu/gis250/lessons/projection/
And a library to convert between common coordinate systems in .net is available at: http://www.doogal.co.uk/dotnetcoords.php.
Would it be possible for you to open the map layer in an GIS program such as: http://www.qgis.org/en/site/ and use the options available to determine the projection of the layer?
Some tips for identifying the coordinate system (written for ARCGIS but the programs are similar): http://resources.arcgis.com/en/help/main/10.1/index.html#//003r00000004000000 https://gis.stackexchange.com/questions/7839/best-practices-for-identifying-the-unknown-coordinate-system-of-a-shapefile
|
/*
You are creating a website that will help you and your friends keep track of the results of volleyball teams from all around the world. Your website regularly crawls the web searching for new games, and adds the results of these games to the results table stored in your local database. After each update, the table should be sorted in ascending order by the total number of games won. This year's results are quite marvelous - at any given moment there are no two teams that have won the same number of games!
The results table contains the following columns:
name - the unique name of the team;
country - the country of the team;
scored - the number of scored goals;
missed - the number of missed goals;
wins - the total number of games the team has won.
Your task is to sort the given results table in ascending order by the number of wins.
*/
/*Please add ; after each select statement*/
CREATE PROCEDURE volleyballResults()
BEGIN
SELECT *
FROM results
ORDER BY wins;
END
|
#!/bin/sh
printf '\033%s\007' $(basename $1) # show full path use $1 instead of $(basename $1)
#printf '\033%s\007' $1 # show full path use $1 instead of $(basename $1)
|
Safe rated pressure for a sankey connection
Does anyone know the rated pressure for a Sankey connector? I see Sankey-fitting kegs are rated 60-120 PSI, so is it safe to assume the connectors themselves are good for at least 60psi? (I'm making sparkling wines so 60PSI is about what I need)
Well the weakest point will always be the polymer based tubing used to carry the wine. So the ratings on the fittings are moot I'd suspect. Go with the highest rated food grade tubing and the fittings will still out rate the tubing.
The only sure way to know are:
Ask the manufacturer
Visit certification station. Or whatever is the proper name, the point where divers go to have their gear certified when previous certificate is no longer valid. They might be able to test for you.
Buy fittings with pressure ratings documented. Probably cheaper than option 2.
|
Using a nested for loop to append to multiple lists
I'm trying to loop the Shockley diode equation over three different temperatures (with three different saturation currents), for a range of values of voltage, and then insert these three lots of data into lists.
kb = 1.38E-23
q = 1.602E-19
voltage = np.arange(0.5, 1.02, 0.02)
T = np.array([269, 289.1, 294.5])
Is = np.array([1.707E-14, 6.877E-14, 1.4510E-13])
i269 = []
i284 = []
i294 = []
for i in range(1, len(voltage)):
for j in range(1, 3):
I = Is[j] * np.exp((voltage[i] * q) / (kb * T[j]))
i269.append(I[j[0]])
i284.append(I[j[1]])
i294.append(I[j[2]])
I know the method I've used here is not syntactically correct but I've written it this way to try to aid my efforts in conveying what it is I'm trying to achieve.
I want to loop through voltage first for j = 0, and append I into i269, then again through voltage for j = 1 and append into i284 etc.
Any help would be much appreciated.
Thanks
What's the question, just how to make it clear and maintainable?
Note that with your current approach I cannot be indexed, as you're simply assigning a value to it. You'd firstly need to define it as a list, and then index it to assign its values to i269, i284 or i294:
kb = 1.38E-23
q = 1.602E-19
voltage = np.arange(0.5, 1.02, 0.02)
T = np.array([269, 289.1, 294.5])
Is = np.array([1.707E-14, 6.877E-14, 1.4510E-13])
I = [0 for _ in range(len(T))]
i269 = []
i284 = []
i294 = []
for i in range(len(voltage)):
for j in range(3):
I[j] = Is[j] * np.exp((voltage[i] * q) / (kb * T[j]))
i269.append(I[0])
i284.append(I[1])
i294.append(I[2])
However, it is possible to gain improvements in performance by leveraging broadcasting and vectorising the above as:
i269, i284, i294 = Is[:,None] * np.exp((voltage * q) / (kb * T)[:,None])
Lets check the results and have a look at the timings with both approaches:
kb = 1.38E-23
q = 1.602E-19
voltage = np.arange(0.5, 1.02, 0.02)
T = np.array([269, 289.1, 294.5])
Is = np.array([1.707E-14, 6.877E-14, 1.4510E-13])
def current_approach(kb, q, voltage, T, Is):
I = [0 for _ in range(len(T))]
i269 = []
i284 = []
i294 = []
for i in range(len(voltage)):
for j in range(3):
I[j] = Is[j] * np.exp((voltage[i] * q) / (kb * T[j]))
i269.append(I[0])
i284.append(I[1])
i294.append(I[2])
return i269, i284, i294
def vect_approach(kb, q, voltage, T, Is):
i269, i284, i294 = Is[:,None] * np.exp((voltage * q) / (kb * T)[:,None])
return i269, i284, i294
np.allclose(current_approach(kb, q, voltage, T, Is),
vect_approach(kb, q, voltage, T, Is))
# True
%timeit current_approach(kb, q, voltage, T, Is)
# 201 µs ± 3.46 µs per loop (mean ± std. dev. of 7 runs, 10000 loops each)
%timeit vect_approach(kb, q, voltage, T, Is)
# 30.9 ns ± 0.647 ns per loop (mean ± std. dev. of 7 runs, 10000000 loops each)
Up to a huge 6,500x speedup with the vectorised approach!
|
HENRY KOCH, PROSECUTOR, v. JOSEPH M. VANDERHOOF, QUI TAM, &c.
1. In the legislation of this state concerning the jurisdiction of courts for the trial of small causes, and District Courts, the phrase “every suit of a civil nature at law ” does not embrace actions for statutory penalties.
2. The District Courts of the city of Newark have no general jurisdiction-over actions for statutory penalties beyond $100.
On certiorari to the Essex Common Pleas, on appeal from the Second District Court of the city of Newark.
Argued at February Term, 1887,
before Justices Knapp- and Dixon.
For the prosecutor in certiorari, Samuel Kalisch.
For the defendant in certiorari, F. M. Olds.
The opinion of the court was delivered by
Dixon, J.
We have not found it necessary to decide the-important question argued in this cause, touching the constitutionality of An act to prohibit the manufacture and sale-of impure and imitation dairy products,” approved May 5th, 1884 (Pamph. L., p. 289), and its amendment, approved March 18th, 1885 (Pamph. L., p. 108), for the reason that we think that the court in which this action was brought was not entitled to take cognizance of it.
The suit was instituted January 20th, 1886, for a penalty of $200, given by the amendatory statute just mentioned for a violation of the provisions of the earlier act, “ to be recovered by any person who may sue for the same in any court of competent jurisdiction.” The plaintiff having chosen as his forum one of the District Courts of the city of Newark, the defendant insists that those courts have not general jurisdiction of actions for penalties to the sum of $200, and hence had no authority to entertain this action.
These courts were created and their original jurisdiction was conferred by “ An act to establish District Courts in the city of Newark,” approved March 4th, 1873. Pamph. L., p. 245. Under that statute they were invested with “ the civil jurisdiction theretofore exercised by or conferred upon justices of the peace, within the corporate limits of the city of Newark, under and by virtue of an act entitled An act constituting courts for the trial of small causes,' approved April 16th, 1846, and the various supplements thereto,” and other enumerated statutes, and were also invested with exclusive jurisdiction “in all civil cases arising under any of the above-recited acts,” where both parties reside in Newark. At the passage of this enactment, March 4th, 1873, the jurisdiction of justices of the peace, under the act constituting courts for the trial of small causes, and its supplements, extended to “ every suit of a civil nature at law, where the debt, balance or other matter in dispute did not exceed the sum or value of $100,” except some specified actions (Nix. Dig., p. 458, § 1); and also extended to every suit for a “sum of money or penalty not exceeding $100, to be sued for and recovered by virtue of any law of this state, in any court of record, or in any court having cognizance thereof.” Nix. Dig., p. 469, § 65. We are of opinion that the jurisdiction conferred upon justices of the peace by both of these sections of the Small Causes Court act was included in the “civil jurisdiction” granted to the District Courts under the before-mentioned act of March 4th, 1873. Actions for penalties are civil actions (Campbell v. Board of Pharmacy, 16 Vroom 241), and therefore should be regarded as embraced within a legislative grant of “civil jurisdiction,” unless the legislature has evinced a. design to exclude them from the grant. No such design appears in the law creating these District Courts.
The inquiry next to be made is whether this jurisdiction over suits for penalties to the amount of $100 has been enlarged so as to cover penalties of $200.
Two statutes must be considered, one “ An act concerning the District Courts of cities in this state, created by special statute,” approved March 20th, 1878 (Rev. Sup., p. 265), which extends the jurisdiction of such courts to “ every suit of a civil' nature at law in which the debt, balance or other matter in dispute does not exceed the sum or value of $200; the other “An act relative to the jurisdiction and practice of District Courts in this state,” approved March 27th, 1882 (Rev. Sup., p. 261), which extends their jurisdiction to “every suit of a civil nature at law, in which the debt, balance, damage or other matter in dispute does not exceed the sum or value of $300.” The question arising on these enactments is whether the extensions embrace suits for penalties.
Looking at them abstractly, it would appear that, nowadays at least, the words “ every suit of a civil nature at law ” include an action for a penalty, for such actions are deemed of a civil nature. But, in the interpretation of statutes, words are not to be regarded abstractly, but are to be considered in conjunction with not only the context of the same enactment, but also other statutes in pari materia. Said Kinsey, C. J.: “ In the construction of the acts of the legislature, it has ever been held a sound and wholesome rule that when divers laws are made, relating to one subject, the whole must be considered as constituting one system, and mutually connected with each other. Another rule is that when the legislature have made use of a particular expression, and given to it a plain and precise signification, the same word, when used in other proceedings, ought, unless the contrary appears manifestly right, to receive the same construction. It is unreasonable to presume that the legislature intended, by the same words, to convey different ideas.” White v. Hunt, 1 Halst. 415. See, also, Rudderow v. State, 2 Vroom 512, 515; Trustees of Public Schools v. Trenton, 3 Stew. Eq. 667, 686.
Following the suggestions of these principles, then, we find that for nearly a century before these statutes this form of expression, “ every suit of a .civil nature at law,” had been employed by the legislature in granting jurisdiction to courts for the trial of small causes, and to the District Courts, which, in part, supplanted them. It first appears in “An act constituting courts for the trial of small causes,” passed March 15th, 1798 (Pat. L., p. 313, § 1), then in a supplement passed November 30th, 1801 (Bloom. L., p. 73), next in the act of the same title, passed February 12th, 1818 (Elm. Dig., p. 275, § 1), afterwards in the Revisions of 1846 and 1874, and finally in “An act constituting District Courts in certain cities in this state,” approved March 9th, 1877 (Rev. Sup., p. 222), and its supplement, approved March 20th, 1878. Rev. Sup., p. 256. This frequent use of a uniform phrase during so long a period indicates that in legislative contemplation it expresses a precise idea, and devolves upon the courts the duty of ascertaining that idea, and giving to the same words, when found in statutes of similar character^ a like interpretation.
The idea which these words have been used to convey is, I think, quite clearly one exclusive of actions for sums of money or penalties recoverable by virtue of statutes. This is evinced by the fact that in the enactments before cited there was expressly conferred the right to take cognizance of suits for the recovery of “ every sum of money or penalty to be sued for and recovered by virtue of any law of this state,” outside of the grant of jurisdiction over “ every suit of a civil nature at law.” See act of March 15th, 1798, § 42; act of February 12th, 1818, § 45 ; act of April 16th, 1846, § 65; act of March 27th, 1874, § 5; act of March 9th, 1877, § 10. Although it occasionally happens that statutes are tautological, repeating the. same thought in different language, yet this generally springs from, inadvertence, and, under the primary rule of giving effect, when possible, to all parts of a statute, is admitted by the courts to exist only in cases where that conclusion is fairly inevitable. Where, as in the present instance, such tautology is alleged, not of individual words only, but of two distinct sections, conjoined, not once merely, but over and over again, not simply in original enactments, but also in several revisions designed to prune and harmonize the law, the presumption against its existence becomes very great. If any reasonable construction can be found which will exclude it, that should be adopted. Such a construction is not hard to discover. We have but to assume that the legislature had in mind three classes of suits: private suits for private wrongs, private suits for public wrongs, and public suits for public wrongs, and that by “ suits of a civil nature,” it meant only suits of the first class; and then both sections, in all of these statutes, become significant. Such an assumption is entirely reasonable; for, while the term “civil” may be applied to the form of litigation, in contradistinction to that which is criminal, it may also, with propriety, be applied to the nature of litigation, as growing out of the relations of citizens inter sese, rather than their relations to the state. Blackstone says private wrongs are frequently termed civil injuries. “ Suits of a civil nature,” then, may aptly have been used to denote remedies for such wrongs.
Our conclusion, therefore, is that in these statutes, passed at various times from 1798 to 1878, the phrase “ every suit of a civil nature at law ” was intended by the legislature not to include actions for statutory penalties, and that the same phrase, when used in the statutes of 1878 and 1882, now before us for construction, must receive the same interpretation.
Hence, it follows that the District Courts of the city of Newark have no general jurisdiction over actions for penalties beyond $100, and could not lawfully entertain this suit.
The judgments below must be reversed.
|
/*
* To change this license header, choose License Headers in Project Properties.
* To change this template file, choose Tools | Templates
* and open the template in the editor.
*/
package easycoding.ch04.classLoader.customClassLoaderDemo;
import easycoding.ch04.classLoader.Constants;
import java.io.ByteArrayOutputStream;
import java.io.File;
import java.io.FileInputStream;
import java.io.IOException;
import java.io.InputStream;
import java.security.InvalidKeyException;
import java.security.NoSuchAlgorithmException;
import javax.crypto.Cipher;
import javax.crypto.CipherOutputStream;
import javax.crypto.NoSuchPaddingException;
import javax.crypto.spec.SecretKeySpec;
/**
* 自定义类加载器, 加载指定目录下的加密文件.
*
* @author wliu
*/
public class ByPathDecryptClassLoader extends ClassLoader {
private final String loadDir;
public ByPathDecryptClassLoader(String loadDir) {
this.loadDir = loadDir;
}
@Override
protected Class<?> findClass(String name) throws ClassNotFoundException {
if (name.contains("A_")) {
byte[] bytes = loadClassBytes(name);
if (bytes == null) {
System.err.println("Cannot find class");
return null;
}
return defineClass(name, bytes, 0, bytes.length);
}
return null;
}
private byte[] loadClassBytes(String name) {
System.out.println("load class bytes.");
String classPath = name.replaceAll("\\.", "/") + ".class";
String loadPath = this.loadDir + "/" + classPath;
try {
InputStream keyInputStream = new FileInputStream(Constants.LOAD_PATH + "/DES_bytes.dat");
byte[] keyBytes = new byte[keyInputStream.available()];
keyInputStream.read(keyBytes);
SecretKeySpec keySpec = new SecretKeySpec(keyBytes, "DESede");
Cipher cipher = Cipher.getInstance("DESede");
cipher.init(Cipher.DECRYPT_MODE, keySpec);
File file = new File(loadPath);
InputStream classInputStream = new FileInputStream(file);
ByteArrayOutputStream byteArrayOutputStream = new ByteArrayOutputStream();
try (CipherOutputStream cipherOutputStream = new CipherOutputStream(byteArrayOutputStream, cipher)) {
int b;
while ((b = classInputStream.read()) != -1) {
cipherOutputStream.write(b);
}
}
byte[] classData = byteArrayOutputStream.toByteArray();
return classData;
} catch (IOException | InvalidKeyException | NoSuchAlgorithmException | NoSuchPaddingException e) {
e.printStackTrace();
}
return null;
}
}
|
using System.Xml;
using ProSuite.Commons.Essentials.Assertions;
using ProSuite.Commons.Essentials.CodeAnnotations;
namespace ProSuite.QA.Core.Reports
{
internal class InstanceIndexEntry : IndexEntry
{
private readonly IncludedInstanceBase _includedInstance;
public InstanceIndexEntry([NotNull] IncludedInstanceBase includedInstance)
{
Assert.ArgumentNotNull(includedInstance, nameof(includedInstance));
_includedInstance = includedInstance;
}
public override void Render(XmlDocument xmlDocument, XmlElement context)
{
XmlElement anchor = xmlDocument.CreateElement("a");
if (_includedInstance.Obsolete)
{
anchor.SetAttribute("class", "obsoleteIndex");
}
anchor.SetAttribute("href", string.Format("#{0}", _includedInstance.Key));
anchor.SetAttribute("title", _includedInstance.IndexTooltip);
anchor.AppendChild(xmlDocument.CreateTextNode(_includedInstance.Title));
context.AppendChild(anchor);
context.AppendChild(xmlDocument.CreateElement("br"));
}
}
}
|
TABLE 23 Primers used for site directed mutagenesis by the mega primer PCR method.^(a) Fwd-T7-pro 5′-TAATACGACTCACTATAGGG-3′ SEQ ID NO: 81 Rev-T7-term 5′-GCTAGTTATTGCTCAGCGG-3′ SEQ ID NO: 82 anLAD Fwd-D213S/I214R 5′-CCTATCGTCATTACCTCACGT ^(b)GACGAGGGGCGGCTG-3′ SEQ ID NO: 83 Rev-D213S/I214R 5′-CAGCCGCCCCTCGTCACGTGAGGTAATGACGATAGG-3′ SEQ ID NO: 84 Fwd-A359T 5′- CCT TCGAAACGGCTACAAACCCCAAGACG-3 SEQ ID NO: 85 tlLAD Fwd-D214S/I215R 5′-GCTTGTCATCACATCACGTTCAGAGAGCCGTCTG-3′ SEQ ID NO: 86 Rev-D214S/I215R 5′-CAGACGGCTCTCTGAACGTGATGTGATGACAAGC-3′ SEQ ID NO: 87 Fwd-S362T 5′-GCATTTGAGACGTCAACAGATCCCAAGAGC-3′ SEQ ID NO: 88 pcLAD Fwd-D212S/I213R 5′-CCTATTGTCATCACTTCACGTGACGAGGGCCGCTTG-3′ SEQ ID NO: 89 Rev-D212S/I213R 5′-CAAGCGGCCCTCGTCACGTGAAGTGATGACAATAGG-3′ SEQ ID NO: 90 Fwd-S358T 5′-CCTTTGAGACTGCCACAAACCCTAAGACCGGTG-3′ SEQ ID NO: 91 ^(a)To create mutant LADs, fragments 1 and 2 were amplified using Fwd-T7-pro and Rev-D213S/I214R and Fwd-A359T and Rev-T7-term primers, respectively. Fragment 3 was amplified using Fwd-D123S/I214R and fragment 2 (Rev mega primer). Full mutant genes were amplified by overlap extension of fragment 1 and 3. Template DNA was pET-28a plasmid. ^(b)Sequences underlined were the mutation sites.
Kinetic Analysis of LADs with Altered Cofactor Specificity
In this example, “tlLAD mutant” is defined as tlLAD with the mutations D224S/I225R/A362T; “anLAD mutant” is defined as anLAD with the mutations D213S/I214R/A359T; and “pcLAD mutant” is defined as pcLAD with the mutations D212S/I213R/S358T. The tlLAD mutant showed significantly altered cofactor specificity from NAD⁺ to NADP⁺. It also demonstrated the highest catalytic activity. The K_(m) and k_(cat) of the tlLAD mutant for L-arabinitol with NADP⁺ were 46±4 mM and 170±9 min⁻¹, respectively (Table 24). In all assays including the tlLAD mutant with saturated NAD⁺, a plateau of reaction rate was not observed in the tested concentration range, so catalytic efficiencies were determined at 0.8 mM for NAD⁺ and 80 mM for L-arabinitol (Tables 24, 25). For cofactors, anLAD and tlLAD mutants showed significantly higher preference for NADP⁺ over NAD⁺ (Table 25). The K_(m) values of the anLAD and tlLAD mutants were 0.46±0.09 and 0.10±0.01 mM, and the k_(cat) values were 55.7±6.4 and 90.5±9.2 min⁻¹, respectively (Table 25). The catalytic efficiencies of anLAD and tlLAD mutants were 130±32 and 934±72 mM⁻¹·min⁻¹, and the ratios of the catalytic efficiencies with NADP⁺ to NAD⁺ were 100 and 161, respectively. For the tlLAD mutant, the ratio of catalytic efficiency for NADP⁺ to NAD⁺ was increased by 2.5×10⁴ fold (Tables 21, 25). The pcLAD mutant showed no activity with NAD⁺.
Table 24 shows kinetic parameters of LAD mutants for L-arabinitol at saturated cofactor concentrations.
Specific activity K_(m) k_(cat) k_(cat)/K_(m) (U/mg protein) (mM) (min⁻¹) (mM⁻¹ · min⁻¹) anLAD NAD⁺ —^(a) — — 0.010 ± 0.002^(b) mutant NADP⁺ — — — 0.45 ± 0.20 tlLAD NAD⁺ — — — 0.050 ± 0.007 mutant NADP⁺ 3.9 ± 0.2 46 ± 4 170 ± 9 3.7 ± 0.2 pcLAD NAD⁺ — — — — mutant NADP⁺ — — — 0.02 ± 0.02 ^(a)Dash indicates not determined due to high K_(m) for indicated cofactor ^(b)Error indicates standard deviation from the mean, n = 3 Table 25 shows kinetic parameters of LAD mutants for NAD⁺ and NADP⁺ at saturated L-arabinitol concentration.
K_(m) k_(cat) k_(cat)/K_(m) (mM) (min⁻¹) (mM⁻¹ · min⁻¹) anLAD mutant NAD⁺ —^(a) — 1.3 ± 0.3^(b) NADP⁺ 0.46 ± 0.09 55.7 ± 6.4 130 ± 32 tlLAD mutant NAD⁺ — — 5.8 ± 0.8 NADP⁺ 0.097 ± 0.011 90.5 ± 9.2 934 ± 72 pcLAD mutant NAD⁺ — — — NADP⁺ — — 3.6 ± 1.0 ^(a)Dash indicates not determined due to high K_(m) for indicated cofactor ^(b)Error indicates standard deviation from the mean, n = 3
Engineering of N. crassa XDH (ncXDH) with Altered Cofactor Specificity
Cloning and Characterization of Putative ncXDH
A putative N. crassa xylitol dehydrogenase (ncXDH) sequence was found using a protein BLAST search on the National Center for Biotechnology Information website (webpage ncbi.nlm.nih.gov) using the P. stipitis xylitol dehydrogenase (psX DH) enzyme as a query sequence. The two enzymes were aligned fully using a ClustalW algorithm and found to share 44% identity and 60% similarity (FIG. 56). The whole-genome sequence of Neurospora crassa has been published (Gala gan et al., 2003) and it was utilized to design primers for cloning of the putative xylitol dehydrogenase (XDH) gene.
RT-PCR performed on total RNA isolated from D-xy lose-induced N. crassa 10333 showed the expected size of gene product (˜1.1 kb). The RT-PCR product was cloned into the pET-28a vector using NdeI and SacI restriction sites and was transformed into E. coli BL21 (DE3). This construct (pET-28a ncXDH) expressed ncXDH as an N-terminal His6-tagged fusion with a thrombin cleavage site. Cell lysates of IPTG-induced cultures of these cells were prepared, analyzed by SDS-PAGE, and assayed for XDH activities. The XDH was then purified by immobilized metal ion affinity chromatography (IMAC) using Talon® Co2+ Superflow resin (Clontech, Mountain View, Calif.) according to manufacturer's protocol. The purified protein was desalted by ultrafiltration with several washes of 50 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) buffer (pH 7.25)+15% glycerol and stored frozen at −80° C. Protein concentrations were determined by the Bradford method (Bradford 1976).
ncXDH is a strictly NAD⁺-preferring enzyme. ncXDH also displays high stability (half-life of ˜200 min at 50° C.) and expression. Previous work by Watanabe et al. (2005b) was aimed at reversing the cofactor specificity of psX DH.
Development of ncXDH with Altered Cofactor Specificity
Through sequence alignment, residues D204, I205, and V206 of ncXDH were targeted for site-directed mutagenesis to alanine, arginine, and serine, respectively, to create ncXDH-ARS. Table 26 shows that ncXDH-ARS has completely reversed cofactor specificity, now preferring NADP⁺. The affinity for substrate xylitol did not suffer very much from the affinity-change for the co-factor.
Table 26 shows kinetic parameters for N. crassa and P. stipitis XDH and XDH-ARS with nicotinamide cofactors NAD⁺ and NADP⁺ at saturated xylitol concentrations.
NAD⁺ NADP⁺ k_(cat)/K_(m) k_(cat)/K_(m) k_(cat) K_(m) (mM⁻¹ k_(cat) K_(m) (mM⁻¹ Enzyme (min⁻¹) (mM) min⁻¹) (min⁻¹) (mM) min⁻¹) Source ncXDH-wt 2160 0.127 17000 -a ~5.6 ~68 This work ncXDH-ARS -a ~3.5 ~165 2080 0.325 6400 This work psX DH 1050 0.381 2760 110 170 0.65 Watanabe et al. (2005b) psX DH-ARS 240 1.3 181 2500 0.897 2790 Watanabe et al. (2005b) aNot determined, cofactor saturation not reached. All assays were performed at 25° C. in 50 mM Tris, pH 8.0.
Kinetic Analysis of ncXDH Mutant
The mutant ncXDH had a dramatic reversal of cofactor specificity. The K_(m) of the mutant ncXDH for NADP⁺ was only about 2.5-fold higher than the K_(m) of wild-type ncXDH for NAD⁺ whereas the k_(cat) values were similar (Table 27).
Table 27 shows kinetic parameters of ncXDH mutants for substrate xylitol.
k_(cat) K_(m) k_(cat)/K_(m) Enzyme (min⁻¹) (mM) (mM⁻¹ min⁻¹) ncXDH-wt 2170 ± 135 6.6 ± 2.0 330 ncXDH-ARS 2090 ± 35 4.3 ± 0.3 490 a Not determined, cofactor saturation not reached. All assays were performed at 25° C. in 50 mM Tris, pH 8.0. All enzymes were purified and characterized with N-His₆-tag
As shown in FIG. 57, XDH activity exhibits a higher tolerance to more acidic conditions with activity extending down to pH 4.0, whereas LAD activity is abolished at pH 5.0 in the in vitro activity assay.
Example 14 Expression of Xylose Isomerase from Bacteroides stercoris in S. cerevisiae
Bacterial xy lose isomerase (XI) is involved in converting xy lose into xylulose. Recently, three successful cases of expressing active XI from two species of anaerobic fungi (Piromyces sp. and Orpinomyces sp.) and from the anaerobic bacteria (Clostridium phytofermentans) have been reported. A fungal XYLA gene from Piromyces sp. E2 was functionally expressed in S. cerevisiae and a maximum 1.1 U/mg-protein of XI activity was obtained at 30° C. (Kuyper et al., 2003). The second fungal XYLA gene from Orpinomyces, which has 94% identity with that from Piromyces sp., was also functionally expressed in S. cerevisiae (Madhavan et al., 2009). Recently, the first prokaryotic xy lA gene from Clostridium phytofermentans was functionally expressed in S. cerevisiae (Brat et al., 2009).
The isomerase gene xy lA from the anaerobic bacteria Bacteroides stercoris (BtXI) shares high sequence identity with the isomerase gene from Piromyces sp. (82%). BtXI was cloned into the pRS424TEF vector and transformed into the S. cerevisiae L2612 strain. The gene was also integrated into the S. cerevisiae D452-2 strain by using the pRS403TEF vector. Ethanol production was observed in both strains expressing BtXI (5 g/L in L2612 and 7.8 g/L in D452-2) (FIG. 58-59). However, rates of production were relatively low compared to that of engineered strains expressing the XYL genes.
The low ethanol production could be attributed to the inhibitory effect of any accumulated xylitol (formed from xy lose by endogenous yeast aldose reductase). To decrease xylitol accumulation, XDH and XK were expressed in BTXI-expressing yeast strain (DBtXI). The resulting strain had slightly improved ethanol yield and decreased xylitol production (FIG. 60). Co-expression of these two XYL genes in DBtXI resulted in ethanol production even under aerobic conditions.
Example 15 Over-Expression of Enzymes in Pentose Phosphate Pathway (PPP)
The PPP enzymes glucose-6-phosphate dehydrogenase (ZWF1), 6-phosphogluconate dehydrogenase (GDN1), transaldolase (TAL1), and transketolase (TKT1) from P. stipitis were cloned into an integration vector (pRS406) under the control of a strong promoter (P_(GPD)). The plasmid was linearized by the enzyme St uI and integrated into the chromosome of S. cerevisiae.
However, to get the beneficial effects of over-expressing the PPP enzymes, there also had to be over-expression of XYL3 (XK) (FIG. 61). Expression of XYL3 and the PPP enzymes also improved ethanol production in YP-xylulose media.
Example 16 Expression of Aldose-1-Epimerase
Hydrolysis of cellobiose by β-glucosidase releases β-D-glucose. However, yeast hexokinases prefer (or exclusively use) α-D-glucose, and the rate of mutaroation of β-D-glucose to α-D-glucose could effectively slow down metabolic rate. One way of enhancing the conversion was to over-express the predicted aldose-1-epi merase NCU09705. This hypothesis was tested by over-expressing NCU09705 homologs: ga lM in E. coli; GAL10, YHR210C, and YNR071C in S. cerevisiae; and GAL 10 in P. stipitis. The strains were then tested for cellobiose consumption and ethanol production (FIGS. 62A-B). The results indicated that over-expression of the homologs in S. cerevisiae caused a slight increase in cellobiose consumption and ethanol production.
Example 17 Co-Fermentation of Xylose and Cellobiose
In this example a new strategy was used to overcome glucose repression in which a dimer of glucose, cellobiose, was co-fermented with xy lose (a pentose). Cellobiose is an intermediate product from enzymatic hydrolysis of cellulose, which is further converted to glucose by β-glucosidases in the cocktail of cellulases including exocellulases, endocellulases, and β-glucosidases, whereas pentose sugars are the products of dilute acid hydrolysis of hemicellulose. Wild type S. cerevisiae cannot assimilate cellobiose because it lacks both a cellobiose transporter and a β-glucosidase capable of hydrolyzing cellobiose into glucose. Hence, the newly discovered cellodextrin transporter genes described in Example 9 and a β-glucosidase gene from N. crassa were co-expressed in S. cerevisiae and a mixture of xy lose and cellobiose was used as carbon source (FIGS. 63A-C). Similar approaches have employed either secretion, or cell surface display, of β-glucosidases to allow cellobiose fermentation by S. cerevisiae (van Rooyen et al., 2005; Skory et al., 1996; Kota ka et al., 2008; Katahira et al., 2006). In those cases, cellobiose was hydrolyzed into glucose extracellularly before being transported by the endogenous hexose transport system of S. cerevisiae. In contrast, in this strategy, cellobiose was hydrolyzed intracellularly following transport.
In the conventional methods for mixed sugar fermentation in S. cerevisiae, a mixture of glucose and pentose sugars derived from lignocellulose is used. However, in this new strategy, a mixture of cellobiose and pentose sugars was used. The cellobiose was transported inside yeast cells via the heterologous cellodextrin transporters while pentose sugars were transported inside yeast cells by endogenous hexose transporters, thus removing the direct competition between glucose and pentose sugars for the same transporters, a phenomenon that is partly responsible for glucose repression. Once inside yeast cells, cellobiose was converted to glucose by β-glucosidase and immediately consumed by yeast cells, which resulted in low intracellular glucose concentration, thereby further alleviating glucose repression.
The engineered xy lose-utilizing yeast strain L2612 was used as a host to co-express cellodextrin transporter and β-glucosidase genes. In this strain, the D-xy lose utilization pathway consisting of xy lose reductase, xylitol dehydrogenase, and xylulokinase from Pichia stipitis was integrated into the chromosome. The cellodextrin transporters from Neurospora crassa including NCU008011, NCU08114, and, NCU00809, and two β-glucosidase genes, one from Neurospora crassa and the other from Aspergillus aculeatus, were evaluated.
S. cerevisiae L2612 (MATα, leu2-3, leu2-112, ura3-52, trp1-298, can1, cyn1, gal+) was cultivated in synthetic dropout media to maintain plasmids (0.17% of Difco yeast nitrogen base without amino acids and ammonium sulfate, 0.5% of ammonium sulfate, 0.05% of amino acid dropout mix). YPA medium (1% yeast extract, 2% peptone, 0.01% adenine hemi sulfate) with 2% of sugar was used to grow yeast strains.
To integrate the D-xy lose utilization pathway consisting of D-xy lose reductase, xylitol dehydrogenase, and xylulokinase from Pichia stipitis, the corresponding genes were PCR-amplified and cloned into the pRS416 plasmid using the DNA assembler method (Shao et al., 2009). BamHI and HindIII were used to remove the DNA fragment encoding the D-xy lose utilization pathway and then ligated into the pRS406 plasmid digested by the same two restriction enzymes. The resulting plasmid was then linearized by ApaI and integrated into the URA3 locus on the chromosome of L2612.
The pRS425 plasmid (New England Biolabs, Ipswich, Mass.) was used to co-express a cellodextrin transporter gene and a β-glucosidase gene. As shown in FIG. 64, the pRS425 plasmid was digested by BamHI and ApaI. The PYK1 promoter and the ADH1 terminator were added to N-terminus and C-terminus of the cellodextrin transporter, respectively, while the TEF1 promoter and the PGK1 terminator were added to the N-terminus and C-terminus of the β-glucosidase, respectively. These DNA fragments were assembled into the linearized pRS425 shuttle vector using the DNA assembler method (Shao et al., 2009). Three cellodextrin transporter genes NCU00801 (XM_(—)958708), NCU08114 (XM_(—)958780), and NCU00809 (XM_(—)959259) from Neurospora crassa and two β-glucosidase genes NCU00130 (XM_(—)951090) from Neurospora crassa and BGL1 (D64088) from Aspergillus aculeatus were used. There were six combinations in total, each with one cellodextrin transporter gene and one β-glucosidase gene.
Yeast plasmids were then transferred into E. coli DH5α, which were used for recombinant DNA manipulation. The transformants were plated on Luria broth plates containing 00 mg/L ampicillin. Single colonies of E. coli transformants were then inoculated into the liquid Luria broth media (Fisher Scientific, Pittsburgh, Pa.) and grown at 37° C. and 250 rpm. Plasmids were isolated from E. coli using the QIAprep Spin Miniprep Kit (QIAGEN). These plasmids were transformed into the L2612 strain individually to yield the following strains: SL01 (contained the plasmid harboring the NCU00801 cellodextrin transporter gene and the NCU00130β-glucosidase gene from Neurospora crassa), SL02 (contained the plasmid harboring the NCU00809 cellodextrin transporter gene and the NCU00130β-glucosidase gene from Neurospora crassa), SL03 (contained the plasmid harboring the NCU08114 cellodextrin transporter gene and the NCU00130 β-glucosidase gene from Neurospora crassa), SL04 (contained the plasmid harboring the NCU00801 cellodextrin transporter gene and the BGL1 gene from Aspergillus aculeatus), SL05 (contained the plasmid harboring the NCU00809 cellodextrin transporter gene and the BGL1 gene from Aspergillus aculeatus), and SL06 (contained the plasmid harboring the NCU08114 cellodextrin transporter gene and the BGL1 gene from Aspergillus aculeatus). The empty pRS425 plasmid was transformed into the L2612 strain to yield the SL00 strain, which was used as a negative control. Yeast transformation was carried out using the standard lithium acetate method (Gietz et al., 1995). The resulting transformation mixtures were plated on SC-Ura-Leu medium supplemented with 2% D-glucose.
To confirm the proper construction of plasmids using the DNA assembler method, plasmids were isolated from yeast cells using the Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research, Orange, Calif.) and then transferred into E. coli DH5α cells. The resulting cells were spread on LB plates containing 100 mg/L ampicillin. Single E. coli colonies were inoculated into the LB liquid media. Plasmids were isolated from E. coli using the QIAprep Spin Miniprep Kit (QIAGEN, Valencia, Calif.) and checked by diagnostic PCR or restriction digestion using ClaI and HindIII. All restriction enzymes were obtained from New England Biolabs (Ipswich, Mass.). All chemicals were purchased from Sigma Aldrich or Fisher Scientific.
For each yeast strain, single colony was first grown up in 2 mL SC-Ura-Leu medium plus 2% glucose, and then inoculated into 50 mL of the same medium in a 250 mL shake flask to obtain enough cells for mixed sugar fermentation studies. After one day of growth, cells were spun down and inoculated into 50 mL of YPA medium supplemented with 4% cellobiose and 5% D-xy lose, or 4% cellobiose, 5% xy lose, and 0.5% glucose, or 4% cellobiose, 5% xy lose, and 1% glucose in a 250 mL unbaffled shake-flask. Starting from an initial OD₆₀₀˜1, cell culture was grown at 30° C. at 100 rpm for fermentation under oxygen limited condition. OD₆₀₀ reading and cell culture sample were taken at various time points. Sugar concentrations were analyzed using HPLC, while ethanol formation was analyzed using the Ethanol Kit (R-biopharm, Darmstadt, Germany). For each data point, triplicate samples were taken. The mixed sugar fermentation results for the strains ranging from SL00 to SL06 are shown in FIGS. 65A-G. The best strain SL01 was selected for further characterization.
A total of six different strains, ranging from SL01 to SL06, were constructed by introducing a pRS425 plasmid harboring one of the cellodextrin transporter genes and one of the β-glucosidase genes into the L2612 strain. In each plasmid, the cellodextrin transporter gene and the β-glucosidase gene were added with a yeast promoter and terminator, respectively, and assembled into the pRS425 multi-copy plasmid by the DNA 10 assembler method (Shao et al., 2009) (FIG. 64). The empty pRS425 plasmid was introduced into the L2612 strain to yield the SL00 strain, which was used as a negative control. All strains were cultivated with a mixture of 40 g/L cellobiose and 50 g/L D-xy lose in shake-flasks, and their sugar consumption rates, cell growth rates, and ethanol titers were determined (FIG. 65). Amongst all strains, the SL01 strain containing the β-glucosidase from Neurospora crassa and the cellodextrin transporter NCU00801 showed the highest sugar consumption rate and ethanol productivity. Thus, this strain was selected for further characterization.
Both SL01 and SL00 were cultivated using a mixture of 40 g/L cellobiose and 50 g/L D-xy lose in both shake-flasks and bioreactors (FIGS. 66A-D). In the shake-flask cultivation (FIG. 66 a-b), 83% cellobiose was consumed in 96 hours by SL01, with 41.2% higher average D-xy lose consumption rate compared to SL100 (from 0.33 g/L/h to 0.46 g/L/h). Consistent with the enhanced sugar consumption rate, 1.32-fold increased average biomass growth rate was observed (from 0.031 g dry cell weight/L/h to 0.072 g dry cell weight/L/h). The ethanol productivity was increased by more than 2.1-fold, from 0.07 g/L/h to 0.23 g/L/h. The highest ethanol yield of 0.31 g per g sugar was reached in 48 hours, and the average ethanol yield was 0.28 g per g sugar, representing a 23% increase compared to the SL00 strain. In the SL01 cultivation, a faster D-xy lose consumption rate was observed, without the lag phase that is the hallmark of glucose repression in co-fermentation of glucose and D-xy lose. Moreover, enhanced biomass growth and ethanol production were also observed.
The Multifors system (Info rs-HT, Bottmingen, Switzerland) was used for mixed sugar fermentation in bioreactors. Each vessel had a total capacity volume of 750 mL. For each vessel, there was one individual set of pO₂ sensor, air spar ger, exit gas cooler, temperature sensor, inoculation port, spare port, dip tube, anti foam sensor, pH sensor, drive shaft, heater block, rota meter, and peristaltic pumps system. The whole bioreactor system was equipped with a cooling system, ThermoFlex900 (Thermo Scientific, Waltham, Mass.).
Single colonies of yeast strains were first grown up in 2 mL SC-Ura-Leu medium plus 2% glucose, and then inoculated into 50 mL of the same medium in a 250 mL shake flask to obtain enough cells for mixed sugar fermentation studies. After one day of growth, 10 mL saturated culture were inoculated in 400 mL YPA medium supplemented with 4% cellobiose and 5% D-xy lose, or 4% cellobiose, 5% xy lose, and 0.5% glucose, or 4% cellobiose, 5% xy lose, and 1% glucose. The temperature was maintained at 30° C. and the pH was maintained at 5.5, adjusted by addition of either 2 N H₂SO4 or 4 N NaOH. In the first 48 hours, the air flow rate was maintained at 0.5 L/min, with the impeller speed at 250 rpm. Afterwards, the air flow rate was adjusted to 0.2 L/min to achieve high ethanol production under oxygen limited condition. Triplicate samples were taken at various time points and the OD₆₀₀, sugar concentration, and ethanol concentration were determined as described above.
In the bioreactor cultivation (FIG. 66 c-d), almost all cellobiose and 66% D-xy lose were consumed in 48 hours, representing 44% increased D-xy lose consumption rate (from 0.47 g/L/h to 0.68 g/L/h) and 1.1-fold increased biomass growth rate (from 0.08 g dry cell weight/L/h to 0.17 g dry cell weight/L/h). The ethanol productivity was increased by more than 4.3-fold (from 0.09 g/L/h to 0.50 g/L/h), and the ethanol yield was 0.39 g per g sugar. Compared to shake-flask cultivations, sugar consumption rates in the first 24 hours were lower, which was due to the low cell density used in the beginning of batch cultivation.
Unexpectedly, a small amount of glucose was detected even though there was no glucose added in fermentation (FIG. 66 a-b). The maximum glucose concentration was reached in approximately 24 hours in both shake-flasks (12.1 g/L) and bioreactors (17.5 g/L) and then dropped to a very low level. However, no obvious glucose repression was observed even in the presence of such glucose. Because no glucose was detected in the SL00 strain, the extracellular glucose may result from the slow conversion of β-glucose to its epi mer α-glucose, the main form of glucose used in glycolysis. Typically, β-glucose can be efficiently converted to α-glucose either enzymatically or chemically because of its relatively low concentration in glucose (Bouffard et al., 1994). However, in the engineered SL01 strain, catalyzed by β-glucosidase, an excess amount of β-glucose is produced from cellobiose intracellularly and a small fraction may be secreted outside cells, similar to what was observed with β-galactose (Bouffard et al., 1994).
Because a small amount of glucose (less than 10% of total sugars) is typically present in lignocellulosic hydrolysates in industrial settings, the fermentation performance of the engineered SL01 strain was also investigated using a mixture of cellobiose, D-xy lose, and glucose. Two concentrations of glucose, 5 g/L or 10 g/L, were combined with 40 g/L cellobiose and 50 g/L D-xy lose as mixed carbon source in bioreactors. With 5 g/L glucose (FIG. 67 a-b), 81.7% cellobiose was consumed by SL01, with 67.8% D-xy lose consumed at 48 hours in batch cultivation. The D-xy lose consumption rate was increased by 1.19-fold, from 0.32 g/L/h to 0.69 g/L/h. The ethanol productivity was increased by 3.3-fold (from 0.11 g/L/h to 0.46 g/L/h) while the ethanol yield was increased from 0.26 g per g sugar to 0.33 g per g sugar. With 10 g/L glucose (FIG. 67 c-d), 83.8% cellobiose was consumed by SL01, with 74.7% D-xy lose consumed at 48 hour in batch cultivation. The D-xy lose consumption rate was increased by 68%, from 0.45 g/L/h to 0.76 g/L/h. The ethanol productivity was increased by 2.1-fold (from 0.16 g/L/h to 0.50 g/L/h) and the ethanol yield was increased from 0.30 g per g sugar to 0.33 g per g sugar. As expected, the engineered SL01 strain showed both a higher efficiency of sugar consumption and a higher rate of ethanol production than the SL00 wild type strain. More importantly, there was no significant glucose repression in the co-fermentation of three sugars even with glucose up to 10% of total sugars (FIG. 67 c-d) suggesting that this approach may be viable for industrial applications.
A similar study was carried out in the S. cerevisiae strain D452-2, where the three N. crassa cellodextrin transporters NCU00801, NCU08114, and NCU00809 were introduced together with the β-glucosidase NCU00130. The transformants were selected on YSC medium containing 20 g/liter cellobiose expressing an intracellular β-glucosidase (NCU00130). Strains and plasmids used in this work are described in Table 17 (Ex. 12). The primers used are listed in Table 28.
Table 28 shows the synthetic oligonucleotides used in the study.
Name Sequences NCU00801-F ATGGATCCAAAAATGTCGTCTCACGGCTCC SEQ ID NO: 92 NCU00801-R ATGAATTCCTACAAATCTTCTTCAGAAATC AATTTTTGTTCAGCAACGATAGCTTCGGAC SEQ ID NO: 93 NCU08114-F ATACTAGTAAAAATGGGCATCTTCAACAAG AAGC SEQ ID NO: 94 NCU08114-R GCATATCGATCTACAAATCTTCTTCAGAAA TCAATTTTTGTTCAGCAACAGACTTGCCCT CATG SEQ ID NO: 95 NCU00130-F GCATACTAGTAAAAATGTCTCTTCCTAAGG ATTTCCTCT SEQ ID NO: 96 NCU00130-R ATACTGCAGTTAATGATGATGATGATGATG GTCCTTCTTGATCAAAGAGTCAAAG SEQ ID NO: 97
Yeast were grown in YP medium containing 20 g/L of glucose or 20 g/L of cellobiose to prepare inoculums for xy lose or cellobiose fermentation experiments, respectively. Cells at mid-exponential phase from YP media containing 20 g/L of glucose or cellobiose were harvested and inoculated after washing twice with sterilized water. All of the flask fermentation experiments were performed using 50 mL of YP medium containing 40 g/L or 80 g/L of xy lose in 250 mL flask at 30° C. with initial OD₆₀₀ of 1.0 under oxygen limited conditions. Bioreactor fermentations were performed in 400 mL of YP medium containing appropriate amounts of sugars using Sixfors Bioreactors (Appropriate Technical Resources, Inc) at 30° C. with an agitation speed of 200 rpm under oxygen limited 250 conditions. Initial cell densities were adjusted to OD₆₀₀=1.0.
Cell growth was monitored by optical density (OD) at 600 nm using UV-visible Spectrophotometer (Bio mate 5, Thermo, N.Y.). Glucose, xy lose, xylitol, glycerol, acetate, and ethanol concentrations were determined by high performance liquid chromatography 264 (HPLC, Agilent Technologies 1200 Series) equipped with a refractive index detector using 265 a Rezex ROA-Organic Acid H+ (8%) column (Phenomenex Inc., Torrance, Calif.). The column was eluted with 0.005 N of H₂SO₄ at a flow rate of 0.6 mL/min at 50° C.
All three transformants were able to grow and produce ethanol when cellobiose was the sole carbon source (FIGS. 68A-C), but the three transformants exhibited different cellobiose fermentation rates (NCU00801>NCU08114>NCU00809). The fastest cellulose-fermenting transformant (D801-130), expressing both NCU00801 and NCU00130, consumed 40 g/L of cellobiose within 4 hours, producing 16.8 g/L of ethanol. The volumetric productivity of cellobiose fermentation (P_(Ethanol/Cellobiose)=0.7 g/L/h) was lower than that of glucose fermentation (P_(Ethanol/Glucose)=1.2 g/L/h), and ethanol yield from cellobiose (Y_(Ethanol/Cellobiose)=0.42 g/g) was about the same as ethanol yield from glucose (Y_(Ethanol/Glucose)=0.43 g/g) under the same culture conditions. However, the observed cellobiose consumption rate and ethanol yield by D801-130 were an improvement over S. cerevisiae strains engineered to ferment cellobiose through surface display of β-glucosidase (Kota ka et al., 2008; Nakamura et al., 2008). These results suggest that simultaneous expression of NCU00801 and NCU00130 in S. cerevisiae can result in efficient cellobiose fermentation.
After developing the efficient xy lose fermenting strain DA24-16 (described in Example 13), genes coding cellodextrin transporter and β-glucosidase (NCU00801 and NCU00130) enzyme were introduced into the strain enabling it to consume cellobiose and xy lose simultaneously. It was hypothesized that glucose repression of xy lose utilization may be alleviated in this strain, due to the intracellular hydrolysis of cellobiose. The NCU00801 gene was integrated into the genome of DA24-16, and NCU00130 was expressed from a multi-copy plasmid. The resulting transformant, DA24-16-BT3, was selected on an agar plate containing cellobiose as the sole carbon source.
The DA24-16-BT3 strain grown in media containing various amounts of cellobiose and xy lose co-consumed cellobiose and xy lose, and produced ethanol with yields of 0.38-0.39 g/g in all conditions tested (FIGS. 69A-C). The potential synergistic effects of co-fermentation were tested by culturing DA2416-BT3 under three different conditions: 40 g/L of cellobiose, 40 g/L of xy lose, and 40 g/L of both sugars (total 80 g/L of sugars). Surprisingly, DA24-16BT3 was able to co-consume 80 g/L of a cellobiose/xy lose mixture within the same period that was required to consume 40 g/L of cellobiose or 40 g/L xy lose separately (FIGS. 70A-C). Moreover, DA24-16BT3 produced ethanol with a higher yield (0.39 g/g) from a mixture of cellobiose and xy lose as compared to ethanol yields (0.31˜0.33 g/g) from single sugar fermentations (cellobiose or xy lose). Ethanol productivity also drastically increased from 0.27 g/L/h to 0.65 g/L/h during co-fermentation. These results demonstrated that co-fermentation of cellobiose and xy lose can enhance overall ethanol yield and productivity. Fermentation experiments were also done to compare this engineered S. cerevisiae strain (DA24-16BT3) to P. stipitis, which is capable of co-fermenting cellobiose and xy lose efficiently.
A simulated hydrolysate (10 g/L of glucose, 80 g/L of cellobiose, 40 g/L of xy lose) based on the composition of energy cane was used. The composition of different lignocellulosic plants varies in a broad range. For instance, the US Department of Energy biomass database lists the composition of more than 150 biomass samples (webpage eere.energy.gov/biomass/m/feedstock_databases.html). The cellulose-to-hemicellulose ratios of these samples are between 1.4 and 19, and the average is 2.3. Energy crops typically have higher hemicellulose content than woody biomass. The average cellulose to hemicellulose ratios of sugarcane bagasse, corn stover, sorghum are 2.0, 1.85 and 2.14, respectively. We therefore used a glucan/xylan ratio of 2 in our simulated sugar experiment design. The engineered yeast will likely be used in conjunction with traditional cellulase cocktails that are deficient in β-glucosidase activities for the biofuels production. The biomass hydrolysis process may result in small amounts of glucose in the lignocellulosic hydrolysates as 6-30% glucan-to-glucose conversions with incomplete cellulase cocktails were reported (Med ve et al., 1998). Considering all the above factors, a sugar combination of 10 g/L glucose, 80 g/L cellobiose, and 40 g/L xy lose was chosen in the simulated sugar experiments.
The DA24-16BT3 consumed glucose first before co-consuming cellobiose and xy lose rapidly. A total of 130 g/L of sugars was consumed within 60 hours even though small inoculums were used (OD₆₀₀=1). In contrast, P. stipitis could not finish fermenting the sugar mixture within the same period under identical culture conditions (FIGS. 71A-B). DA24-16BT3 produced 48 g/L of ethanol within 60 hours (Y_(Ethanol/Sugars)=0.37 g/g and P_(Ethanol/Sugars)=0.79 g/L/h).
A transient accumulation of cellodextrins in the medium during cellobiose consumption was observed (FIG. 72-73). The accumulated cellotriose and cellotetraose were again consumed after depletion of cellobiose. It is likely that the accumulated cellodextrins were generated by the trans-glycosylation activity (Christakopoulos et al., 1994) of β-glucosidase (NCU00130), and secreted by the cellodextrin transporter (NCU00801), which might facilitate the transport of cellodextrins in both directions (intracellular
extracellular). This transient cellodextrin accumulation would probably not reduce product yields since the accumulated cellodextrins would eventually be consumed by the engineered yeast. However, it might decrease productivity because the transport rates of cellotriose and cellotetraose might be slower than that of cellobiose.
Small amounts of glucose were constantly detected in the medium during co-fermentation. Since even low amounts of glucose accumulation can repress xy lose fermentation, glucose levels have to be kept at a minimum. It can be hypothesized that the relative expression levels of the cellodextrin transporter and β-glucosidase are likely to affect glucose accumulation. In support of this, it was observed that more glucose was accumulated in the medium when NCU00801 was introduced on a multi-copy plasmid than when NCU00801 was integrated into the yeast genome. The strain (DA24-16-BT). containing both NCU00801 and NCU00130 on multi-copy plasmids, had relatively slower xy lose utilization rates than those observed in DA24-16-BT3, a potential reason being glucose repression (FIGS. 74A-B). Further adjustments of the cellodextrin transporter and β-glucosidase expression levels, or the identification of β-glucosidases with reduced trans-glycosylation activities, may be able to reduce the accumulation of glucose and cellodextrin during co-fermentation.
Co-fermentation of xy lose and cellobiose could also be achieved by mixed cultivation of two different yeast strains: the xy lose-fermenting DA24-16 strain and the cellobiose-fermenting DA452BT (FIG. 75). As explained above, the yeast strain DA24-16 expressed the xy lose-utilizing enzymes wild type xy lose reductase (XYL1), mutant xy lose reductase R276H (mXYL1), xylitol dehydrogenase (XYL2), and xylulokinase (XKS1) (Ex. 12; Table 17). D452BT was formed by engineering D452 to express the cellodextrin transporter NCU00801 and the β-glucosidase NCU00130. In the mixed culture, the DA24-16 strain took up xy lose (xy lose molecule shown as a green pentagon in FIG. 75 a) and metabolized it using the enzymes XYL1 (wild type and mutant), XYL2, and XYL3, whereas the other strain D452BT was able to take up cellobiose (cellobiose molecule shown as two red hexagons in FIG. 75 a) using the transporter NCU00801 and convert the cellobiose into glucose using the enzyme NCU00130. Hence, the mixed culture was able to co-ferment both xy lose and cellobiose to produce ethanol (FIG. 75 b).
This study demonstrated a novel strategy to allow co-fermentation of hexose and pentose sugars by S. cerevisiae. By combining an efficient xy lose utilization pathway with a cellodextrin transport system, the problem caused by glucose repression was over-come. As a result, the engineered yeast co-fermented two non-metabolizable sugars in cellulosic hydrolysates synergistically into ethanol. The new co-fermentation method described herein advances lignocellulosic technologies on both the saccharification and fermentation fronts. Most traditional fungal cellulase cocktails are deficient in β-glucosidase and end the cellulose hydrolysis with cellobiose that is not fermented efficiently by yeast. As a result, extra β-glucosidase enzyme must be added to convert cellobiose into glucose. The cellobiose/xy lose co-fermentation yeast makes it possible to use these cellulase cocktails with limited β-glucosidase activities, lowering enzyme usage and cost associated with the cellulose saccharification process. Further, the synergy between cellobiose and xy lose co-fermentation significantly increases ethanol productivity, thus improving fermentation economics. The presence of a small amount of glucose from the pre-treatment and hydrolysis of lignocellulosic materials does not affect the capacity of the engineered yeast to convert hexose and pentose sugar mixtures into ethanol.
This study involved measuring the capacity of an engineered S. cerevisiae strain to ferment various mixtures of sugars meant to mimic hydrolysates from plant biomass. The ability of this strain to co-ferment cellodextrins and xy lose is particularly useful during the simultaneous saccharification and co-fermentation (SSCF) of pre-treated plant biomass. During SSCF, hemicellulose would first be hydrolyzed by acid pre-treatment, resulting in formation of xy lose and still-crystalline cellulose. Then, fungal cellulases and the yeast strain described herein would be added, allowing the cellulases to co-convert xy lose and cellobiose into ethanol. Because of the limited extracellular glucose production in this scheme, there will be reduced repression of xy lose utilization and co-fermentation will proceed rapidly and synergistically.
Although the S. cerevisiae strain used in this study was a laboratory strain, the fermentation performance of the engineered strain was very impressive when compared to published results. The key fermentation parameters (yield and productivity) may be further improved by the use of industrial yeast strains as a platform. Applications of this co-fermentation strategy would not be limited to ethanol production. Since it is a foundational technology, the strategy presented here can be combined with any other product diversification technologies to produce commodity chemicals and advanced biofuels.
Example 18 Transcriptome Analysis of N. crassa Grown on Xylan
Lignocellulosic biomass is composed of cellulose, hemicellulose, and lignin. Examples 1-3 describe the discovery of genes critical for growth on cellulose through transcriptome and secretome analysis of N. crassa. In this example the expression profile of the N. crassa genome was examined during growth on xylan to determine which genes are important for utilization of hemicellulose.
Ten day old conidia of WT or ΔxlnR strains were inoculated at 10⁶ conidia/mL on 100 mL 1× Vogel's salts minimal medium (2% sucrose), grown for 16 hours at 25° C. with constant light, and washed with 1× Vogel's only medium. Conidia were then transferred into 100 mL 1× Vogel's salts with 2% sucrose or 2% Beechwood xylan as the sole carbon source in the medium and allowed to grow for 4 hours. Mycelia were harvested by filtration and immediately flash frozen in liquid nitrogen. Total RNA was isolated using TRIzol (Invitrogen) according to the manufacturer's instructions and treated with DNase (Turbo DNA-free kit; Ambion) (Kasuga, Townsend et al., 2005).
For cDNA synthesis and labeling, the Pronto kit (Catalog No. 40076; Corning) was used according to the manufacturer's specifications except that the total RNA used was 10 μg per sample.
Microarray hybridization and data analysis were performed as previously described (Tian, Kasuga et al., 2007). A GenePix 4000B scanner (Axon Instruments) was used to acquire images, and GenePix Pro6 software was used to quantify hybridization signals and collect the raw data. Normalized expression values were analyzed by using the BAGEL (Bayesian analysis of gene expression levels) software program (Townsend and Hartl 2002; Townsend 2004). 354 genes were found to be induced greater than 2-fold in N. crassa grown on xylan. The list is shown in FIG. 76.
Example 19 Secretome Analysis of N. crassa Grown on Xylan
The secretome of N. crassa during growth on xylan was analyzed using a shotgun proteomics approach. Supernatants from xylan cultures were digested with trypsin and analyzed by liquid chromatography nano-electrospray ionization tandem mass spectrometry.
Mass spectrometry samples were prepared as follows. N. crassa wild type strain was grown on 2% xylan media for 4 or 7 days. Culture supernatants were isolated by centrifugation, filtered through 0.22 μm filters, and concentrated 10 times with 10 kDa MWCO PES spin concentrators. 3. 36 mg of urea, 5 μL of 1M Tris pH 8.5, and 5 μL of 100 mM DTT were then added to 100 μL of concentrated culture supernatant, and the mixture was heated at 60° C. for 1 hour. After heating, 700 μL of 25 mM ammonium bicarbonate and 140 μL of methanol were added to the solution followed by treatment with 50 μL of 100 μg/mL trypsin in 50 mM sodium acetate pH 5.0. The trypsin was left to react overnight at 37° C. with inverting for about 8-9 hours at basal pH. After digestion the volume was reduced to dryness by speed vac and washed with 300 μl Mill iQ water three times. The final volume was 100 μl. TFA was added at 0.1-0.3% v/v. Residual salts in the sample were removed by using OMIX micro extraction pipette tips according to the manufacturer's instructions. The acetonitrile was removed by evaporation. The sample solution was an aqueous solution with 0.1%-1% TFA, and the final volume was 10 microliters or greater.
Example 20 Analysis of Xylan-Induced Genes Predicted to Encode Secreted Proteins
The transcriptome and secretome analysis results indicated a total of 71 genes, of which 55 were predicted to be secreted. The list of these genes is in Table 29. Deletion strains were available for 46 out of 69 genes. Out of these 46, six of the strains were heterokaryons, thus the remaining 40 deletion strains were analyzed for total secreted protein, amount of xy lose present, and azo-endo-xylanase activity. Results are shown in FIG. 77.
Table 29 shows xylan-induced N. crassa genes
Gene Name Signal P Data Annotation NCU00642 Y Transcription probable beta-galactosidase NCU00695 Y Transcription putative protein NCU00798 MS hypothetical protein NCU00937 Y Transcription conserved hypothetical protein NCU01517 Y Transcription glucan 1,4-alpha-glucosidase NCU02136 MS probable transaldolase NCU02252 MS probable phosphoglyceromutase NCU02343 Y Transcription related to alpha-L-arabinofuranosidase A precursor NCU02455 Y Transcription FK506-binding protein 2 precursor (Peptidyl-prolyl cis-trans isomerase) NCU02583 Y Transcription probable Alpha-glucosidase precursor (Maltase) NCU03013 Y Transcription related to cytosolic Cu/Zn superoxide dismutase NCU03222 Y Transcription putative protein NCU03636 Y Transcription NCU03639 Y Transcription probable triacylglycerol lipase precursor NCU04202 MS nucleoside-diphosphate kinase NCU04265 Y Transcription related to beta-fructofuranosidase NCU04388 Y Transcription probable phosphatidylglycerol/phosphatidylinositol transfer protein NCU04395 MS beta-1,6-glucanase Neg1 NEG-1 NCU04415 Y Transcription related to brefeldin A resistance protein NCU04431 Y MS related to endo-1,3-beta-glucanase NCU04475 Y Transcription probable lipase B precursor NCU04482 MS hypothetical protein NCU04623 Y Transcription related to beta-galactosidase NCU04674 Y Transcription related to alpha-glucosidase b NCU04675 Y Transcription putative protein NCU04930 Y Transcription related to triacylglycerol lipase NCU05137 Y Transcription conserved hypothetical protein NCU05143 Y Transcription related to Rds1 protein NCU05159 Y Transcription probable acetylxylan esterase precursor NCU05275 MS probable ubiquitin fusion protein (ubiquitin/ribosomal protein) NCU05315 Y Transcription hypothetical protein NCU05395 Y Transcription conserved hypothetical protein NCU05686 Y MS probable cell wall protein UTR2 NCU05751 Y Transcription related to acetylxylan esterase NCU05924 Y Transcription probable endo-beta-1,4-D-xylanase NCU05965 Y Transcription related to putative arabinase NCU05974 MS related to cell wall protein (putative glycosidase) NCU06364 Y Transcription hypothetical protein NCU06380 Y Transcription related to catecholamines up protein NCU06650 Y Transcription conserved hypothetical protein NCU06781 MS probable beta (1-3) glucanosyltransferase NCU06961 Y Transcription probable exopolygalacturonase NCU07067 MS related to class I alpha-mannosidase 1B NCU07143 Y Transcription NCU07190 Y Transcription related to cellulose 1,4-beta- cellobiosidase II precursor NCU07200 Y MS related to metalloprotease MEP1 NCU07225 Y Transcription probable endo-1,4-beta-xylanase B precursor NCU07281 MS probable glucose-6-phosphate isomerase NCU07787 Y MS probable SnodProt1 precursor NCU08131 Y Transcription probable alpha-amylase precursor NCU08171 Y MS conserved hypothetical protein NCU08189 Y Transcription related to endo-1,4-beta-xylanase NCU08384 MS probable D-xy lose reductase NCU08418 MS related to tripeptidyl-peptidase I NCU08457 Y Transcription hydrophobin Ccg-2 CCG-2 NCU08516 Y Transcription related to aldose 1-epi merase NCU08750 Y Transcription related to isoamyl alcohol oxidase NCU08752 Y Transcription related to esterase NCU08755 Y Transcription hypothetical protein NCU08909 Y MS probable beta (1-3) glucanosyltransferase gel3p NCU08936 MS related to sporulation-specific gene SPS2 NCU09024 Y MS related to choline dehydrogenase NCU09133 Y Transcription putative protein NCU09170 Y MS probable alpha-N-arabinofuranosidase NCU09175 Y Transcription related to glucan 1,3-beta-glucosidase precursor NCU09267 MS related to glyoxal oxidase precursor NCU09491 MS feruloyl esterase B precursor (subclass of the carboxylic acid esterases) NCU09923 Y Transcription related to xylan 1,4-beta-xy losidase NCU09924 Y Transcription conserved hypothetical protein NCU10040 Y Transcription NCU10045 Y Transcription
Samples were prepared as follows. 10 day old conidia were grown in 100 mL 2% xylan Vogel's media at 10⁶ conidia/mL. Two replicates were prepared for each strain. Cultures were grown at 25° C. with constant light and 220 rpm. Samples were harvested on day 4. Supernatants were isolated by centrifugation and used in assays.
Bradford protein concentrations were measured to determine the total amount of secreted protein. Stocks were prepared with BSA standards: 0 μg/mL, 50 μg/mL, 100 μg/mL, 250 μg/mL, and 500 μg/mL. Bradford solution was diluted 1:4. A multichannel pipette was used to pipette 200 μL of Bradford solution into a 96-well plate. 10 μL of sample and 10 μL of each standard were added. Samples were incubated at room temperature for 10 minutes. The absorbance was read at 595 nm, and the protein concentration was determined.
The assay used to measure xy lose was modified from Bailey et al., 1992 (J Biotech 23: 257-270). Xylose standards were prepared in H₂O. For concentrated 0.8 M xy lose (1.2 g in 10 mL), the standards included 0 mM, 8 mM (1:100 dilution; 990 μl+10 μl), 20 mM (1:100 dilution; 975 μl+25 μl), 40 mM (1:100 dilution; 950 μl+50 μl), 80 mM (1:100 dilution; 900 μl+100 μl), and 160 mM (1:100 dilution; 800 μl+200 μl). A multichannel pipette was used to add 900 μL of substrate solution to a deep well 96-well plate. The substrate was allowed to incubate at 50° C. for 10 minutes. One hundred μL of culture supernatant and the standards were added and allowed to incubate at 50° C. for 5 minutes. Samples were centrifuged for 10 minutes at 3,400 rpm. A multichannel pipette was used to pipette 75 μL DNS solution into a 96-well PCR plate. Five μL of solution was removed from the reaction and added to the PCR plate containing DNS solution. The plate was heated at 99° C. in the PCR machine for 5 min. After the samples cooled, they were transferred to clear flat-bottomed plates, and the absorbance was read at 540 nm. Substrate solution (500 mL) contained beechwood xylan (5 g; 10 mg/mL), 3M NaO Ac, pH 5.0 (8.33 mL; 50 mM), water (491 mL), and was autoclaved for 20 minutes. DNS solution (100 mL) contained 3,5-dinitrosalicylic acid (707 mg), NaOH (1.32 g), Rochelle salts (Na K tartrate) (20.4 g), Sodium meta-bisulfate (553 mg), phenol (507 μL), and water (94.4 mL).
Azo-endo-xylanase activity was measured with a kit from Megazyme. This assay indirectly measures the amount of endo-xylanase activity in a sample by spectrophotometrically measuring the amount of dye liberated from a xylan chain complexed with the dye. The more enzymes that are present, the more dye will be released. All supernatant samples were diluted 1:10 by adding 50 μL of supernatant to 450 μL of Na Acetate buffer (50 mM, pH 4.5) in separate 15 mL Falcon tubes. Next, Falcon tubes were pre-warmed about 10 minutes. Substrate solution was added for all samples (500 μL/sample) to the tubes. Samples and substrate solutions were added into a 40° C. water bath for 10 minutes to pre-equilibrate them. Five hundred μL substrate solution was added to each 1:10 diluted sample, vortexed for 10 seconds, and incubated at 40° C. for 10 minutes. The reaction was terminated by adding 2.5 mL of precipitant solution (95% ethanol) to each sample and vortexing for 10 seconds. Tubes were allowed to stand at room temperature for 10 minutes. Tubes were vortexed for 10 seconds and then centrifuged at room temperature for 10 minutes at 1,000 g. One mL of supernatant solution from each tube was placed directly into a cuvette, and the absorbance was measured at 590 nm. The blank used for this procedure was the supernatant from 500 μL substrate solution added to 2.5 mL of precipitant solution.
In conclusion, it is anticipated that the modulation of genes identified here that affect the degradation of hemicellulose in N. crassa will facilitate engineering strains that have enhanced capacity for plant cell wall breakdown and growth on plant cell wall components such as hemicellulose. Genes of interest include NCU01517, which encodes a predicted glucamylase; NCU02343, which encodes a predicted arabinofuranosidase; NCU05137, which encodes a conserved hypothetical protein; NCU05159, which encodes a predicted acetylxylan esterase precursor; NCU09133, which encodes a conserved hypothetical protein; and NCU10040, which encodes a hypothetical protein.
The growth of a cell on hemicellulose will be increased by providing a host cell that contains a recombinant polynucleotide that encodes a polypeptide encoded by NCU01517, NCU09133, or NCU10040. The host cell will be cultured in a medium that contains hemicellulose such that the recombinant polynucleotide is expressed. The host cell will grow at a faster rate in this medium than a cell that does not contain the recombinant polynucleotide.
Example 21 Further Analysis of the ΔNCU05137 Strain
As described in Examples 1-3 and 18-20, NCU05137 is a predicted secreted protein that was overexpressed during growth of N. crassa on any of Miscanthus, Avicel, or xylan. A deletion strain of N. crassa lacking NCU05137 grown on Avicel showed increased endoglucanase, β-glucosidase, and Avicelase activity. An NCU05137 deletion strain grown on xylan showed increased azo-endo-xylanase activity. As described in this example, the complementation of ΔNCU05137 was performed in order to verify that the phenotypes observed in the ΔNCU05137 strain were due to the loss of the NCU05137 gene.
A plasmid containing NCU05137 with a C-terminal GFP tag under the control of the cc gl promoter was generated. N. crassa conidia were transformed with the NCU05137-GFP construct. Experiments were performed according to standard Neurospora procedures (webpage fgsc.net/Neurospora/NeurosporaProt ocolGuide.htm).
The total secreted protein and carboxymethyl cellulase (CMC) activity of wild-type, ΔNCU05137, and ΔNCU05137-NCU05137-GFP strains was measured. Total secreted protein was measured by taking 100 μL of supernatant from a culture of each strain, adding it to 900 μL Bradford Dye, and measuring absorbance at 595 nm. CMC activity was measured with 20× diluted supernatant from each strain culture and an azo-CMC kit (Megazyme SCMCL). ΔNCU05137 knockout strains displayed increased levels of secreted protein and CMC activity. Introduction of the GFP-tagged NCU05137 into ΔNCU05137 strains reduced these levels back to wild-type levels (FIG. 78).
In addition, the localization of NCU05137-GFP in complemented strains was observed. NCU05137-GFP localized to the cell wall of conidia and to the hypha tip (FIG. 79-80). These data indicate that the GFP-tagged NCU05137 protein is fully functional and can be used for purification and experiments addressing the biochemical activity of this protein.
Thus, the normal function of NCU05137 may be to inhibit signaling processes associated with induction of cellulase and hemicellulase gene expression. Reduction of expression of NCU05137 or a homolog of NCU05137 in a cell is likely to increase cellulase and hemicellulase activity in that cell and, consequently, growth of the cell on cellulose or hemicellulose. The growth of a cell on cellulose or hemicellulose will be increased by providing a host cell that contains an endogenous polynucleotide that encodes a polypeptide encoded by NCU05137. The expression of the endogenous polynucleotide will be inhibited, and the cell will be cultured in a medium containing cellulose and/or hemicellulose. The host cell will grow at a faster rate in the medium than a cell in which expression of the endogenous polynucleotide is not inhibited.
Example 22 Further Analysis of NCU07705
Expression of NCU07705 was found to be upregulated during growth of N. crassa on cellulose. BLAST analysis of the polypeptide encoded by NCU07705 revealed that the polypeptide has high similarity to many C6 zinc finger domain containing transcription factors (FIG. 1). To further investigate the role of NCU07705 in the utilization of cellulose, the phenotype of a deletion strain lacking NCU07705 was evaluated.
The ΔNCU07705 strain was unable to grow on 2% cellulose (Avicel), PASC, or CMC as a sole carbon source (Table 30) but grew with similar kinetics to wild-type strain on sucrose, xylan, and xy lose. In order to determine whether NCU07705 plays a role in regulating expression of cellulases, the expression of cellulase and hemicellulase genes was examined during growth of ΔNCU07705 on cellulose. Ten-day-old conidia from wild-type (FGSC 2489) and ΔNCU07705 strains were inoculated into Vogel's liquid MM (2% sucrose) (Vogel 1956) and grown for 16 hours. Mycelia were centrifuged, washed with 1× Vogel's salts, and then transferred into either Vogel's media with 2% sucrose or 2% Avicel and grown in constant light for 4 hours. They were harvested by filtration and immediately frozen in liquid nitrogen. Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions and treated with DNase (Turbo DNA-free kit, Ambion/Applied Biosystems, Foster City, Calif.) (Kasuga et al., 2005). Chip Shot™ Indirect Labeling/Clean-Up System (Catalog No. Z4000, Promega, Madison, Wis.) and Cy Dye Post-Labeling Reactive Dye Pack (Catalog No. RPN5661, GE Healthcare, Piscataway, N.J.) were used to synthesize and label cDNA according to the manufacturer's instructions except the amount of RNA used was 10 μg. The Pronto! Hybridization Kit (Catalog No. 40076, Corning, Lowell, Mass.) was used for microarray hybridization according to the manufacturer's specifications.
Data analyses were performed as previously described (Tian et al., 2007). A GenePix 4000B scanner (Axon Instruments, Union City, Calif.) was used to acquire images, and GenePix Pro6 software was used to quantify hybridization signals and collect the raw data. Normalized expression values were analyzed by using BAGEL (Bayesian Analysis of Gene Expression Levels) (Townsend and Hartl, 2002). None of the predicted cellulase genes were induced in the ΔNCU07705 strain, whereas induction of predicted hemicellulase genes was unaffected (see Table 30 below). Thus, NCU07705 has been named cdr-1, cellulose degradation regulator 1.
Therefore, the growth of a cell on cellulose will be increased by providing a host cell that contains a recombinant polynucleotide that encodes a polypeptide encoded by NCU07705. The host cell will be cultured in a medium that contains cellulose such that the recombinant polynucleotide is expressed. The host cell will grow at a faster rate in this medium than a cell that does not contain the recombinant polynucleotide.
Table 30 shows expression profile of genes in N. crassa ΔNCU07705 strain
7705-switch² WT-switch¹ Gene/locus name GH Family Class up in Avi³ No 15 NCU00762 5 endo- 31.5 No No NCU03996 6 CBHII like No 168 NCU07190 6 CBHII like 119 No 26 NCU09680 6 CBHII 251.3 No 18 NCU04854 7 CBHI like 10.8 No 3.8 NCU05057 7 CBHI like 7.4 No No NCU05104 7 CBHI like No 93 NCU07340 7 CBHI 382.2 No 2 NCU05121 45 endo- 17.2 No 5.8 NCU00836 61 endo- 31 No 3.7 NCU01050 61 endo- 382.1 No No NCU01867 61 endo- No 49 NCU02240 61 endo- 84 No No NCU02344 61 endo- 4.1 No 6.1 NCU02916 61 endo- 17.7 No No NCU03000 61 endo- No 17 NCU03328 61 endo- 23.8 No No NCU05969 61 endo- 12.7 No No NCU07520 61 endo- No No NCU07760 61 endo- No 103 NCU07898 61 endo- 230 No No NCU07974 61 endo- No 25 NCU08760 61 endo- 44.7 ¹Expression levels of predicted cellulase genes from an N. crassa (NCU07705) culture grown in Vogel's/sucrose for 16 hours, filtered, and resuspended in Vogel's/Avicel for 4 hours prior to RAN extraction. ²Expression levels of predicted cellulase gene from an N. crassa (wild type FGSC 2489) culture grown in Vogel's/sucrose for 16 hours, filtered, and resuspended in Vogel's/sucrose for 4 hours prior to RNA extraction. ³Expression levels derived from microarray analyses of wild type (FGSC 2489) cells grown for 30 hours in Avicel (Tian et al., 2009).
REFERENCES
- Arendt, C. S., K. Ri, et al. (2007). “Genetic selection for a highly functional cysteine-less membrane protein using site saturation mutagenesis.” Anal Biochem 365(2):185-193. - Bai, F. W., W. A. Anderson, and M. Moo-Young (2008). “Ethanol fermentation technologies from sugar and starch feedstocks.” Biotechnol Adv 26(1): 89-105. - Bailey, M. J., P. Bi ely, and K. Poutanen (1992). “Interlaboratory testing of methods for assay of xylanase activity.” J Biotechnol 23:257-270. - Bailey, J. E. and D. F. Olliis (1986). Biochemical Engineering Fundamentals, McGraw-Hill Book Company, NY. - Basso, L. C., H. V. de Amorim, et al. (2008). “Yeast selection for fuel ethanol production in Brazil.” FEMS Yeast Res 8(7):1155-1163. - Becker, D. M. and V. Lundblad (2001). “Introduction of DNA into yeast cells.” Curr Prot oc Mol Biol Chapter 13, Unit13.7. - Bendtsen, J. D., H. Nielsen, et al. (2004). “Improved prediction of signal peptides: SignalP 3.0.” J. Mol. Biol 340(4):783-95. - Bengsston, O., B. Hahn-Hägerdal, and M. F. Gorwa-Grauslund (2009). “Xylose reductase from Pichia stipitis with altered coenzyme preference improves ethanolic xy lose fermentation by recombinant Saccharomyces cerevisiae.” Biotechnol Biofuels 2:9. - Bhat, K. M. and R. Maheshwari (1987). “Sporotrichum thermophile Growth, Cellulose Degradation, and Cellulase Activity.” Appl Environ Microbiol 53(9):2175-2182. - Bouffard, G. G., K. E. Rudd, and S. L. Adhya (1994). “Dependence of lactose metabolism upon mutarotase encoded in the gal operon in Escherichia coli.” J Mol Biol 244(3):269-278. - Bouws, H, A. Wattenberg and H. Zorn (2008). “Fungal secretomes—nature's toolbox for white biotechnology.” Appl Microbiol Biotechnol 80(3):381-388. - Brat, D., E. Boles, and B. Wiedemann (2009). “Functional Expression of a Bacterial Xylose Isomerase in Saccharomyces cerevisiae.” Appl Environ Microbiol 75(8):2304-2311. - Canevascini, G. (1988). “Cellobiose dehydrogenase from Sporotrichum thermophile.” Method Enzymol 160:443-448. - Cantarel, B. L., P. M. Coutinho, et al. (2009). “The Carbohydrate-Active EnZymes database (CAZy): an expert resource for glycogenomics.” Nucleic Acids Res 37(Database issue):D233-238. - Chauve, M., H. Mathis, et al. (2010). “Comparative kinetic analysis of two fungal beta-glucosidases.” Biotechnol Biofuels 3(1):3. - Christakopoulos, P., M. K. Bhat, et al. (1994). “Enzymatic synthesis of trisaccharides and alkyl beta-D-glucosides by the transglycosylation reaction of beta-glucosidase from Fusarium oxysporum.” Int J Biol Macromol 16(6):331-334. - Christianson, T. W., R. S. Sikorskim, et al., (1992). “Multifunctional yeast high-copy number shuttle vectors.” Gene, 110(1):119-122. - Chu, B. C. and H. Lee (2007). “Genetic improvement of Saccharomyces cerevisiae for xy lose fermentation.” Biotechnol Adv 25(5):425-441. - Co lot, H. V., G. Park, et al. (2006). “A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors.” Proc Natl Acad Sci USA 103(27):10352-10357. - Cullen, D., L. J. Wilson, et al. (1987). “Sequence and centromere proximal location of a transformation enhancing fragment ans1 from Aspergillus nidulans.” Nucleic Acids Res 15(22):9163-9175. - Davies, G. J., A. M. Brzozowski, et al. (2000). “Structure and function of Humicola insolens family 6 cellulases: structure of the endoglucanase, Ce16B, at 1.6 A resolution.” Biochem J 348 Pt 1:201-207. - Davis, R. H. (2000). “Neurospora: Contributions of a model organism.” New York, Oxford University Press. - Davis, R. H. and D. D. Perkins (2002). “Timeline: Neurospora: a model of model microbes.” Nat Rev Genet 3(5):397-403. - de Groot, M. J., W. Prathumpai, et al. (2005). “Metabolic control analysis of Aspergillus niger L-arabinose catabolism.” Biotechnol Prog 21(6):1610-1616. - Dementhon K, G. Iyer, and N. L. Glass (2006). “VIB-1 is required for expression of genes necessary for programmed cell death in Neurospora crassa.” Eukaryot Cell 5(12):2161-2173. - Doran-Peterson, J., A. Jan gid, et al. (2009). “Simultaneous saccharification and fermentation and partial saccharification and co-fermentation of lignocellulosic biomass for ethanol production.” Methods Mol Biol 581:263-280. - Drissen, R. E. T., R. H. W. Mass, et al. (2009). “Modelling ethanol production from cellulose: separate hydrolysis and fermentation versus simultaneous saccharification and fermentation.” Biocatal Biotransfor 27(1):27-35. - Dunlap, J. C., K. A. Borkovich, et al. (2007). “Enabling a Community to Dissect an Organism: Overview of the Neurospora Functional Genomics Project.” Adv Genet 57:49-96. - du Preez, J. C., M. Bosch, and B. A. Prior (1986). “The fermentation of hexose and pentose sugars by Candida shehatae and Pichia stipitis.” Appl Microbiol Biotechnol 23(3):228-233. - Eberhart, B. M., R. S. Beck, et al. (1977). “Cellulase of Neurospora crassa.” J Bacteriol 130(1):181-186. - Ellis, K. J. and J. F. Morrison (1982). “Buffers of constant ionic strength for studying pH-dependent processes.” Methods Enzymol 87:405-426. - Espagne, E., O. Lespinet, et al. (2008). “The genome sequence of the model ascomycete fungus Podospora anserina.” Genome Biol 9(5):R77. - Fonseca, C. R. Romao, et al. (2007). “L-Arabinose transport and catabolism in yeast.” FEBS J 274(14):3589-3600. - Freer, S. N. (1991). “Fermentation and aerobic metabolism of cellodextrins by yeasts.” Appl Environ Microbiol 57(3):655-659. - Freer, S. N. and R. V. Greene (1990). “Transport of glucose and cellobiose by Candida wickerhamii and Clavispora lusitaniae.” J Biol Chem 265(22):12864-12868. - Gala gan, J. E., S. E. Calvo, et al. (2003). “The genome sequence of the filamentous fungus Neurospora crassa.” Nature 422(6934):859-868. - Gems, D., I. L. Johnstone, and A. J. Clutterbuck (1991). “An autonomously replicating plasmid transforms Aspergillus nidulans at high frequency.” Gene 98(1):61-67. - Guindon, S. and O. Gascuel (2003). “A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.” Syst Biol 52(5):696-704. - Hahn-Hägerdal, B., K. Karhumaa, et al. (2007). “Towards industrial pentose-fermenting yeast strains.” Appl Microbiol Biotechnol 74(5):937-953. - Hector, R. E., N. Qureshi et al. (2008). “Expression of a heterologous xy lose transporter in a Saccharomyces cerevisiae strain engineered to utilize xy lose improves aerobic xy lose consumption.” Appl Microbiol Biotechnol 80(4):675-684. - Himmel, M. E., S. Y. Ding, et al. (2007). “Biomass recalcitrance: engineering plants and enzymes for biofuels production.” Science 315(5813):804-807. - Hosaka, K., J. Nik awa, et al., (1992). “A dominant mutation that alters the regulation of INO1 expression in Saccharomyces cerevisiae.” J Biochem 111(3):352-358. - Jacobson, D. J., A. J. Powell, et al. (2004). “Neurospora in temperate forests of western North America.” Mycologia 96(1):66-74. - Jeffries, T. W., I. V. Grigoriev, et al. (2007). “Genome sequence of the lignocellulose-bio converting and xy lose-fermenting yeast Pichia stipitis.” Nat Biotechnol 25(3):319-326. - Kasuga, T. and N. L. Glass (2008). “Dissecting colony development of Neurospora crassa using mRNA profiling and comparative genomics approaches.” Eukaryot Cell 7(9): 1549-64. - Kasuga, T., J. P. Townsend, et al. (2005). “Long-oligomer microarray profiling in Neurospora crassa reveals the transcriptional program underlying biochemical and physiological events of conidial germination.” Nucleic Acids Res 33(20): 6469-85. - Katahira, S., M. Ito, et al. (2008). “Improvement of ethanol productivity during xy lose and glucose co-fermentation by xy lose-assimilating S. cerevisiae via expression of glucose transporter Sut1.” Enzyme Microb Tech 43(2):115-119. - Katahira, S., A. Mizuike, et al. (2006). “Ethanol fermentation from lignocellulosic hydrolysates by a recombinant xy lose- and cellooligosaccharide-assimilating yeast strain.” Appl Microbiol Biotechnol 72(6): 1136-1143. - Korkhin, Y., A. J. Kalb (Gilboa), et al. (1998). “NADP-dependent bacterial alcohol dehydrogenases: crystal structure, cofactor-binding and cofactor specificity of the ADHs of Clostridium beijerinckii and Thermoanaerobacter brock ii.” J Mol Biol 278(5):967-981. - Kota ka, A., H. Bando, et al. (2008). “Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanases.” J Biosci Bioeng 105(6):622-627. - Kötter, P. and M. Ciriacy (1993). “Xylose fermentation by Saccharomyces cerevisiae.” Appl Microbiol Biotechnol 38(6):776-783. - Kubicek, C. P., R. Messner, et al. (1993). “Triggering of cellulase biosynthesis by cellulose in Trichoderma reesei. Involvement of a constitutive, sophorose-inducible, glucose-inhibited beta-diglucoside permease.” J Biol Chem 268(26):19364-19368. - Kumar, R., S. Singh, and O. V. Singh (2008). “Bioconversion of lignocellulosic biomass: biochemical and molecular perspectives.” J Ind Microbiol Biotechnol 35(5):377-391. - Kuyper, M, H. R. Harhangi, et al. (2003). “High-level functional expression of a fungal xy lose isomerase: the key to efficient ethanolic fermentation of xy lose by Saccharomyces cerevisiae? FEMS Yeast Res 4(1):69-78. - Lang, J. M. and V. P. Cirillo (1987). “Glucose transport in a kinase less Saccharomyces cerevisiae mutant.” J Bacteriol 169(7):2932-2937. - Leandro, M. J., P. Goncalves, and I. Spencer-Martins (2006). “Two glucose/xy lose transporter genes from the yeast Candida intermedia: first molecular characterization of a yeast xy lose-H+ sym porter.” Biochem J 395(3):543-549. - Linder, M. and T. T. Tee ri (1996). “The cellulose-binding domain of the major cellobiohydrolase of Trichoderma reesei exhibits true reversibility and a high exchange rate on crystalline cellulose.” Proc Natl Acad Sci USA 93(22):12251-12255. - Lynd, L. R., M. S. Laser, et al. (2008). “How biotech can transform biofuels.” Nat. Biotechnol. 26(2):169-172. - Lynd, L. R., P. J. Weimer, et al. (2002). “Microbial cellulose utilization: fundamentals and biotechnology.” Microbiol Mol Biol Rev 66(3):506-77, table of contents. - Madhavan, A., S. Tamalampudi, et al. (2009). “Xylose isomerase from polycentric fungus orpinomyces: gene sequencing, cloning, and expression in Saccharomyces cerevisiae for bioconversion of xy lose to ethanol.” Appl Microbiol Biotechnol 82(6):1067-1078. - Martin, F., A. Kohler, et al. (2010). “Périgord black truffle genome uncovers evolutionary origins and mechanisms of symbiosis.” Nature 464(7291):1033-1038. - Martinez, D., R. M. Berka, et al. (2008). “Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina).” Nat Biotechnol 26(5):553-60. - Martinez, D., J. Callacombe, et al. (2009). “Genome, transcriptome, and secretome analysis of wood decay fungus Post ia placenta supports unique mechanisms of lignocellulose conversion.” Proc Natl Acad Sci USA 106(6):1954-1959. - Martinez, D., L. F. Larrondo, et al. (2004). “Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78.” Nat Biotechnol 22(6):695-700. - Matsushika, A., S. Watanabe, et al. (2008). “Expression of protein engineered NADP+-dependent xylitol dehydrogenase increases ethanol production from xy lose in recombinant Saccharomyces cerevisiae.” Appl Microbiol Biotechnol 81(2):243-255. - Matteucci, M. D. and M. H. Caruthers (1980). Tetrahedron Lett 21:719-722. - McCluskey, K. (2003). “The Fungal Genetics Stock Center: from molds to molecules.” Adv Appl Microbiol 52:245-262. - Med ve, J., J. Karlsson, et al. (1998). “Hydrolysis of microcrystalline cellulose by cellobiohydrolase I and endoglucanase II from Trichoderma reesei: adsorption, sugar production pattern, and synergism of the enzymes.” Biotechnol Bioeng 59(5):621-34. - Miyasaka, H. (1999). “The positive relationship between codon usage bias and translation initiation AUG context in Saccharomyces cerevisiae.” Yeast 15(8):633-637. - Nair, N. and H. Zhao (2007). “Biochemical characterization of an L-Xylulose reductase from Neurospora crassa.” Appl Environ Microbiol 73(6):2001-2004. - Nakamura, N., R. Yamada, et al. (2008). “Effective xy lose/cellobiose co-fermentation and ethanol production by xy lose-assimilating S. cerevisiae via expression of β-glucosidase on its cell surface.” Enzyme Microb Tech 43(3):233-236. - Noguchi, Y., M. Sano, et al. (2009). “Genes regulated by AoXlnR, the xylanolytic and cellulolytic transcriptional regulator, in Aspergillus oryzae.” Appl Microbiol Biotechnol 85(1):141-154. - Notre dame, C., D. G. Higgins, and J. Heringa (2000). “T-Coffee: A novel method for fast and accurate multiple sequence alignment.” J Mol Biol 302(1):205-217. - Pandit, A. and R. Maheshwari (1996). “Life-history of Neurospora intermedia in a sugar cane field.” J Biosci (Bangalore) 21(1):57-79. - Pauly, T. A., J. L. Ekstrom, et al. (2003). “X-ray crystallographic and kinetic studies of human sorbitol dehydrogenase.” Structure 11(9):1071-1085. - Pedelacq, J. D., S. Cabantous, et al. (2006). “Engineering and characterization of a super folder green fluorescent protein.” Nat Biotechnol 24(1):79-88. - Perkins, D. D., B. C. Turner, et al. (1976). “Strains of Neurospora collected from nature.” Evolution 30: 281-313. - Ramos, J., K. Szkutnicka, and V. P. Cirillo (1988). “Relationship between low- and high-affinity glucose transport systems of Saccharomyces cerevisiae.” J Bacteriol 170(11):5375-5377. - Rawat, U. and M. Rao (1997). “Site and significance of cysteine residues in xy lose reductase from Neurospora crassa as deduced by fluorescence studies.” Biochemical and Biophysical Research Communications 239(3): 789-93. - Reifenberger E., E. Boles, and M. Ciriacy (1997). “Kinetic characterization of individual hexose transporters of Saccharomyces cerevisiae and their relation to the triggering mechanisms of glucose repression.” Eur J Biochem 245(2):324-333. - Romero, M. D., J. Aguado, et al. (1999). “Cellulase production by Neurospora crassa on wheat straw.” Enzyme Microb Tech 25: 244-250. - Roy, A., A. Kucukural, and Y. Zhang (2010). “I-TASSER: a unified platform for automated protein structure and function prediction.” Nat Prot oc 5(4):725-738. - Rubin E. M. (2008). “Genomics of cellulosic biofuels.” Nature 454(7206):841-845. - Ruepp, A., A. Zollner, et al. (2004). “The FunCat, a functional annotation scheme for systematic classification of proteins from whole genomes.” Nucleic Acids Res 32(18):5539-5545. - Runquist, D., C. Fonseca, et al. (2009). “Expression of the Gxf1 transporter from Candida intermedia improves fermentation performance in recombinant xy lose-utilizing Saccharomyces cerevisiae.” Appl Microbiol Biotechnol 82(1): 123-130. - Runquist, D., B. Hahn-Hägerdal, and P. R{dot over (a)}dström (2010). “Comparison of heterologous xy lose transporters in recombinant Saccharomyces cerevisiae.” Biotechnol Biofuels 3:5. - Saha, B. C. (2003). “Hemicellulose bioconversion.” J Ind Microbiol Biotechnol 30:279-291. - Saloheimo, A., J. Rauta, et al. (2007). “Xylose transport studies with xy lose-utilizing Saccharomyces cerevisiae strains expressing heterologous and homologous permeases.” Appl Microbiol Biotechnol 74(5):1041-1052. - Sarkar, G. and S. S. Sommer (1990). “The “mega primer” method of site-directed mutagenesis.” Biotechniques 8(4):404-407. - Sauer, U. (2001). “Evolutionary engineering of industrially important microbial phenotypes.” Adv Biochem Eng Biotechnol 73:129-169. - Scarborough, G. A. (1973). “Transport in Neurospora.” Int Rev Cytol 34:103-122. - Sei both B, S. Hakola, et al. (1997). “Role of four major cellulases in triggering of cellulase gene expression by cellulose in Trichoderma reesei.” J Bacteriol 179(17):5318-5320. - Seidl, V., C. Gam auf, et al. (2008). “The Hypocrea jecorina (Trichoderma reesei) hypercellulolytic mutant RUT C30 lacks a 85 kb (29 gene-encoding) region of the wild-type genome.” BMC Genomics 9:327. - Shao, Z., H. Zhao, and H. Zhao (2009). “DNA assembler, an in vivo genetic method for rapid construction of biochemical pathways.” Nucleic Acids Res. 37(2):e16. - Sikorski, R. S. and P. Hieter (1989). “A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.” Genetics 122(1):19-27. - Skory, C. D., S. N. Freer, and R. J. Both ast (1996). “Expression and secretion of the Candida wickerhamii extracellular beta-glucosidase gene, bg lB, in Saccharomyces cerevisiae.” Curr Genet 30(5):417-422. - Smith, M. L., O. C. Micali, et al. (2000). “Vegetative incompatibility in the het-6 region of Neurospora crassa is mediated by two linked genes.” Genetics 155(3):1095-1104. - Stambuk, B. U., M. A. Fran den, et al. (2003). “D-Xylose transport by Candida succiphila and Kluyveromyces marxianus.” Appl Biochem Biotechnol 105-108:255-263. - Stephanopoulos, G. (2007). “Challenges in Engineering Microbes for Biofuels Production.” Science 315(5813):801-804. - Stricker A. R., R. L. Mach and L. H. de Graaff (2008). “Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei).” Appl Microbiol Biotechnol 78(2):211-220. - Sullivan, R. and H. Zhao (2007). “Cloning, characterization, and mutational analysis of a highly active and stable L-arabinitol 4-dehydrogenase from Neurospora crassa.” Appl Microbiol Biotechnol 77(4):845-52. - Sun Y. and J. Cheng (2002). “Hydrolysis of lignocellulosic materials for ethanol production: a review.” Bioresource Technol 83(1):1-11. - Suominen P. L., A. L. Mantyla, et al. (1993). “High frequency one-step gene replacement in Trichoderma reesei. II. Effects of deletions of individual cellulase genes.” Mol Gen Genet 241(5-6):523-530. - Tian, C., W. T. Beeson, et al. (2009). “Systems analysis of plant cell wall degradation by the model filamentous fungus Neurospora crassa.” Proc Natl Acad Sci USA 106(52):22157-22162. - Tian, C., T. Kasuga, et al. (2007). “Transcriptional profiling of cross pathway control in Neurospora crassa and comparative analysis of the Gcn4 and CPC1 regulons.” Eukaryot Cell 6(6): 1018-1029. - Townsend J. P. (2004). “Resolution of large and small differences in gene expression using models for the Bayesian analysis of gene expression levels and spotted DNA microarrays.” BMC Bioinformatics 5:54. - Townsend J. P. and D. L. Hartl (2002). “Bayesian analysis of gene expression levels: statistical quantification of relative mRNA level across multiple strains or treatments.” Genome Biol 3(12):research0071.1-0071.16. - USDA, The Economic Feasibility of Ethanol Production from Sugar in the United States, United States Department of Agriculture (2006). - van Rooyen, R., B. Hahn-Hägerdal, et al. (2005). “Construction of cellobiose-growing and fermenting Saccharomyces cerevisiae strains.” J Biotechnol 120(3):284-295. - Vogel, H. J. (1956). “A convenient growth medium for Neurospora.” Microbiol. Genet. Bull. 13:42-46. - Wagner, S., M. L. Bader, et al. (2006). “Rationalizing membrane protein overexpression.” Trends Biotechnol 24(8):364-371. - Watanabe, S., A. Abu Saleh, et al. (2007). “Ethanol production from xy lose by recombinant Saccharomyces cerevisiae expressing protein-engineered NADH-preferring xy lose reductase from Pichia stipitis.” Microbiology 153(Pt 9):3044-3054. - Watanabe, S., T. Kodak i, and K. Makino (2005a). “L-Arabinose 1-dehydrogenase: a novel enzyme involving in bacterial L-arabinose metabolism.” Nucleic Acids Symp Ser (Oxf) 49:309-310. - Watanabe, S., T. Kodak i, and K. Makino (2005b). “Complete reversal of coenzyme specificity of xylitol dehydrogenase and increase of thermostability by the introduction of structural zinc.” J Biol Chem 280(11):10340-10349. - Wiedemann, B. and E. Boles (2008). “Codon-optimized bacterial genes improve L-arabinose fermentation in recombinant Saccharomyces cerevisiae.” Appl Environ Microbiol 74(7):2043-2050. - Wisselink, H. W., M. J. Toirkens, et al. (2007). “Engineering of Saccharomyces cerevisiae for efficient anaerobic alcoholic fermentation of L-arabinose.” Appl Environ Microbiol 73(15):4881-4891. - Wisselink, H. W., M. J. Toirkens, et al. (2009). “Novel Evolutionary Engineering Approach for Accelerated Utilization of Glucose, Xylose, and Arabinose Mixtures by Engineered Saccharomyces cerevisiae Strains.” Appl Environ Microbiol 75(4):907-914. - Woody er, R., M. Simurdiak, et al. (2005). “Heterologous expression, purification, and characterization of a highly active xy lose reductase from Neurospora crassa.” Appl Environ Microbiol 71(3): 1642-7. - Wymelenberg, A. V., et al. (2009). “Transcriptome and Secretome Analyses of Phanerochaete Chrysosporium Reveal Complex Patterns of Gene Expression.” Appl Environ Microbiol 75(12):4058-4068. - Xin, Z, Q. Yin bo, and G. Pei ji. (1993). “Acceleration of ethanol production from paper mill waste fiber by supplementation with β-glucosidase.” Enzyme Microb Tech 15(1):62.
1.-19. (canceled)
20. A method of increasing transport of cellodextrin into a cell, comprising: culturing a host cell which comprises a recombinant polynucleotide encoding a cellodextrin transporter polypeptide in a medium such that the recombinant polynucleotide is expressed, said cellodextrin transporter having the structure of a Major Facilitator Superfamily protein and comprising transmembrane α-helix 1, α-helix 2, α-helix 3, α-helix 4, α-helix 5, α-helix 6, α-helix 7, α-helix 8, α-helix 9, α-helix 10, α-helix 11, α-helix 12, said transmembrane α-helix 5 characterized by: an arginine at the position corresponding to amino acid 1 of SEQ ID NO:4; a tyrosine or phenylalanine at a position corresponding to amino acid 7 of SEQ ID NO:4; and an asparagine at a position corresponding to amino acid 8 of SEQ ID NO:4; wherein expression of the recombinant polynucleotide results in increased transport of cellodextrin into the cell compared with a cell that does not comprise the recombinant polynucleotide.
21. The method of claim 20 wherein the polypeptide comprises an amino acid sequence having at least 29%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% amino acid identity to NCU00801 or NCU08114.
22. The method of claim 20 wherein the host cell further comprises a second recombinant polynucleotide encoding at least a catalytic domain of a β-glucosidase.
23. The method of claim 22 wherein the β-glucosidase is from Neurospora crassa.
24. The method of claim 23 wherein the β-glucosidase is encoded by NCU00130.
25. The method of claim 20 wherein the host cell further comprises one or more recombinant polynucleotides wherein the one or more polynucleotides encode one or more enzymes selected from one or more of the group consisting of L-arabinose isomerase, L-ribulokinase, L-ribulose-5-P 4 epi merase, xy lose isomerase, xylulokinase, aldose reductase, L-arabinitol 4-dehydrogenase, L-xylulose reductase, and xylitol dehydrogenase.
26. The method of claim 20, wherein the host cell further comprises a second recombinant polynucleotide wherein the second recombinant polynucleotide encodes a pentose transporter.
27. The method of claim 26, wherein the pentose transporter is selected from the group consisting of NCU00821, NCU04963, NCU06138, STL12/XUT6, SUT2, SUT3, XUT1, and XUT3.
28. The method of claim 20 wherein the medium comprises a cellulase-containing enzyme mixture from an altered organism, wherein the cellulase-containing mixture has reduced β-glucosidase activity compared to a cellulase-containing mixture from an unaltered organism.
29. The method of claim 20, wherein the host cell is selected from the group consisting of Saccharomyces sp., Saccharomyces cerevisiae, Saccharomyces monacensis, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces carlsbergensis, Saccharomyces pombe, Kluyveromyces sp., Kluyveromyces marxiamus, Kluyveromyces lactis, Kluyveromyces fragilis, Pichia stipitis, Sporotrichum thermophile, Candida shehatae, Candida tropicalis, Neurospora crassa, Zymomonas mobilis, Clostridium sp., Clostridium phytofermentans, Clostridium thermocellum, Clostridium beijerinckii, Clostridium acetobutylicum, Moorella thermoacetica, Escherichia coli, Klebsiella oxytoca, Thermoanaerobacterium saccharolyticum, and Bacillus subtilis.
30. The method of claim 20 wherein the cellodextrin is selected from one or more of the group consisting of cellobiose, cellotriose, and cellotetraose.
31. The method of claim 21, wherein the polypeptide comprises an amino acid sequence having at least 85% amino acid identity to NCU00801.
32. The method of claim 21, wherein the polypeptide comprises an amino acid sequence having at least 85% amino acid identity to NCU08114.
33. The method of claim 21, wherein the polypeptide comprises an amino acid sequence having at least 90% amino acid identity to NCU00801.
34. The method of claim 21, wherein the polypeptide comprises an amino acid sequence having at least 90% amino acid identity to NCU08114.
35. The method of claim 21, wherein the polypeptide comprises an amino acid sequence having at least 95% amino acid identity to NCU00801.
36. The method of claim 21, wherein the polypeptide comprises an amino acid sequence having at least 95% amino acid identity to NCU08114.
|
Today in OpenGov: Where’s your press pass?
by
Editor's note: Today in OpenGov will be taking another brief hiatus for the next couple of weeks. We'll be back after Memorial Day with all the latest news. On that note, today marks your last chance to take our reader survey. Your feedback will help us continue to provide the best, most comprehensive #OpenGov newsletter in the game!
In today's edition, a new police misconduct database highlights a lack of accountability, the FEC reveals its internal conflict to Congress, the White House revokes many permanent press passes, and more.
states and cities
Image credit: Tony Webster.
• LAPD official behind controversial data programs retiring to pursue lucrative contracts working with other cities. "The architect behind the Los Angeles Police Department’s widely hailed but controversial data-driven crime-fighting tools is leaving the agency next week to help expand similar programs in other cities. Deputy Chief Sean Malinowski spent years pushing the LAPD to the forefront of how police agencies analyze data to target crime. His departure, though, comes amid the overhaul of a program he helped implement more than eight years ago to predict locations of property crimes after questions were raised about its effectiveness and whether black and Latino communities are unfairly targeted. A 25-year veteran, Malinowski said he plans to work part time at the University of Chicago and run his own company, which won a $635,000 contract in March with the Baltimore Police Department." (Los Angeles Times)
• New database shares more than 200,000 police misconduct records. "USA Today has scored a coup. It has partnered with police accountability nonprofit Invisible Institute to obtain misconduct records from around the nation. These paint a pretty bleak picture of American policing — not just in the number of incidents, but in the number of incidents that go unpunished. Public records requests have resulted in thousands of documents detailing at least 200,000 incidents of alleged misconduct, along with more than 100,000 internal investigations. The database is completely searchable and leads readers, reporters, researchers, etc. directly to the underlying documents." (TechDirt)
• States contribute images of 270,000 miles of highway to safety database. "Hundreds of thousands of miles of roadways in Arizona and a number of other states are part of a growing network of images detailing guardrails, street-signage, striping and other features central to understanding and improving highway safety. Mapillary, a hosting platform for street-level imagery, has some 40 million images from 270,000 miles of roadways from state transportation departments in Utah, Florida, Arizona, Connecticut and Vermont. The images have been processed with "computer vision” to identify key items like signage and striping. The data is used by DOTs to examine any given stretch of highway for safety, suitability and other criteria." (Government Technology)
• Judge finds South Dakota's out-of-state donor ban unconstitutional. "A federal judge has ruled unconstitutional South Dakota Initiated Measure 24, a state law which would have banned Americans from other states from contributing to ballot measure campaigns in South Dakota. The Institute for Free Speech and former South Dakota Attorney General Marty Jackley represented a coalition of trade associations, an advocacy group, and a former South Dakota resident in a challenge to the law." (via Election Law Blog)
washington watch
Federal Election Commission commissioners on June 27, 2018. Image credit: Ashley Balcerzak/Center for Public Integrity.
• FEC commissioners lay out conflicting views of the organization's problems in letters to Congress. "The Federal Election Commission’s four leaders are offering lawmakers clashing perspectives on the agency’s very purpose…The FEC commissioners’ comments are part of 171 pages’ worth of responses to dozens of questions Committee on House Administration Chairwoman Zoe Lofgren, D-Calif., sent the FEC on April 1. The Center for Public Integrity on Thursday obtained the FEC responses, dated May 1, from the Committee on House Administration. Commissioners at the FEC — an independent, bipartisan agency tasked with enforcing and regulating federal campaign finance laws — had refused the Center for Public Integrity’s requests to review their responses." (Center for Public Integrity)
• Prosecutors charged a former intelligence analyst with leaking classified information to a reporter, continuing a trend. "Federal prosecutors in Virginia charged a former United States intelligence analyst with providing classified information to a reporter, according to unsealed court documents. Daniel Everette Hale, 31, of Nashville was arrested Thursday morning and was expected to make an initial appearance in federal court in Nashville. He was charged under the Espionage Act and with theft of government property…Mr. Hale’s case is the latest example of the Justice Department’s efforts to find and prosecute officials who provide reporters with sensitive information, an aggressive approach dating to the George W. Bush administration. The number of leak cases accelerated under President Barack Obama, and the heightened pace has continued under President Trump." (New York Times)
• Federal IT leaders are struggling to deal with "dark data" that they don't even know exists at their agencies. "Most IT managers agree finding and capturing dark and grey data should be a top priority, but antiquated policies and lack of senior-level support remain major hurdles. Dark data describes all the unknown and therefore unused data across an agency, while grey data is known but unused." (FedScoop)
trumpland
Image credit: Bill Hennessy/CNN.
• New rules at the White House have forced a significant chunk of the White House press corps to hand in their hard passes. "In what appears to be an unprecedented move, the White House revoked the press passes of a significant chunk of the Washington press corps because they didn’t meet a new standard, according to Washington Post columnist Dana Milbank. Under the new rules, rolled out earlier this year, in order to qualify for the highest level of access—known as a “hard pass”—journalists had to be present in the White House for at least 90 days out of a 180-day period." (Columbia Journalism Review)
• President Trump's top housing watchdog is trying to ease fines that he helped big banks fight while in the private sector. "Brian Montgomery spent years helping lenders fight fines for faulty mortgage underwriting before President Donald Trump nominated him to run a key housing agency. Now that he leads the Federal Housing Administration, Montgomery is pursuing policies that could make such penalties far less likely." (Bloomberg)
• President Trump set to nominate acting-Defense Secretary Patrick Shanahan to fill the role for real after he was cleared in an ethics inquiry by the Pentagon IG. "President Trump will nominate Patrick M. Shanahan as his second defense secretary, trying to cement the acting Pentagon chief against an expected challenging battle with lawmakers and Defense Department officials skeptical of him, White House officials said on Thursday. The announcement, in a tweet from Sarah Huckabee Sanders, the White House press secretary, followed a monthlong Pentagon ethics investigation that found that Mr. Shanahan, a former Boeing executive, had not acted improperly in official meetings when discussing military contractors." (New York Times)
• The latest Trump administration conflicts of interest include new subpoenas, old losses, and a rare contempt charge. "This week, the public receives the clearest picture yet of President Donald Trump’s finances and it shows huge losses, the House Judiciary Committee votes to hold Attorney General William Barr in contempt of Congress and Donald Trump Jr. is subpoenaed." (Sunlight Foundation)
Tired of your boss/friend/intern/uncle forwarding you this email every morning? You can sign up here and have it delivered direct to your inbox! Please send questions, comments, tips, and concerns to<EMAIL_ADDRESS>We would love your feedback!
|
<?php
defined('BASEPATH') or exit('No direct script access allowed');
class Category extends CI_Controller
{
public function __construct()
{
parent::__construct();
$this->get_user();
}
public function add_category()
{
$data = array();
$data['maincontent'] = $this->load->view('admin/pages/add_category', '', true);
$this->load->view('admin/master', $data);
}
public function manage_category()
{
$data = array();
$data['all_categroy'] = $this->category_model->getall_category_info();
$data['maincontent'] = $this->load->view('admin/pages/manage_category', $data, true);
$this->load->view('admin/master', $data);
}
public function save_category()
{
$data = array();
$data['category_name'] = $this->input->post('category_name');
$title = strip_tags($this->input->post('category_name'));
$urlslug = strtolower(url_title($title));
$q = $this->db->select()->where('category_slug',$urlslug)->get('categories_table');
if($q->num_rows()){ $titleURL = $urlslug.'-'.time();}
else{$titleURL = $urlslug;}
$data['category_slug'] = $titleURL;
$data['category_description'] = $this->input->post('category_description');
$data['publication_status'] = $this->input->post('publication_status');
$this->form_validation->set_rules('category_name', 'Category Name', 'trim|required');
$this->form_validation->set_rules('category_description', 'Category Description', 'trim');
$this->form_validation->set_rules('publication_status', 'Publication Status', 'trim|required');
if (!empty($_FILES['category_image']['name'])) {
$config['upload_path'] = './uploads/';
$config['allowed_types'] = '*';
$config['max_size'] = 4096;
$config['max_width'] = 2000;
$config['max_height'] = 2000;
$this->upload->initialize($config);
if (!$this->upload->do_upload('category_image')) {
$error = $this->upload->display_errors();
$this->session->set_flashdata('message', $error);
redirect('add/category');
} else {
$post_image = $this->upload->data();
$data['category_image'] = $post_image['file_name'];
}
}
if ($this->form_validation->run() == true) {
$result = $this->category_model->save_category_info($data);
if ($result) {
$this->session->set_flashdata('message', 'Category Inseted Sucessfully');
redirect('manage/category');
} else {
$this->session->set_flashdata('message', 'Category Inserted Failed');
redirect('manage/category');
}
} else {
$this->session->set_flashdata('message', validation_errors());
redirect('add/category');
}
}
public function delete_category($id)
{
$result = $this->category_model->delete_category_info($id);
if ($result) {
$this->session->set_flashdata('message', 'Category Deleted Sucessfully');
redirect('manage/category');
} else {
$this->session->set_flashdata('message', 'Category Deleted Failed');
redirect('manage/category');
}
}
public function edit_category($id)
{
$data = array();
$data['category_info_by_id'] = $this->category_model->edit_category_info($id);
$data['maincontent'] = $this->load->view('admin/pages/edit_category', $data, true);
$this->load->view('admin/master', $data);
}
public function update_category($id)
{
$data = array();
$data['category_name'] = $this->input->post('category_name');
$data['category_description'] = $this->input->post('category_description');
$data['publication_status'] = $this->input->post('publication_status');
$category_delete_image = $this->input->post('category_delete_image');
$delete_image = substr($category_delete_image, strlen(base_url()));
$this->form_validation->set_rules('category_name', 'Category Name', 'trim|required');
$this->form_validation->set_rules('category_description', 'Category Description', 'trim');
$this->form_validation->set_rules('publication_status', 'Publication Status', 'trim|required');
if (!empty($_FILES['category_image']['name'])) {
$config['upload_path'] = './uploads/';
$config['allowed_types'] = '*';
$config['max_size'] = 4096;
$config['max_width'] = 2000;
$config['max_height'] = 2000;
$this->upload->initialize($config);
if (!$this->upload->do_upload('category_image')) {
$error = $this->upload->display_errors();
$this->session->set_flashdata('message', $error);
redirect('add/category');
} else {
$post_image = $this->upload->data();
$data['category_image'] = $post_image['file_name'];
unlink($delete_image);
}
}
if ($this->form_validation->run() == true) {
$result = $this->category_model->update_category_info($data, $id);
if ($result) {
$this->session->set_flashdata('message', 'Category Update Sucessfully');
redirect('manage/category');
} else {
$this->session->set_flashdata('message', 'Category Update Failed');
redirect('manage/category');
}
} else {
$this->session->set_flashdata('message', validation_errors());
redirect('add/category');
}
}
public function published_category($id)
{
$result = $this->category_model->published_category_info($id);
if ($result) {
$this->session->set_flashdata('message', 'Published Category Sucessfully');
redirect('manage/category');
} else {
$this->session->set_flashdata('message', 'Published Category Failed');
redirect('manage/category');
}
}
public function unpublished_category($id)
{
$result = $this->category_model->unpublished_category_info($id);
if ($result) {
$this->session->set_flashdata('message', 'UnPublished Category Sucessfully');
redirect('manage/category');
} else {
$this->session->set_flashdata('message', 'UnPublished Category Failed');
redirect('manage/category');
}
}
public function get_user()
{
$email = $this->session->userdata('admin_email');
$name = $this->session->userdata('admin_name');
$id = $this->session->userdata('admin_id');
if (!$email) {
redirect('dashboard-login');
}
}
}
|
The Kekistani History Timeline Wiki
Welcome to the Wiki
Describe your topic
Latest activity
Photos and videos are a great way to add visuals to your wiki. Add one below!
|
from typing import List, Dict
import copy
def backtest(
config: dict,
routes: List[Dict[str, str]],
extra_routes: List[Dict[str, str]],
candles: dict,
generate_charts: bool = False,
generate_tradingview: bool = False,
generate_quantstats: bool = False,
generate_hyperparameters: bool = False,
generate_equity_curve: bool = False,
generate_csv: bool = False,
generate_json: bool = False,
hyperparameters: dict = None
) -> dict:
"""
An isolated backtest() function which is perfect for using in research, and AI training
such as our own optimization mode. Because of it being a pure function, it can be used
in Python's multiprocessing without worrying about pickling issues.
Example `config`:
{
'starting_balance': 5_000,
'fee': 0.001,
'type': 'futures',
'futures_leverage': 3,
'futures_leverage_mode': 'cross',
'exchange': 'Binance',
'warm_up_candles': 100
}
Example `route`:
[{'exchange': 'Bybit USDT Perpetual', 'strategy': 'A1', 'symbol': 'BTC-USDT', 'timeframe': '1m'}]
Example `extra_route`:
[{'exchange': 'Bybit USDT Perpetual', 'symbol': 'BTC-USDT', 'timeframe': '3m'}]
Example `candles`:
{
'Binance-BTC-USDT': {
'exchange': 'Binance',
'symbol': 'BTC-USDT',
'candles': np.array([]),
},
}
"""
return _isolated_backtest(
config,
routes,
extra_routes,
candles,
run_silently=True,
hyperparameters=hyperparameters,
generate_charts=generate_charts,
generate_tradingview=generate_tradingview,
generate_quantstats=generate_quantstats,
generate_csv=generate_csv,
generate_json=generate_json,
generate_equity_curve=generate_equity_curve,
generate_hyperparameters=generate_hyperparameters,
)
def _isolated_backtest(
config: dict,
routes: List[Dict[str, str]],
extra_routes: List[Dict[str, str]],
candles: dict,
run_silently: bool = True,
hyperparameters: dict = None,
generate_charts: bool = False,
generate_tradingview: bool = False,
generate_quantstats: bool = False,
generate_csv: bool = False,
generate_json: bool = False,
generate_equity_curve: bool = False,
generate_hyperparameters: bool = False
) -> dict:
from jesse.services.validators import validate_routes
from jesse.modes.backtest_mode import simulator
from jesse.config import config as jesse_config, reset_config
from jesse.routes import router
from jesse.store import store
from jesse.config import set_config
from jesse.services import required_candles
import jesse.helpers as jh
jesse_config['app']['trading_mode'] = 'backtest'
# inject (formatted) configuration values
set_config(_format_config(config))
# set routes
router.initiate(routes, extra_routes)
validate_routes(router)
# TODO: further validate routes and allow only one exchange
# TODO: validate the name of the exchange in the config and the route? or maybe to make sure it's a supported exchange
# initiate candle store
store.candles.init_storage(5000)
# assert that the passed candles are 1m candles
for key, value in candles.items():
candle_set = value['candles']
if candle_set[1][0] - candle_set[0][0] != 60_000:
raise ValueError(
f'Candles passed to the research.backtest() must be 1m candles. '
f'\nIf you wish to trade other timeframes, notice that you need to pass it through '
f'the timeframe option in your routes. '
f'\nThe difference between your candles are {candle_set[1][0] - candle_set[0][0]} milliseconds which more than '
f'the accepted 60000 milliseconds.'
)
# divide candles into warm_up_candles and trading_candles and then inject warm_up_candles
max_timeframe = jh.max_timeframe(jesse_config['app']['considering_timeframes'])
warm_up_num = config['warm_up_candles'] * jh.timeframe_to_one_minutes(max_timeframe)
trading_candles = copy.deepcopy(candles)
if warm_up_num != 0:
for c in jesse_config['app']['considering_candles']:
key = jh.key(c[0], c[1])
# update trading_candles
trading_candles[key]['candles'] = candles[key]['candles'][warm_up_num:]
# inject warm-up candles
required_candles.inject_required_candles_to_store(
candles[key]['candles'][:warm_up_num],
c[0],
c[1]
)
# run backtest simulation
backtest_result = simulator(
trading_candles,
run_silently,
hyperparameters=hyperparameters,
generate_charts=generate_charts,
generate_tradingview=generate_tradingview,
generate_quantstats=generate_quantstats,
generate_csv=generate_csv,
generate_json=generate_json,
generate_equity_curve=generate_equity_curve,
generate_hyperparameters=generate_hyperparameters
)
result = {
'metrics': {'total': 0, 'win_rate': 0, 'net_profit_percentage': 0},
'logs': None,
}
if backtest_result['metrics'] is None:
result['metrics'] = {'total': 0, 'win_rate': 0, 'net_profit_percentage': 0}
result['logs'] = None
else:
result['metrics'] = backtest_result['metrics']
result['logs'] = store.logs.info
if generate_charts:
result['charts'] = backtest_result['charts']
if generate_tradingview:
result['tradingview'] = backtest_result['tradingview']
if generate_quantstats:
result['quantstats'] = backtest_result['quantstats']
if generate_csv:
result['csv'] = backtest_result['csv']
if generate_json:
result['json'] = backtest_result['json']
if generate_equity_curve:
result['equity_curve'] = backtest_result['equity_curve']
if generate_hyperparameters:
result['hyperparameters'] = backtest_result['hyperparameters']
# reset store and config so rerunning would be flawlessly possible
reset_config()
store.reset()
return result
def _format_config(config):
"""
Jesse's required format for user_config is different from what this function accepts (so it
would be easier to write for the researcher). Hence we need to reformat the config_dict:
"""
exchange_config = {
'balance': config['starting_balance'],
'fee': config['fee'],
'type': config['type'],
'name': config['exchange'],
}
# futures exchange has different config, so:
if exchange_config['type'] == 'futures':
exchange_config['futures_leverage'] = config['futures_leverage']
exchange_config['futures_leverage_mode'] = config['futures_leverage_mode']
return {
'exchanges': {
config['exchange']: exchange_config
},
'logging': {
'balance_update': True,
'order_cancellation': True,
'order_execution': True,
'order_submission': True,
'position_closed': True,
'position_increased': True,
'position_opened': True,
'position_reduced': True,
'shorter_period_candles': False,
'trading_candles': True
},
'warm_up_candles': config['warm_up_candles']
}
|
#compdef _rbenv rbenv
function _rbenv_commands() {
cmds_str="$(rbenv commands)"
cmds=("${(ps:\n:)cmds_str}")
_describe '_rbenv_commands' cmds
}
_rbenv_versions() {
versions_str="$(rbenv versions --bare)"
versions=(system "${(ps:\n:)versions_str}")
_describe '_rbenv_versions' versions
}
_rbenv() {
case "$words[2]" in
set-* | global | local | shell | prefix ) _rbenv_versions ;;
* ) _rbenv_commands ;;
esac
}
|
Error in model training
When I train my MULTIVI model on fully paired data, I am getting this error:
ValueError: Expected parameter loc (Tensor of shape (128, 18)) of distribution Normal(loc: torch.Size([128, 18]), scale: torch.Size([128, 18])) to satisfy the constraint Real(), but found invalid values:
tensor([[nan, nan, nan, ..., nan, nan, nan],
[nan, nan, nan, ..., nan, nan, nan],
[nan, nan, nan, ..., nan, nan, nan],
...,
[nan, nan, nan, ..., nan, nan, nan],
[nan, nan, nan, ..., nan, nan, nan],
[nan, nan, nan, ..., nan, nan, nan]], grad_fn=)
I did not provide a batch_key for scvi.model.MULTIVI.setup_anndata as my entire dataset was paired and could not be separated into batches based on modality.
I have used the 10x PBMC multiome dataset for my work: https://www.10xgenomics.com/datasets/pbmc-from-a-healthy-donor-granulocytes-removed-through-cell-sorting-10-k-1-standard-1-0-0
How do I resolve this error?
Hi. This is likely a duplicate of: https://github.com/scverse/scvi-tools/issues/2581#issuecomment-2019574427. Please follow the advices there. The fix is planned to be released with version 1.2
Fixed in #2914, for now you can set adversarial_mixing in train to False.
|
Android C2DM Invalidregistration
I have created an android app, that registering to google c2dm service. And It's getting a registration_id token from c2dm services successfully.
I already signed Android Cloud to Device Messaging form and I received confirmation email from c2dm service.
Everything seems ok in client side, it's getting registration_id in simulator environment. So, it's ok.
But, On server side, It's authenticating google service, it's receiving Auth code then it's invoking to c2dm send url with below code.
public void SendMessage(string registrationId, string data)
{
ServicePointManager.ServerCertificateValidationCallback += delegate(
object sender,
X509Certificate certificate,
X509Chain chain,
SslPolicyErrors sslPolicyErrors)
{
return true;
};
string collapseKey = Guid.NewGuid().ToString("n");
string url = "https://android.apis.google.com/c2dm/send";
HttpWebRequest request = (HttpWebRequest)HttpWebRequest.Create(url);
request.Method = "POST";
request.Headers.Add("Authorization", "GoogleLogin auth=DQAAAKYAAACE_0NqG8Sj5lBf4YSPXs_ltQbTzPsAL5u1Q1KGF...");
string px = "registration_id=" + registrationId + "&collapse_key=" + collapseKey + "&data.payload=" + data;
string encoded = HttpUtility.UrlEncode(px);
ASCIIEncoding encoding = new ASCIIEncoding();
byte[] buffer = encoding.GetBytes(encoded);
Stream newStream = request.GetRequestStream();
newStream.Write(buffer, 0, buffer.Length);
newStream.Close();
HttpWebResponse response = (HttpWebResponse)request.GetResponse();
if(response.StatusCode == HttpStatusCode.OK)
{
Stream resStream = response.GetResponseStream();
StreamReader sr = new StreamReader(resStream);
Console.Write(sr.ReadToEnd());
sr.Close();
resStream.Close();
}
Console.WriteLine();
Console.ReadLine();
}
It's still receiving Error=InvalidRegistration response from c2dm service.
What I'm doing wrong ?
Can you upload your project source ?
Can you please share your source code of both server & client side? Thanks
Ok, It solved.
I removed HttpUtility.UrlEncode(px); and everything worked as I expected.
Good to see you resolved it. Just fyi: You should only encode querystring values, not the querystring itself.
I had this problem for a long time until I set the ContentType to-
application/x-www-form-urlencoded
You need to set it to that for both
the authentication stage and,
the send message.
I then got the NotRegistered error but that is due to not using the same account on the phone as the sender for the server authentication.
Hope that helps others.
|
The Reproductive Processes and Parthenogenesis 191
the male chromosomes. While this theory would readily explain the great variation in such hermaphroditic bees it is based on the assumption that sex is determined by fertili zation, .which may be questioned.
Eggs which fail to hatch.
In some cases, one of which came under the author's observation, queens are normally mated and lay eggs, but all the eggs fail to hatch. This is perhaps due to some abnor mality of the queen, and in the case examined it appeared that the failure to hatch might have been due to the evap oration of the water in the protoplasm through the unusually thin and soft chorion of the eggs. Similar cases were de scribed by Claus and v. Siebold ' and also by Leuckart.^
|
Talk:Gabriel Knight
Re-writes
Not sure what happened to the separate pages idea. In the meantime, I've taken the liberty of giving this article an extensive re-write to clean up the first two game synopses (which were rather weak), add some sourced Jane Jensen quotes and to edit the 'Future' section. Although I'd too like to see a continuation of this series, a Wiki article on the games isn't really the place to be extoling the virtues of an external website. A quick summary and link is more than sufficent. Also added a note about the revival of Jane Jensen's Gray Matter since this will obviously keep any potentiol sequel out of production for at least another eighteen months. --Shantih1 03:02, 19 August 2006 (UTC)
A separate article for each game?
With all respect for the very good article written by everyone, I was thinking of creating separate pages for all the GK games (with info boxes and such) and make this article just about Gabriel as a character. --Deadworm222 10:19, 25 October 2005 (UTC)
* I think that's a very good idea! Maaya 03:22, 10 January 2006 (UTC)
* You should probably make this page a summary for the series, and make a seperate one for Gabe himself. MasterGrazzt 19:28, 26 January 2006 (UTC)
* I agree, I think having separate articles covering each of the articles in more depth is a great idea. I thought of doing the same before reading the discussion. NeonDaylight 20:01, 22 February 2006 (UTC)
Photographic VS Rendered
I distinctly remember GK2 as having mostly photographic (not rendered) backgrounds. Jane Jensen toured Munich (and surrounding area) obtaining photographs usable as the backdrops for the game. Although some are likely painted or drawn, similar to a matte in a motion picture, none of them are "rendered" digitally. ShadowChaser 17:41, 6 March 2006 (UTC)
Italian website link
Let's not resort to calling each other names here, alright? <IP_ADDRESS>, I agree with Wetman; Wikipedia policy is not entirely clear on this. The site includes some undoubtedly useful information and screenshots from the game (including pictures of each individual character). Just because it's in Italian doesn't mean it's devoid of content. I also think the link to the forum you deleted should be restored; Wikipedia mentions discussion forums only briefly and if there are few such sites that contain discussion on the series, the link should be retained. On second thought, since the link is in the External links section already, it's not that big a deal if it's not in the actual article. However, the GK4 Campaign site can hardly be described as a discussion forum and therefore should be restored. Cromag 10:30, 11 December 2006 (UTC)
Sources, weasel words
The article is written in a very praising tone, and almost no sources are provided. I'm trying to remove the worst cases of hyperbole and replace them with quotes from reviews, as should be a Wikipedia standard, but help is definitely appreciated. :)--Wormsie 13:17, 9 July 2007 (UTC)
Character summaries
I'm not too crazy about this section - it seems to be bloating this article with unnecessary narrative explanations. The short game summaries and links to each game's own articles are fine as they are. I think the article would be better served by moving these sections to the individual game pages. --Shantih1 22:50, 11 September 2007 (UTC)
Gabriel Knight Mysteries: Limited Edition
Is this the only compilation ever made from this series? If so, can somebody elaborate more about it? For example, did it contain any bug fixes or improvements or did it just add a CD with a soundtrack and a graphic novel?
Also, are you really sure the single soundtrack CD contained music from both games and not just from one of them?
Thanks! -Lwc4life (talk) 11:07, 21 February 2008 (UTC)
"The concept" and linearity
The section on "the concept" is a bit unfocused, and seems to misunderstand the word "nonlinear". The day-structuredness surely means that the games are linear, except for some limited nonlinearity within each day? I will rewrite this section soon unless someone can put an argument to the contrary. --Stephen lamppost (talk) 09:04, 11 May 2008 (UTC)
* Now done. --Stephen lamppost (talk) 22:41, 12 May 2008 (UTC)
External links modified
Hello fellow Wikipedians,
I have just modified one external link on Gabriel Knight. Please take a moment to review my edit. If you have any questions, or need the bot to ignore the links, or the page altogether, please visit this simple FaQ for additional information. I made the following changes:
* Added archive https://web.archive.org/web/20090817043926/http://archive.gamespy.com:80/interviews/may03/jensen/ to http://archive.gamespy.com/interviews/may03/jensen/
Cheers.— InternetArchiveBot (Report bug) 02:15, 7 January 2017 (UTC)
|
import { RedisExecuteRequestResult } from "../../../src/types/index";
export interface OutputItemInfoSuccess {
text: string;
}
export interface OutputItemResponse {
response: string;
time: number;
}
export interface OutputItemRequest {
command: string;
args: string;
eventTime?: string;
resultType?: RedisExecuteRequestResult;
time?: number;
}
export interface OutputItemTypes {
infoSuccess: OutputItemInfoSuccess;
infoError: string;
request: OutputItemRequest;
response: OutputItemResponse;
}
export interface OutputItem {
id: string;
type: string;
data: any;
}
export interface OutputItemStrict<T extends keyof OutputItemTypes> extends OutputItem {
id: string;
type: T;
data: OutputItemTypes[T];
}
|
Questions related to resonance/standing-waves and sound
I understand resonance for a simple harmonic oscillator but not for more complex systems like standing waves.
How can I be in resonance with the normal mode in an organ pipe?
I understand that the frequency of the force acting on the system has to match the natural frequency of the column of air in the pipe. However, the force acting on the system is generating pulses of pressure waves onto the system (suppose I'm blowing air or something) and I just don't see how nodes are going to be preserved if I'm continuously sending these pulses! Namely, I'm imagining that the pulses acting on the system will disturb the nodes of whatever harmonic was present in the organ pipe. The same with a string.
Also, what exactly is a normal mode? My textbook says that standing waves can only satisfy this equation:
Longitude of rope = (lambda/2)N or anything similar that depends on the system.
The thing is I'm so darn sure I saw another type of standing wave in my physics lab, where there was a half-wavelength on one extreme of the rope that was much shorter than all the rest of half-wavelengths. In fact, I think it wasn't even a half-wavelength it was a quarter-wavelength!
Also, I keep reading that a guitar string normally vibrates according to the fundamental frequency. I've seen countless videos that demonstrate in slow-motion how the vibrating string has hundreds of crests and is clearly not in its fundamental frequency. Other sources say harmonics coexist at the same time, this makes little sense to me right now.
Finally, is the topic of waves something I will understand more clearly later on in my studies as a physics major? I've heard you study this topic a big-deal in Differential Equations. Is this true? I've only seen CalcI and CalcII.
Organ pipe, whistles, and the like are not fed with pulses of air. Think about it. You blow into a whistle steadily, but yet what comes out is 1000 pulses per second or so. You certainly aren't huffing 1000 times/second into the whistle.
Whistles and organ pipes are their own oscillators. You put in power in the form or moving air, and that gets turned into pulses of air coming out.
It's probably easiest to think of how a whistle works. You apply steady pressure at the nozzle end. The nozzle deliberately make a sheet of flowing air accross that little gap. The air flow continues into the body of the whistle where is swirls around and pressure builds up. Eventually pressure gets high enough so that it "breaks thru" the sheet of air running accross the opening. That lets out a burst and momentarily re-directs the sheet so that it no longer goes into the body of the whistle. The momentum of the air rushing out of the body thru the opening and a little suction created by the sheet being diverted to go outside the body of the whistle eventually creates negative pressure in the body. That brings the sheet back to flowing into the whistle, and the cycle repeats. The size of the whistle body governs how fast the pressure builds up to break-thru level, and how fast is goes down again. In other words, the larger the body, the longer each cycle takes and the lower the pitch of the sound.
Organ pipes work on quite similar principles.
In the case of an organ pipe, where the air can be oscillating at some harmonic N, why doesn't my burst of air alter the position of the nodes? How can my burst of air enter in resonance with the normal mode within the pipe if I'm not huffing in some kind of periodic way?
In the scenario you describe, you apply an impulse to the system. That is, you excite it with a signal with a broad spectrum. Most of the frequency components die out quickly, and only the component at the resonant frequency produces a sustained response.
|
#!/usr/bin/env node
'use strict';
// Publish script.
// ---------------
// Serves two distinct purposes:
//
// 1. Produces a distribution bundle (npm package) for publishing to NPM.js
//
// The created bundle contains:
// - Transpiled distribution bundle
// - SCSS sources files (containing utilities exposed by kirby)
// - SVG Icons (icons provided / used by kirby)
// - README.md file
//
// or
//
// 2. Produces a npm package tarball (gzipped) that can be installed using "npm install <path to tarball>"
//
// NOTICE: This script automatically determines if running on CI, or a local developer machine.
const cp = require('child_process');
const fs = require('fs-extra');
const path = require('path');
const isCI = require('is-ci');
const { forwardScssFiles } = require('./forward-scss-files');
const packageAlias = '@kirbydesign';
const libsRootDir = `libs`;
const designsystemLibDir = `${libsRootDir}/designsystem`;
const designsystemLibSrcDir = `${designsystemLibDir}/icon/src`;
const coreLibDir = `${libsRootDir}/core`;
const coreLibSrcDir = `${coreLibDir}/src`;
const dist = `dist`;
const distDesignsystemTarget = `${dist}/${designsystemLibDir}`;
const distDesignsystemPackageJsonPath = `${distDesignsystemTarget}/package.json`;
const distCoreTarget = `${dist}/${coreLibDir}`;
const distCorePackageJsonPath = `${distCoreTarget}/package.json`;
const {
version,
description,
repository,
keywords,
author,
license,
bugs,
homepage,
} = require('../package.json');
function npm(args, options) {
return new Promise((resolve, reject) => {
console.log(`Spawning "npm ${args.join(' ')}"...`);
const result = cp.spawn(/^win/.test(process.platform) ? 'npm.cmd' : 'npm', args);
result.stdout.on('data', (data) => {
console.log(data.toString());
});
result.stderr.on('data', (data) => {
console.error(data.toString());
});
result.on('close', (code) => {
if (code === 0) {
resolve(code);
} else {
console.error(options.onFailMessage);
reject(code);
}
});
});
}
function cleanDistribution(distTarget) {
if (!isCI && fs.existsSync(distTarget)) {
console.log(`Removing contents of "${distTarget}"`);
return fs.remove(distTarget);
} else {
return Promise.resolve();
}
}
function buildPackage(npmBuildScript) {
return npm(['run', npmBuildScript], {
onFailMessage: 'Unable to build package (with ng-packagr)',
});
}
function enhancePackageJson(distPackageJsonPath) {
return fs.readJson(distPackageJsonPath, 'utf-8').then((packageJson) => {
// Modify contents
packageJson.version = version;
packageJson.description = description;
packageJson.repository = repository;
packageJson.keywords = keywords;
packageJson.author = author;
packageJson.license = license;
packageJson.bugs = bugs;
packageJson.homepage = homepage;
// (over-)write destination package.json file
const json = JSON.stringify(packageJson, null, 2);
console.log(`Writing new package.json (to: ${distPackageJsonPath}):\n\n${json}`);
return fs.writeJson(distPackageJsonPath, packageJson, { spaces: 2 });
});
}
function copyReadme(distTarget) {
console.log('Copying README.md file...');
return fs.copy('readme.md', `${distTarget}/readme.md`);
}
function createScssCoreForwardFiles(coreLibSrcDir, scssCoreForwardFilePaths) {
const sourceRootDir = `${coreLibDir}/scss`;
const sharedRootDir = libsRootDir;
const copyScssCoreTargetFiles = () => {
console.log('Copying SCSS core target files...');
const onlyScssFiles = (input) => ['', '.scss'].includes(path.extname(input));
return fs.copy(`${coreLibSrcDir}/scss`, `${sourceRootDir}`, {
filter: onlyScssFiles,
});
};
const generateScssCoreForwardFiles = () => {
console.log('Creating SCSS core forwarding files...');
return new Promise((resolve) => {
scssCoreForwardFilePaths.forEach((targetRootDir) => {
forwardScssFiles({ sourceRootDir, targetRootDir, packageAlias, sharedRootDir });
resolve();
});
});
};
const deleteScssCoreTargetFiles = () => {
console.log('Deleting SCSS core target files...');
return fs.remove(`${sourceRootDir}`);
};
return copyScssCoreTargetFiles()
.then(generateScssCoreForwardFiles)
.then(deleteScssCoreTargetFiles);
}
function copyIcons(libSrcDir, distTarget) {
console.log('Copying Icons...');
const onlySvgFiles = (input) => ['', '.svg'].includes(path.extname(input));
return fs.copy(`${libSrcDir}/icons/svg`, `${distTarget}/icons/svg`, {
filter: onlySvgFiles,
});
}
function copyCoreDistributionFiles(coreLibDir, distTarget) {
console.log('Copying core distribution files...');
const copyDistFiles = () => fs.copy(`${coreLibDir}/dist`, `${distTarget}/dist`);
const copyLoaderFiles = () => fs.copy(`${coreLibDir}/loader`, `${distTarget}/loader`);
return copyDistFiles().then(copyLoaderFiles);
}
function copyScssFiles(libSrcDir, distTarget) {
console.log('Copying SCSS files...');
return fs.copy(`${libSrcDir}/scss`, `${distTarget}/scss`);
}
function copyPackageJson(libDir, distJsonPath) {
console.log('Copying package.json file...');
return fs.copy(`${libDir}/package.json`, distJsonPath);
}
function createTarballPackage(distTarget) {
return npm(['pack', distTarget], {
onFailMessage: 'Unable to create gzipped tar-ball package',
});
}
function publish(distTarget, tarballNamePrefix) {
const findCoreTarball = (files) =>
files.find(
(candidate) => candidate.startsWith(tarballNamePrefix) && candidate.endsWith('.tgz')
);
if (isCI) {
// Publish to NPM
console.log('Running on CI, hence publishing package');
return npm(['publish', distTarget], { onFailMessage: 'Unable to publishpackage' });
} else {
// Create a GZipped Tarball
console.log('Running on non-CI, hence creating package as a gzipped tar-ball');
return createTarballPackage(distTarget)
.then(() => fs.promises.readdir('.'))
.then(findCoreTarball)
.then((filename) => fs.move(filename, `${dist}/${filename}`, { overwrite: true }));
}
}
// Actual execution of script!
const args = process.argv.slice(2).map((value) => value.toLowerCase());
const doPublishDesignsystem = args.length === 0 || args.includes('designsystem');
const doPublishCore = args.length === 0 || args.includes('core');
if (doPublishDesignsystem) {
// Publish designsystem
console.log('--- Publishing designsystem ---');
cleanDistribution(distDesignsystemTarget)
.then(() => buildPackage('dist:designsystem'))
.then(() => enhancePackageJson(distDesignsystemPackageJsonPath))
.then(() => copyReadme(distDesignsystemTarget))
.then(() => createScssCoreForwardFiles(coreLibSrcDir, [`${distDesignsystemTarget}/scss`]))
.then(() => copyIcons(designsystemLibSrcDir, distDesignsystemTarget))
.then(() => publish(distDesignsystemTarget, 'kirbydesign-designsystem'))
.catch((err) => console.warn('*** ERROR WHEN PUBLISHING DESIGNSYSTEM ***', err));
}
if (doPublishCore) {
// Publish core
console.log('--- Publishing core ---');
cleanDistribution(distCoreTarget)
.then(() => buildPackage('dist:core'))
.then(() => copyCoreDistributionFiles(coreLibDir, distCoreTarget))
.then(() => copyScssFiles(coreLibSrcDir, distCoreTarget))
.then(() => copyPackageJson(coreLibDir, distCorePackageJsonPath))
.then(() => publish(distCoreTarget, 'kirbydesign-core'))
.catch((err) => console.warn('*** ERROR WHEN PUBLISHING CORE PACKAGE ***', err));
}
|
Medicine » Cardiology and Cardiovascular Medicine
Venous Thrombosis - Principles and Practice
Edited by Ertugrul Okuyan, ISBN 978-953-307-885-4, Hard cover, 232 pages, Publisher: InTech, Chapters published January 05, 2012 under CC BY 3.0 license
DOI: 10.5772/1344
According to Virchow's triad, venous thrombosis can occur as a result of one or more of three factors: changes in the dynamics of the blood flow, endothelial injury/dysfunction of the blood vessel and hypercoagulability. The blood in the veins is constantly forming microscopic thrombi that are routinely broken down by the body, and significant clotting can occur only when the balance of thrombus formation and resolution is altered. This book is a fresh synthesis of venous thromboembolism care and considers the opinions and studies from different fields of medicine. As venous thrombosis spectrum is wide and can affect many organ systems, from deep veins of the leg to the cerebral venous system, our intent is for this to be a comprehensive, up-to-date and readable book. We tried to present a synthesis of existing material infused with new ideas and perspectives and authors own clinical studies and even case-reports.
|
1. Introduction {#sec1}
Lung cancer is one of the most deadly malignant tumors \[[@B1]\]. Nearly 85% of all lung cancer cases are non-small-cell lung cancer (NSCLC) \[[@B2]\]. The early symptoms of NSCLC patients are not obvious, leading to the diagnosis when most patients are already in the middle and late stage. Chemotherapy and radiotherapy are the main methods for the treatment of advanced NSCLC. However, due to the high degree of metastasis of lung cancer, the treatment effect is not ideal \[[@B3]\]. Therefore, the exploration of effective treatment methods has become the focus of people\'s attention in recent years \[[@B4]\]. The occurrence and development of malignant tumor are closely related to immune dysfunction. In recent years, tumor immunotherapy has made great progress in the treatment of NSCLC. Programmed death-1 (PD-1) and its ligand PD-L1 play an important role in tumor immune evasion and formation of the tumor microenvironment \[[@B5]\].
PD-L1 is expressed in a variety of tumors, especially NSCLC \[[@B6]\], melanoma, kidney cancer, prostate cancer, liver cancer, leukemia, multiple myeloma, etc. \[[@B7], [@B8]\]. The expression of PD-L1 can induce the production of multiple proinflammatory factors. PD-L1 is regulated by oncogenes and tumor suppressor genes. For example, the expression of PD-L1 is inhibited by tumor suppressor gene PTEN, which belongs to autoimmunity. Parsa et al. found that knockout of PTEN in glioma can regulate the expression of PD-L1 at the transcriptional level. Its mechanism of action is to activate the downstream mTOR-s6k1 signaling pathway of PI3K/AKT and ultimately increase the expression of PD-L1 \[[@B6], [@B9]\].
In recent years, personalized molecular targeted therapy has achieved great success. For NSCLC with EGFR-sensitive mutations (exon 19 deletion (E19del) and exon 21 point mutation (E21L858R), treatment with first-generation or second-generation EGFR-TKIs can significantly improve the prognosis of patients compared with traditional chemotherapy \[[@B10]\]. Osimertinib is a third representative dermal growth factor receptor tyrosine kinase inhibitor that has been shown to be effective in prolonging survival and reducing the risk of suffering and disease in patients with non-small-cell lung cancer \[[@B10]\]. Osimertinib is widely used in the treatment of non-small-cell lung cancer \[[@B10]--[@B13]\]. However, its mechanism of action needs further study \[[@B14]\]. Bevacizumab is a humanized recombinant monoclonal antibody against the vascular endothelial growth factor IgG1 \[[@B15]\]. By blocking the binding of the vascular endothelial growth factor to its receptor, the angiogenic activity of the vascular endothelial growth factor was inhibited, thus exerting antitumor effect \[[@B16]\]. Bevacizumab reduces tumor resistance to conventional chemotherapy or targeted drugs \[[@B17]\].
Studies have shown \[[@B18]\] that PD-L1 plays an important role in tumor evasion. Whether osimertinib affects the tumor immune microenvironment is unknown. Therefore, this study studied the inhibitory effect of osimertinib on tumor growth in human lung cancer-bearing mice from the perspective of the immune microenvironment. At the same time, the antitumor effect of the combination of osimertinib and bevacizumab was analyzed to provide a new theoretical basis for future clinical research on cancer.
2. Methods {#sec2}
2.1. Tumor Tissue Collection of Metastatic Lung Cancer and Nonmetastatic Lung Cancer {#sec2.1}
25 surgical specimens of metastatic and nonmetastatic NSCLC were collected from our hospital from April 2018 to January 2021. All patients underwent radical surgery, histologically diagnosed as NSCLC, and did not receive any preoperative antitumor therapy. The diagnostic basis of specimens collected in this study is CSCO Guidelines on the diagnosis and treatment of primary bronchogenic carcinoma. The diagnosis was independently evaluated by two pathologists. All patients signed informed consent. The study was approved by the Ethics Committee of Xinjiang Medical University.
2.2. Immunohistochemistry of Tumor Tissue {#sec2.2}
Paraffin sections were taken from the tissues to prepare continuous sections with a thickness of about 4 *µ*m. The slices were dewaxed and hydrated and placed in disodium hydrogen phosphate citric acid buffer. The antigen was repaired with boiling water bath under high pressure, and the reaction time was 2 min. The slices were removed and cooled naturally and then soaked in 3% hydrogen peroxide solution for 15 min. Then slice and place in a wet box, and block with normal goat blood at room temperature for 20 minutes. Diluted CD8, FoxP3, and PD-L1 antibodies were dropped, respectively. Their dilution ratio was 1 : 1000 and they were placed in a wet box at 4°C for overnight incubation. The diluted biotin-labeled secondary antibody was dropped, diluted at 1 : 5000, and placed in a wet box at room temperature for 20 min. DAB was used for color detection. When the observed parts were brownish yellow or brown, the observed parts were washed with running water for 3 times, 5 min each. Hematoxylin was redyed for 5 min and washed with running water. They were dehydrated, transparent, sealed with neutral gum, observed, and stained under a microscope.
2.3. qRT-PCR {#sec2.3}
RNA was extracted according to the instructions of the TRIzol kit. The extracted RNA was stored at −80°C. Reverse transcription and real-time qPCR were performed according to the instructions of TAKARA Prime Script™ RT Master Mix and SYRB Premix Ex Taq™ kit, respectively. Real-time qPCR amplification was used for fluorescence amplification, and GAPDH was used as a housekeeping gene. The reaction strip was prevariable at 95°C for 3 min, denaturation at 95°C for 10 s, annealing at 58°C for 15 s, and extension at 72°C for 20 s, with a total of 40 cycles. GAPDH primers forward: 5′-GCACCGTCAAGGCTGAGAAC-3′ and reverse: 5′-TGGTGAAGACGCCAGTGGA-3′. The relative expression of the target gene was analyzed by the 2^−ΔΔCt^ method.
2.4. Western Blot {#sec2.4}
Cells or tissues are lysed (with the addition of protease and phosphatase inhibitors), and proteins are extracted. The protein concentration was determined by the BCA method, and the 5x loading buffer was mixed. It was boiled for 3 min and cooled quickly in an ice bath. The loading amount was 30 *μ*g per lane. After polyacrylamide gel electrophoresis, it was transferred to PVDF membrane and blocked with calf serum albumin for 2 h. The corresponding primary antibody was added and incubated at 4°C overnight (GAPDH is the internal reference). After washing, the cells were incubated with secondary antibodies and chemiluminescence was developed. ImageJ was used to analyze the gray value detection and analysis of each target protein.
2.5. Subcutaneous Xenograft Model {#sec2.5}
Cells were cultured in the RPMI1640 medium (containing 10% fetal bovine serum and 1% penicillin-streptomycin) and cultured in an incubator at 37°C, 5% CO~2~, and 90% humidity, and the cells adhered. The cells in the logarithmic growth phase were taken, digested, and counted, and 2 × 10^6^/mL cells were inoculated subcutaneously in the flank wall in front of the right hindlimb of mice. Tumor volumes were measured at least twice a week after inoculation and during dosing. Mice were randomly divided into 3 groups: (1) control, (2) osimertinib, and (3) osimertinib + bevacizumab (*n* = 6); osimertinib: 2.5 mg/kg/d and bevacizumab: 5 mg/kg twice a week. Method of administration: osimertinib was administered by gavage daily, and bevacizumab was injected intraperitoneally twice a week. Tumor growth curves were drawn after inoculation and during dosing. All nude mice were euthanized, and whole tumor excised sections were biopsied and placed in 4% paraformaldehyde solution. The remainder was frozen in liquid nitrogen. Animal experiments in this study followed animal welfare and ethical requirements.
2.6. Immunofluorescence {#sec2.6}
Section dewaxing, hydration, antigen retrieval, and blocking steps were the same as for immunohistochemistry. After blocking, the blocking solution was washed, and the diluted primary antibody working solution of CD8 and FoxP3 was added dropwise. After incubation at room temperature, the cells were placed in a humidified chamber at 4°C overnight. The primary antibody was washed, and the corresponding fluorescent secondary antibody was added dropwise and incubated at room temperature for 60 min in the dark. DAPI was added dropwise to completely cover the tissue to counterstain nuclei for 8 min and washed with PBS. The liquid around the tissue was wiped dry, covered with a coverslip, and photographed by a confocal microscope.
2.7. Statistical Analysis {#sec2.7}
Statistical analysis was performed using SPSS 20.0 software. Data are expressed as the mean ± standard deviation. The *t*-test was used for comparison between the two groups. *P* \< 0.05 was considered to be statistically significant.
3. Results {#sec3}
3.1. PD-L1 Is Highly Expressed in Vascular Endothelial Cells in Metastatic Lung Adenocarcinoma Tumor Tissue {#sec3.1}
This study focused on the expression of PD-L1 in vascular endothelial cells in tumor tissue. Immunohistochemical staining showed that compared with the tumor tissues of nonmetastatic lung cancer patients, the expression of PD-L1 in vascular endothelial cells in the tumor tissues of patients with metastatic lung cancer was increased (Figures [1(a)](#fig1){ref-type="fig"} and [1(b)](#fig1){ref-type="fig"}). CD8 was mainly expressed in the cytoplasm, and the positive rate of CD8 in metastatic lung cancer tissues of NSCLC was significantly lower than that in nonmetastatic tumor tissues ([Figure 1(c)](#fig1){ref-type="fig"}). Immunohistochemical results showed that FoxP3 was highly expressed in metastatic lung cancer tumor tissues ([Figure 1(d)](#fig1){ref-type="fig"}). The correlation analysis of PD-L1 coexpression with CD8 and FoxP3 in metastatic lung adenocarcinoma tumor tissue showed that PD-L1 and CD8 were negatively correlated with coexpression in lung cancer tumor tissue ([Figure 2(a)](#fig2){ref-type="fig"}). In metastatic lung adenocarcinoma tumor tissue, PD-L1 and FoxP3 showed a positive correlation with coexpression ([Figure 2(b)](#fig2){ref-type="fig"}).
3.2. Osimertinib Inhibits the Expression of PD-L1 in Endothelial Cells {#sec3.2}
The complex mechanism of tumor metastasis lies in the extensive interactions that occur between tumor cells and various host cells. Tumor cells regulate the function and state of vascular endothelial cells through a variety of mechanisms. This study firstly analyzed the effect of the lung cancer cell culture medium on HUVECs. The expression of PD-L1 was detected after HUVECs were treated with tumor cell (CM) supernatant for 48 h. The results showed that CM could upregulate the expression of PD-L1 in endothelial cells ([Figure 3(a)](#fig3){ref-type="fig"}). Subsequently, we examined the effect of lung cancer-targeted drug osimertinib on the expression of PD-L1 in endothelial cells. The experiment was divided into three groups: (1) control, (2) lung cancer cell culture medium supernatant, and (3) lung cancer cell culture medium supernatant + osimertinib. The experimental results showed that the expression of PD-L1 was decreased in the CM + osimertinib-treated group compared with the CM-treated group ([Figure 3(b)](#fig3){ref-type="fig"}).
3.3. Osimertinib Inhibits the Expression of PD-L1 in Endothelial Cells through the AKT/ERK Pathway {#sec3.3}
Studies have reported that the AKT signaling pathway mediates the expression of PD-L1 in cells. Western blot was used to analyze the expressions of p-AKT and p-ERK in osimertinib-treated HUVECs. The results showed that, compared with the control group, the expressions of p-AKT and p-ERK in HUVECs were decreased after osimertinib treatment (Figures [4(a)](#fig4){ref-type="fig"} and [4(b)](#fig4){ref-type="fig"}). Further, we used the AKT-specific inhibitor Ly294002 to verify whether blocking AKT could reduce the expression of PD-L1. The results showed that the expression of p-AKT was decreased in HUVECs treated with osimertinib and Ly294002. At the same time, PD-L1 expression was also decreased (Figures [4(c)](#fig4){ref-type="fig"} and [4(d)](#fig4){ref-type="fig"}). The above experimental results indicate that osimertinib inhibits the expression of PD-L1 in endothelial cells through the AKT/ERK pathway.
3.4. Osimertinib Inhibits the Expression of PD-L1 in Endothelial Cells and Inhibits Tumor Growth {#sec3.4}
This study further investigated the ability of osimertinib to increase the antitumor effect of bevacizumab. C57BL/6 mice were injected with B16 cells. Mice were divided into 3 groups (*n* = 6 per group) and treated with either osimertinib or osimertinib + bevacizumab. The changes of tumor volume and tumor weight of transplanted tumor nude mice in each treatment group are shown in the figure. After administration, the tumor volume and tumor weight of the osimertinib combined with the bevacizumab group were significantly smaller than those of the osimertinib single-agent group (Figures [5(a)](#fig5){ref-type="fig"} and [5(b)](#fig5){ref-type="fig"}). The results of CD8^+^T cell immunofluorescence staining showed that the CD8^+^T cell content in the tumor tissue of osimertinib combined with the bevacizumab group was higher than that of the osimertinib single-agent group (Figures [5(c)](#fig5){ref-type="fig"} and [5(d)](#fig5){ref-type="fig"}). The results of FoxP3^+^T cell immunofluorescence staining showed that the FoxP3^+^T cell content in the tumor tissue of osimertinib combined with the bevacizumab group was lower than that of the osimertinib single-agent group (Figures [5(e)](#fig5){ref-type="fig"} and [5(f)](#fig5){ref-type="fig"}). Statistics of CD8/FoxP3 ratio in tumor tissue showed that the infiltration rate of CD8^+^ T cells was increased after the combination of osimertinib and bevacizumab, while the infiltration rate of FoxP3^+^ T cells was decreased ([Figure 5(g)](#fig5){ref-type="fig"}).
4. Discussion {#sec4}
Tumor microenvironment plays a central role in the development and progression of lung cancer \[[@B19]\]. Innate and adaptive immune cells in the tumor microenvironment have protumor and antitumor effects. Tumor cells overexpress immune checkpoint molecules to escape the surveillance and killing of immune cells, thus promoting tumor growth \[[@B20]\]. Further study on the immune regulation function of immune cells is helpful to improve the efficacy of immunotherapy and find new therapeutic targets \[[@B21], [@B22]\].
CD8^+^T cells play an important role in the tumor immune microenvironment, and their invasion level can affect the efficacy of tumor immunotherapy \[[@B23]\]. It has been reported that the infiltration rate of CD8^+^T cells in NSCLC tissues is about 68.9% \[[@B24]\]. In this study, the infiltration rate of CD8^+^T cells in metastatic NSCLC lesions was lower than that in the primary lesions. The decrease of CD8^+^T cell infiltration may be one of the important reasons for NSCLC metastasis. However, this study only observed the infiltration of CD8^+^T cells in tumor tissues, which could not represent the whole immune microenvironment in tumor area. The changes of CD3^+^, CD4^+,^ and CD8^+^T cells in blood could be further analyzed. Fork head box protein 3 (FoxP3)^+^ regulatory T cells (Treg) are important immune regulatory cells, which play an important role in the development of many kinds of malignant tumors. A lot of studies prove, FoxP3 is expressed in a variety of tumors such as colon cancer, pancreatic cancer, liver cancer, bladder cancer, breast cancer, melanoma, lung cancer, prostate cancer, and glioma. FoxP3 is located in Treg and/or tumor cells and is one of the factors of poor prognosis of tumor \[[@B25]--[@B29]\]. Reduction of FoxP3+T was observed after osimertinib administration. Meanwhile, fewer FoxP3+T cells were observed after osimertinib was combined with bevacizumab. These results suggest that FoxP3^+^T, a negative immunoregulatory cell, is involved in the malignant progression of lung cancer. Osimertinib can inhibit negative immune regulation.
Vascular endothelial growth factor (VEGF) plays an important role in angiogenesis and is essential for the survival of endothelial cells in tumors \[[@B30], [@B31]\]. Bevacizumab can reduce VEGF levels and block neovascularization, temporarily normalize tumor tortuous blood vessels, improve tumor oxygenation and reduce interstitial fluid pressure, and restore drug delivery to the tumor. This may make tumor cells more sensitive to EGFR-TKIs \[[@B32]\]. This study showed that osimertinib inhibited the AKT/ERK signaling pathway and then inhibited the expression of PD-L1 in endothelial cells. It can be observed from the tumor growth curve that the synergistic tumor inhibition effect of bevacizumab is more significant than the single dose double tumor inhibition effect. It is suggested that an appropriate dose of osimertinib combined with antivascular therapy may bring more benefits than increasing the dose of osimertinib alone. The combination of bevacizumab improved the microenvironment in tumor tissue and enhanced the inhibitory effect of osimertinib, thus killing tumor cells more effectively.
In this study, although bevacizumab inhibited tumor angiogenesis, it improved the tumor internal environment and thus improved oxygen supply in tumor tissues. This is also in line with the normalization phenomenon of blood vessels in antiangiogenic therapy proposed by Jain et al. \[[@B33], [@B34]\].
There are also some deficiencies in this study. Protein kinase B, or AKT, plays an important role in cell survival and apoptosis. The PI3 kinase-AKT pathway is a classical signaling pathway. Many kinase inhibitors inhibit AKT activation when they inhibit PI3 kinase. Total AKT was detected in this study without further distinction between AKT1, 2, 3. The role and differences of AKT subtypes will be analyzed in subsequent experiments. In this study, we found that osimertinib inhibited ERK phosphorylation. In subsequent experiments, we will analyze the role and differences of ERK subtypes in this process.
5. Conclusion {#sec5}
In conclusion, this study confirmed that the 3rd generation EGFR-TKI osimertinib has a strong tumor suppressive effect on lung adenocarcinoma transplanted tumor through cell experiment and animal experiment of transplanted tumor. Bevacizumab can significantly increase the killing ability of osimertinib against lung adenocarcinoma transplanted tumor, and the two have a synergistic effect. The synergistic effect of bevacizumab and osimertinib is achieved by reducing PD-L1 expression in tumor blood vessels, improving tumor microenvironment, and enhancing the function of immune cells. This study provides theoretical basis for further clinical trials.
The study was supported by Xinjiang Key Laboratory of Active Components of Natural Medicine and Drug Release Technology (XJDX1713).
Conflicts of Interest
The authors declare that they have no conflicts of interest.
::: {#fig1 .fig}
PD-L1 is highly expressed in vascular endothelial cells in metastatic lung cancer tumor tissue. (a) Immunohistochemical staining images of endothelial cells with high PD-L1 expression in metastatic and nonmetastatic lung cancers (*n* = 25). (b) Statistical results of PD-L1 expression. (c) Immunohistochemical staining results of CD8 in metastatic and nonmetastatic lung cancer tissues. (d) FoxP3 immunohistochemical staining results in metastatic and nonmetastatic lung cancer tumor tissues. ^*∗*^ ^*∗*^*P* \< 0.01.
::: {#fig2 .fig}
Correlation analysis of coexpression of PD-L1 with CD8 and FoxP3 in metastatic lung cancer tumor tissue. (a) Correlation analysis of PD-L1 and CD8 coexpression in metastatic lung cancer tumor tissue. (b) Correlation analysis of PD-L1 and FoxP3 coexpression in metastatic lung cancer tumor tissue. ^*∗*^ ^*∗*^*P* \< 0.01.
::: {#fig3 .fig}
Osimertinib inhibits PD-L1 expression on endothelial cells. (a) The expression of PD-L1 was detected after HUVECs were treated with the tumor cell (CM) supernatant for 48 h. (b) Osimertinib inhibits the expression of PD-L1 in HUVECs. ^*∗*^ ^*∗*^*P* \< 0.01.
::: {#fig4 .fig}
Osimertinib inhibits the expression of PD-L1 in endothelial cells via the AKT/ERK pathway. (a) Western blot analysis showed that the expressions of p-AKT and p-ERK were decreased in osimertinib-treated HUVECs. (b) Statistical analysis results of p-AKT/AKT and p-ERK/ERK. (c) Blocking AKT can reduce the expression of PD-L1. (d) Statistical results of each group of proteins. ^*∗*^ ^*∗*^*P* \< 0.01.
::: {#fig5 .fig}
Osimertinib inhibits PD-L1 expression in endothelial cells and inhibits tumor growth. (a) C57BL/6 mice were injected with 1 × 10^6^ B16 cells, and tumors grew. The tumor growth curve of each treatment group (*n* = 6 per group). (b) Tumor weight in each treatment group. (c) Representative images of immune cell markers (CD8^+^ T cells) in B16 tumor tissue. (d) Quantification of CD8^+^ T cells in B16 tumors. (e) Representative images of immune cell markers (FoxP3^+^ T cells) in B16 tumor tissue. (f) Quantification of FoxP3^+^ T cells in B16 tumors. (g) Statistics of CD8/FoxP3 ratio in tumor tissue. ^*∗*^*P* \< 0.05, ^*∗*^ ^*∗*^*P* \< 0.01.
[^1]: Academic Editor: Xueliang Wu
|
Effects of computerized clinical decision support systems on practitioner performance and patient outcomes: Methods of a decision-maker-researcher partnership systematic review
Background Computerized clinical decision support systems are information technology-based systems designed to improve clinical decision-making. As with any healthcare intervention with claims to improve process of care or patient outcomes, decision support systems should be rigorously evaluated before widespread dissemination into clinical practice. Engaging healthcare providers and managers in the review process may facilitate knowledge translation and uptake. The objective of this research was to form a partnership of healthcare providers, managers, and researchers to review randomized controlled trials assessing the effects of computerized decision support for six clinical application areas: primary preventive care, therapeutic drug monitoring and dosing, drug prescribing, chronic disease management, diagnostic test ordering and interpretation, and acute care management; and to identify study characteristics that predict benefit. Methods The review was undertaken by the Health Information Research Unit, McMaster University, in partnership with Hamilton Health Sciences, the Hamilton, Niagara, Haldimand, and Brant Local Health Integration Network, and pertinent healthcare service teams. Following agreement on information needs and interests with decision-makers, our earlier systematic review was updated by searching Medline, EMBASE, EBM Review databases, and Inspec, and reviewing reference lists through 6 January 2010. Data extraction items were expanded according to input from decision-makers. Authors of primary studies were contacted to confirm data and to provide additional information. Eligible trials were organized according to clinical area of application. We included randomized controlled trials that evaluated the effect on practitioner performance or patient outcomes of patient care provided with a computerized clinical decision support system compared with patient care without such a system. Results Data will be summarized using descriptive summary measures, including proportions for categorical variables and means for continuous variables. Univariable and multivariable logistic regression models will be used to investigate associations between outcomes of interest and study specific covariates. When reporting results from individual studies, we will cite the measures of association and p-values reported in the studies. If appropriate for groups of studies with similar features, we will conduct meta-analyses. Conclusion A decision-maker-researcher partnership provides a model for systematic reviews that may foster knowledge translation and uptake.
Background
Computerized clinical decision support systems (CCDSSs) are information technology-based systems designed to improve clinical decision-making. Characteristics of individual patients are matched to a computerized knowledge base, and software algorithms generate patient-specific information in the form of assessments or recommendations. As with any healthcare intervention with claims to improve healthcare, CCDSSs should be rigorously evaluated before widespread dissemination into clinical practice. Further, for CCDSSs that have been properly evaluated for clinical practice effects, a process of 'knowledge translation' (KT) is needed to ensure appropriate implementation, including both adoption if the findings are positive and foregoing adoption if the trials are negative or indeterminate.
The Health Information Research Unit (HIRU) at McMaster University has previously completed highly cited systematic reviews of trials of all types of CCDSSs [1][2][3]. The most recent of these [1] included 87 randomized controlled trials (RCTs) and 13 non-randomized trials of CCDSSs, published up to September 2004. This comprehensive review found some evidence for improvement of the processes of clinical care across several types of interventions. The evidence summarized in the review was less encouraging in documenting benefits for patients: only 52 of the 100 trials included a measure of clinical outcomes and only seven (13%) of these reported a statistically significant patient benefit. Further, most of the effects measured were for 'intermediate' clinical variables, such as blood pressure and cholesterol levels, rather than more patient-important outcomes. However, most of the studies were underpowered to detect a clinically important effect. The review assessed study research methods and, fortunately, found study quality improved over time.
We chose an opportunity for 'KT synthesis' funding from the Canadian Institutes of Health Research (CIHR) to update the review, partnering with our local hospital administration and clinical staff and our regional health authority. We are in the process of updating this review and, in view of the large number of trials and clinical applications, split it into six reviews: primary preventive care, therapeutic drug monitoring and dosing, drug prescribing, chronic disease management, diagnostic test ordering and interpretation, and acute care management. The timing of this update and separation into types of application were auspicious considering the maturation of the field of computerized decision support, the increasing availability and sophistication of information technology in clinical settings, the increasing pace of publication of new studies on the evaluation of CCDSSs, and the plans for major investments in information technology (IT) and quality assurance (QA) in our local health region and elsewhere. In this paper, we describe the methods undertaken to form a decisionmaker-research partnership and update the systematic review.
Methods
Steps involved in conducting this update are shown in Figure 1.
Research questions
Research questions were agreed upon by the partnership (details below). For each of the six component reviews, we will determine whether the accumulated trials for that category show CCDSS benefits for practitioner performance or patient outcomes. Additionally, conditional on a positive result for this first question for each component review, we will determine which features of the successful CCDSSs lend themselves to local implementation. Thus, the primary questions for this review are: Do CCDSSs improve practitioner performance or patient outcomes for primary preventive care, therapeutic drug monitoring and dosing, drug prescribing, chronic disease management, diagnostic test ordering and interpretation, and acute care management? If so, what are the features of successful systems that lend themselves to local implementation?
CCDSSs were defined as information systems designed to improve clinical decision-making. A standard CCDSS can be broken down into the following components. First, practitioners, healthcare staff, or patients can manually enter patient characteristics into the computer system, or alternatively, electronic medical records can be queried for retrieval of patient characteristics. The characteristics of individual patients are then matched to a computerized knowledge base (expert physician opinion or clinical practice guidelines usually form the knowledge base for a CCDSS). Next, the software algorithms of the CCDSS use the patient information and knowledge base to generate patient-specific information in the form of assessments (management options or probabilities) and/or recommendations. The computergenerated assessments or recommendations are then delivered to the healthcare provider through various means, including a computer screen, the electronic medical record, by pager, or printouts placed in a patient's paper chart. The healthcare provider then chooses whether or not to employ the computer-generated recommendations.
Partnering with decision-makers
For this synthesis project, HIRU partnered with the senior administration of Hamilton Health Sciences (HHS, one of Canada's largest hospitals), our regional health authority (the Hamilton, Niagara, Haldimand, and Brant Local Health Integration Network (LHIN)), and clinical service chiefs at local hospitals. The partnership recruited leading local and regional decisionmakers to inform us of the pertinent information to extract from studies from their perspectives as service providers and managers. Our partnership model was designed to facilitate KT, that is, to engage the decisionmakers in the review process and feed the findings of the review into decisions concerning IT applications and purchases for our health region and its large hospitals.
The partnership model has two main groups. The first group is the decision-makers from the hospital and region and the second is the research staff at HIRU at McMaster University. Each group has a specific role. The role of the decision-makers is to guide the review process. Two types of decision-makers are being engaged. The first type provides overall direction. The names and positions of these decision-makers are shown in Table 1. The second type of decision-maker provides specific direction for each of the six clinical application areas of the systematic review. These decision-makers are shown in Table 2. Each of these clinical service decision-makers (shown in Table 2) is partnered with a research staff lead for each of the six component reviews. The role of the research staff is to do the work 'in the trenches,' that is, undertake a comprehensive literature search, extract the data, synthesize the data, plan dissemination, and engage in the partnership. This group is comprised of physicians, pharmacists, research staff, graduate students, and undergraduate students. Research staff designed results tables (e.g., study characteristics, CCDSS characteristics, process outcomes, patient outcomes) working with the HIRU programmer to pre-populated these tables as much as possible from the data extraction forms Decision-makers were engaged to review the articles included in their application area, to make suggestions on data synthesis, and to assist with dissemination strategies, including manuscript writing and publication The partners will continue to work together throughout the review process. Both types of decision-makers were engaged early in the review process. Their support was secured before submitting the grant application. Each decision-maker partner was required by the funding agency, CIHR, to sign an acknowledgement page on the grant application and provide a letter of support and curriculum vitae. Research staff in HIRU met with each of the clinical service decision makers independently, providing them with copies of the data extraction form used in the previous review and sample articles in their content areas, to determine what data should be extracted from each of the included studies. Specifically, we asked them to tell us what information from such investigations they would need when deciding about implementation of computerized decision support.
Engaging the decision-makers at the data extraction stage was enlightening, and let us know that decisionmakers are interested in, among other things: 1. Implementation challenges, for example, how was the system put into place? Was it too cumbersome? Was it too slow? Was it part of an electronic medical record or computerized physician order entry system? How did it fit into existing workflow?
2. Training details, for example, how much training on the use of the CCDSS was done, by whom, and how?
3. The evidence base, for example, if and how the evidence base for decision support was maintained?
4. Customization, for example, was the decision support system customizable?
All of this led to richer data extraction to be undertaken for those CCDSSs that show benefit.
We continued to engage the decision-makers throughout the review process by meeting with them once again before data analysis to discuss how best to summarize the data and to determine how to separate the content into the six component reviews. Prior to manuscript submission, decision-makers will be engaged in the dissemination phase, engaging in manuscript writing and authorship of their component reviews.
Studies eligible for review
As of 13 January 2010 we started with 86 CCDSS RCTs identified in our previously published systematic review [1] (one of the 87 RCTs from the previous review was excluded because the CCDSS did not provide patientspecific information), and exhaustive searches that were originally completed in September 2004 were extended and updated to 6 January 2010. Consideration was given only to RCTs (including cluster RCTs), given that participants in CCDSS trials generally cannot be blinded to the interventions and RCTs at least assure protection from allocation bias. For this update, we included RCTs in any language that compared patient care with a CCDSS to routine care without a CCDSS and evaluated clinical performance (i.e., a measure of process of care) or a patient outcome. Additionally, to be included in the review, the CCDSS had to provide patient-specific advice that was reviewed by a healthcare practitioner before any clinical action. CCDSSs for all purposes were included in the review. Studies were excluded if the system was used solely by students, only provided summaries of patient information, provided feedback on groups of patients without individual assessment, only provided computer-aided instruction, or was used for image analysis.
The five questions answered to determine if a study was eligible for inclusion in the review were: 1. Is this study focused on evaluating a CCDSS? 2. Is the study a randomized, parallel controlled trial (not randomized time-series) where patient care with a CCDSS is compared to patient care without a CCDSS?
3. Is the CCDSS used by a healthcare professionalphysicians, nurses, dentists, et al.-in a clinical practice or post-graduate training (not studies involving only students and not studies directly influencing patient decision making)?
4. Does the CCDSS provide patient-specific information in the form of assessments (management options or probabilities) and/or recommendations to the clinicians? 5. Is clinical performance (a measure of process of care) and/or patient outcomes (on non-simulated patients) (including any aspect of patient well-being) described?
A response of 'yes' was required for all five questions for the article to be considered for inclusion in the review. [4]. The flow diagram of included and excluded articles is shown in Figure 2.
Reviewer agreement on study eligibility was quantified using the unweighted Cohen [5]. The kappa was = 0.84 (95% confidence interval [CI], 0.82 to 0.86) for preadjudicated pair-wise assessments of in/in and in/uncertain versus out/out, out/uncertain, and uncertain/uncertain. Disagreements were then adjudicated by a third observer.
Data Extraction
Pairs of reviewers independently extracted the following data from all studies meeting eligibility criteria: study setting, study methods, CCDSS characteristics, patient/ provider characteristics, and outcomes. Disagreements were resolved by a third reviewer or by consensus. We attempted to contact primary authors of all included studies via email to confirm data and provide missing data. Primary authors were sent up to two email messages where they were asked to review and amend, if necessary, the data extracted on their study. Primary authors were presented with a URL in the email message. When they clicked on the URL, they were presented with an on-line web-based data extraction form that showed the data extracted on their study. Comments buttons were available for each question and were used by authors to suggest a change or provide clarification for a data extraction item. Upon submitting the form, an email was sent to a research assistant in HIRU summarizing the author's responses. Changes were made to the extraction form noting that the information came from the primary author. We sent email correspondence to the authors of all included trials (n = 168 as of January 13, 2010) and, thus far, 119 (71%) provided additional information or confirmed the accuracy of extracted data. When authors did not respond or could not be contracted, a reviewer trained in data extraction reviewed the extraction form against the fulltext of the article as a final check.
All studies were scored for methodological quality on a 10-point scale consisting of five potential sources of bias. The scale used in this update differs from the scale used in the previously published review because only RCTs are included in this update. The scale we used is an extension of the Jadad scale [6] (which assesses randomization, blinding, and accountability of all patients), and includes three additional potential sources of bias (i. e., concealment of allocation, unit of allocation, and presence of baseline differences). In brief, we considered concealment of allocation (concealed, score = 2, versus unclear if concealed, 1, versus not concealed, 0), the unit of allocation (a cluster such as a practice, 2, versus physician, 1, versus patient, 0), the presence of baseline differences between the groups that were potentially linked to study outcomes (no baseline differences present or appropriate statistical adjustments made for differences, 2, versus baseline differences present and no statistical adjustments made, 1, versus baseline characteristics not reported, 0), the objectivity of the outcome (objective outcomes or subjective outcomes with blinded assessment, 2, versus subjective outcomes with no blinding but clearly defined assessment criteria, 1, versus, subjective outcomes with no blinding and poorly defined, 0), and the completeness of follow-up for the appropriate unit of analysis (>90%, 2, versus 80 to 90%, 1, versus <80% or not described, 0). The unit of allocation was included because of the possibility of group contamination in trials in which the patients of an individual clinician could be allocated to the intervention and control groups, and the clinician would then receive decision support for some patients but not others. Contamination bias would lead to underestimating the effect of a CCDSS.
Data Synthesis
CCDSS and study characteristics predicting success will be analyzed and interpreted with the study as the unit of analysis. Data will be summarized using descriptive summary measures, including proportions for categorical variables and means (±SD, standard deviation) for continuous variables. Univariable and multivariable logistic regression models, adjusted for study methodological quality, will be used to investigate associations between the outcomes of interest and study specific Total included in this review (82+86), n = 168 *The first database searched was Medline, followed by EMBASE, EBM Reviews and finally Inspec. 366 articles retrieved in EMBASE were already identified in Medline. 250 articles retrieved in EBM Reviews were already identified in Medline. 73 articles retrieved in EBM Reviews were already identified in EMBASE. 6 articles retrieved in Inspec were already identified in Medline. 7 articles retrieved in Inspec were already identified in EMBASE. 1 article retrieved in Inspec was already identified in EBM. †Reasons for exclusion: 30 studies did not focus on the evaluation of a CCDSS; 17 were not RCTs; two did not have a healthcare professional using the CCDSS; two did not have the CCDSS provide patient-specific information in the form of assessments and/or recommendations to the clinicians; three did not evaluate practitioner performance or patient outcomes; four were abstracts and one a short discussion on full-text articles already included in the review; nine were supplementary articles regarding a study that was already included and thus were linked to the main articles for data extraction purposes; and one study published in 2004 was already detected in our previous review. ‡ Reasons for exclusion: four studies did not focus on the evaluation of a CCDSS; 49 were not RCTs; two did not have the CCDSS provide patient-specific information in the form of assessments and/or recommendations to the clinicians; and one did not evaluate practitioner performance or patient outcomes. covariates. All analyses will be carried out using SPSS, version 18.0. We will interpret p ≤ 0.05 as indicating statistical significance; all p-values will be two-sided. When reporting results from individual studies, we will cite the measures of association and p-values reported in the studies. If appropriate for groups of studies with similar features, we will conduct meta-analyses using standard techniques, as described in the Cochrane Handbook http://www.cochrane.org/resources/handbook/.
Conclusion
A decision-maker-researcher partnership provides a model for systematic reviews that may foster KT and uptake.
|
using Microsoft.AspNetCore.OData.Query;
using System;
namespace AutoMapper.AspNet.OData
{
/// <summary>
/// Settings for configuring OData options on the server
/// </summary>
public class ODataSettings
{
/// <summary>
/// Gets or sets a value indicating how null propagation should
/// be handled during query composition.
/// </summary>
/// <value>
/// The default is <see cref="F:Microsoft.AspNet.OData.Query.HandleNullPropagationOption.Default" />.
/// </value>
public HandleNullPropagationOption HandleNullPropagation { get; set; } = HandleNullPropagationOption.Default;
/// <summary>
/// Gets or sets the maximum number of query results to return.
/// </summary>
/// <value>
/// The maximum number of query results to return, or null if there is no limit. Default is null.
/// </value>
public int? PageSize { get; set; }
/// <summary>
/// Gets of sets the <see cref="TimeZoneInfo"/>.
/// </summary>
/// <value>
/// Default is null.
/// </value>
public TimeZoneInfo TimeZone { get; set; }
}
}
|
Params that can hold negative values are not initialized properly
Describe the bug
I'm creating an oscillator that uses a param with range -100% to 100%. When I switch to an Init Program on the Prologue, and switch to my custom oscillator, it sounds like the parameter is set to -100% (i.e. a call was made to OSC_PARAM with a value argument of 0). However, when you go into the "edit mode" on the prologue, it displays a value of 0% (which means the argument to OSC_PARAM should have been 100). Changing the value in the edit menu resumes correct and expected behavior.
To Reproduce
Create a simple oscillator program that uses a param range of -100% to 100%. Design this program such that the sound will be audibly different with values of -100% and 0%.
After uploading the oscillator to the device, open an init program. Verify in the menu (without changing the value) that the parameter is set to 0%.
Play some notes with the oscillator. Note the sound generated.
Change the parameter's value to 1%, then back to 0%.
Play some notes with the oscillator. Note the change in the sound generated.
Expected behavior
I would expect the sound heard in steps 3 and 5 to be the same. Instead, when you play notes in step 3, it sounds like the param is set to a value of -100%.
Desktop (please complete the following information):
OS: [Ubuntu in WSL]
Device: [prologue ver 2.00]
Additional context
This seems related to issue #35 . It's my expectation that calls to OSC_PARAM should be made upon initialization of the oscillator, in order to set up the oscillator if it is a part of a preset. However, we ought to be able to set default values, and even if we can't, there should never be a situation where the value the user is shown is different from the last value sent to the custom OSC_PARAM.
@etienne-korg , I hate to ping devs directly, but I've not received feedback on this for several months. I'm prepping for release of an oscillator in the next few weeks, and if this bug is not resolved, I will need to release with an workaround that will be unpleasant from both the dev and user perspectives (and I'll need to explain to my users that this issue is an issue with the synth, not with my oscillator).
I can confirm that this bug still exists in prologue version 2.10, using the very latest version of the SDK (I pulled master before building).
If there's anything I can do to help drive this bug to a root-cause and a resolution, please let me know. I'm happy to supply a sample oscillator and a repro video, if that would be helpful.
I can confirm thet bug too. Current workaround is to limit bipolar parameter to -99 and add 100 in the parameter handler if zero value is received.
I can confirm thet bug too. Current workaround is to limit bipolar parameter to -99 and add 100 in the parameter handler if zero value is received.
Some additional details on bipolar values:
minilogue XD initializes params internally by raw 0 value (i.e. -100%), displaying first time 0%. On the second selection of the same parameter, the lower bound value (which is stated in the manifest) is displayed, but parameter value is unchanged. On program recall all parameters are restored and displayed fine.
NTS-1 initializes to the lower bound value - both internally and displayed value.
@etienne-korg I really hope drumlogue won't have such issues and all logues firmware will be aligned.
|
#!/usr/bin/env python
# -*- encoding: utf-8 -*-
# Created on 2016-07-26 11:04:34
import datetime
import peewee
deferred_db = peewee.SqliteDatabase(None)
STAUS_WAIT_TAKING = 0 # 待揽件
STAUS_IN_TRANSIT = 1 # 运输中
STAUS_IN_DELIVERING = 2 # 派件中
STAUS_IN_DELIVERED = 3 # 已签收
class BaseModel(peewee.Model):
class Meta:
database = deferred_db
class PackageTrackingRecord(BaseModel):
# 订阅类型 群、私人信息 group friend
sub_type = peewee.CharField(null=False)
# 订阅来源 微信、QQ wx qq
sub_source = peewee.CharField(null=False)
# 群组名
group_name = peewee.CharField(null=True)
# 群组号码
group_no = peewee.CharField(null=True)
# 订阅者账号
suber_account = peewee.CharField(null=True)
# 订阅者昵称
suber_nike_name = peewee.CharField(null=False)
# 包裹号码
tracking_no = peewee.CharField(null=True)
# 快递公司名称
company_name = peewee.CharField(null=True)
# 当前状态 0 待揽收 1 运输中 2 派送中 3 已签收
package_status = peewee.IntegerField(null=False, default=0)
# 创建时间
create_time = peewee.DateTimeField(null=False, default=datetime.datetime.now())
# 更新时间
update_time = peewee.DateTimeField(null=False)
class PackageTrackingDetail(BaseModel):
package_tracking = peewee.ForeignKeyField(PackageTrackingRecord, related_name='logs')
package_tracking_no = peewee.CharField(null=True)
tracking_msg = peewee.CharField(null=True)
update_time = peewee.DateTimeField(null=False)
update_time_int = peewee.IntegerField(null=False)
|
kubectl set image does not work on initContainers
kubectl version
Client Version: version.Info{Major:"1", Minor:"9", GitVersion:"v1.9.6", GitCommit:"9f8ebd171479bec0ada837d7ee641dec2f8c6dd1", GitTreeState:"clean", BuildDate:"2018-03-21T15:21:50Z", GoVersion:"go1.9.3", Compiler:"gc", Platform:"linux/amd64"}
Server Version: version.Info{Major:"1", Minor:"9", GitVersion:"v1.9.6", GitCommit:"9f8ebd171479bec0ada837d7ee641dec2f8c6dd1", GitTreeState:"clean", BuildDate:"2018-03-21T15:13:31Z", GoVersion:"go1.9.3", Compiler:"gc", Platform:"linux/amd64"}
kubectl set image deployment/abcxyz abcxyz="123"
Error from server (NotFound): deployments.extensions "abcxyz" not found
When a container by that name does exist - but it is defined in 'initContainers'.
Error from server (NotFound): deployments.extensions "abcxyz" not found
points to the fact that abcxyz deployment doesn't exist. You should be getting an error:
error: unable to find container named "foo"
but I'm guessing you're still right, set image probably doesn't support init containers.
same issue
/kind feature
/sig cli
/area kubectl
/priority P3
same issue!
:+1:
/kind bug
/remove-priority P3
/priority P2
/remove-kind feature
So is there any workaround to set image for init container?
I trying to run migrations with "fresh" image on init container.
Thanks for any help!
/assign vithati
|
import { getToken } from '../auth';
import { TooManyIdsError } from '../errors/ubiErrors';
import { fetch } from '../fetch';
import { URLS } from '../ubicontants';
import { stringify } from 'querystring';
import { Platform, Region } from '@r6db/constants';
import { UUID } from '@r6db/interfaces';
interface ISingleProfile {
board_id: 'pvp_ranked';
past_season_abandons: number;
update_time: string;
skill_mean: number;
abandons: number;
season: number;
region: Region;
profile_id: UUID;
past_season_losses: number;
max_mmr: number;
mmr: number;
wins: number;
skill_stdev: number;
rank: number;
losses: number;
next_rank_mmr: number;
past_seasons_wins: number;
previous_rank_mmr: number;
max_rank: number;
}
interface IGetRanksResponse {
players: {
[profileId: string]: ISingleProfile;
};
}
interface IRanks {
region: Region;
abandons: number;
losses: number;
max_mmr: number;
max_rank: number;
mmr: number;
skill_mean: number;
skill_stdev: number;
wins: number;
rank: number;
}
export interface IGetRanks {
id: UUID;
season: number;
apac: IRanks;
emea: IRanks;
ncsa: IRanks;
}
interface IGetRanksQuery {
season_id: number;
region_id: Region;
profile_ids: string;
board_id: 'pvp_ranked';
}
export interface IGetRanksOptions {
season_id?: number;
}
const regions = [Region.APAC, Region.EMEA, Region.NCSA];
export const getRanks = async (platform: Platform, ids: UUID[], opts: IGetRanksOptions): Promise<IGetRanks[]> => {
const query: UUID[] = ([] as UUID[]).concat(ids);
if (query.length > 40) {
throw new TooManyIdsError('too many ids passed (max 40)');
}
const token = await getToken();
try {
const response: IGetRanks[] = [];
const [apac, emea, ncsa] = await Promise.all(
regions.map(async region => {
const defaults: Required<IGetRanksOptions> = { season_id: -1 };
const overrides: Partial<IGetRanksQuery> = {
region_id: region,
profile_ids: query.join(','),
board_id: 'pvp_ranked',
};
const options: Partial<IGetRanksQuery> = {
...defaults,
...opts,
...overrides,
};
const res = await fetch<IGetRanksResponse>(`${URLS[platform].RANK_URL}${stringify(options)}`)(token);
return res.players;
}),
);
query.forEach(id => {
if (!apac[id] && !emea[id] && !ncsa[id]) {
console.warn({ id, warning: 'Could not get ranks for player' });
} else if (!apac[id] || !emea[id] || !ncsa[id]) {
console.warn({ id, warning: 'Missing region from rankget', apac, emea, ncsa });
} else {
response.push({
id,
season: apac[id].season,
apac: {
region: Region.APAC,
abandons: apac[id].abandons,
losses: apac[id].losses,
max_mmr: apac[id].max_mmr,
max_rank: apac[id].max_rank,
mmr: apac[id].mmr,
rank: apac[id].rank,
skill_mean: apac[id].skill_mean,
skill_stdev: apac[id].skill_stdev,
wins: apac[id].wins,
},
emea: {
region: Region.EMEA,
abandons: emea[id].abandons,
losses: emea[id].losses,
max_mmr: emea[id].max_mmr,
max_rank: emea[id].max_rank,
mmr: emea[id].mmr,
rank: emea[id].rank,
skill_mean: emea[id].skill_mean,
skill_stdev: emea[id].skill_stdev,
wins: emea[id].wins,
},
ncsa: {
region: Region.NCSA,
abandons: ncsa[id].abandons,
losses: ncsa[id].losses,
max_mmr: ncsa[id].max_mmr,
max_rank: ncsa[id].max_rank,
mmr: ncsa[id].mmr,
rank: ncsa[id].rank,
skill_mean: ncsa[id].skill_mean,
skill_stdev: ncsa[id].skill_stdev,
wins: ncsa[id].wins,
},
});
}
});
return response;
} catch (err) {
console.error({ command: 'getRanks', err, platform, ids });
throw err;
}
};
|
const api = ((window as unknown) as {
api: {
log: (...args: any[]) => void,
click: () => void,
crouch: (down: boolean) => void,
walk: (foreward: boolean) => void,
sendGameEnded: (reopen: boolean) => void,
sendLogin: (user: string, pass: string) => void,
onCounter: (handler: (counter: number) => void) => void,
onLogin: (handler: (user: string, pass: string) => void) => void
}
}).api;
const krunkerFunctions = ((window as unknown) as {
clearPops: () => void,
showWindow: (n: number) => void,
loginAcc: () => void
});
let enabled = true;
let cps = 3;
let counter = 0;
let login: { user: string, pass: string } | undefined;
let isLoggingIn = false;
let foreward = true;
let timeout = Date.now();
const display = document.createElement('div');
display.style.position = 'fixed';
display.style.right = '10px';
display.style.top = '35%';
display.style.color = 'white';
display.style.padding = '20px';
display.style.borderRadius = '8px';
display.style.background = 'rgba(1, 1, 1, 0.5)';
display.style.zIndex = '2147483647';
display.style.textAlign = 'left';
document.getElementById('gameUI')?.appendChild(display);
const updateDisplay = (): void => {
display.innerHTML =
`State: <span style="color: ${enabled ? 'lime">Enabled' : 'tomato">Disabled'}</span><br/>
Crouches per second: <span style="color:${cps >= 4 ? 'tomato' : 'deepskyblue'}">${cps}</span><br/>
Crouches this session: <span style="color:deepskyblue">${counter}</span><br/>
Timeout in: <span style="color:deepskyblue">${Math.floor((265000 - (Date.now() - timeout)) / 1000)}</span><hr/>
<span style="color:gray">[Esc]</span> to turn on/off<br/>
<span style="color:gray">[N]</span> to change lobby<br/>
<span style="color:gray">[L]</span> to set autologin<br/>
<span style="color:gray">[Up/Down]</span> to change speed`;
};
const loginForm = document.createElement('form');
loginForm.style.position = 'fixed';
loginForm.style.left = '50%';
loginForm.style.top = '50%';
loginForm.style.transform = 'translate(-50%, -50%)';
loginForm.style.color = 'white';
loginForm.style.padding = '20px';
loginForm.style.borderRadius = '8px';
loginForm.style.background = 'rgba(1, 1, 1, 0.5)';
loginForm.style.zIndex = '2147483647';
loginForm.style.textAlign = 'left';
loginForm.style.display = 'none';
document.getElementById('gameUI')?.appendChild(loginForm);
loginForm.innerHTML = `
Save login information<br />
<input type="text" placeholder="Username" /><br />
<input type="password" placeholder="Password" /><br />
<input type="submit" value="Save" />
`;
loginForm.onsubmit = (e) => {
e.preventDefault();
login = {
user: (loginForm.children[1] as HTMLInputElement).value,
pass: (loginForm.children[3] as HTMLInputElement).value
};
api.sendLogin(login.user, login.pass);
enabled = true;
loginForm.style.display = 'none';
};
api.onCounter((c) => {
counter = c;
updateDisplay();
});
api.onLogin((user, pass) => {
login = { user, pass };
});
document.addEventListener('keydown', (e) => {
if (e.key === 'Escape' && loginForm.style.display === 'none') {
enabled = !enabled;
}
if (e.key === 'n' && loginForm.style.display === 'none') {
api.sendGameEnded(false);
}
if (e.key === 'l' && loginForm.style.display === 'none') {
enabled = false;
loginForm.style.display = 'block';
document.exitPointerLock();
} else if (e.key === 'Escape' && loginForm.style.display === 'block') {
enabled = true;
loginForm.style.display = 'none';
}
if (e.key === 'ArrowUp' && cps < 10) {
cps += 1;
}
if (e.key === 'ArrowDown' && cps > 1) {
cps -= 1;
}
if (e.key !== 'Shift') {
updateDisplay();
}
});
setInterval(() => {
if (Date.now() - timeout >= 265000) {
api.sendGameEnded(true);
return;
}
if (enabled && document.getElementById('initLoader')?.style.display === 'none') {
api.walk(foreward);
foreward = !foreward;
krunkerFunctions.clearPops();
if (!login) {
enabled = false;
loginForm.style.display = 'block';
} else if (document.getElementById('menuAccountUsername')?.textContent === '?' && !isLoggingIn) {
isLoggingIn = true;
setTimeout(() => {
if (document.getElementById('menuAccountUsername')?.textContent === '?') {
krunkerFunctions.showWindow(5);
(document.getElementById('accName') as HTMLInputElement).value = login!.user;
(document.getElementById('accPass') as HTMLInputElement).value = login!.pass;
krunkerFunctions.loginAcc();
}
}, 5000);
} else if (document.getElementById('menuAccountUsername')?.textContent !== '?') {
krunkerFunctions.showWindow(0);
api.click();
}
const timer = document.getElementById('timerVal')?.textContent;
if (timer === '00:00' && document.getElementsByClassName('endTableN').length > 1) {
api.sendGameEnded(false);
} else if (timer === '00:00') {
timeout = Date.now();
}
} else if (document.getElementById('initLoader')?.style.display === 'none') {
timeout = Date.now();
}
}, 750);
let down = false;
const toggleCrouch = (): void => {
if (enabled && document.getElementById('inGameUI')!.style.display === 'block') {
down = !down;
api.crouch(down);
}
setTimeout(toggleCrouch, 500 / cps);
};
toggleCrouch();
|
Public Transport and Feeder Modes considering Social Distancing Norms
Public transport which include buses and metro plays major role in people mobility in urban and rural areas of India. Presently, around 10 cities are having operational metro network with a total network of more than 700 kilometers and about 525 metro stations. Similarly, more than 1.6 million buses are registered in India, and the public bus sector operates 170,000 buses carrying roughly 70 million people per day. During the present prevailing COVID-19 pandemic situation, there may be high risk for commuters travelling by metro and bus and chances of spreading of virus are also very high. As recommended by World Health Organization (WHO) and Government Health Ministries recommended to maintain social distance of 6 feet to control the spread of the virus through person-to-person. In Delhi, more than 80 lakh trips are made by public transport i.e. Bus and Metro in a day. It’s always been a challenge to manage the gap between demand and supply of commuting. This gap is going to be further widened due to COVID pandemic requiring the social distancing practices. In view of this, a systematic and strategic approach is required to be adopted to move ahead during the COVID19 pandemic. A gradual change in demand/ supply and adoption of circumstances by commuters is expected. The great challenge of both sides has to be dealt with carefully.
|
export enum Operation {
NONE = 'NONE',
ENTRANCE = 'ENTRANCE',
EXIT = 'EXIT'
}
|
Exercise device with swing function
ABSTRACT
An exercise device with a swing function includes a main body and a plurality of support mechanisms. The main body has a base which includes a front part and a back part. Each of the plurality of support mechanisms has a height and is abutted upon a ground to sustain the base. The height of each of the plurality of support mechanisms is changeable. When the main body is controlled to drive the base, the base stresses each of the plurality of support mechanisms to change its height. Therefore, the main body can be inclined to any direction to form a swing motion.
1. FIELD OF THE INVENTION
The present disclosure relates to an exercise device, and more particularly to an exercise device capable of producing a swing motion from the left to right with respect to the ground.
2. DESCRIPTION OF THE RELATED ART
As we all know, doing exercise is an important way to promote human's health. Furthermore, apart from promoting the health, doing exercise can also help to shape human's body curve. As a result, the exercise atmosphere becomes very popular in current society. Most of modern people just have free time at night because of busy life, but many factors are detrimental for doing exercise at night. For example, night temperature is lower, respiration of plants at night leads oxygen content in the atmosphere to be lower, a lot of crime may be existed at night and so on. Thus, indoor exercise equipment gets people's lots of attractions because people can use the exercise equipment to do exercise at home or at a gymnasium.
In a traditional indoor exercise equipment such as an exercise bike, a bike body is fixed on a base to allow a user for treading. However, in the aforesaid structure the bike body is stayed immovably during the treading process, so the user may miss a real riding experience and feel bored during the exercise, and it results in reducing the pleasure of the exercise.
Thus, how to solve the above problems becomes a major issue in the present disclosure.
SUMMARY OF THE INVENTION
The major objective of the present disclosure is to provide an exercise device with a swing function, and the exercise device includes elastic support mechanisms at the left part and the right part of the bottom thereof. During operation of the exercise device, heights of the left part and the right part from the ground may be changed accordingly, so as to produce a swing motion.
In order to achieve the above objective, the present disclosure is to provide an exercise device with a swing function, and the exercise device includes a main body and a plurality of support mechanisms.
The main body has a base which includes a front part and a back part.
The plurality of support mechanisms which are disposed on the front part and the back part respectively, and each of the plurality of support mechanisms has a height and is abutted upon a ground to support the base. The height of each of the plurality of support mechanisms is changeable. When the main body is controlled to drive the base, the plurality of support mechanisms are forced by the base to change the heights thereof respectively, such that the main body can be inclined to any direction to produce a swing motion.
In one embodiment, each of the support mechanisms has a fixed member and an elastic member. The fixed member is fastened with the base. The elastic member is linked to the fixed member at an end thereof and abutted upon the ground at other end thereof. The motion of the base enables deformation of the elastic member to change the height of the elastic member, so as to change the height of the support mechanism.
In another embodiment, the support mechanism has a fixed cylinder, a first elastic member, a support cylinder and a foundation. The fixed cylinder is fastened with the base and has a hollow space therein. The foundation is abutted upon the ground, and the support cylinder is pivoted on the foundation and inserted into the hollow space. The first elastic member is disposed in the hollow space. The first elastic member is abutted upon a top surface of the fixed cylinder at an end thereof and abutted upon the support cylinder at other end thereof. The motion of the base enables deformation of the first elastic member to change a height of the first elastic member, so as to change the height of the support mechanism.
Furthermore, the base has support parts at the front part and the back part thereof respectively. Each of the support part has an arc-shaped bottom abutted upon the ground, and a position where the ground abuts the bottom is defined as a pivot. With the swing motion of the base to the left and right, the position of the pivot on the bottom of the support part is changed accordingly.
The above objectives and advantages of the present disclosure can have a gain insight easily by choosing from the detailed description and the accompanying drawings in the following embodiments.
BRIEF DESCRIPTION OF THE DRAWINGS
The detailed structure, operating principle and effects of the present disclosure will now be described in more details hereinafter with reference to the accompanying drawings that show various embodiments of the present disclosure as follows.
FIG. 1 shows a perspective view of an exercise device according to a first embodiment of the present disclosure.
FIG. 2 shows a sectional exploded view of the exercise device according to the first embodiment of the present disclosure.
FIG. 3 shows a sectional view of a working status of the exercise device according to the first embodiment of the present disclosure.
FIG. 4 shows a perspective view of the exercise device according to a second embodiment of the present disclosure.
FIG. 5 shows a sectional view of the working status of the exercise device according to the second embodiment of the present disclosure.
FIG. 6 shows a perspective view of the exercise device according to a third embodiment of the present disclosure.
FIG. 7 shows a sectional exploded view of the exercise device according to the third embodiment of the present disclosure.
FIG. 8 shows a sectional view of a working status of the exercise device according to the third embodiment of the present disclosure.
FIG. 9 shows a perspective view of the exercise device according to a fourth embodiment of the present disclosure.
FIG. 10 shows a sectional view of the working status of the exercise device according to the fourth embodiment of the present disclosure.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Reference will now be made in detail to the exemplary embodiments of the present disclosure, examples of which are illustrated in the accompanying drawings. Therefore, it is to be understood that the foregoing is illustrative of exemplary embodiments and is not to be construed as limited to the specific embodiments disclosed, and that modifications to the disclosed exemplary embodiments, as well as other exemplary embodiments, are intended to be included within the scope of the appended claims. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the inventive concept to those skilled in the art. The relative proportions and ratios of elements in the drawings may be exaggerated or diminished in size for the sake of clarity and convenience in the drawings, and such arbitrary proportions are only illustrative and not limiting in any way. The same reference numbers are used in the drawings and the description to refer to the same or like parts.
It will be understood that, although the terms ‘first’, ‘second’, ‘third’, etc., may be used herein to describe various elements, these elements should not be limited by these terms. The terms are used only for the purpose of distinguishing one component from another component. Thus, a first element discussed below could be termed a second element without departing from the teachings of embodiments. As used herein, the term “or” includes any and all combinations of one or more of the associated listed items.
Please refer to FIG. 1 which shows a perspective view of an exercise device with a swing motion according to the first embodiment of the present disclosure. A main body 1 of the exercise device is shown in the FIG. 1. In the present disclosure, the main body 1 may be any type of the exercise device, and the exercise bike is just taken as example for illustration. In the present embodiment, the main body 1 includes a support frame 11, and the support frame 11 includes a handle 12, a seat 13 and a rotating mechanism 14 which is driven by treading. A user can sit on the seat 13, hold the handle 12 by hand, and tread the rotating mechanism 14 by feet at the same time, so as to obtain an effect of exercising.
The main body 1 has a base 2, and a front part 21 and a back part 22 are defined in the base 2. Support mechanisms 3 are mounted on the front part 21 and the back part 22 respectively. In the present embodiment, the support mechanisms 3 are provided on a left part and a right part of the front part 21 and the back part 22, respectively. Each of the support mechanisms 3 is abutted upon the ground and has a height, and the base 2 is sustained by the support mechanisms 3 from the ground by a distance. The heights of the support mechanisms are changeable. Therefore, when the user controls the main body 1 to produce motion, the base 2 is driven to force the height of each support mechanism to be changed. Then the main body 1 can be inclined to any direction to produce a swing motion.
The detailed structure of the support mechanism 3 is shown in FIG. 2, and the support mechanism 3 includes a fixed member 31 and an elastic member. The fixed member 31 is fastened with the base 2 and the fixed member 31 has a threaded hole 32. In the present embodiment, the elastic member is an elastic column 33 which is made of elastic material, and has a deformable characteristic. A threaded bolt 34 is extended from an end of the elastic column 33, and the threaded bolt 34 is used to be screwed to the threaded hole 32 of the fixed member 31. The elastic column 33 is abutted upon the ground 5 at other end thereof.
By the above structure, the base 2 is driven when the user controls the main body to have an exercise. For example, when the user controls the main body 1 to incline to the left, as shown in FIG. 3, the base 2 is inclined to the left to stress the support mechanism 3A disposed at the left part of the base 2. At this moment, the elastic column 33 of the stressed support mechanism 3A is compressed to reduce the height thereof, and it results in a height reduction of the support mechanism 3A. Therefore, the height of the left part of the base 2 being sustained with respect to the ground is reduced, and the main body 1 is inclined to the left successfully. On the other hand, the manner of inclining the main body 1 to the right is equal to that of inclining the main body 1 to the left, so the detail description is omitted here. According to the exercise device of this embodiment, the main body 1 may be inclined to any direction to produce a swing motion.
FIG. 4 and FIG. 5 show a second embodiment of the present disclosure. The difference between the second present embodiment and the first embodiment is that support parts 23 are additionally disposed at the front part 21 and the back part 22 of the base 2 respectively. The support part 23 has an arc-shaped bottom 24 abutted upon the ground 5, and a position where the bottom 24 is abutted with the ground 5 is defined as a pivot 25. With the swing motion of the main body 1 controlled by the user in the above description, the support part 23 can be rolled on the ground 5 via the arc-shaped bottom 24 thereof, so the position of the pivot 25 on the bottom 24 is changeable. In the present embodiment, the capability of sustaining the main body 1 and the base 2 can be enhanced by the support part 23.
The present disclosure further provides a third embodiment as shown in FIG. 6 and FIG. 7. The difference between the third embodiment and the first embodiment is the change in the support mechanism. The other parts of the third embodiment are the same as that of the first embodiment. The support mechanism 4 of the third embodiment has a fixed cylinder 41, a first elastic member 42, a second elastic member 43, a support cylinder 44 and a foundation 45. The fixed cylinder 41 includes a hollow space 411 therein and the fixed cylinder 41 is fastened with the base 2. In the embodiment, the fixed cylinders 41 are disposed on the left part and the right part of the front part 21 and the back part 22 of the base 2, respectively. On the other hand, the foundation 45 is disposed on the ground 5, and the support cylinder 44 is pivoted on the foundation 45. The support cylinder 44 has a spherical pivot part 441 at a bottom thereof, and the support cylinder 44 is pivoted on the foundation 45 via the spherical pivot part 441. Therefore, the support cylinder 44 can perform a universal pivoting towards any direction with respect to the foundation 45.
A top end of the support cylinder 44 is extended into the hollow space of the fixed cylinder 41, and an abutting block 442 is disposed at the top end. A first elastic member 42 and a second elastic member 43 are disposed at both sides of the abutting block 442 in the hollow space 411, and the first elastic member 42 is abutted with atop surface 412 of the fixed cylinder 411 at one end thereof and abutted with the abutting block 442 at other end thereof. The second elastic member 43 is sleeved outside of the support cylinder 44, and the second elastic member 43 is abutted with a bottom 413 of the fixed cylinder 41 at an end thereof and abutted with the abutting block 442 at other end thereof. In the present embodiment, the first elastic member 42 has an elastic structure made of elastic materials, the second elastic member 43 is a spring, and both them can be deformed to change heights thereof. According to the structure, the support mechanism 4 can be abutted upon the ground 5 via the foundation 45, and the base 2 is sustained by using the support cylinder 44 and two elastic members 42 and 43 to sustain the fixed cylinder 41.
When the user controls the main body to do exercise, the base 2 is driven correspondingly. For example, when the user controls the main body 1 to incline to the left, as shown in FIG. 8, the base 2 is forced to incline to the left and then stresses the support mechanism 4A disposed at the left part of the base 2. At this moment, in the stressed support mechanism 4A, the fixed cylinder 41 compresses the first elastic column 42 to reduce the height of the first elastic member 42, and it results in a height reduction of the support mechanism 4A, and the height of the left end of the base 2 being sustained with respect to the ground is further reduced, whereby the main body 1 is inclined to the left successfully. On the other hand, the manner of inclining the main body 1 to the right is equal to the one of inclining the main body 1 to the left, so the detailed description is omitted. According to the exercise device, the main body 1 can be inclined to any direction to produce a swing motion.
In addition, FIG. 9 and FIG. 10 show a fourth embodiment of the present disclosure. A difference between the fourth embodiment and the third embodiment is that support parts 26 are additionally disposed on both the front part 21 and the back part 22 of the base 2 of the third embodiment, respectively. Each of the support parts 26 has an arc-shaped bottom 27 abutted upon the ground 5, and a position where the bottom 27 is abutted upon the ground 5 is defined as a pivot 28. With the swing motion of the main body 1 controlled by the user in the above description, the support part 26 can be rolled on the ground 5 via the arc-shaped bottom 27, so the position of the pivot 28 on the bottom 27 is changeable. In the present embodiment, the capability of sustaining the main body 1 and the base 2 can be may enhanced by the support parts 26.
The above-mentioned descriptions represent merely the exemplary embodiment of the present disclosure, without any intention to limit the scope of the present disclosure thereto. Various equivalent changes, alternations or modifications based on the claims of present disclosure are all consequently viewed as being embraced by the scope of the present disclosure.
The invention claimed is:
1. An exercise device with a swing motion, comprising: a main body having a base which includes a front part and a back part; and a plurality of support mechanisms disposed on the front part and the back part respectively, each of the plurality of support mechanisms having a height and disposed upon a support surface to sustain the base; wherein each of the plurality of support mechanisms is changeable in height, and when the main body is controlled to drive the base, the base forces the plurality of support mechanisms to change in height respectively, so that the main body is inclined to any direction in a swing motion; wherein the main body includes a support frame having a handle, a seat and a rotating mechanism driven by treading wherein the support mechanism includes a fixed cylinder, a first elastic member, a support cylinder and a foundation, the fixed cylinder is fastened with the base, and the fixed cylinder includes a hollow space therein, the foundation is disposed upon the support surface, and the support cylinder is pivoted on the foundation and is extended into the hollow space, the first elastic member is disposed in the hollow space and abuts a top surface of the fixed cylinder at an end thereof and abuts the support cylinder at another end thereof, the motion of the base enables deformation of the first elastic member to change in height and thereby change the support mechanism in height.
2. The exercise device of claim 1, wherein both the front part and the back part of the base include support parts respectively, the support part includes an arc-shaped bottom abutted upon the support surface, a position where the support surface abuts the bottom is defined as a pivot, and the position of the pivot on the bottom of the support part is changed according to the swing motion of the base.
3. The exercise device of claim 1, wherein the support mechanism further includes a second elastic member which is disposed in the hollow space and sleeved outside of the support cylinder, and the second elastic member abuts a bottom surface of the fixed cylinder at an end thereof and abuts the support cylinder at another end thereof.
4. The exercise device of claim 1, wherein both the front part and the back part of the base include support parts respectively, each of the support parts includes an arc-shaped bottom abutted upon the support surface, and a portion of the bottom is contacting the support surface defining a pivot, the position of the pivot on the bottom of the support part changing laterally according to the swing motion of the base.
|
Phantasm (Orpheus)
Phantasm has many things in common with the Arcanos Phantasm from Wraith: The Oblivion.
Horrors
Manifestation Forms
Zero Vitality: Appears as a flat shadow with no light source, can also whisper short phrases.
One Vitality: Appears as a three-dimensional shadow with a more humanoid shape
Two Vitality: Fully human, but reflecting how they truly see themselves.
|
Ocean [ah42], ocean, in The Inner Sea
Last updated Turn #79
Ocean [ah42], ocean, in The Inner Sea
------------------------------------------------------------------------
26: Fast Sail [ht2u], ship, 3 hulls, 1 rowing port, 9 sails, 8% damaged,
26: arrived from Ocean [ah41], owner:
26: Stewart [k0u], Pen, with 12 sailors
27: Fast Sail [ht2u], ship, 3 hulls, 1 rowing port, 9 sails, 8% damaged,
27: departed for Ocean [ah43].
Routes leaving Ocean:
North, to Ocean [ag42], Crystal Sea, 6 days
East, to Ocean [ah43], 6 days
South, to Ocean [ai42], 6 days
West, to Ocean [ah41], 6 days
|
Getting SimpleDateFormat for specific timezone
I am having a hard time displaying time for a specific timezone. I have a TV Guide like app that gets all start times of the programs in Unix epoch time from the server and I want the times to be shown in the time it would be in the Netherlands wherever the app user is and from whatever android device. After a bit of researching I would think it would work like this:
new SimpleDateFormat("HH:mm", new Locale("nl", "NL")).format(new Date(time*1000));
where time is a epoch time for example<PHONE_NUMBER>
This is 07:40 in the Netherlands but it seems it just takes the timezone of the device you are using. Tested it on a Samsung Galaxy Tab 2.0
What am I doing wrong?
A related question:
According to http://developer.android.com/reference/java/util/Locale.html I can't assume the nl_NL Locale is available on every device, how would I solve this?
Sidenote: http://www.epochconverter.com/ is a nice way to quickly see what time a certain epoch time is.
Use setTimeZone():
SimpleDateFormat simpleDateFormat = new SimpleDateFormat("HH:mm", new Locale("nl", "NL"));
simpleDateFormat.setTimeZone(TimeZone.getTimeZone("Europe/Amsterdam"));
A related question: According to http://developer.android.com/reference/java/util/Locale.html I can't assume the nl_NL Locale is available on every device, how would I solve this?
Are you talking about the UI here? If so, then you can not solve it. Only Google and/or OEMs can add new locales to the system.
|
Extension:CommentPages
Source
Source is available here on SVN.....
This is GPL, by the way.
Installation
First, download the latest snapshot and extract it to your extensions directory.
The above could look different if you have more namespaces.
100 should be changed to the key for your "Comments" namespace, whatever that is (something > 100).
This is not yet perfect, and I'm open to suggestions for improvements.
|
Java Edition 19w44a
General
* Tags
* Added the block tag.
Items
* Honey bottles
* Are now stackable (up to 16).
Mobs
* Iron golems
* Iron golem's damage progress is now based on the ratio of current health to max health.
* Parrots
* No longer imitate polar bears, wolves, and zombie pigmen.
General
* Chunks
* Improved performance of chunk saving.
* Particles
* Vertically moving particles now perform better when colliding with blocks.
* Recipe book
* Many recipes changed to only require one material instead of nine to unlock.
Video
Video made by slicedlime:
|
γδ T cells and the PD-1/PD-L1 axis: a love–hate relationship in the tumor microenvironment
Gamma delta (γδ) T cells demonstrate strong cytotoxicity against diverse cancer cell types in an MHC-independent manner, rendering them promising contenders for cancer therapy. Although amplification and adoptive transfer of γδ T cells are being evaluated in the clinic, their therapeutic efficacy remains unsatisfactory, primarily due to the influence of the immunosuppressive tumor microenvironment (TME). Currently, the utilization of targeted therapeutic antibodies against inhibitory immune checkpoint (ICP) molecules is a viable approach to counteract the immunosuppressive consequences of the TME. Notably, PD-1/PD-L1 checkpoint inhibitors are considered primary treatment options for diverse malignancies, with the objective of preserving the response of αβ T cells. However, γδ T cells also infiltrate various human cancers and are important participants in cancer immunity, thereby influencing patient prognosis. Hence, it is imperative to comprehend the reciprocal impact of the PD-1/PD-L1 axis on γδ T cells. This understanding can serve as a therapeutic foundation for improving γδ T cells adoptive transfer therapy and may offer a novel avenue for future combined immunotherapeutic approaches.
Background
Γδ T cells in humans are classified into three main subgroups according to the γδ chains of T cell receptors (TCRs) [1].There are three major γδ T cell subsets classified based on their T cell receptor delta variable (TRDV) genes, which are referred to as Vδ1, Vδ2, and Vδ3 [2] The majority of γδ T cells are in the peripheral circulation comprised of the Vδ2 chain and Vγ9 chain paired population, known as Vγ9Vδ2 T cells.The Vδ1 chain and various Vγ chain paired groups are predominantly found in the skin and mucosa.Vδ3 T cells constitute the majority of non Vδ1 cells and non Vδ2 γδ T cells, which are present in a significant proportion of the liver.
Besides this "innate" programming, the subgroups of γδ T cells retain functional plasticity.In the context of TME, -classification of γδ T based on function rather than TCR phenotype, will describe its functions more objectively.This is immune functions are often switchable, allowing them to exert different effector functions based on the inflammatory background and participating receptors [2,3].Studies have also indicated that a subset of γδ T cells, known as γδ T17 cells, can secrete IL-17 within the TME [4].These cells have been proven to drive cancer progression by exerting downstream effects on cancer cells, endothelial cells, and other immune cell populations [5].
Similar to those of αβ T cells, the effector functions of γδ T cells can be differentiated based on the expression of CD45RA and CD27, including naïve (T naïve ), central memory (T CM ), effector memory (T EM ), and terminally differentiated (T EMRA ) subsets [6].γδ T cells can directly recognize tumor cells via their TCRs and natural killer cell receptors (NKRs).They are capable of producing interferon γ (IFN-γ) and tumor necrosis factor (TNF), as well as exerting antigen presentation functions to activate αβ T cells, thereby inducing antitumor immunity.Furthermore, when exposed to tumor specific antibodies, γδ T cells can effectively target tumor cells through antibody dependent cellular cytotoxicity (ADCC) [7].
Due to the potent antitumor abilities of γδ T cells, both in vivo and in vitro studies have been conducted to expand these cells, with the aim of utilizing adoptive immunotherapy [8].γδ T cells exhibit reduced infiltration and frequently experience immune tolerance and exhaustion in the immune microenvironment [9][10][11].The swift development of tolerance in γδ T cells has even been observed in terminal cancer patients with B cell tumors [12].Therefore, gaining a deeper comprehension of the expression and regulation of immunosuppressive molecules in γδ T cells has significant implications for advancing immune checkpoint blockade (ICB) therapy and adoptive transfer therapy.This article provides a comprehensive overview of the involvement of the PD-1/ PD-L1 signaling pathway in the proliferation, activation, and antitumor properties of γδ T cells, along with their potential application in immunotherapy.
The expression of PD-1 and function of γδ T cells in healthy individuals
Vδ2 chains are predominant in peripheral blood (PB), and the proportion of PD-1 expressing Vδ2 T cells decreases with maturity, with the highest expression in healthy umbilical cord blood, followed by Vδ2 T cells from infants and then lowest in adults [13].After in vitro activation, the expression time of PD-1 in Vδ2 T cells from neonates is longer than that in adult Vδ2 T cells, suggesting that PD-1 may be a crucial regulator in early life [13].
The expression of CD56 and PD-1 can be used to evaluate the cytotoxic potential of Vδ2 T cells in umbilical cord blood.The PD-1 − CD56 + subgroup has higher expression of perforin (PRF1) and higher expression of genes linked with NK-mediated cytotoxicity [14].Compared to umbilical cord blood cells, peripheral Vδ2 T cells from 12 month-old infants exhibit stronger proliferative responses and cytotoxic functions that are similar to those in adults.The enhanced capacity of Vδ2 T cells in infants to generate cytotoxic mediators is also congruent with a reduction in PD-1 expression and an increase in NKG2A expression [13].The percentage of Vδ1 T cells is considerably lower than that of Vδ2 T cells, and healthy individuals' breast and lung tissues harbor a distinct subset of resident Vδ1 T cells [15,16].An investigation of immune cell repositories in healthy adults revealed that PD-1 expression in Vδ1 T cells is higher than that in Vδ2 T cells [17].
Generally, Vδ2 T cells amplified by zoledronic acid (Zol) and IL-2 have potential clinical efficacy as demonstrated by the ability to effectively eliminate cancer cells in vitro [17,18].Circulating adult Vγ9Vδ2 T cells express minimal levels of PD-1, which peaks at 3-4 days following activation and subsequently rapidly decreases to baseline levels within 7 days [19].PD-1, TIM3 and CTLA-4 exhibit slight changes in expression within 14 days of amplification, but granzyme B (GZMB) is sharply upregulated on the third day and rapidly decreases [20].During the amplification of Vδ2 T cells, the expression of ICPs increases in a Zol dose-dependent manner [21].Similarly, the expression of inhibitory receptors during the amplification of Vγ2Vδ2 T cells exhibited upregulation on the third day, and PD-1 was expressed on the majority of Vγ2Vδ2 T cells.However, by the 14th day, Vγ2Vδ2 T cells lost the expression of PD-1 as well as CTLA4 [22].
Additionally, Vδ1 T cells amplified with IL-7 and phytohemagglutinin (PHA) demonstrated superior efficacy in killing cancer cells compared to Vδ2 T cells amplified by ZOL and IL-2.Furthermore, the expression levels of PD-1 and CTLA-4 are increased on Vδ2 T cells amplified with PHA and IL-7, while no such increase was observed in Vδ1 T cells [23].
The function and immunosuppressive phenotype of γδ T cells in cancer patients
Numerous studies have documented a favorable association between the prognostic outcomes of patients with tumors and γδ tumor-infiltrating lymphocytes (TILs) [2].However, the influence of immunosuppressive molecule expression on the functionality of these γδ TILs remains uncertain.In the context of cancer, γδ T cells undergo functional alterations, and the presence of PD-1 expressing γδ TILs has been observed in pancreatic ductal adenocarcinoma (PDAC), colorectal cancer (CRC), and multiple myeloma (MM) [24].The expression of PD-1 serves as an indicator of γδ T cell functionality to a certain degree and can subsequently impact patient prognosis.
γδ T cells tend to accumulate at the T CM stage in metastatic tumors of cancer patients.But following tumor progresses, there is a tendency toward an increase in the proportions of CD25 + FoxP3 + regulatory γδ T cells in advanced disease compared to early stage.CD25 + FoxP3 + regulatory γδ T cells are associated with poorer clinical outcomes.Additionally, the presence of LAG3, TIM3, PD-1 and 4-1BBL on peripheral γδ T cells and γδ TILs is related to early recurrence and shorter overall survival (OS) [25].
In an analysis of CRC samples, it was found that CD3 T cells accounted for an average of 20% of the total white blood cell (CD45) population.The percentage of B lymphocytes (6%) and NK lymphocytes (10%) is lower than that of CD3 T cells, while γδ T cells account for approximately 4.5% of the total white blood cell population [26].In research on endometrial cancer and CRC, it was observed that γδ T cells express low levels of CTLA-4, PD-1, TIM3 and LAG3, akin to NK cells [27].γδ T cells are more likely to constitute a subgroup of T cells with tumor cytotoxicity, and their immunosuppressive impact may be comparatively lower than that of other populations of antitumor cells (such as CD8, CD4 and mucosalassociated invariant (MAI) T cells) [28].
Additionally, γδ T cells are capable of sustaining elevated levels of cytotoxic effector molecules, such as GZMB, PRF1 and IFN-γ, similar to NK cells and CD8 T cells [27].This observation aligns with previous findings from single-cell sequencing analysis of blood and tumor samples, which indicate that γδ T cells possess a mixed phenotype resembling both CD8 T cells and NK cells [28].There are also studies demonstrating that γδ T cells infiltrating CRC exhibit more pronounced functional exhaustion than CD8 T cells or NK cells.Specifically, the levels of VISTA, PD-1 and TIM3 expressed by γδ T cells are much higher, while the levels of TNF-α and IFN-γ are considerably lower in γδ T than in NK cells or CD8 T cells in CRC [29].Further studies have demonstrated that c-Maf promotes the upregulation of inhibitory receptors, thereby resulting in γδ T cell exhaustion [29].
Compared to those in healthy individuals, γδ T cells in tumor patients exhibit an increased immunosuppressive phenotype.In late-stage breast cancer samples, more than 20% of γδ TILs express CD73 and produce immunosuppressive cytokines (IL-8, IL-10, and adenosine) to facilitate tumor growth [30].Furthermore, the ratio of peripheral γδ T cells in melanoma patients expressing TIM3, LAG3, 4-1BB, and ICOSL is higher than that in healthy donors, while the cytotoxic potential of γδ T cells is compromised both in PB and tumor tissue [25].
The proportion of PD-1 + TIM3 + Vδ2 T cells is strongly higher in individuals with acute myeloid leukemia (AML) than in healthy controls [31].Additionally, analysis of PB samples from AML patients in The Cancer Genome Atlas (TCGA) database revealed that elevated levels of FOXP3 and PD-1 co-expression on γδ T cells were associated with adverse clinical outcomes [32].Similarly, γδ TILs in colon cancer mainly express PD-1 + CD8α − [33], in contrast to γδ T cells from PB and adjacent normal colon tissue, which display an effector phenotype but a diminished ability to secrete IFN-γ [26].PD-1 + CD8α − γδ T cells preferentially express IL-17, while PD-1 − CD8α + γδ T cells preferentially produce IFN-γ [33].The supernatant derived from cancer stem cells significantly inhibits the release of IFN-γ by γδ T cells while concurrently promoting the generation of IL-17 [26].Furthermore, studies have indicated that Treg cells mediate the antitumor inhibition of γδ T cells in an IL-10 and TGF-β dependent manner [9].More than 50% of CRC patients will experience colon liver metastatic (CLM).However, unlike in situ tumors, intrahepatic γδ TILs exhibit high cytotoxic potential in CLM, with low or negative expression of PDCD1 and CTLA4 [34].
The upregulation of PD-1 on γδ T cells can affect their potential toxicity to tumor cells.However, the mere increase in PD-1 expression alone cannot fully define the functional phenotype of γδ T cells in various tumor types.A comprehensive assessment involving other markers and indicators is necessary.In AML patients, PD-1 + γδ T cells can produce more anti-tumor cytokines than γδ T cells lacking PD-1 or expressing both PD-1 and TIM3 [31].
γδ TILs in hepatocellular carcinoma (HCC) highly express the exhaustion marker gene LAG3, while PD-1 and TIM3 are not upregulated.Additionally, these cells express cytotoxic genes, including IFNG, GZMB, NKG7 and GNLY, indicating that their status is an exhausted, yet cytotoxic population [35].The proportions of peripheral γδ T cells in HCC patients and healthy individuals are comparable, but the number of γδ TILs is notably lower in HCC patients than in healthy liver tissue.This is evidenced by diminished G2/M cell cycle arrest and proliferation [35].Compared to non-tissueresident memory γδ T (γδ T RM ) cells, γδ T RM cells in liver cancer tissue exhibit higher levels of PD-1 expression.However, the majority of these cells demonstrate an enhanced capacity for rapid generation of IFN-γ and IL-2 upon stimulation [11].Additionally, PD-1 high γδ T cells maintain their ability to secrete IFN-γ during stimulation.The expression of Eomesodermin (EOMEs) and Blimp-1 in γδ T RM cells is relatively low, while the expression of Tcf-1, which endows T cells with a stem cell-like lifespan, trends to increase [11].Hence, despite the increased expression of γδ T immunosuppressive molecules in the TME, certain cells can still maintain their heightened cytotoxic function.This observation aligns with the notion that CD8 T RM cells expressing PD-1 do not represent a population that is functionally impaired [36].
Immunosuppressive phenotypes of different γδ T cell subtypes in cancer patients
Different subtypes of γδ T cells can cause infiltration and functional changes in tumor patients.In healthy populations, the ratio of Vδ1/Vδ2 is usually less than 1.However, in many cancer patients, this proportion is the opposite [2].We summarized the infiltration patterns of Vδ1 and Vδ2 T cells in different tumors in Table 1.Most research on the antitumor properties of Vδ2 T cells has focused primarily on the peripheral circulation.A greater abundance of peripheral Vδ2 T cells is significantly correlated with improved OS in patients.In triple negative breast cancer (TNBC) patients, Vγ9Vδ2 T cells in the PB exhibited increased PD-1, TIM3 and TIGIT expression.Additionally, when stimulated in vitro, these cells displayed diminished production of TNF-α and IFN-γ, as well as a slight reduction in the expression of GZMB and PRF1 [37].The proportion of Vδ2 T cells in the PB of AML patients is significantly decreased.This decrease was accompanied by a decrease in NKG2D expression, an increase in PD-1 expression, and defects in IFN-γ generation.However, there was no significant decrease in the production of IL-2 or TNF-α, indicating that Vδ2 T cells were highly activated but exhausted during diagnosis [38].Similarly, in melanoma patients, the abundance of circulating Vδ2 T cells also decreased.Notably, patients who died within 9 months had lower levels of Vδ2 T cells.Therefore, the baseline frequency of Vδ2 T cells holds promise as a candidate for predicting patient outcomes [39].
In comparison to Vδ2 T cells, Vδ1 T cells, which are characterized by solid tumor infiltration, diverse immunosuppressive molecules, and a predominantly T EMRA phenotype, are more abundant in PT.Consequently, Vδ1 T cells potentially exert a significant influence on antitumor immunity.Notably, the Vδ1 T cell population is greater among γδ T cells within primary tumors and malignant ascites lymphocytes (MALs) in ovarian cancer (OC) [40], as well as resident in the bone marrow (BM) of AML and MM patients [41].An increased percentage of Vδ1 T cells positive for FOXP3 [32], CD39, PD-1 and TIM3 was primarily observed, which is characterized by elevated co-expression of multiple immunosuppressive molecules with TIGIT [41].The differentiation of Vδ1 T cells in TILs and MALs in OC differs: the majority of Vδ1 TILs exhibit a T EM phenotype, while Vδ1 MALs exhibit a more mature T EMRA phenotype.TIGIT and TIM3 are abundantly expressed in Vδ1 T cells in both MALs and PBLs, and PD-1, CD39 and OX40 have the highest expression in Vδ1 TILs [40].Vδ1 T cells found in certain tumors exhibit elevated levels of immunosuppressive molecules but also express corresponding activation molecules.
A rare neuroendocrine skin cancer, Merkel cell carcinoma (MCC), is characterized by significant infiltration of Vδ2-T cells that express PD-1 and LAG3, as well as the activation and tissue retention markers CD69 and CD103 [42].Similarly, Vδ1 T cells with effector memory and resident memory phenotypes are enriched in lung tumors, which are similar to stem cell-like CD8 T cells expressing EOMEs, TCF7, and TOX.The number of Vδ1 T EMRA cells present in tumors and the number of CD103 + Vδ1 T cells residing in adjacent normal tissue are significantly correlated with sustained remission in patients after surgery [15].Additionally, these Vδ1 T cells are related to the non-progression and OS of patients with TNBC [16].In the peritumoral compartment of CLM patients, Vδ1 T cells also constitute the predominant population of TILs and are characterized by high expression of CD69, which is indicative of effector cell function.These Vδ1 + CD69 + TILs are associated with improved clinical outcomes in patients [34].
The γδ T cell subtypes within a given tumor exhibit distinct functional variations, characterized by heightened plasticity and functional diversity.Notably, liver cancer patients exhibit a significant reduction in the percentage of tumor-infiltrating and circulating Vδ2 T cells and a significant increase in the percentage of Vδ1 T cells [35].The Vδ1 T subgroup exhibited a substantial decrease in NKG2D expression, while PD-1 expression remained unaltered.Conversely, Vδ2 T cells display a marked increase in PD-1 expression, consequently impairing antitumor immune responses [43].
Among renal cell carcinoma (RCC) patients, Vδ2 T cells are the main group expressing PRF1 and GZMB, while Vδ2 − T cells (include Vδ1 and Vδ3 T cells) are more abundant in tumors and almost absent in healthy tissues.These Vδ2 − T cells exhibit a unique phenotype characterized by early activation markers (CD28 and CD27) and effector cell-related markers (PD-1, CD57, and 4-1BB).Vδ2 − T cells are also the primary group of γδ T cells expressing PD-1, TIM3, and TIGIT, but they maintain the expression of effector cytokines at levels similar to those of unexhausted cells and are capable of killing autologous tumor cells in vitro [24].These findings are not entirely consistent with the above findings that Vδ1 T cells strongly infiltrate the tumors of CRC patients [44].Compared with Vδ2 T cells, PD-1 expression in Vδ1 T cells is lower, but TIGIT and secreted GZMB, GZMK, and TNF levels are higher [27], indicating strong cytotoxic gene expression.However, Vδ1 T cells in tumors exhibit genetic features related to metabolic adaptation and tumor-promoting functions [33], which are correlated with patient stage and prognosis [44].
Specifically, DNA mismatch repair-deficient (dMMR) cancer contains β2M mutations that prevent β2M recognition by T cells, increasing the likelihood of immune escape.Recent studies have revealed a strong association between β2M inactivation in dMMR colon cancer and Vδ1 and Vδ3 T subpopulations that have high expression of PD-1 and other activation markers, as well as higher expression of killer cell immunoglobulin-like receptors (KIRs) compared with Vδ2 T cells.These PD-1 + γδ T cells exhibit increased sensitivity to β2M knockout tumor-like organs and human leukocyte antigen (HLA) class I-negative dMMR colon cancer cell lines compared with cells with normal antigen-presenting function [45].
In CLM, high transcriptional levels of inhibitory KIRs exist on Vδ1 and Vδ3 TILs, while NKG2A and KLRG1 are expressed on Vδ2 TILs.Unlike in the original cancer, TIGIT is highly expressed on Vδ3 T cells [34].Therefore, different types of cancer and different sites may have different γδ T cell subtypes, which may result in different phenotypes, functional changes, and clinical outcomes.
The correlation between the PD-1/PD-L1 axis and the immunosuppression of γδ T cells
The PD1/PD-L1 axis is a crucial pathway for the immune response in various types of cancer.By inhibiting phosphatase containing SHP2 to the immunoreceptor tyrosine-based switch motif (ITSM) at the tail of PD-1, PD-1 hampers the function of T cells.Positive signals triggered by TCR (interacting with MHC-I peptides) and CD28 (interacting with CD86 and/or CD80) can be reversed by these phosphatases.Furthermore, PD-1 increases the expression of the basic leucine zipper transcription factor ATF-like (BATF), which inhibits T cell function [50].As mentioned earlier, inhibitory receptors expressed on γδ TILs [51,52] and amplified Vδ2 T cells inhibit T cell antitumor function when interacting with the ligands of these inhibitory receptors [22].
Research has clarified that even without the use of ICIs, Vδ2 T cells amplified from human PBMCs still have effective antitumor effects after adoptive transfer [19].Simultaneously, Vδ2 T cells after cryopreservation still retain most of their antitumor function in vivo, indicating that they can be employed in preclinical studies and clinical treatments [22].However, Vδ2 T cells are different from CD8 T cells.Despite the fact that the number of Vδ2 T cells had increased 62 folds, their antitumor immunity was not improved with the adoptive transfer of more Vδ2 T cells [22].This observation indicates that the TME may act a key part in influencing γδ T cells to control tumor growth (Fig. 1): some TMEs are in an immunosuppressive state, which affects the immunotherapeutic effect of γδ T cells; IFN-γ or other cytokines released by Vδ2 T cells may enhance PD-L1 expression on tumor cells during tumor recognition, potentially reducing antitumor immunity [22]; Tumor cells are not the only producers of isopentenyl pyrophosphate (IPP), which can activate γδ T cells through TCR in the TME, and BM-derived stromal cells (BMSCs) in monoclonal gammopathy of undetermined significance (MGUS) and MM also release a significant amount of IPP.Therefore, chronic TCR conjugation in the immunosuppressive TME (characterized by inappropriate cytokines and/or co-stimulatory signals) may lead to PD-1 expression and γδ T cell dysfunction [10]; γδ T cells can also induce an immunosuppressive state in other antitumor cells through PD-L1.
PD-1/PD-L1 axis influence the immune activity of γδ T cells
Compared to that in healthy individuals, the number of PD-L1 + myeloid suppressor cells (MDSCs) is increased in MM patients, while Vγ9Vδ2 T cells are surrounded by PD-L1 + myeloma cells.TNBC patients also exhibit high PD-L1 expression, which leads to exhaustion of Vγ9Vδ2 T cells [37].The BM microenvironment significantly hinders the phosphoantigens (pAgs) reactivity of these T cells, further inducing γδ T cells exhaustion [53], which downregulates their cytotoxicity, IFN-γ generation, and ADCC through the PD-1/PD-L1 axis [10].Dysfunction of Vγ9Vδ2 T cells is an early and persistent event that can be identified in patients with MGUS and these patients may not fully recover during the clinical remission period after autologous stem cell transplantation [53,54].Anti-TGF-β or OX-40L can be utilized to inhibit intratumoral regulatory T cells (Tregs) in the TME but these treatments are unable to restore the proliferation of Vγ9Vδ2 T cells in the BM [53].PD-1 expression on Vγ9Vδ2 T cells in the BM of myeloma patients increased after Zol stimulation.That is, PD-1 is upregulated to increase resistance to pAg-induced TCR activation [10].However, when primary AML cells sensitized by Zol were incubated with γδ T cells, it was demonstrated that tumor cells can induce γδ T cells to express PD-1.However, these PD-1 + γδ T cells exhibit increased levels of IFN-γ, which proves that they still have certain functions [52].It has further been reported that PD-L1 indirectly regulates γδ T cells.The oxygen pressure in the TME can alter the content of tumor derived exosomes (TEXs).Hypoxia can inhibit TEX-stimulated γδ T cell activity, further coordinating the balance between pro-and antitumor γδ T cells, and promoting MDSC mediated inhibition of γδ T cells via the miR-21/PTEN/PD-L1 axis [55].
Notably, B lymphocyte and T lymphocyte attenuators (BTLA) exhibit robust expression on γδ T cells in leukemia patients.BTLA, a member of the CD28 family, interacts with its ligand herpesvirus entry mediator (HVEM).Like PD-1, BTLA negatively regulates T cell activation.Despite both BTLA and PD-1 possessing ITSM and ITIM motifs, PD-1 predominantly relies on ITSM to achieve its inhibitory function, whereas BTLA necessitates the concurrent presence of both ITIM and ITSM [56].Resting γδ T cells, especially naïve γδ T cells, express high levels of BTLA, which is downregulated in the T CM and T EM stages.In contrast, PD-1 is upregulated in γδ T EM cell subpopulations.Additionally, PD-1 expression increases after TCR involvement, while BTLA expression is markedly attenuated.Exposure to lymphoma cells leads to a notable decrease in γδ T cell growth through BTLA/ HVEM interactions, and inhibiting BTLA/HVEM signaling can enhance γδ T cells proliferation [57].However, manipulating BTLA/HVEM signal transduction does not change the effect of γδ T cells on target cell death during cultivation or the reaction period.These findings demonstrate the distinct regulation of BTLA and PD-1 expression, potentially indicating divergent functions [57].BTLA governs the proliferation of γδ T cells, while PD-1 regulates their cytotoxicity [58].
Immune regulation of γδ T cells on other cells through the PD-1/PD-L1 axis
The expression of PD-L1 on γδ T cells in patients with tumors has implications for the functionality of other cells within the TME.Specifically, the expression of PD-L1 in γδ TILs of oral cancer patients surpasses that in PTs, while there is a significant increase in PD-L1 expression on γδ T cells in the PB of these patients compared with healthy controls [59].Moreover, in patients with PDAC, PD-L1 and galactose lectin-9 are increased in circulating γδ T cells and γδ TILs, resulting in the promotion of tumor growth by inhibiting the cytotoxic activity of CD4 and CD8 T cells [60].The co-culture of CD8 T cells and γδ T cells isolated from the PB of healthy donors markedly increase the proportion of CD8 T cells undergoing apoptosis when subjected to IL-2 stimulation and hypoxia [59].Consequently, IL-2 and hypoxia have the potential to augment the PD-L1 expression on γδ T cells, affecting the survival of CD8 T. Furthermore, stimulation with IL-12/18 can also result in an increased expression of co-inhibitory receptors and PD-L1 on γδ T cells, along with heightened phosphorylation of JNK and p38 in γδ T cells.The upregulation of co-inhibitory receptors remains largely unaltered following the administration of p-JNK or p-p38 inhibitors.However, the use of a p-JNK inhibitor (SP600125) considerably reduced the PD-L1 expression on γδ T cells, without concomitantly increasing of IFN-γ and GZMB expression on CD8 T cells.Consequently, the observed decrease in PD-L1 expression on human γδ T cells is more likely to contribute to a reduction in the immune suppression of CD8 T cells in vivo [61].
In conclusion, PD-L1 expression on γδ T cells has the potential to act as a regulatory mechanism for T cells who exhibit a response.The inhibitory impact of PD-L1 can be counteracted to a certain extent by anti-PD-L1 antibodies, while anti-PD-1 antibodies have relatively limited effects.It is plausible that, in addition to the inhibitory PD-1, there may be unidentified PD-L1 secondary co-stimulatory receptors [62].
In addition to PD-L1, Vδ2 T cells exhibit immunosuppressive capabilities when exposed to antigen-presenting cells or when co-stimulated with an anti-CD28 monoclonal antibody (mAb).This immunosuppressive potential can be counteracted by Toll-like receptor 2 (TLR2) ligands or a substantial quantity of Th1 cytokines produced by reactive T cells [62].Consequently, the inhibition effect of αβ T cells can be eliminated by obstructing the interaction between CD86 of Vδ2 T cells and CTLA-4 of αβ T cells.Using TLR2 ligands pre-treatment Vδ2 T cells has been shown to augment the phosphorylation of NF-κB, MAPK and AKT, thereby partially attenuating their inhibitory effects.Additionally, co-cultured responder T cells exhibit downregulation of inhibitory molecules, accompanied by restoration of the phosphorylation of AKT and NF-κB [62].Moreover, anti-CD80 therapy does not affect the interaction between Vδ2 T cells and responsive T cells [62].The modulation of αβ T cells by activated Vδ2 T cells has the potential to refine αβ T cells responses, thus offering potential utility for the regulation of responsive T cells in cancer patients through the manipulation of γδ T cells or elimination of inhibitory γδ T cells from cells used for adoptive transfer.
The effect of immune checkpoint inhibitors (ICIs) on γδ T cells function
The US-FDA approved ICB therapy for the treatment of a variety of cancer types.PD-1/PD-L1 blockers have emerged as the primary medication option for various tumors, either as a standalone treatment or in combination with CTLA-4 blockers, chemotherapy, or targeted therapy [63].Although blocking antibodies targeting PD-1 or PD-L1 have demonstrated considerable success in clinical trials, a majority of patients do not exhibit enduring remission following PD-1 treatment [64].As an important subgroup of antitumor therapy, γδ T cells require further understanding of the impact of ICBs on their function.
The effect of an anti-PD-L1 antibody on γδ T cells
Anti-PD-L1 mAb treatment can augment the antitumor effect of γδ T cells on PD-L1 + Daudi cells [65], as well as on Zol-pretreated bladder cancer cells (UMUC3, TCCSUP, T24 and T24cis), breast cancer cells (MDA-MB-231) and mesothelioma cells (H2052 and H2452) with high expression of PD-L1 [66].However, the use of anti-PD-L1 mAb has been shown to augment the ADCC activity of γδ T cells to target cancer cells characterized by high PD-L1 levels [67].To exclude the influence of ADCC, PD-L1 in tumor cells was silenced, which did not increase the cytolytic activity of γδ T cells [66].Studies in liver cancer have shown that the co-administration of anti-PD-L1 blockers and γδ TCR stimulation in vitro does not substantially elevate the generation of IFN-γ or GZMB in Vγ9Vδ2 TILs [11].Moreover, the utilization of anti-PD-L1 mAb in TNBC patients does not further enhance the antitumor immunity of Vγ9Vδ2 T cells [37].
Additionally, expanding Vδ2 − T cells in RCC have been found to exhibit comparable levels and kinetics of autologous tumor cell killing to those of CD8 T cells but the antitumor activity of anti-PD-L1 mAbs is not significantly enhanced in vitro [24].Nevertheless, research suggests that the combination of anti-PD-L1 mAb and the adoptive transfer of IL-12/18/21 pre-activated γδ T cells can enhance their cytotoxicity function in a CD8 T cell dependent manner.This combination promotes the secretion of TNF-β and IFN-γ by CD8 T cells [68].Patients with locally advanced and metastatic urothelial carcinoma were treated with atezolizumab in a clinical trial (NCT02108652) to assess its efficacy, and to analyze 168 tumor samples.The analysis demonstrated a significant correlation between Vδ2 genetic characteristics and favorable clinical response [24].Therefore, the effect of anti-PD-L1 mAbs on γδ T cells needs to be considered with the corresponding effects on the tumor environment.When PD-L1 is highly expressed in the TME, administration of anti-PD-L1 monoclonal antibodies will likely augment their antitumor efficacy.
The effect of anti-PD-1 antibody on γδ T cells
In tumors with immunosuppressive environments, anti-PD-1 therapy can promote the killing function of γδ T cells against tumors.Stimulation of Vγ2Vδ2 T cells with pamidronate to treat prostate cancer increases PD-L1 expression on PC-3 cells.Consequently, the concurrent utilization of PD-1 checkpoint inhibitors and the adoptive transfer of Vγ2Vδ2 T cells have significantly enhanced antitumor immune responses, resulting in a substantial reduction in tumor volume, approaching complete eradication [22].However, some studies have shown that the inhibition of PD-1 in bladder cancer cells, breast cancer cells and mesothelioma cells with high PD-L1 expression does not enhance the killing function of γδ T cells [66].
In research on hematological tumors, although it was observed that blocking PD-1 did not significantly affect the direct cell-mediated destruction of leukemia cells by γδ T cells, it did significantly augment in the synthesis of IFN-γ within the cytoplasm of γδ T cells [52].With the increase in the anti-PD-1 mAb concentration in MM, Vγ9Vδ2 T cells stimulated with Zol in the BM partially resumed proliferation, with a nearly fivefold increase in cytotoxic potential and upregulation of CD107a expression [53].
Therefore, although PD-1 checkpoint inhibitors did not enhance cytolysis by stimulated or expanded γδ T cells, they effectively induced the secretion of IFN-γ and pro-inflammatory cytokines.Other studies that were conducted demonstrated that inhibiting PD-1 alone does not have a substantial impact on the generation of TNF-α and IFN-γ in Vδ2 T cells.However, the inhibition of TIM3 and the dual inhibition of PD-1/TIM3 have been demonstrated to significantly enhance their production.
This phenomenon may be attributed to the compensatory increase in TIM3 expression following the use of anti-PD-1 antibodies [31].It should also be acknowledged that the use of a single PD-1 blockade may exacerbate the regulation/inhibitory polarization of Vγ9Vδ2 T cells in MM by inducing the release of inhibitory factors such as IL-10 and the expression of other inhibitory molecules (CD73, FOXP3, CD38 and CD39) [10].Specifically, some patients with follicular lymphoma (FL) exhibit a "high" immune escape phenotype, with extensive infiltration of PD1 + CD16 + Vγ9Vδ2 T lymphocytes.Unlike PD-1, which is induced by high levels of PD-L1 expression in solid tumors, most γδ TILs with ADCC express PD-1, which influences the cytolytic activity of γδ T cells toward FL cell aggregates.The inhibition of PD-1 enhances the innate cytotoxicity of FL and ADCC [69].
In clinical practice, the therapeutic effect of PD-1 antibodies on γδ T cells is positive.By comparing paired tumor samples obtained from dMMR colon cancer patients before and after dual blockade of PD-1 and CTLA-4, it was shown that ICB significantly increased the number of γδ TILs, indicating that γδ T cells are crucial for the ICB response in HLA class I negative dMMR colon cancer patients [45,70].At the mid to late stages of treatment with ipilimumab alone in melanoma patients, the proportion of Vδ2 T cells remains unchanged or increases, which is related to better OS and higher clinical benefits for patients [39].Four MCC patients who received ICI treatment had a high tumor γδ T cell enrichment score, three of which responded completely to the treatment.After resection of the retroperitoneal tumor mass, the patient received adjuvant treatment and remained disease-free after 3 years of continuous treatment [42].RNA-seq data analysis of a phase II basket clinical trial (NCT02644369) of pembrolizumab in advanced solid non-small cell lung cancer (NSCLC) revealed that patients with TRDV1 expression higher than the median in tumor biopsy before treatment had a significant increase in survival rate, indirectly reflecting that high Vδ1 T cells infiltration is beneficial for patient prognosis [15].It should also be noted that there have been reports of cases during long-term Hodgkin lymphoma (HL)-associated inflammation, where blocking PD-1 accelerates γδ T cells clone proliferation and leads to secondary hyperplastic T cells lymphoma [71].These studies further indicate that the combined blockade of PD-1 and other immune checkpoints on γδ T cells can enhance their antitumor cytotoxicity potential, which seems to be an effective strategy for enhancing immunity.
The effects of cytokines and drugs on immune checkpoint molecules and γδ T cells functions
The prevailing notion suggests that Zol-induced TCR triggering can partially counteract the inhibitory impact of PD-1 on γδ T cells.Upon exposure to Zol-treated PD-L1 + tumor cells, PD-1 + γδ T cells undergo of γδ TCRmediated signaling.This induction leads to a mild to moderate reduction in cytokine production compared to that induced by PD-L1 − tumor cells.Nevertheless, PD-1 + γδ T cells exhibit similar cytotoxic activity against both PD-L1 + and PD-L1 − tumor cells treated with Zol [65].Stimulation of Vδ2 T cells with IL-2 and the phosphate antigen 4-hydroxy-3-methyl-but-2-enyl-pyrophosphate (HMBPP) for 24 h resulted in a significant upregulation of the PD-1 + TIM3 + subgroup.This subgroup exhibited the lowest production levels of TNF-α and IFN-γ [31].Additionally, the use of TCR pan-γδ antibodies can also amplify γδ T cells.PD-1 expression is rapidly induced upon activation for 48-72 h.However, the expression of PD-1 gradually decreases and stabilizes to the initial level after transferring cells to wells without the presence of an antibody [72].
In conjunction with the utilization of IL-2 and Zol for the co-amplification of Vγ9Vδ2 T cells intended for adoptive transfer, the inclusion of the corresponding cytokines can produce twice the result with half the effort.The utilization of cytokine combination pre-treatment strategies, such as IL12/18, IL12/18/21, IL12/15/18, or IL12/15/18/21, has been clarified to dramatically augment the cytotoxicity and activation of γδ T cells in vitro.Additionally, these methods have been shown to modulate the function of γδ T cells and regulate the expression of immunosuppressive molecules on γδ T cells [68].
The administration of IL-12/18 resulted in elevated PD-1, CTLA-4, TIM3 and LAG3 expression in Vδ2 T cells, along with significant upregulation of activation related genes (IFNG, FASLG, and GZMB).These compounds increase the expression of IRF4, BATF and signallng lymphocytic activation molecule (SLAM) family member 7, which can induce a high level of IFN-γ and increase the killing of tumor cells [61].Moreover, EOMEs + γδ T cells exhibit increased proliferation rates and increased IFN-γ generation efficiency.However, γδ T cells with excessively high expression of EOMEs exhibit a exhaustion phenotype of PD-1 [73].Furthermore, the combination of IL-12/IL-4 in γδ T cells has been shown to elicit the expression of EOMEs.The use of Zol, IL-2, IL-15, and vitamin C for Vγ9Vδ2 T cells expansion in vitro can better promote their proliferation and differentiation.In comparison to expansion solely with Zol and IL-2, this approach leads to significantly elevated expression of co-stimulatory molecules, heightened levels of effector molecules (NKG2D, TNF-α and IFN-γ) and CD107a, and enhanced cellular energy metabolism.Moreover, they have improved antitumor function in vitro [18].Researchers have also discovered that amplified Vδ1 T cells, derived from healthy blood, produce amphiregulin (AREG), which possesses wound healing capabilities.However, researchers have found that a combination of IL-15, IL-18, anti-CD3, and anti-CD2 can effectively sustain the expansion of antitumor cytotoxic Vδ1 T cells, while concurrently limiting the amplification of a specific subset that produces AREG, thereby promoting tumor wound healing.This approach ultimately leads to improved tumor infiltration and clearance [27].
Compared with those in the Zol treatment group, the percentages of total and PD-1 + Vδ2 T cells generated by live Bacille Calmette-Guérin (BCG) stimulation markedly decreased [74].BCG may lead to weaker stimulation, inducing lower activation levels and resulting in the downregulation of PD-1.Alternatively, the multiple fold increase in IFN-γ induced by BCG stimulation compared to that induced by Zol stimulation may lead to a substantial increase in PD-L1 expression.Consequently, PD-1 binds to PD-L1, facilitating the negative selection of PD-1 + cells [13].Moreover, BCG amplified cells exhibit a greater degree of degranulation upon recognition of tumor cells, resulting in the production of a wider range of cytokines [21].Considering that BCG is an effective inducer of the Th1 response to control Mycobacteriummediated bladder tumors, the concurrent administration of Zol and BCG has the potential to enhance the proportion and multifunctionality of bladder tumor reactive Vδ2 T cells.This combination therapy may be an effective treatment option for non-muscle-invasive bladder cancer patients [75].1α, 25(OH) 2 D 3 can promote the nuclear translocation of vitamin D receptor (VDR), which can bind to the promoter regions of the TIGHT, PDCD1 and TIM3 genes to inhibit their expression.Moreover, it can also upregulate CD28.Pretreatment with 1α, 25(OH) 2 D 3 increases Th1 cytokine production in Vγ9Vδ2 T cells and enhances antitumor immunity [76].
The prolonged utilization of indomethacin has been observed to induce the upregulation of PD-L2 and PD-1 in γδ T cells, in a dose-dependent manner, via the TRIF/ NF-κB and JAK/STAT3 pathway, while concurrently suppressing the generation of effector molecules in hepatocellular carcinoma [77].Similarly, histone deacetylases (HDACs) can modify the acetylation of histones within chromatin, thereby augmenting gene transcription.HDAC inhibitors, which are employed as therapeutic agents against tumors, have been found to impede tumor progression, promote cellular apoptosis, and facilitate cellular differentiation [78].The tumor cells they treat are easily killed by γδ T cells, but it suppresses γδ T cells antigen-specific proliferation and antitumor effects are suppressed by the upregulation of immune checkpoints (PD-L1 and PD-1).Reductions in the expression of effector molecules, activation markers CD69 and CD25, and transcription factors (T-bet and EOMEs) expression are also observed on γδ T cells.
Ameliorating the immunosuppression of γδ TILs
Targeted modulation of ICPs can ameliorate the impaired functionality of exhausted γδ T cells within the TME, thereby exerting antitumor effects through enhanced proliferation, activation and cytotoxicity [79].The prospect of combining ICIs with chemotherapy drugs, mAbs, small molecule inhibitors, and other therapeutic agents holds promise for ameliorating γδ T cells immunosuppression (Fig. 2).
To mount effective immune responses in the face of specific challenges, γδ T cells must undergo metabolic resetting.This involves the significant downregulation of functional pathways associated with γδ TILs, including OXPHOS, glycolysis, and fat and amino acid metabolism pathways.Conversely, glutamine metabolism and its related pathways (nitrogen, arginine, and proline metabolism) are upregulated [35].By targeting specific metabolic checkpoints (MCPs) and combining them with ICP/ICP-L blockade, it is possible to enhance γδ T cells function and improve the efficacy of immune intervention in cancer treatment.The expression of glucose transporters on the surface of γδ T cells is higher than that on the surface of αβ T cells, suggesting a greater reliance on glucose uptake and metabolism.Combining ICP/ICP-L inhibitors with lower therapeutic concentrations of glycolytic inhibitors, to mitigate side effects, can synergistically enhance the antitumor activity of γδ TILs.ICP/ICP-L inhibitors can also be used in conjunction with AKT/mTOR inhibitors to facilitate a more balanced redistribution of glucose in the TME [80].
Although γδ T cells can survive in hypoxic microenvironments, their ability to exert antitumor cytotoxicity is compromised, resulting in the differentiation of γδ T17 cells.The exhaustion phenotype of PD-L1 high γδ T cells in tumors is mediated by the hypoxic environment, suggesting that combination therapy targeting HIF1-α and blocking PD-1/PD-L1 signaling may effectively reverse hypoxia-induced immunosuppression [59].Additionally, arginine deprivation has been found to inhibit the Vγ9Vδ2 T cell-mediated antitumor immune response thus the inhibition of arginase 1 (Arg1) can restore the capability of γδ T cells to secrete IFN-γ and effectively eliminate MDSC-induced immunosuppressive Daudi and Jurkat cells [80].An IDO inhibitor (1-MT) can also rescue dysfunctional or exhausted T cells by increasing tryptophan levels and enhancing the cytotoxicity of Vγ9Vδ2 T cells by increasing the generation of PRF1 in TNBC [37].
The simultaneous enhancement of the antitumor capabilities of αβ T cells and γδ T cells through combination therapy exhibits considerable clinical applicability.The administration of vascular endothelial growth factor receptor tyrosine kinase inhibitor (VEGFR2-TKI) at high doses has been found to induce the generation of IL-17A in γδ T cells via the VEGFR1/PI3K/AKT pathway.This, in turn, promotes the differentiation of neutrophils into the N2 phenotype and accelerates the dysfunction of CD8 T cells, resulting in an increase in PD-1 expression [81].However, the combination of VEGFR2-TKI with immunotherapy has been shown to alleviate tumor resistance caused by high-dose VEGFR2-TKI therapy.Additionally, the combination of an anti-IL-17A mAb and an anti-Ly6G mAb has been found to reduce the indirect inhibitory effect of γδ T cells on CD8 T cells and effectively decrease PD-1 expression [81,82].The molecular attributes of Vδ2 − demonstrate a significant correlation with the clinical response observed in patients with metastatic RCC who undergo combination therapy involving atezolizumab (anti-PD-L1) and bevacizumab (anti-VEGF) [24].In NSCLC patients, the estrogen receptor α can predict the response to pembrolizumab and is positively associated with PD-L1 expression.The use of an aromatase inhibitor (letrozole) significantly improved the efficacy of pembrolizumab in immune-PDXs, increasing the frequency of antitumor Vγ9Vδ2 T and CD8 T cells.Therefore, aromatase can be used as an adjuvant for immunotherapy [83].In addition, butylphilic protein (BTN) molecules are members of the B7 immunoglobulin superfamily and play an important role in stimulating γδ T cells [84].In patients who exhibited non-responsiveness to anti-PD-1 treatment with pembrolizumab or nivolumab, the levels of circulating PD-1 and BTN2A1 prior to treatment significantly increased and decreased, respectively [85].There is a discernible correlation between BTN2A1 and immune evasion.By combining BTN3A1 and BTN2A1 with TCRs, γδ T cells can be activated and their corresponding phenotypic characteristics can be altered, enhancing their antitumor effects [86].BTN2A/3A binding antibody-clone 20.1, and the excitatory anti-BTN3A1 antibody-CTX-2026 [87] can activate most Vγ9Vδ2 T cells without exogenous pAg.Currently, a humanized anti-BTN3A agonist known as ICT01 is being evaluated in an interventional, nonrandomized phase I/II clinical study for the treatment of recurrent/ refractory patients diagnosed with advanced or recurrent cancer by histology or cytology [88].By employing anti-BTN3A1 to target Vγ9Vδ2 T cells and integrating it with ICP therapies, it becomes feasible to not only strengthen the antitumor functionality of Vγ9Vδ2 T cells, but also hinder the immunosuppressive impact resulting from the interaction between BTN3A1 and CD45-N-mannosylated residues on human αβ T cells [87].Additionally, by obstructing the PD-1/PD-L1 axis, exhausted αβ T and Vγ9Vδ2 T cells can be revived, thereby enhancing their adaptive immune capacity [89].
Enhancing the therapeutic effect of γδ T cells adoptive transfer
Currently, adoptive transfer therapy involving γδ T cells has achieved a degree of success in terms of clinical safety and therapeutic efficacy [18].Nonetheless, there are several obstacles that need to be addressed, including the restricted accessibility of γδ T cells and their rapid exhaustion following repeated activation in vitro, inadequate comprehension of γδ TCR diversity and interactions with receptor ligands, and an underestimation of the influence on functional diversity [90].Consequently, innovative treatment approaches could involve combining γδ T cells adoptive transfer therapy with ICIs [91], as well as combining it with antitumor medications and other immunomodulatory antibodies [54].
To enhance local immune suppression within tumors, researchers constructed γδ T cells capable of producing humanized anti-PD-1 antibodies, denoted as "Lv-PD-1-γδ T" cells.This novel approach demonstrates superior efficacy in mitigating local immune suppression compared to the combination of PD-1 antibodies and γδ T cells.In murine models of ovarian tumors, Lv-PD-1-γδ T cells exhibit enhanced cytotoxicity and enhanced proliferation, resulting in notable therapeutic outcomes and improved survival rates [72].
γδ T cells can effectively target tumor cells and augment their cytotoxicity.To this end, scientists have devised a Y-body-based bispecific antibody (bsAb) known as the Vγ2 × PD-L1 antibody, which exhibits a selective affinity towards Vγ2Vδ2 T cells for the purpose of eliminating PD-L1 + tumor cells.The combination of Vγ2 × PD-L1 with adoptive metastatic Vγ2Vδ2 T cells has been demonstrated to impede the progression of established tumor xenografts and enhance the infiltration of Vγ2Vδ2 T cells into the TME [92].Another EGFR-Vδ2 bispecific T-cell engager (bsTCE) can activate Vγ9Vδ2 T cells in the PB and tumor samples of EGFR + cancer patients.These T cells express minimal levels of PD-1, TIM3 and LAG3, which in turn mediate the lysis of various tumor samples from EGFR + cancer patients.Significant tumor growth inhibition and improved survival rates were observed in a xenograft mouse model using PBMCs as effector cells [93].
Furthermore, the MHC independent manner of γδ T cells makes them suitable for CAR manipulation.Neuroblastoma mediates immune evasion of Vδ2 T cells by blocking the NKG2D/DAP10 signaling pathway.Therefore, researchers have designed GD2-DAP10-CAR-γδ T cells, which consist of an outer domain that specifically targets GD2, a widely expressed tumor-associated antigen and an inner domain that supports the DAP10 co-stimulatory pathway.CAR-T cells can induce cytotoxicity and decrease PD-1 and TIM3 expression [94].The co-expression of HLA-G and PD-L1, or the upregulation of PD-L1, may reduce the effectiveness of HLA-G-CAR after adoptive immunotherapy.Concurrent targeting of HLA-G and PD-L1 using a multi-specific CAR will be a suitable solution.The combination of Nb-CAR-γδ T cells and atezolizumab can restore the killing effect of Nb-CAR-γδ T cells and inhibit the growth of 231-R3 tumors in mice, thus prolonging the survival rate of tumor-bearing mice [95].Simultaneously, using Vδ2 T cells as effector cells, engineered HLA-G-CAR-T cells can secrete the PD-L1/CD3ε bispecific T-cell engager (BiTE) construct (Nb-CAR.BiTE), which can overcome the limitation of HLA-G and PD-L1, even against tumor cells with inadequate antigen expression, thereby generating potent antitumor effects without obvious toxicity [95].
Conclusion
The potent cytotoxicity of γδ T cells to tumor cells has garnered growing interest.This review seeks to elucidate their functional status within the TME and establish a foundation for enhancing their therapeutic efficacy.Overall, the expression of exhausted molecules in the tumor immune microenvironment is upregulated, accompanied by changes in the expression of other molecules.However, the upregulation of exhausted molecules does not necessarily indicate a weakened function, but may also indicate adaptive regulation in response to the TME.Moreover, different γδ T cell subtypes may also exhibit different phenotypic changes, but little is known about their functional mechanisms.Understanding their functions and combining them with immune checkpoint therapy could have a significant impact on future immunotherapy.Research has demonstrated that immunosuppressive molecules expressed by γδ T cells can regulate tumor growth and cytokine secretion.Therefore, the impact of γδ T cells on cancer is also limited by PD-1/ PD-L1 signaling.Therefore, PD-1/PD-L1 blockade confers benefits not only for αβ T cells but also for γδ T cells; Checkpoint inhibitors can also relieve the immunosuppressive effect of γδ T cells on other cells in the TME, and their cooperation can expand the range of cancer patients who can benefit from immunotherapy [22].Furthermore, γδ T cells exhibited minimal expression of PD-1 following in vitro expansion, and this low level of PD-1 expression was sustained even after their transfer to NSG mice after tumor transplantation.Consequently, γδ T cells may be less susceptible to inhibitory ligands expressed on tumor cells than endogenous T cells [19].Therefore, combining immune checkpoint therapy with γδ T cell adoptive transfer therapy will open up a new therapeutic approach.
Fig. 1
Fig. 1 The PD-1/PD-L1 axis influences the immune activity of γδ T cells: a.The PD-1/PD-L1 axis weakens the TCR-mediated activation of γδ T cells and the ADCC effect; b.PD-L1 and CD80/CD86 weakens the antitumor function of γδ T cells by binding to immune checkpoint molecules (PD-1, CTLA4, BTLA) on the surface of γδ T cells; c TEXs promote the activation of γδ T cells, and the IFN-γ secreted by activated γδ T cells promotes the upregulation of PD-L1 in tumor cells, enhancing the inhibitory effect on γδ T cells.Immune regulation of γδ T cells on other cells through the PD-1/PD-L1 axis: d IL-2 and APC can enhance the immunosuppressive potential of γδ T cells; e the interaction between PD-L1 or CD80/CD86 expressed on γδ T cells and αβT cells weaken the antitumor effect of αβ T cells; f blocking CTLA4 and TLR2 can partially eliminate the inhibitory effect of γδ T cells
Fig. 2 A
Fig. 2 A Ameliorating the immunosuppression of γδ TILs: combining ICPs with metabolic checkpoint inhibitors, and mAbs (IL-17A mAb, BTN3A mAb, etc.).B Enhancing the therapeutic effect of γδ T cells adoptive transfer: adoptive infusion of CAR γδ T cells, construction of γδ T cells secreting humanized anti-PD-1 antibodies, and construction of a bispecific T-cell engager (bsTCE) to activate γδ T cells
Table 1
The infiltration levels of γδ T cells and potential immunotherapy in cancer patients PB peripheral blood, HDs healthy donors, MA malignant ascites, BM bone
|
Metallized polyamideimide film for substrate and production method thereof
ABSTRACT
Metallized polyamideimide films for use as a substrate, in which a conductive layer is adhered to a polyamideimide film at high peel strength, may be prepared in a relatively small number of steps without using a special material by treating an inorganic filler-containing polyamideimide film with an alkaline permanganate solution, and subjecting the treated surface to electroless copper plating, or successive electroless copper plating and electrolytic copper plating. Preferably, a potassium permanganate solution or a sodium permanganate solution is used as the alkaline permanganate solution.
CROSS REFERENCES TO RELATED APPLICATIONS
This application claims priority to Japanese Patent Application No. 2004-289113, filed Sep. 30, 2004, and which is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to metallized polyamideimide films which are useful as substrates and a production method thereof. More particularly, the present invention relates to metallized polyamideimide films which are particularly useful as a film for tape automated bonding (TAB) or flexible printed circuit (FPC), and a production method thereof.
2. Discussion of the Background
Having superior heat resistance, size stability, solvent resistance and electric mechanical properties, polyimide has been widely used as an insulating material for electronic equipment and the like. For example, CCL (copper clad lamination) comprising a conductive layer formed on a polyimide film has been used for various purposes including flexible printed circuits (FPC) for tape automated bonding (TAB) and the like. In recent years, CCL comprising a conductive layer formed on a polyamideimide film having similar properties as polyimide has also been used.
As CCL, a three-layer CCL poly(amide)imide film in which a polyimide or polyamideimide film and a copper foil are adhered with an adhesive (e.g. epoxy resin and the like) has been generally used. However, the three layer CCL is not optimal because the adhesive to be used exerts an adverse influence on the insulation properties, heat resistance, mechanical strength and the like of CCL, and the inherent characteristics of polyimide or polyamideimide are impaired.
Therefore, a two-layer CCL manufactured without using an adhesive by a method (casting method) comprising coating a copper foil with a polyimide varnish or polyamic acid varnish, and drying the same to form a film is currently prevailing. In this casting method two layer CCL, for example, a copper foil having a thickness of about 12-35 μm is used. With a copper foil having a thickness of not less than 12 μm, formation of a fine circuit pattern at a pitch of less than 40 μm by subtractive methods becomes difficult. Thus, a method comprising reducing the thickness of the conductive layer, by half etching, of a two-layer CCL produced using a 12 μm-thick copper foil, and a method comprising use of a copper foil having a thickness of not more than 5 μm have been employed. In the case of half etching, however, the thickness control is not easy, and when a thin copper foil is used, handling thereof is not easy. Therefore, both methods pose problems of disadvantages in cost.
To solve such problems, for example, a method comprising directly forming a base metal layer (e.g., cobalt, nickel, chrome) on a polyimide film by sputtering, and then forming a conductive layer on the seed layer by electroless copper plating and by electrolytic copper plating to give a two-layer CCL (sputtering method) has been tried. However, the sputtering method is disadvantageous in cost because it requires a special apparatus, and inconveniences such as pinholes and the like easily occur. In addition, the base metal layer is difficult to remove by etching during circuit formation. Furthermore, the sputtering method CCL has problems in heat resistance and its use at high temperature for a long time tends to result in degraded adhesiveness.
On the other hand, a method for forming a conductive layer by plating has been tried without relying on the sputtering method and, for example, the following methods (1)-(8) have been reported.
(1) JP-A-3-6382 discloses a method comprising treating a polyimide film with an aqueous alkaline solution to form a modified layer having a thickness of 100-1500 Å, forming an electrolessly plated metal layer of not more than 1 μm on the modified layer, diffusing the metal within the thickness range of from not less than 50 Å to the thickness of the entire modified layer by heating, and adjusting the thickness of the conductive layer to a desired range by electroless plating and electrolytic plating to give a conductive layer.
(2) JP-A-6-21157 discloses a method comprising making a polyimide film hydrophilic with an aqueous solution of permanganate salt or hypochlorite, forming a nickel plating layer, cobalt plating layer or nickel cobalt plating layer having an impurity content of not more than 10 mass % and a thickness of 0.01-0.1 μby electroless plating, and further forming a conductive layer by electroless copper plating and electrolytic copper plating.
(3) JP-A-8-031881 discloses a method comprising treating a polyimide film with an aqueous solution containing hydrazine and alkali metal hydroxide, adding a catalyst, forming a nickel, cobalt or alloy layer by electroless plating, heat treating the layer under an inert atmosphere, and forming a conductive layer by electroless copper plating and electrolytic copper plating.
(4) JP-A-2000-289167 discloses a method comprising adding a palladium compound to a polyimide precursor, heat treating the same, activating the obtained film with dilute sulfuric acid, and forming a conductive layer by electroless copper plating and electrolytic copper plating.
(5) JP-A-2002-208768 discloses a method comprising treating a polyimide film with an aqueous alkaline solution containing a primary amine-containing organic disulfide compound or a primary amine-containing organic thiol compound, washing and drying the film, adding a catalyst, and forming a conductive layer by electroless copper plating and electrolytic copper plating.
(6) JP-A-2002-256443 discloses a method for forming a conductive layer by subjecting a polyimide film to a swelling treatment, a roughening treatment with an alkaline permanganate solution, a neutralization treatment, a de binding treatment, imide ring opening by alkali treatment, copper ion adsorption by treatment with copper ion solution, copper precipitation by reduction treatment, electroless copper plating and electrolytic copper plating.
(7) JP-A-2003-013243 discloses a method comprising treating a polyimide film with aqueous alkali hydroxide solution, hydrolyzing an imide bond, removing a low molecular hydrolysis product, adding a catalyst, and applying electroless metal plating (when high peel strength is necessary, electroless copper plating needs to be performed after electroless nickel plating).
(8) JP-A-2003-136632 discloses a method comprising manufacturing a polyimide film from alkoxysilane modified polyimide, treating the film with a palladium catalyst solution, and forming a conductive layer by electroless copper plating and electrolytic copper plating.
As a method for forming a conductive layer (copper plating layer) without relying on a dry process, a method comprising, as in the above-mentioned (1), (3), (5) and (7), treating the surface of polyimide with an alkaline solution, and introducing a carboxyl group by ring opening reaction of imide ring to enhance affinity for a metal has been mainly tried. However, (1) is associated with a problem in that each step is difficult to control and lacks versatility, (3) requires nickel or cobalt plating prior to copper plating, (7) also requires nickel plating prior to copper plating so as to afford high peel strength of the conductive layer, and nickel plating and cobalt plating cannot be easily removed by an etching step for circuit formation. Furthermore, (3) and (5) lack versatility and are disadvantageous in cost because they require a special alkaline solution.
In the case of the methods (2) and (6) wherein a polyimide film is treated with an alkaline permanganate solution, the method of (2) requires nickel plating and cobalt plating prior to copper plating, and the method of (6) requires many steps and complicated operation. Thus, all these methods lack versatility and are disadvantageous in cost. In general, moreover, since polyimide films tend to be chemically damaged by alkaline solutions, particularly highly active alkaline permanganate solutions have never been actually used in consideration of the difficulty in controlling the surface during treatments.
With regard to the methods (4) and (8) wherein a conductive layer is formed without treatment with alkaline solution etc., the method of (4) using a polyimide film containing a copper plating catalyst requires use of a considerable amount of an expensive palladium compound, and the method of (8) using alkoxysilane modified polyimide requires use of a special polyimide. Both methods lack versatility and are disadvantageous in cost.
Thus, there remains a need for an efficient and economical production method for providing a metallized polyamideimide film for a substrate wherein a conductive layer having high peel strength is adhered to the polyamideimide film. There also remains a need for a novel metallized polyamideimide film possessing a conductive layer having high peel strength adhered to a polyamidemide film.
BRIEF SUMMARY OF THE INVENTION
Accordingly, it is one object of the present invention to provide a novel method for producing a metallized polyamidemide film for a substrate, wherein a conductive layer having high peel strength is adhered to the polyamide film, in a relatively small number of steps, without using special material.
It is another object of the present invention to provide a novel metallized polyamidemide film for a substrate which comprises a conductive layer having high peel strength at least on one surface of a polyamide film layer, which is superior in heat resistance, and which can realize a substrate that is superior in insulation properties, heat resistance, and mechanical strength.
These and other objects, which will become apparent during the following detailed description, have been achieved by the inventors' discovery that a roughening treatment with an alkaline permanganate solution on the surface of a polyamide film containing a conventional inorganic filler easily makes the surface of the polyamide film suitable for plating, and copper plating the surface of the polyamide film subjected to the roughening treatment affords a conductive layer (copper plating layer) having high peel strength.
Accordingly, the present invention provides the following:
(1) A method of producing a metallized polyamideimide film for a substrate, which comprises treating an inorganic filler-containing polyamideimide film with an alkaline permanganate solution, and subjecting the film to electroless copper plating.
(2) The method of (1), wherein the inorganic filler-containing polyamideimide film is obtained by drying by heating a resin composition varnish comprising a polyamideimide and inorganic filler.
(3) The method of (2), wherein the resin composition varnish is applied onto a support, and the treatment with an alkaline permanganate solution and the electroless copper plating are successively performed.
(4) The method of (3), wherein the support is a copper foil.
(5) The method of (3), wherein the support is a polyimide film.
(6) The method of any of (1)-(5), wherein the inorganic filler-containing polyamideimide film is subjected to a swelling treatment with an alkaline solution before the treatment with an alkaline permanganate solution.
(7) The method of any of (1)-(6), wherein electrolytic copper plating is further applied after the electroless copper plating.
(8) The method of any of (1)-(7), wherein a catalyst is provided onto the surface of the inorganic filler-containing polyamideimide film before the electroless copper plating.
(9) The method of (8), wherein the catalyst is palladium.
(10) The method of any of (1)-(9), wherein the inorganic filler is one or more kinds selected from the group consisting of silica, silicon particles, and calcium carbonate.
(11) The method of any of (1)-(9), wherein the inorganic filler is silica.
(12) The method of any of (1)-(11), wherein the inorganic filler has an average particle size of 0.01-5 μm.
(13) The method of any of (1)-(12), wherein the inorganic filler is contained in the varnish in a proportion of 2-100 parts by weight per 100 parts by weight of polyamideimide.
(14) The method of any of (1)-(13), wherein the alkaline permanganate solution is a potassium permanganate solution or a sodium permanganate solution.
(15) The method of any of (1)-(6), (8)-(14), wherein the inorganic filler-containing polyamideimide film has a thickness of 5-125 μm, and the electroless copper plating layer has a thickness of 0.1-3 μm.
(16) The method of any of (7)-(14), wherein the inorganic filler-containing polyamideimide film has a thickness of 5-125 μm, the electroless copper plating layer has a thickness of 0.1-3 μm, and the total thickness of the electroless copper plating layer and the electrolytic copper plating layer is 3-35 μm.
(17) The method of any of (4), (6)-(16), wherein the copper foil support has a thickness of 3-35 μm.
(18) The method of any of (5)-(16), wherein the polyimide film support has a thickness of 10-125 μm.
(19) The method of any of (1)-(18), wherein an annealing treatment is conducted after the electroless copper plating or the electrolytic copper plating.
(20) The method of any of (1)-(19), wherein the inorganic filler-containing polyamideimide film further comprises one or more kinds of heat resistant resins selected from the group consisting of polyamide, polyimide, polyetheretherketone, polyetherimide, polybenzoxazole, and polybenzoimidazole in a proportion of not more than 30 parts by weight relative to 100 parts by weight of polyamideimide.
(21) The method of (20), wherein the heat resistant resin has a phenolic hydroxyl group in a molecular skeleton.
(22) A metallized polyamideimide film comprising a polyamideimide film layer and a conductive layer formed on at least one surface of the polyamideimide film layer, wherein the polyamideimide film layer comprises an inorganic filler and has a roughening treated surface on which the conductive layer is formed.
(23) The metallized polyamideimide film of (22), wherein the polyamideimide film layer containing an inorganic filler is formed on a support.
(24) The metallized polyamideimide film of (23), wherein the support is a copper foil layer.
(25) The metallized polyamideimide film of (23), wherein the support is a polyimide film layer.
(26) The metallized polyamideimide film of any of (22)-(25), wherein the inorganic filler is one or more kinds selected from the group consisting of silica, silicon particles and calcium carbonate.
(27) The metallized polyamideimide film of any of (22)-(25), wherein the inorganic filler is silica.
(28) The metallized polyamideimide film of any of (22)-(27), wherein the inorganic filler has an average particle size of 0.01-5 μm.
(29) The metallized polyamideimide film of any of (22)-(28), wherein the polyamideimide film layer has an inorganic filler content of 2-100 mass % relative to polyamideimide.
(30) The metallized polyamideimide film of any of (22), (26)-(29), wherein the polyamideimide film layer has a thickness of 5-125 μm, and the conductive layer has a thickness of 3-35 μm.
(31) The metallized polyamideimide film of any of (24), (26)-(29), which comprises a laminate of the copper foil layer/the polyamideimide film layer comprising an inorganic filler/the conductive layer laminated in this order, wherein the copper foil layer has a thickness of 3-35 μm, the polyamideimide film layer has a thickness of 5-125 μm, and the conductive layer has a thickness of 3-35 μm.
(32) The metallized polyamideimide film of any of (25)-(29), which comprises a laminate of the polyimide film layer/the polyamideimide film layer comprising an inorganic filler/the conductive layer laminated in this order, wherein the polyimide film layer has a thickness of 10-125 μm, the polyamideimide film layer has a thickness of 5-125 μm, and the conductive layer has a thickness of 3-35 μm.
(33) The metallized polyamideimide film of any of (22)-(32), wherein the roughening treated surface of the polyamideimide film layer has a surface roughness of 100-1500 nm.
(34) The metallized polyamideimide film of any of (22)-(33), wherein the conductive layer is a copper plating layer.
(35) The metallized polyamideimide film of any of (22)-(34), wherein the roughening treatment of the roughening treated surface of the polyamideimide film layer is a treatment with an alkaline permanganate solution.
(36) The metallized polyamideimide film of (35), wherein the alkaline permanganate solution is a potassium permanganate solution or a sodium permanganate solution.
(37) The metallized polyamideimide film of any of (22)-(36), wherein the inorganic filler-containing polyamideimide film further comprises one or more kinds of heat resistant resins selected from the group consisting of polyamide, polyimide, polyetheretherketone, polyetherimide, polybenzoxazole and polybenzoimidazole in a proportion of not more than 30 parts by weight relative to 100 parts by weight of polyamideimide.
(38) The metallized polyamideimide film of (37), wherein the heat resistant resin has a phenolic hydroxyl group in a molecular skeleton.
According to the method of producing a metallized polyamideimide film of the present invention, a metallized polyamideimide film comprising a conductive layer having high peel strength adhered to the polyamideimide film, which is particularly preferable for a substrate, can be produced in a relatively small number of steps without using a special material. According to the present invention, the production efficiency can be improved and the production costs can be reduced, as compared to conventional production methods of this kind of metallized polyamideimide films.
Using a metallized polyamideimide film of the present invention, moreover, a material for a substrate, which is superior in heat resistance and which does not require complicated steps for circuit formation, can be provided, since the film has a conductive layer having high peel strength, which is formed on at least one surface thereof, and is free of an adhesive and a seed layer between the conductive layer and the polyamideimide film layer. Consequently, manufacture of a substrate superior in insulation properties, heat resistance, mechanical strength, and the like at a low cost can be enabled using a metallized polyamideimide film of the present invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The production method of the metallized polyamideimide film of the present invention is mainly characterized in that a polyamideimide film comprising an inorganic filler is treated with an alkaline permanganate solution and then subjected to electroless copper plating.
That is, the present invention is predicated on the finding that, by subjecting a polyamideimide film containing polyamideimide and an inorganic filler (hereinafter to be also referred to as “inorganic filler-containing polyamideimide film”), which is formed using a resin composition varnish containing an inorganic filler, to a treatment with an alkaline permanganate solution, the surface of the polyamideimide film comes to have a rough surface preferable for electroless copper plating, and by subjecting the roughening treated surface of the polyamideimide film to electroless copper plating, a conductive layer made of a copper plating layer having high peel strength can be formed. Preferably, by conducting electrolytic copper plating after electroless copper plating, a conductive layer made of a copper plating layer having higher peel strength can be formed. Moreover, since the polyamideimide film contains an inorganic filler, the surface can be easily controlled even when the surface of the polyamideimide film is treated with an alkaline permanganate solution, which facilitates formation of a rough surface preferable for forming a conductive layer by plating.
In the production method of a metallized polyamideimide film of the present invention, use of a special material is not necessary, and a metallized polyamideimide film, which comprises a laminate comprising a polyamideimide film layer, wherein at least one surface is roughening treated, and a conductive layer made of a copper plating layer, which is adhered at high peel strength to the roughening treated surface(s) of the polyamideimide film layer, can be obtained in a relatively small number of steps. In addition, the thus-obtained metallized polyamideimide film does not require an adhesive and a seed layer formed by sputtering or plating for the formation of a copper plating layer. Therefore, it can be used as a material for a substrate, which is superior in heat resistance, and which does not require complicated steps for circuit formation. Using the metallized polyamideimide film, a substrate superior in insulation properties, heat resistance, mechanical strength, and the like can be manufactured at a low cost.
A resin composition varnish containing polyamideimide and an inorganic filler to be used in the present invention (hereinafter to be also referred to as an “inorganic filler-containing resin composition varnish”) is made of a polyamideimide varnish used for producing a polyamideimide film by casting method and the like and an inorganic filler, and as the polyamideimide varnish, known ones can be used without any limitation, as long as the film forming is possible.
The polyamideimide in the polyamideimide varnish is a polymer having an amide bond and an imide bond in a molecule. The polyamideimide can be obtained by reacting an acid component and a diamine component in a high boiling point polar solvent according to known polyamideimide synthetic methods such as the acid chloride method, the isocyanate method, and the like. As used herein, by the “acid component” is meant tricarboxylic acid and acid anhydride thereof, tetracarboxylic acid and acid anhydride thereof, dicarboxylic acid, diimidedicarboxylic acid, and these compounds having acid chloride instead of carboxylic acid. The “diamine component” means a diamine compound or a diisocyanate compound in the case of isocyanate methods.
As methods of making the polyamideimide, (1) a method comprising reacting a tricarboxylic acid anhydride and a diisocyanate compound, (2) a method comprising reacting an acid chloride of tricarboxylic acid anhydride and a diamine compound, (3) a method comprising reacting a tetracarboxylic acid anhydride, a dicarboxylic acid compound and a diamine compound, and (4) a method comprising reacting adiimidedicarboxylic acid and a diisocyanate compound, and the like can be mentioned.
As the tricarboxylic acid anhydride when reacting the tricarboxylic acid anhydride and a diisocyanate compound in (1), for example, trimellitic anhydride, butane-1,2,4-tricarboxylic acid anhydride, naphthalene-1,2,4-tricarboxylic acid anhydride, and the like can be mentioned, with preference given to trimellitic anhydride. These may be used alone or two or more of them are used in combination. As the diisocyanate compound, for example, alicyclic diisocyanates such as 1,4-cyclohexanediisocyanate, 1,3-cyclohexanediisocyanate, isophoronediisocyanate, dicyclohexylmethane-4,4′-diisocyanate, and the like; aromatic diisocyanates such as m-phenylenediisocyanate, p-phenylenediisocyanate, diphenylmethane-4,4′-diisocyanate, diphenylether-4,4′-diisocyanate, diphenylsulfone-4,4′-diisocyanate, (1,1′-biphenyl)-4,4′-diisocyanate, (1,1′-biphenyl)-3,3′-dimethyl-4,4′-diisocyanate, 2,4-tolylenediisocyanate, 2,6-tolylenediisocyanate, xylenediisocyanate, 1,4-naphthalenediisocyanate, 1,5-naphthalenediisocyanate, 2,6-naphthalenediisocyanate, 2,7-naphthalenediisocyanate, and the like; and the like can be mentioned, with preference given to aromatic diisocyanate. These may be used alone or two or more of them are used in combination.
As the acid chloride of the tricarboxylic acid anhydride when reacting the acid chloride of tricarboxylic acid anhydride and a diamine compound in (2), for example, trimellitic anhydride chloride, acid chloride of butane-1,2,4-tricarboxylic anhydride, acid chloride of naphthalene-1,2,4-tricarboxylic anhydride, and the like can be mentioned, with preference given to trimellitic anhydride chloride. These may be used alone or two or more of them are used in combination. As the diamine compound, for example, aliphatic dia mines such as ethylenediamine, propylenediamine, hexamethylenediamine, and the like; alicyclic dia mines such as 1,4-cyclohexanediamine, 1,3-cyclohexanediamine, isophoronediamine, 4,4′-diamino dicyclohexylmethane, and the like; aromatic dia mines such as m-phenylenediamine, p-phenylenediamine, 4,4′-diaminodiphenylmethane, 4,4′-diaminodiphenylether, 4,4′-diaminodiphenylsulfone, benzidine, o-tolidine, 2,4-tolylenediamine, 2,6-tolylenediamine, xylylenediamine, 1,4-naphthalenediamine, 1,5-naphthalenediamine, 2,6-naphthalenediamine, 2,7-naphthalenediamine, and the like; can be mentioned, with preference given to aromatic diamine. These may be used alone or two or more of them can be used in combination.
As the tetracarboxylic acid anhydride when reacting tetracarboxylic acid anhydride, a dicarboxylic acid compound and a diamine compound in (3), for example, pyromellitic anhydride, biphenyltetracarboxylic acid anhydride, biphenylsulfonetetracarboxylic acid anhydride, benzophenonetetracarboxylic acid anhydride, biphenylethertetracarboxylic acid anhydride, ethylene glycol bistrimellitic anhydride, propylene glycol bistrimellitic anhydride, and the like can be mentioned, with preference given to pyromellitic anhydride and biphenyltetracarboxylic acid anhydride. These may be used alone or two or more of them can be used in combination. As the dicarboxylic acid compound, moreover, for example, aliphatic dicarboxylic acids such as oxalic acid, adipic acid, malonic acid, sebacic acid, azelaic acid, dodecanedicarboxylic acid, dicarboxypolybutadiene, dicarboxypoly(acrylonitrile-butadiene), dicarboxypoly(styrene-butadiene) and the like; alicyclic dicarboxylic acids such as 1,4-cyclohexanedicarboxylic acid, 1,3-cyclohexanedicarboxylic acid, 4,4′-dicyclohexylmethanedicarboxylic acid, dimer acid and the like; aromatic dicarboxylic acids such as terephthalic acid, isophthalic acid, diphenylsulfonedicarboxylic acid, diphenyl ether dicarboxylic acid, naphthalenedicarboxylic acid and the like, and the like can be mentioned. These may be used alone or two or more of them can be used in combination. As the diamine compound, moreover, those exemplified above can be mentioned, which may be used alone or two or more of them can be used in combination.
As the diimidedicarboxylic acid when reacting diimidedicarboxylic acid and a diisocyanate compound in (4), for example, diimidedicarboxylic acid that can be obtained by reacting tricarboxylic acid anhydride and a diamine compound at a ratio of about 2:1 can be mentioned. As the tricarboxylic acid anhydride and diamine compound here, those exemplified above can be mentioned. As the diisocyanate compound, too, those exemplified above can be mentioned.
For controlling the properties of polyamideimide, two or more from the above-mentioned methods (1)-(4) may be combined to carry out synthesis reactions (polymerization reaction) in multi-steps.
As a high melting point polar reaction solvent, N,N-dimethylacetamide, N-methyl-2-pyrrolidone, N,N-dimethylformamide, γ-butyrolactone and the like can be mentioned. The reaction temperature is generally about 60-200° C. The reaction solutions obtained by the above-mentioned methods (1), (3), (4) can be used as they are or, after substituting the solvent as necessary, without particular purification for as polyamideimide varnish. In the method of the above-mentioned (2), since removal of chlorine ion etc., becomes necessary, the reaction solution is desirably poured into a solvent (coagulation bath), which is a poor solvent to polyamideimide and miscible with a high boiling point polar solvent, thereby separating the polyamide from the reaction solvent (high boiling point polar solvent), after which the polyamide is washed with water, acetone and the like, and dried to give a solid. By re-dissolving the obtained polyamideimide (solid) in a solvent, the polyamideimide varnish is obtained. While the solvent can be appropriately selected from the solvents in which polyamideimide can be dissolved, for example, high boiling point solvents such as N,N-dimethylacetamide, N-methyl-2-pyrrolidone, N,N-dimethylformamide, γ-butyrolactone, and the like; alcohols such as methanol, ethanol, butanol, and the like; aromatic hydrocarbons such as toluene, xylene, and the like; ethers such as tetrahydrofuran, dioxane, and the like; and ketones such as cyclopentanone, cyclohexanone, and the like; and a mixed solvent; and the like can be mentioned. In the above-mentioned methods (1), (3), (4), such purification may be conducted where necessary.
The polyamideimide may be used alone or two or more thereof may be used in a mixture.
As the polyamideimide varnish to be used in the present invention, which affords film formation, a commercially product can be used as it is. Specific examples of polyamideimide varnish include Vylomax HR11NN, Vylomax HR16NN (product of Toy obo Co., Ltd.), KS6000 (product of Hitachi Chemical Co., Ltd.) and the like. In addition, for example, polyamideimide such as Torlon AI-10 (product of Solvay Advanced Polymers K.K.) and the like may be dissolved in an organic solvent to give a varnish.
The metallized polyamideimide film of the present invention is intended for use as a substrate (particularly flexible printed circuit (FPC)) and a polyamideimide varnish having a suitable structure and properties can be appropriately selected according to the properties requested for a substrate, such as heat resistance, mechanical strength and the like. A polyamideimide varnish having an aromatic ring structure is generally preferable.
In the present invention, an inorganic filler-containing resin composition varnish can be prepared by mixing and dispersing an inorganic filler with/in the above-mentioned polyamideimide varnish. Alternatively, an inorganic filler may be dispersed in a solvent capable of dissolving the aforementioned polyamideimide to give a slurry, and polyamideimide may be dissolved in this slurry. This inorganic filler-containing resin composition varnish may contain a slight amount of a heat resistant resin other than polyamideimide, and as other heat resistant resins, for example, polyamide, polyimide, polyetheretherketone, polyetherimide, polybenzoxazole, polybenzoimidazole and the like can be mentioned, with preference given to polyamide. Two or more heat resistant resins may be mixed and used. The presence of a suitable amount of other heat resistant resin produces a phase separation structure, and when a polyamideimide film is roughening treated, small roughness is easily formed. An inorganic filler-containing resin composition varnish containing such heat resistant resin can be prepared by dissolving a heat resistant resin in a solvent capable of dissolving the aforementioned polyamideimide to give a solution, mixing the solution (varnish) and polyamideimide varnish, and mixing or dispersing an inorganic filler. To improve affinity for a metal layer or a polyamideimide film to be a support, a heat resistant resin preferably has a phenolic hydroxyl group in the molecular skeleton, and one having a phenolic hydroxyl group equivalent amount in the range of 100-1500 g/eq is particularly preferable. The amount of the heat resistant resin to be added is not more than 30 parts by weight, preferably 0.5-30 parts by weight, more preferably 5-30 parts by weight, relative to 100 parts by weight of polyamideimide. When it exceeds 30 parts by weight, the phase separation tends to be too great.
The mixing•dispersion for the preparation of the inorganic filler-containing resin composition varnish can be conducted using a homogenizer, a rotating•revolving mixer, a 3-roll mill, a ball mill and the like, with preference given to a homogenizer and a rotating•revolving mixer. When a roll mill such as a 3-roll mill and the like is used, the resin composition varnish tends to absorb moisture, and when the moisture absorption is remarkable, the resin is often precipitated on the roll. When the above-mentioned heat resistant resin is added, which can be added optionally, one free of precipitation and decrease in the molecular weight, which are caused by moisture absorption, and the like is selected. Using a roll mill, an inorganic filler is dispersed in advance in the heat resistant resin, and the resin is mixed with polyamideimide varnish, whereby mixing-dispersion can be conducted well. In addition, an inorganic filler may be dispersed in advance in the aforementioned solvent to give a slurry, which slurry is then mixed with polyamideimide varnish.
It is also possible to carry out the above-mentioned poly condensation reaction in the slurry to prepare the polyamideimide varnish.
In the present invention, as the inorganic filler, those generally used as fillers (e.g., various plastic formed parts, etc) can be used and, for example, silica, alumina, barium sulfate, talc, clay, mica powder, aluminum hydroxide, magnesium hydroxide, calcium carbonate, magnesium carbonate, magnesium oxide, boron nitride, aluminum borate, barium titanate, strontium titanate, calcium titanate, magnesium titanate, bismuth titanate, titanium oxide, barium zirconate, calcium zirconate, silicon particles, and the like can be mentioned. Of these, silica, silicon particles, and calcium carbonate are preferable for achieving superior plating peel strength and the like, and silica is particularly preferable. These inorganic fillers may be surface treated with a surface treatment agent (e.g., silane coupling agent etc.) for the purpose of improving the moisture resistance of a metallized polyamideimide film (substrate) to be produced. The inorganic filler may be used alone or two or more kinds thereof may be used in a mixture.
The inorganic filler to be used in the present invention preferably has an average particle size of 0.01-5 μm, more preferably 0.05-2 μm. When the average particle size exceeds 5 μm, a fine pattern may not be formed stably when forming a circuit pattern from a conductive layer formed by plating after a roughening treatment. When the average particle size is less than 0.01 μm, the roughened surface may not be sufficiently formed by a roughening treatment, which may un preferably result in a failure to provide sufficient plating peel strength. The inorganic filler preferably has a maximum particle size of not more than 10 μm, more preferably not more than 5 μm, and further preferably not more than 3 μm. For controlling the maximum particle size of an inorganic filler, air classification comprising blowing air to an inorganic filler and classifying the inorganic filler based on mass differences, filtration classification comprising dispersing an inorganic filler in water and classifying the inorganic filler by filtration and the like can be mentioned. The amount of the inorganic filler to be added is preferably 2-100 parts by weight, more preferably 5-45 parts by weight, relative to 100 parts by weight of polyamideimide (solid content) in varnish (when a heat resistant copolymer resin is contained, relative to the total amount (solid content) of polyamideimide and heat resistant copolymer resin). When it exceeds 100 parts by weight, degradation of the resin surface becomes remarkable during a roughening treatment and sufficient plating peel strength tends to be difficult to achieve. When it is less than 2 parts by weight, a roughened surface is not sufficiently formed by a roughening treatment and sufficient plating peel strength tends to be difficult to achieve.
The above-mentioned average particle size of the inorganic filler can be measured by laser diffraction•scattering methods based on Mie scattering. To be specific, the particle size distribution of an inorganic filler is plotted based on volume by a laser diffraction type particle size distribution measurement device, and the median diameter can be taken as the average particle size. As a measurement sample, an inorganic filler can be dispersed in water by ultrasonic ation and preferably used as the sample. As the laser diffraction type particle size distribution measurement device, LA-500 manufactured by HORIBA Ltd. and the like can be used.
Where necessary, the polyamideimide varnish to be used in the present invention may contain components other than those mentioned above, as long as properties that a polyamideimide film is required to have for use as a flexible printed circuit, and the effect of the present invention are not impaired. For example, coupling agents, coloring agents, thixotropic agents, antistatic agents, plasticizers, and the like can be mentioned. In general, thermosetting resins such as epoxy resin and the like often fail to have heat resistance necessary for polyamideimide film production, and tend to increase dimensional changes of polyamideimide film. Thus, it is preferable that thermosetting resins be substantially absent from the polyamideimide film varnish to be used in the present invention.
In the present invention, an inorganic filler-containing polyamideimide film is generally formed by applying a resin composition varnish containing the above-mentioned polyamideimide and an inorganic filler onto a support, and drying the film by heating. While the thickness of the inorganic filler-containing polyamideimide film thus formed varies depending on the lamination structure of the object substrate, specific use and the like, it is generally about 5-125 μm. When it is less than 5 μm, the mechanical strength of an insulating layer of the substrate may become insufficient, and when it exceeds 125 μm, the cost becomes high and coating and drying of the varnish tends to be difficult. Then, the inorganic filter-containing polyamideimide film thus formed is treated with an alkaline permanganate solution and copper plating is applied to the surface roughening treated by the alkaline permanganate solution.
As the above-mentioned support, any can be used as long as it is made from a material substantially free from causing property and morphology changes during preparation of an inorganic filler-containing polyamideimide film by coating with a resin composition varnish containing the above-mentioned polyamideimide and an inorganic filler, and drying the film by heating. When the final product (metallized polyamideimide film) is a structure comprising an inorganic filler-containing polyamideimide film layer laminated on a support, heat resistant films such as polyimide film, aramid film and the like (preferably polyimide film), metal foils such as copper foil, aluminum foil, stainless foil and the like (preferably copper foil) and the like are generally used as the support. In the present invention, therefore, whether the support is to be delaminated in advance from an inorganic filler-containing polyamideimide film before a treatment with an alkaline permanganate solution (when the metallized polyamideimide film to be produced is a laminate structure without a support) or to be laminated on an inorganic filler-containing polyamideimide film (when the metallized polyamideimide film to be produced is a laminate structure having a support) is determined depending on the lamination structure of the produced metallized polyamideimide film. When a copper,foil is used as a support, the thickness of the copper foil is preferably about 3-35 μm, more preferably about 12-35 μm. When the thickness is less than 3 μm, the workability during coating and drying of varnish and the like is degraded, and when the thickness exceeds 35 μm, formation of a fine circuit pattern from the copper foil tends to become difficult. In other words, when a copper foil is used as a conductive layer in the final product (metallized polyamideimide film for a substrate), a fine circuit pattern cannot be formed easily from the conductive layer. When a polyimide film is used as a support, the thickness of the polyimide film is preferably about 10-125 μm, more preferably about 25-75 μm. When the thickness is less than 10 μm, the supportability during coating and drying of varnish becomes inferior, and when it exceeds 125 μm, the bending property of the final product (metallized polyamideimide film) is degraded. The polyimide film is used as an insulating layer in the final product (metallized polyamideimide film for a substrate).
The lamination structure of the metallized polyamideimide film of the present invention (final product) is as mentioned below.
The drying by heating of an inorganic filler-containing resin composition varnish is divided into an initial heating step for volatilization of solvent to form a film, and middle—last heating steps for complete removal of the solvent. For example, the initial heating step can be appropriately determined according to the workability while considering difference in the boiling points of solvents, adhesiveness between the support and the resin composition and the like. Generally, it can be appropriately selected from the range of about 1 minute-30 minutes at 75-150° C. In addition, preferable conditions of the middle—last heating steps can be appropriately determined by those of ordinary skill in the art and selected from the range of, for example, 160-370° C. for 1-40 hours. The middle—last heating steps may be one-step heating comprising heating at a constant temperature for a given time. Multi-step heating such as three-step heating comprising heating within a low temperature range (constant temperature selected from the range of 160-220° C.) for about 5 minutes-12 hours and then within a middle temperature range (constant temperature selected from the range of 220-300° C.) for about 30-18 hours and then further within a high temperature range (constant temperature selected from the range of 300-370° C.) for about 1-24 hours, and the like is preferably conducted for the purpose of preventing the warp of an inorganic filler-containing polyamideimide film.
In the present invention, as the alkaline permanganate solution to be used for a roughening treatment of the surface of an inorganic filler-containing polyamideimide film, for example, a solution obtained by dissolving potassium permanganate or sodium permanganate in an aqueous sodium hydroxide solution can be mentioned. The treatment method using an alkaline permanganate solution is not particularly limited and may be performed by, for example, immersing an inorganic filler-containing polyamideimide film delaminated from a support in an alkaline permanganate solution heated to 40-80° C., immersing an inorganic filler-containing polyamideimide film formed on a support in an alkaline permanganate solution heated to 40-80° C., together with the support and the like. While the treatment time is not particularly limited, about 5-20 minutes is preferable. The concentration of the permanganate salt in an alkaline permanganate solution is preferably about 80-150 μg/l, more preferably about 110-120 μg/l.
It is preferable to conduct a treatment to swell a polyamideimide film prior to a treatment with an alkaline permanganate solution. For the swelling treatment, an alkaline solution, a surfactant solution and the like can be used, with preference given to an alkaline solution. As the alkaline solution, for example, sodium hydroxide solution, potassium hydroxide solution and the like can be mentioned. In addition, a commercially available swelling solution may be used and, for example, produced by Ato tech Japan, Swelling Dip Securiganth P and Swelling Dip Securiganth SBU and the like can be mentioned. The method of the swelling treatment is not particularly limited and may be performed by, for example, immersing an inorganic filler-containing polyamideimide film delaminated from a support in a swelling solution heated to 40-80° C., immersing an inorganic filler-containing polyamideimide film formed on a support in a swelling solution heated to 40-80° C., together with the support and the like. While the treatment time is not particularly limited, about 5-20 minutes is preferable.
The level of the roughening treatment of the surface of a polyamideimide film to be roughening treated in this way (surface roughness) is defined by the arithmetic average roughness (Ra) described in the Japan Industrial Standard (JIS) B0601. Specifically, for example, it can be measured using a surface shape measurement system WYCO NT3300 manufactured by Veeco Instruments. The surface roughness (arithmetic average roughness (Ra)) is preferably 100-1500 nm, more preferably 100-1200 nm, and further preferably 200-800 nm. When it is less than 100 nm, sufficient plating peel strength tends to be unavailable, and when it exceeds 1500 nm, formation of a fine circuit pattern tends to become un preferably difficult.
A copper plating layer on a roughening treated surface of an inorganic filler-containing polyamideimide film, or formation of a conductive layer by copper plating, can be performed by a method combining electroless copper plating and electrolytic copper plating, or a method comprising forming a plating resist of a pattern reverse to the pattern of the conductive layer and forming the conductive layer by electroless copper plating alone.
The electroless copper plating can be conducted according to the methods generally used for additive method or semi-additive method of printed wiring board. That is, a catalyst is provided to the surface of an inorganic filler-containing polyamideimide film which has been roughened by the aforementioned treatment with an alkaline permanganate solution, and immersed in a given electroless copper plating solution under given conditions. As the catalyst to be provided for the roughening treatment of a surface, palladium metals widely used for electroless copper plating are preferable. While various electroless copper plating solutions having different plating components (e.g., chelating agents, reducing agents etc.) are commercially available, the solution is not particularly limited.
Plating of the surface of a electroless copper plating by electrolytic copper can be conducted according to a known method. As the electrolytic copper plating solution, various solutions having different plating components can be used. Particularly, generally used sulfuric acid copper plating bath is preferable.
The thickness of the electroless copper plating layer is generally 0.1-3 μm, preferably 0.3-2 μm. The thickness of the electrolytic copper plating layer is such thickness that makes the total thickness with the electroless copper plating layer to be 3-35 μm, preferably 5-20 μm. To be specific, a electroless copper plating layer having a thickness of 0.1-3 μm (preferably 0.3-2 μm) is formed, and an electrolytic copper plating layer is formed such that the total thickness of the electroless copper plating layer and the electrolytic copper plating layer becomes 3-35 μm (preferably 5-20 μm).
The thus-obtained conductive layer made of a copper plating layer is formed with high peel strength on the roughening treated surface of an inorganic filler-containing polyamideimide film. After electroless copper plating, or after successively conducting electroless copper plating and electrolytic copper plating, an annealing treatment is applied at 150-200° C. for about 30 minutes-100 hours, whereby peel strength of the conductive layer from the inorganic filler-containing polyamideimide film can be further improved and stabilized.
With such an annealing treatment, the peel strength of the conductive layer made of a copper plating layer from the inorganic filler-containing polyamideimide film of the metallized polyamideimide film of the present invention can be, for example, not less than 0.5 kgf/cm, preferably not less than 0.7 kgf/cm, as measured by the following measurement method.
Measurement Method of Peel Strength.
The measurement was performed according to JIS C6481. The thickness of the conductive plating of the measurement sample was about 30 μm.
The metallized polyamideimide film of the present invention is used for substrates and finally manufactured into, for example, the following laminates (1)-(5).
(1) conductive layer (copper plating layer)/inorganic filler-containing polyamideimide film layer;
(2) copper foil layer (support)/inorganic filler-containing polyamideimide film layer/conductive layer (copper plating layer);
(3) conductive layer (copper plating layer)/inorganic filler-containing polyamideimide film layer/conductive layer (copper plating layer);
(4) polyimide film layer (support)inorganic filler-containing polyamideimide film layer/conductive layer (copper plating layer);
(5) conductive layer (copper plating layer)/inorganic filler-containing polyamideimide film layer/polyimide film layer (support)/inorganic filler-containing polyamideimide film layer/conductive layer (copper plating layer).
The laminate (1) is manufactured by forming an inorganic filler-containing polyamideimide film on a support, successively applying an alkaline permanganate solution treatment and a electroless copper plating treatment to form a electroless copper plating layer and then de laminating the support from the inorganic filler-containing polyamideimide film; or forming a electroless copper plating layer, further forming an electrolytic copper plating layer and then de laminating a support from an inorganic filler-containing polyamideimide film.
When the laminate (1) is particularly used for a flexible printed circuit (FPC), the thickness of the inorganic filler-containing polyamideimide film layer is preferably about 10-75 μm.
The laminate (2) is manufactured by forming an inorganic filler-containing polyamideimide film on a copper foil, and successively applying an alkaline permanganate solution treatment and a electroless copper plating treatment to form a electroless copper plating layer; or forming a electroless copper plating layer, and further forming an electrolytic copper plating layer.
When the laminate (2) is particularly used for a flexible printed circuit (FPC), the thickness of the inorganic filler-containing polyamideimide film layer is preferably about 5-75 μm, particularly preferably about 10-50 μm.
The laminate (3) is manufactured by forming an inorganic filler-containing polyamideimide film on a support, de laminating the support and successively applying an alkaline permanganate solution treatment and a electroless copper plating treatment to both surfaces of the inorganic filler-containing polyamideimide film to form electroless copper plating layers; or forming a electroless copper plating layer, and further forming an electrolytic copper plating layer.
When the laminate (3) is particularly used for a flexible printed circuit (FPC), the thickness of the inorganic filler-containing polyamideimide film layer is preferably about 10-75 μm.
The laminate (4) is manufactured by forming an inorganic filler-containing polyamideimide film on one surface of a polyimide film (support), and successively applying an alkaline permanganate solution treatment and a electroless copper plating treatment to the inorganic filler-containing polyamideimide film to form electroless copper plating layers; or forming a electroless copper plating layer, and further forming an electrolytic copper plating layer.
When the laminate (4) is particularly used for a flexible printed circuit (FPC), the thickness of the polyimide film (support) is preferably about 10-75 μm, and the thickness of the inorganic filler-containing polyamideimide film layer is preferably about 10-75 μm, particularly preferably about 10-25 μm.
The laminate (5) is manufactured by forming an inorganic filler-containing polyamideimide film on both surfaces of a polyimide film (support), and successively applying an alkaline permanganate solution treatment and a electroless copper plating treatment to both surfaces of the inorganic filler-containing polyamideimide film to form electroless copper plating layers; or forming electroless copper plating layers, and further forming electrolytic copper plating layers.
When the laminate (5) is particularly used for a flexible printed circuit (FPC), the thickness of the polyimide film (support) is preferably about 10-50 μm, and the thickness of the inorganic filler-containing polyamideimide film layer is particularly preferably about 10-25 μm.
When a substrate is to be manufactured using a metallized polyamideimide film of the present invention, a circuit can be formed from a conductive layer (copper plating layer) by subtractive methods and semi-additive methods known to the skilled artisan in the technical field of substrates, and the like. In the case of subtractive methods, an electrolytic plating layer is formed on a electroless copper plating layer, an etching resist is formed thereon and the copper plating layers are etched with an etching solution of ferric chloride, copper (II) chloride etc. to form a conductor pattern, after which the etching resist is removed to give a circuit. In the case of semi-additive methods, a pattern resist is applied on a electroless copper plating layer, an electrolytic copper plating layer (pattern plating layer) having a desired thickness is formed, the pattern resist is removed and the electroless copper plating layer is removed by flash etching to give a substrate.
A circuit can be formed from a copper foil by, for example, forming an etching resist on the copper foil, and etching the copper foil with an etching solution of ferric chloride, copper (II) chloride etc. to give a conductor pattern, and removing the etching resist.
Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.
EXAMPLES
In the following examples, “parts” means “parts by mass.”
Example 1
Polyamideimide varnish “Vylomax HR16NN” (70 parts, solid content 14 w %, manufactured by Toy obo Co., Ltd.) was mixed with silica particles (2.5 parts, average particle size: 0.22 μm), and the mixture was dispersed in a rotating•revolving mixer (AwatoriRentaro AR250, manufactured by Think y corporation) for 12 minutes to give a resin composition varnish (a).
Then, this resin composition varnish (a) was applied to a mat surface of a 18 μm-thick copper foil with a bar coater such that the resin thickness after drying became 30 μm, and step wisely dried at 75-130° C. (average 110° C.) for about 20 minutes, at 180° C. for 30 minutes, at 240° C. for 20 hours and at 260° C. for 5 hours.
The resin composition layer/copper foil composite film thus obtained was first immersed in a swelling solution containing “Swelling Dip Securiganth P” (manufactured by Ato tech Japan) at 60° C. for 5 minutes, then in an alkaline permanganate solution at 80° C. for 20 minutes to conduct a roughening treatment of the surface of the resin composition layer, and manganese finally remaining on the surface was removed by reduction (surface roughness: 764 nm).
Subsequently, a catalyst for electroless copper plating was provided to the surface of the resin composition layer after the aforementioned roughening treatment, and the film was immersed in a electroless plating solution at 32° C. for 30 minutes to form a 1.5 μm-thick electroless copper plating film. This was dried at 150° C. for 30 minutes, washed with an acid, and subjected to electrolytic copper plating with a phosphorus-containing copper plate as an anode at anodic current density 2.0 A/dm² for 12 minutes to form a 5 μm-thick copper plating film. After annealing at 180° C. for 30 minutes, the adhesion strength (plating peel strength) between this plating film and a resin composition layer was measured and found to be 0.55 kgf/cm. The resulting film was further subjected to an annealing treatment at 150° C. for 100 hours, and the adhesion strength (plating peel strength) between the plating film and the resin composition layer was measured and found to be 0.55 kgf/cm.
Example 2
Polyamideimide varnish “Vylomax HR11NN” (70 parts, solid content 15 w %, manufactured by Toy obo Co., Ltd.) was mixed with silica particles (2.5 parts, average particle size: 0.22 μm), and the mixture was dispersed in a rotating•revolving mixer (AwatoriRentaro AR250, manufactured by Think y corporation) for 12 minutes to give a resin composition varnish (b).
Then, this resin composition varnish (b) was applied to a mat surface of a 18 μm-thick copper foil with a bar coater such that the resin thickness after drying became 30 μm, and step wisely dried at 75-130° C. (average 110° C.) for about 20 minutes, at 180° C. for 30 minutes, at 240° C. for 20 hours and at 260° C. for 5 hours.
The resin composition layer/copper foil composite film thus obtained was first immersed in a swelling solution containing “Swelling Dip Securiganth P” (manufactured by Ato tech Japan) at 60° C. for 5 minutes, then in an alkaline permanganate solution at 80° C. for 20 minutes to conduct a roughening treatment of the surface of the resin composition layer, and manganese finally remaining on the surface was removed by reduction (surface roughness: 864 nm).
Subsequently, a catalyst for electroless copper plating was provided to the surface of the resin composition layer after the aforementioned roughening treatment, and the film was immersed in a electroless plating solution at 32° C. for 30 minutes to form a 1.5 μm-thick electroless copper plating film. This was dried at 150° C. for 30 minutes, washed with an acid, and subjected to electrolytic copper plating with a phosphorus-containing copper plate as an anode at anodic current density 2.0 A/dm² for 12 minutes to form a 5 μm-thick copper plating film. After annealing at 180° C. for 30 minutes, the adhesion strength (plating peel strength) between this plating film and a resin composition layer was measured and found to be 0.6 kgf/cm. The resulting film was further subjected to an annealing treatment at 150° C. for 100 hours, and the adhesion strength (plating peel strength) between the plating film and the resin composition layer was measured and found to be 0.71 kgf/cm.
Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that, within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.
All patents and other references mentioned above are incorporated in full herein by this reference, the same as if set forth at length.
1. A method of producing a metallized polyamideimide film, which comprises: (a) treating an inorganic filler-containing polyamideimide film with an alkaline permanganate solution, to obtain a treated film; and (b) subjecting said treated film to electroless copper plating, to form a electroless copper plating layer.
2. The method of claim 1, wherein said inorganic filler-containing polyamideimide film is obtained by drying by heating a resin composition varnish comprising a polyamideimide and inorganic filler.
3. The method of claim 2, wherein said resin composition varnish is applied onto a support, and said treatment with an alkaline permanganate solution and said electroless copper plating are successively performed.
4. The method of claim 3, wherein said support is a copper foil.
5. The method of claim 3, wherein said support is a polyimide film.
6. The method of claim 1, wherein said inorganic filler-containing polyamideimide film is subjected to a swelling treatment with an alkaline solution before said treatment with the alkaline permanganate solution.
7. The method of claim 1, which further comprises: (c) conducting electrolytic copper plating after said electroless copper plating, to form an electrolytic copper plating layer.
8. The method of claim 1, wherein a catalyst is provided onto the surface of said inorganic filler-containing polyamideimide film before the electroless copper plating.
9. The method of claim 8, wherein said catalyst is palladium.
10. The method of claim 1, wherein said inorganic filler is one or more kinds selected from the group consisting of silica, silicon particles, calcium carbonate, and mixtures thereof.
11. The method of claim 1, wherein wherein said inorganic filler comprises silica.
12. The method of claim 1, wherein said inorganic filler has an average particle size of from 0.01 to 5 μm.
13. The method of claim 2, wherein said varnish comprises said inorganic filler in a proportion of 2 to 100 parts by weight per 100 parts by weight of said polyamideimide.
14. The method of claim 1, wherein said alkaline permanganate solution comprises at least one member selected from the group consisting of potassium permanganate, sodium permanganate, and mixtures thereof.
15. The method of claim 1, wherein said inorganic filler-containing polyamideimide film has a thickness of from 5 to 125 μm, and said electroless copper plating layer has a thickness of from 0.1 to 3 μm.
16. The method of claim 7, wherein said inorganic filler-containing polyamideimide film has a thickness of from 5 to 125 μm, said electroless copper plating layer has a thickness of from 0.1 to 3 μm, and the total thickness of said electroless copper plating layer and said electrolytic copper plating layer is from 3 to 35 μm.
17. The method of claim 4, wherein said copper foil support has a thickness of from 3 to 35 μm.
18. The method of claim 5, wherein said polyimide film support has a thickness of from 10 to 125 μm.
19. The method of claim 1, wherein an annealing treatment is conducted after said electroless copper plating or the electrolytic copper plating.
20. The method of claim 7, wherein an annealing treatment is conducted after said electrolytic copper plating.
21. The method of claim 1, wherein said inorganic filler-containing polyamideimide film further comprises one or more kinds of heat resistant resins selected from the group consisting of polyamide, polyimide, polyetheretherketone, polyetherimide, polybenzoxazole, polybenzoimidazole, and mixtures thereof in a proportion of not more than 30 parts by weight relative to 100 parts by weight of polyamideimide.
22. The method of claim 21, wherein said one or more kinds of heat resistant resins comprises a phenolic hydroxyl group in a molecular skeleton.
23. A metallized polyamideimide film comprising a polyamideimide film layer and a conductive layer formed on at least one surface of said polyamideimide film layer, wherein said polyamideimide film layer comprises an inorganic filler and has a roughening treated surface on which said conductive layer is formed.
24. The metallized polyamideimide film of claim 23, wherein said polyamideimide film layer comprising an inorganic filler is formed on a support.
25. The metallized polyamideimide film of claim 24, wherein said support is a copper foil layer.
26. The metallized polyamideimide film of claim 24, wherein said support is a polyimide film layer.
27. The metallized polyamideimide film of claim 23, wherein said inorganic filler is one or more kinds selected from the group consisting of silica, silicon particles, calcium carbonate, and mixtures thereof.
28. The metallized polyamideimide film of claim 23, wherein said inorganic filler comprises silica.
29. The metallized polyamideimide film of claim 23, wherein said inorganic filler has an average particle size of from 0.01 to 5 μm.
30. The metallized polyamideimide film of claim 23, wherein said polyamideimide film layer comprises said inorganic filler in an amount of 2 to 100 mass % relative to polyamideimide.
31. The metallized polyamideimide film of claim 23, wherein said polyamideimide film layer has a thickness of from 5 to 125 μm, and said conductive layer has a thickness of from 3 to 35 μm.
32. The metallized polyamideimide film of claim 25, which comprises a laminate of said copper foil layer/said polyamideimide film layer comprising an inorganic filler/said conductive layer laminated in this order, wherein said copper foil layer has a thickness of from 3 to 35 μm, said polyamideimide film layer has a thickness of from 5 to 125 μm, and said conductive layer has a thickness of from 3 to 35 μm.
33. The metallized polyamideimide film of claim 26, which comprises a laminate of said polyimide film layer/said polyamideimide film layer comprising an inorganic filler/said conductive layer laminated in this order, wherein said polyimide film layer has a thickness of from 10 to 125 μm, said polyamideimide film layer has a thickness of from 5 to 125 μm, and said conductive layer has a thickness of from 3 to 35 μm.
34. The metallized polyamideimide film of claim 23, wherein said roughening treated surface of the polyamideimide film layer has a surface roughness of from 100 to 1500 nm.
35. The metallized polyamideimide film of claim 23, wherein said conductive layer is a copper plating layer.
36. The metallized polyamideimide film of claim 23, wherein said roughening treatment of the roughening treated surface of said polyamideimide film layer is obtained by a treatment with an alkaline permanganate solution.
37. The metallized polyamideimide film of claim 36, wherein said alkaline permanganate solution comprises at least one member selected from the group consisting of potassium permanganate, sodium permanganate, and mixtures thereof.
38. The metallized polyamideimide film of claim 23, wherein said polyamideimide film comprising an inorganic filler further comprises one or more kinds of heat resistant resins selected from the group consisting of polyamide, polyimide, polyetheretherketone, polyetherimide, polybenzoxazole, polybenzoimidazole, and mixtures thereof in a proportion of not more than 30 parts by weight relative to 100 parts by weight of polyamideimide.
39. The metallized polyamideimide film of claim 38, wherein said heat resistant resin comprises a phenolic hydroxyl group in a molecular skeleton.
|
Talk:Dragonskull Robe/@comment-34728991-20180218002315/@comment-34559445-20180219052616
Can I buy it for 10-12 million and max council??
IGN: Janreve_TDM
|
public class GroveRotarySample{
static {
try {
System.loadLibrary("javaupm_grove");
}catch (UnsatisfiedLinkError e) {
System.err.println("error in loading native library");
System.exit(-1);
}
}
public static void main(String[] args) throws InterruptedException {
upm_grove.GroveRotary knob = new upm_grove.GroveRotary(0);
while (true) {
float abs_value = knob.abs_value(); // Absolute raw value
float abs_deg = knob.abs_deg(); // Absolute degrees
float abs_rad = knob.abs_rad(); // Absolute radians
float rel_value = knob.rel_value(); // Relative raw value
float rel_deg = knob.rel_deg(); // Relative degrees
float rel_rad = knob.rel_rad(); // Relative radians
System.out.println( "Absolute: " + abs_value + " raw, " + abs_deg + " deg, " + abs_rad + " rad" );
System.out.println( "Relative: " + rel_value + " raw, " + rel_deg + " deg, " + rel_rad + " rad" );
Thread.sleep(3000);
}
}
}
|
Techniques for indicating and changing network communication settings of a computer host
ABSTRACT
A technique for setting network communications for a computer host having multiple network interface controllers (NICs) includes performing network communication for a baseboard management controller (BMC) using a first NIC. In response to actuation of a switch of a network connector jack that is associated with the first NIC, a switching signal is sent from the switch to the BMC. In response to receipt of the switching signal at the BMC, network communication for the BMC is performed using a second NIC.
This application claims priority to Taiwanese Patent Application 102127541, entitled “COMPUTER HOST AND NETWORK COMMUNICATION SETTING METHOD THEREOF,” filed on Jul. 31, 2013. The disclosure of Taiwanese Patent Application 102127541 is hereby incorporated herein by reference in its entirety for all purposes.
BACKGROUND
The disclosure relates to network communications and, more specifically, to techniques for indicating and changing network communication settings of a computer host.
Details about the basic structure of a baseboard management controller (BMC) of a computer host may be located in literature on IBM service processors, namely Integrated Management Module (IMM) and Integrated Management Module II (IMM2).
Conventionally, a computer host may have two different network interface controllers (NICs), namely, a general-purpose NIC for use of the computer host and a NIC dedicated to a BMC. The two NICs may have different MAC addresses and can be allocated to different IP addresses (see, for example, U.S. Patent Application Publication No. 2011/0161482).
For instance, the IBM IMM performs network communication using the general-purpose NIC of the computer host (known as a “shared mode”) or using the NIC dedicated to the IMM of the computer host. For further details, refer to Integrated Management Module User's Guides, Third Edition, published by IBM in February 2010.
BRIEF SUMMARY
A technique for indicating and changing network communication settings for a computer host having multiple network interface controllers (NICs) includes performing network communication for a baseboard management controller (BMC) using a first NIC. In response to actuation of a switch of a network connector jack that is associated with the first NIC, a switching signal is sent from the switch to the BMC. In response to receipt of the switching signal at the BMC, network communication for the BMC is performed using a second NIC.
The above summary contains simplifications, generalizations and omissions of detail and is not intended as a comprehensive description of the claimed subject matter but, rather, is intended to provide a brief overview of some of the functionality associated therewith. Other systems, methods, functionality, features and advantages of the claimed subject matter will be or will become apparent to one with skill in the art upon examination of the following figures and detailed written description.
The above as well as additional objectives, features, and advantages of the present invention will become apparent in the following detailed written description.
BRIEF DESCRIPTION OF THE DRAWINGS
The description of the illustrative embodiments is to be read in conjunction with the accompanying drawings, wherein:
FIG. 1 is a block diagram of a computer host according to an embodiment of the present disclosure;
FIGS. 2A-2C are schematic views of network connector jacks according to embodiments of the present disclosure; and
FIG. 3 is a schematic view of a circuit associated with the embodiment illustrated in FIG. 2C.
DETAILED DESCRIPTION
The illustrative embodiments provide a computer host and a method for indicating and changing network communication settings of a computer host.
In the following detailed description of exemplary embodiments of the invention, specific exemplary embodiments in which the invention may be practiced are described in sufficient detail to enable those skilled in the art to practice the invention, and it is to be understood that other embodiments may be utilized and that logical, architectural, programmatic, mechanical, electrical and other changes may be made without departing from the spirit or scope of the present invention. The following detailed description is, therefore, not to be taken in a limiting sense, and the scope of the present invention is defined by the appended claims and equivalents thereof.
It should be understood that the use of specific component, device, and/or parameter names are for example only and not meant to imply any limitations on the invention. The invention may thus be implemented with different nomenclature/terminology utilized to describe the components/devices/parameters herein, without limitation. Each term utilized herein is to be given its broadest interpretation given the context in which that term is utilized. As may be used herein, the term ‘coupled’ may encompass a direct connection between components or elements or an indirect connection between components or elements utilizing one or more intervening components or elements.
Conventionally in a situation where a computer host has multiple network interfaces, the computer host, particularly from the appearance, does not provide a clue to identifying the network interface in which a baseboard management controller (BMC) performs communication.
According to Integrated Management Module User's Guides, Third Edition, published by IBM in February 2010, as soon as the computer host boots (or restarts), inquiry or execution of the network interface for use in configuration is typically effectuated by a Unified Extensible Firmware Interface (uE FI). However, doing so may take significant time. Conventionally, a user may log into a BMC remotely in order to query or perform configuration. Before remote access begins, a user needs to know a network communication setting of the BMC and identify the network interface in which the BMC is currently performing communication.
In view of this, the present disclosure, in one aspect, provides an indicator device that is positioned at a visible external point of the computer host, such that a user can discern the network communication settings of the BMC by referring to a mode (such as color or flashing frequency) in which the indicator device is operating. According to another embodiment, a switch that is positioned at an approachable external point of the computer host is provided, such that a user can switch between the network communication settings of the BMC directly.
In an embodiment, a computer host comprises: a baseboard management controller (BMC); a first network interface controller (NIC); and a network connector jack configured to connect a network cable and the first NIC. The network connector jack may include an indicator device electrically coupled to the BMC that receives a configuration indication signal of the BMC and operates in response to the configuration indication signal.
In an embodiment, a computer host comprises: a baseboard management controller (BMC); a first network interface controller (NIC); and a network connector jack configured to connect a network cable and the first NIC. The network connector jack may include a switch electrically coupled to the BMC. A user may send a switching signal to the BMC through the switch. In this case, the BMC changes its network communication setting in response to the switching signal.
In another embodiment, a method of changing a network communication setting of a BMC of a computer host using a switch of a network connector jack of the computer host is disclosed.
Referring now to FIG. 1 through FIG. 3, systems/devices, methods, and computer program products are illustrated as structural or functional block diagrams or process flowcharts according to various embodiments of the present invention. The flowchart and block diagrams in the Figures illustrate the architecture, functionality, and operation of possible implementations of systems, methods and computer program products according to various embodiments of the present invention. In this regard, each block in the flowchart or block diagrams may represent a module, segment, or portion of code, which comprises one or more executable instructions for implementing the specified logical function(s). It should also be noted that, in some alternative implementations, the functions noted in the block may occur out of the order noted in the figures. For example, two blocks shown in succession may, in fact, be executed substantially concurrently, or the blocks may sometimes be executed in the reverse order, depending upon the functionality involved. It will also be noted that each block of the block diagrams and/or flowchart illustration, and combinations of blocks in the block diagrams and/or flowchart illustration, can be implemented by special purpose hardware-based systems that perform the specified functions or acts, or combinations of special purpose hardware and computer instructions.
FIG. 1 illustrates the hardware framework of a computer host 100, according to an embodiment of the present invention. The computer host 100 comprises a casing 130. The casing 130 contains therein a baseboard management controller (BMC) 102, two separate network interface controllers (NICs) 104 and 106, and a basic component 110 (such as a central processing unit, a main memory module, or a hard disk drive, etc.). In particular, the BMC 102 has different network communication settings and performs network communication through one of the NICs 104 and 106, for example. In one embodiment, the NIC 104 is dedicated to the BMC 102 and the NIC 106 is available to the other devices, such as a central processing unit (not shown), of the computer host 100 (and, as such, the NIC 106 is not dedicated to the BMC 102).
For the basic framework attributed to the computer host 100 but not directly related to the present invention, refer to conventional personal computers or servers, such as IBM System X, Blade Center, or eServer and, more specifically, to IBM System×3550 M4. Details not related to the present invention are left out in the following description. Referring to FIG. 1, the casing 130 has a network connector jack 134 (allocated to the NIC 104) and a network connector jack 136 (allocated to the NIC 106). In the embodiment described below, the NICs 104 and 106 are provided in the form of Ethernet NICs.
The network connector jacks 134 and 136 may each be coupled to an external RJ-45 network cable. For the basic structure attributed to the network connector jacks 134 and 136, but not directly related to the present invention, refer to conventional RJ-45 connector jacks or U.S. Patent Application Publication No. 2011/0267191, for example. If the NICs 104 and 106 are not provided in the form of Ethernet NICs, the structure of the network connector jacks 134 and 136 may change to comply with a protocol supported by the NICs 104 and 106. Moreover, while the various embodiments are exemplified by the network connector jacks 134 and 136, more than two network connector jacks may be employed according to the present disclosure.
Various embodiments of the network connector jacks of the present disclosure are illustrated in FIG. 2A through FIG. 2C and further described below. Although the description below is exemplified by the network connector jack 134, the description below also applies to the network connector jack 136. Referring to FIG. 2A, the network connector jack 134 has an indicator device 200. The indicator device 200 may be a light-emitting diode (LED) device, but is not restricted thereto. Moreover, the disclosed quantity and position of the indicator device 200 on the network connector jack 134 are illustrative rather than restrictive. In at least one embodiment, the network connector jack 134 has two of the indicator devices 200 disposed at two corners on the front of the network connector jack 134, respectively, as shown in FIG. 2A. Further details of the operation of the indicator device 200 are set forth in Table 1 and discussed with respect to FIG. 3.
Referring to FIG. 2B, the network connector jack 134 includes a switch 300. As shown in FIG. 2B, the switch 300 is exemplified by a press switch (i.e., a pushbutton switch), but the switch 300 is not so limited. For example, the switch 300 can be a toggle switch. The disclosed position of the switch 300 on the network connector jack 134 is illustrative, rather than restrictive, and the switch 300 can be positioned anywhere on the network jack connector 124 (provided that the switch 300 is accessible to users). The number of statuses between which the switch 300 is switched is subject to change, provided that it meets the switching requirements of the BMC 102. Further details of the operation of the switch 300 are set forth in Table 1 and discussed with respect to FIG. 3.
Referring to FIG. 2C, the network connector jack 134 includes the indicator device 200 and the switch 300 according to an embodiment of the present disclosure. While the related circuit connection and operation of the network connector jack 134 is illustrated in FIG. 2C and described below, it should be noted that the present disclosure further includes a variant pertaining to the network connector jack 134 that is equipped solely with the indicator device 200 (as shown in FIG. 2A) and another variant pertaining to the network connector jack 134 that is equipped solely with the switch 300 (as shown in FIG. 2B). Furthermore, in an embodiment not shown, the indicator device 200 and the switch 300 are integrally coupled together to form a unitary structure. That is, in at least one embodiment, the indicator device 200 is directly mounted on the switch 300, such that a size of the network connector jack 134 can be reduced.
FIG. 3 shows a circuit 500 between the BMC 102, the NICs 104 and 106, and the network connector jacks 134 and 136 according to an embodiment. In particular, in the embodiment of FIG. 3, the circuit 500 further comprises a control logic 184 (corresponding in function to the network connector jack 134) and a control logic 186 (corresponding in function to the network connector jack 136). The control logic 184 and the control logic 186 may take the form of programmable integrated circuits (programmable ICs), field programmable gate arrays (FPGAs), or any other circuits meeting the aforesaid logical requirement. The NIC 104 (106) has a signal pin (not shown) for sending a connection status indication signal ‘NS’ to the control logic 184 (186), For further details about connection status indication signal ‘NS’, refer to U.S. Patent Application Publication No. 2011/0267191 and commercially-available network card products, such as TP-LINK. TG-3269 Gigabit PCI network card.
When the connection status indication signal ‘NS’ is at a high voltage level, the NIC 104 (106) has detected an abnormal connection status or a connection failure. Conversely, when the connection status indication signal ‘NS’ is at a low voltage level, the NIC 104 (106) has detected a normal connection status. The BMC 102 is electrically connected to other components on the circuit 500 via multiple general-purpose input/output (GPIO) so as to send/receive signals. In an embodiment, the BMC 102 receives switching signal ‘SS’ from the switch 300 and sends a configuration indication signal ‘CS’ and a switching indication signal ‘SI’ to the control logic 184 (186). In this embodiment, when the configuration indication signal ‘CS’ (sent to the control logic 184) is at a high voltage level, the BMC 102 is not using the NIC 104 (106) connected to the control logic 184 (186) for network communication. Conversely, when the configuration indication signal ‘CS’ is at a low voltage level, the BMC 102 is performing network communication using the NIC 104 (106) connected to control logic 184 (186).
When the switching indication ‘SI’ signal (sent to the control logic 184 (186)) is at a low voltage level, the BMC 102 is currently changing its network communication setting (for example, switching between the NICs 104 and 106). Upon completion of the switching process or when the BMC 102 has not changed its network communication setting, the switching indication signal ‘SI is at or returns to a high voltage level. Therefore, regarding the network connector jack 134 allocated to the NIC 104, the control logic 184 controls the operation of the indicator device 200 of the network connector jack 134 according to the configuration indication signal ‘CS’ and the switching indication signal ‘SI’ (from the BMC 102) and the connection status indication signal ‘NS’ (from the NIC 104) in a manner to allow a user to visually discern the five statuses enumerated in Table 1 below. It should be appreciated that the present disclosure is not limited to displaying the statuses of Table 1. In one or more embodiments, the indicator device 200 includes a yellow LED unit ‘Y’ and a green LED unit ‘G’ that emit yellow light and green light, respectively. Similarly, the control logic 186 controls the operation of the indicator device 200 of the network connector jack 136 according to the configuration indication signal ‘CS’ and the switching indication signal ‘SI’ (from the BMC 102) and the connection status indication signal ‘NS’ (from the NIC 106).
TABLE 1 Status No. Signal CS Signal SI Signal NS LED Lamp 1 high voltage high voltage high voltage Off level level level 2 high voltage high voltage Low voltage Green level level level 3 low voltage high voltage high voltage Off level level level 4 low voltage high voltage Low voltage Yellow level level level 5 Not low not Flashing considered considered
The five operation statuses illustrated in Table 1 are further described below with respect to NIC 104. In Status No. 1, the BMC 102 is not using the NIC 104 (connected to the control logic 184) to perform network communication, as the configuration indication signal ‘CS’ is at a high voltage level. Additionally, the BMC 102 is not changing its network communication setting, as the switching indication signal ‘SI’ is at a high voltage level. Furthermore, the NIC 104 has detected an abnormal connection status or a connection failure, as the connection status indication signal ‘NS’ is at a high voltage level. In this case, the control logic 184 turns off the indicator device 200 of the network connection jack 134. That is, the indicator device 200 does not emit any light.
In Status No. 2, the BMC 102 is not using the NIC 104 (connected to the control logic 184) to perform network communication, as the configuration indication signal ‘CS’ is at a high voltage level. Additionally, the BMC 102 is not changing its network communication setting, as the switching indication signal ‘SI’ is at a high voltage level. Furthermore, the NIC 104 has detected a normal connection status, as the connection status indication signal ‘NS’ is at a low voltage level. In this case, the control logic 184 drives green LED unit ‘G’ of the indicator device 200 to emit green light.
In Status No. 3, the BMC 102 is using the NIC 104 (connected to the control logic 184) to perform network communication, as the configuration indication signal ‘CS’ is at a low voltage level. Additionally, the BMC 102 is not changing its network communication setting, as switching indication signal ‘SI’ is at a high voltage level. Furthermore, the NIC 104 has detected an abnormal connection status or a connection failure, as the connection status indication signal ‘NS’ is at a high voltage level. In this case, the control logic 184 turns off the indicator device 200. That is, the indicator device 200 does not emit any light. Hence, like Status No. 1, Status No. 3 is characterized in that the indicator device 200 does not emit any light, provided that the NIC 104 detects an abnormal connection status or a connection failure, so as to instruct the user to handle the connection status abnormality first.
In Status No. 4, the BMC 102 is using the NIC 104 (connected to the control logic 184) to perform network communication, as the configuration indication signal ‘CS’ is at a low voltage level. Additionally, the BMC 102 is not changing its network communication setting, as the switching indication signal ‘SI’ is at a high voltage level. Furthermore, the NIC 104 has detected a normal connection status, as the connection status indication signal ‘NS’ is at a low voltage level. In this case, the control logic 184 drives the yellow LED unit ‘Y’ of the indicator device 200 to emit yellow light.
In Status No. 5, the BMC 102 is changing its network communication setting (for example, switching from the NIC 104 to the NIC 106, or switching back from the NIC 106 to the NIC 104) in response to switching signal ‘SS’ sent by the user via the switch 300, as the switching indication signal ‘SI’ is at a low voltage level. In this case, the control logic 184 controllably drives green LED unit ‘G’ in the indicator device 200 to emit green light intermittently in response to switching indication signal ‘SI’ of a low voltage level. Upon receipt of switching indication signal ‘SI’ of a low voltage level, the control logic 184 does not consider configuration indication signal ‘CS’ and connection status indication signal ‘NS’. In the situation where connection status of the NIC 104 remains normal (i.e., ruling out Status No. 1 and Status No. 3), Status No. 2 (in which the BMC 102 performs network communication without using the MC 104 connected to the control logic 184) is replaced by Status No. 4 (in which the BMC 102 performs network communication by the NIC 104 connected to the control logic 184) after the BMC 102 has finished changing its network communication setting and Status No. 4 is replaced by Status No. 2 after the BMC 102 has finished changing its network communication setting.
According, techniques have been disclosed herein that facilitate indicating and changing network communication settings of a computer host.
While the invention has been described with reference to exemplary embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In addition, many modifications may be made to adapt a particular system, device or component thereof to the teachings of the invention without departing from the essential scope thereof. Therefore, it is intended that the invention not be limited to the particular embodiments disclosed for carrying out this invention, but that the invention will include all embodiments falling within the scope of the appended claims. Moreover, the use of the terms first, second, etc. do not denote any order or importance, but rather the terms first, second, etc. are used to distinguish one element from another.
The corresponding structures, materials, acts, and equivalents of all means or step plus function elements in the claims below, if any, are intended to include any structure, material, or act for performing the function in combination with other claimed elements as specifically claimed. The description of the present invention has been presented for purposes of illustration and description, but is not intended to be exhaustive or limited to the invention in the form disclosed. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention. The embodiments were chosen and described in order to best explain the principles of the invention and the practical application, and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated.
What is claimed is:
1. A computer host, comprising: a baseboard management controller (BMC); a first network interface controller (NIC); a first network connector jack configured to couple a network cable to the first NIC, wherein the first network connector jack includes a first indicator device that is coupled to the BMC, and wherein the first indicator device is configured to operate in a mode that is determined by a configuration indication signal provided by the BMC to indicate whether the BMC is using the first NIC for network communications; a second NIC; and a second network connector jack configured to couple another network cable to the second NIC, wherein the BMC performs network communication using one of the first NIC and the first network connector jack or the second NIC and the second network connector jack, and wherein the first network connector jack further includes a first switch coupled to the BMC that, when actuated, causes a first switching signal to be sent to the BMC, where the BMC is configured to switch between using the first NIC and the second NIC for network communication in response receipt of the first switching signal.
2. The computer host of claim 1, wherein the first switch is a pushbutton switch.
3. The computer host of claim 1, wherein the first indicator device is coupled to the first NIC and the mode is also determined by a connection status indication signal provided by the first NIC.
4. The computer host of claim 1, wherein the second network connector jack further comprises: a second switch coupled to the BMC that, when actuated, causes a second switching signal to be sent to the BMC, wherein the BMC is configured to switch between using the second NIC and the first NIC for network communication in response receipt of the second switching signal.
5. The computer host of claim 1, wherein the first indicator device provides a first color light in response to the configuration indication signal being in a first state and a second color light, different from the first color light, in response to the configuration indication signal being in a second state, different from the first state, when the first NIC is connected.
6. The computer host of claim 1, wherein the first indicator device provides no light in response to the configuration indication signal being in a first state or a second state, different from the first state, when the first NIC is not connected.
7. The computer host of claim 1, wherein the first indicator device provides a flashing light in response to a switching indication signal provided by the BMC to the first network connector jack being in a given state, and wherein the BMC is configured to provide the switching indication signal in the given state in response to receipt of the first switching signal from the first network connector jack.
8. A computer host, comprising: a baseboard management controller (BMC); a first network interface controller (NIC); a first network connector jack configured to couple a network cable to the first NIC, wherein the first network connector jack includes a first switch coupled to the BMC, and wherein the first switch, when actuated, causes a first switching signal to be sent to the BMC and the BMC is configured to change a network communication setting in response to receipt of the first switching signal; a second NIC; and a second network connector jack configured to couple another network cable to the second NIC, wherein the second network connector jack includes a second switch coupled to the BMC, and wherein the second switch when actuated, causes a second switching signal to be sent to the BMC and the BMC is configured to change a network communication setting in response to receipt of the second switching signal, where the BMC uses one of the first NIC and the second NIC for network communication and switches between the first NIC and the second NIC in response to the first and second switching signals.
9. The computer host of claim 8, wherein the first NIC is dedicated to the BMC and the second NIC is not dedicated to the BMC.
10. The computer host of claim 8, wherein the first and second switches are pushbutton switches.
11. The computer host of claim 8, wherein the first network connector jack includes a first indicator device that is coupled to the BMC, and wherein the first indicator device is configured to operate in a mode that is determined by a configuration indication signal provided by the BMC to indicate whether the BMC is using the first NIC for network communication.
12. The computer host of claim 11, wherein the second network connector jack further includes a second indicator device that is coupled to the BMC and is configured to operate in a mode that is determined by a second configuration indication signal provided by the BMC to indicate whether the BMC is using the second NIC for network communication.
13. The computer host of claim 12, wherein the first indicator device provides a first color light in response to the configuration indication signal being in a first state and a second color light, different from the first color light, in response to the configuration indication signal being in a second state, different from the first state, when the first NIC is connected.
14. The computer host of claim 12, wherein the first indicator device provides no light in response to the configuration indication signal being in a first state or a second state, different from the first state, when the first NIC is not connected.
15. The computer host of claim 12, wherein the first indicator device provides a flashing light in response to a switching indication signal provided by the BMC to the first network connector jack being in a given state, and wherein the BMC is configured to provide the switching indication signal in the given state in response to receipt of the first switching signal.
|
# Refrred to https://github.com/the-computer-scientist/OpenAIGym/blob/master/PrioritizedExperienceReplayInOpenAIGym.ipynb
from keras.layers import Dropout
from keras.optimizers import Adam, RMSProp, SGD
from keras.layers.core import Dense
import random
import keras
from keras.models import load_model
from keras.models import Sequential
import numpy as np
from keras.callbacks import TensorBoard
import tensorflow as tf
from time import time
from keras.callbacks import History
from collections import deque
class ANN:
def __init__ (self, load_network = False, load_weight = False, load_file = None):
memory_len = 10000
self.PER = False
self.tick = 1
self.learning_rate = 0.0001
self.discount_factor = 0.99
self.tau = 1
self.num_actions = 4
self.model = self.create_network(load_network, load_weight, load_file)
self.target_model = self.create_network(False, False, False)
self.epsilon = np.power(0.97, self.tick)
self.MAX_MEMORY_LENGTH = memory_len
self.SAMPLE_SIZE = 32
self.memory = deque(maxlen = memory_len)
self.priorities = deque(maxlen = memory_len)
self.priority_scale = 1.0
self.priority_offset = 0.1
self.replay_history = History()
#self.tensorboard1 = TensorBoard(log_dir = "logs\log_inter_ann")
#self.tensorboard2 = TensorBoard(log_dir = "logs\log_replay_ann"
def create_network(self, load_network = False, load_weight = False, load_file = None):
if load_network is True:
model = load_model(load_file)
return model
model = Sequential()
model.add(Dense(128, activation='relu', input_dim = 363))
model.add(Dropout(0.15))
model.add(Dense(64, activation='relu'))
model.add(Dropout(0.15))
model.add(Dense(self.num_actions, activation='linear'))
opt = SGD(self.learning_rate, decay = 1e-6)
model.compile(loss = tf.keras.losses.Huber(), optimizer=opt, metrics = ['accuracy'])
if load_weight is True:
model.load_weights(load_file)
return model
def remember(self, state, action, reward, next_state, finished):
# if(len(self.memory) < self.MAX_MEMORY_LENGTH):
self.memory.append((state, action, reward, next_state, finished))
self.priorities.append(max(self.priorities, default=1))
# else:
# ind = np.random.randint(self.MAX_MEMORY_LENGTH)
# self.memory[ind] = (state, action, reward, next_state, finished)
def get_probabilities(self):
scaled_priorities = np.array(self.priorities) ** self.priority_scale
sample_probabilities = scaled_priorities / sum(scaled_priorities)
return sample_probabilities
def get_sample_weights(self, probabilities):
weights = 1/len(self.memory) * 1/probabilities
weights_normalized = weights / max(weights)
return weights_normalized
def set_priorities(self, indices, errors):
for i,e in zip(indices, errors):
self.priorities[i] = abs(e) + self.priority_offset
def replay_new_PER(self):
sample_size = min(len(self.memory), self.SAMPLE_SIZE)
sample_probs = self.get_probabilities()
sample_indices = random.choices(range(len(self.memory)), k=sample_size, weights=sample_probs)
minibatch = np.array(self.memory)[sample_indices]
sample_weights = (self.get_sample_weights(sample_probs[sample_indices])) ** (1-self.epsilon)
errors = []
for i in range(len(sample_indices)):
state, action, reward, next_state, finished = minibatch[i]
end_result = reward if finished is True else (
reward + self.discount_factor * np.max(self.target_model.predict(next_state)[0]))
target = self.model.predict(state)
target[0][action] = end_result
self.model.fit(state, target, sample_weight = np.array([sample_weights[i]]), epochs=1, verbose=0, callbacks=[self.replay_history])
avg_loss = self.replay_history.history['loss'][0]
errors.append(avg_loss)
self.set_priorities(sample_indices, errors)
avg_loss = sum(errors)/sample_size
f = open("./logs_ann/model_metrics_PER.csv",'a+')
f.write(str(avg_loss)+ "\n")
f.close()
def replay_new(self):
sample_size = min(len(self.memory), self.SAMPLE_SIZE)
minibatch = random.sample(self.memory, sample_size)
states = []
targets = []
for state, action, reward, next_state, finished in minibatch:
end_result = reward if finished is True else (
reward + self.discount_factor * np.max(self.target_model.predict(next_state)[0]))
target = self.model.predict(state)
target[0][action] = end_result
self.model.fit(state, target, epochs=1, verbose=0, callbacks=[self.replay_history])
avg_loss += self.replay_history.history['loss'][0]
#states.append(state.reshape((363,)))
#argets.append(target.reshape(self.num_actions,))
#states = np.array(states)
#targets = np.array(targets)
#self.model.fit(states, targets, epochs=1, verbose=0, callbacks=[self.replay_history])
#loss = self.replay_history.history['loss'][0]
avg_loss = avg_loss/sample_size
f = open("./logs_ann/model_metrics_ER.csv",'a+')
f.write(str(loss)+ "\n")
f.close()
def immediate_update(self, state, action, reward, next_state, done):
target = reward
if not done:
target = reward + self.discount_factor * np.amax(self.model.predict(next_state)[0])
reward_pred = self.model.predict(state)
reward_pred[0][action] = target
self.model.fit(state, reward_pred, epochs=1, verbose=0)
def transfer_weights(self):
online_weights = self.model.get_weights()
old_target_weights = self.target_model.get_weights()
new_target_weights = []
for i in range(len(old_target_weights)):
new_target_weights.append(online_weights[i] * self.tau + old_target_weights[i] * (1 - self.tau))
self.target_model.set_weights(new_target_weights)
def set_PER(self, tf):
self.PER = tf
def train(self, state, action, reward, next_state, done):
self.remember(state, action, reward, next_state, done)
#self.immediate_update(state, action, reward, next_state, done)
if(self.PER):
self.replay_new_PER()
else:
self.replay_new()
# if(self.tick % 100 == 0):
# self.replay_new()
# if(self.tick % 1000 == 0):
# self.transfer_weights()
def save_model(self, iteration='1'):
ex = "PER" if self.PER else "ER"
self.model.save_weights("./weight_store" + "/ann_" + ex + "_weight_"+ iteration+".h5")
self.model.save("./model_store" + "/ann_" + ex + "_model_" + iteration+".h5")
def predict_action(self, state):
self.tick = self.tick + 1
return np.argmax(self.model.predict(state)[0])
def get_summary(self):
return self.model.summary()
|
Cosmetic issues in excel sheet
Row | Topic Heading | Subject | Comments
26 | COVID 19 | Masks | extra space after bullets
5 | Figure outside body walking | Be Active | extra space after bullets
41 | Heart | Heart Disease | extra space after bullets
19 | Colon | Colorectal Cancer | extra space between cancer & may
66 | Physical Exam | Physical Exam | not sure if bullet is required for "more". There is not bullet in others.
15 | Uterus | Cervical Cancer | not sure if bullet is required for "more". There is not bullet in others.
63 | Physical Exam | Physical Exam | extra space after bullets in the health provider text
Row 23 Patient Male 150, Typo: COVID-19 Español, Arabic, Mandarin and other languagues.
Row 40 Provider femae 49, Type: provider text, links which is "Canadian Simplified Lipid Guidelines by family physicans"
Hi @niharikaavasthi
Since EN excel sheet cleaning was part of your checklist for creating JSON-EN, could you please try to communicate with Rishang for fixing these problems to be able to re-create JSONs?
Thanks in advance!
HI @niharikaavasthi can you please provide the new Excel and json files for EN
Row 23 Patient Male 150, Typo: COVID-19 Español, Arabic, Mandarin and other languagues.
Row 40 Provider femae 49, Type: provider text, links which is "Canadian Simplified Lipid Guidelines by family physicans"
what is this about?
Row 23 Patient Male 150, Typo: COVID-19 Español, Arabic, Mandarin and other languagues.
Row 40 Provider femae 49, Type: provider text, links which is "Canadian Simplified Lipid Guidelines by family physicans"
what is this about?
I think the first issue is languages has a type. There is an extra u at the end.
@Darshanapujar please provide details of these 2, to @RISHANGSHARMA
Thanks
@RISHANGSHARMA I changed the excel sheet yesterday but I did not not convert it to JSON because there was a possibility of more changes on it. Do you want me to change it and notify you?
I used your excel sheet to get new jsons...i noticed that
So i uodated it in the gdrive also
should be fixed on the test website update (13-7-2020: 6 PM)
Please consider it in your tests.
Patient Female 55 | Tests | Low dose CT scan | An x-ray machine scans the lungs | Lack of period.
Patient Female 18 | Tests | Rubella and Varicella immunity | if you are non immune you may become infected with rubella during a pregnancy | No capitalization at the beginning of the sentence.
Patient Female 18 | Tests | STI tests | •Women: a pelvic exam or a urine test; and blood tests. | Assume the 'a' that after double quotes should be capitalized.
Patient Female 18 | Tests | STI tests | •Men: a urine test and blood tests | Lack of period. Assume the 'a' that after the colon should be capitalized.
Patient Female 18 | Tests | STI tests | The test done by pelvic exam in women is for Chlamydia and Gonorrhea | Lack of period.
Patient Male 65 | Topics | Be active | while you are active you have enough breath to say a short sentence but not enough to sing | Lack of period. Assume the 'w' that after the colon should be capitalized.
Patient Male 18 | Topics | Bone health | Below age 65: only recommended if: you have [[risk factors; https://www.canada.ca/en/public-health/services/chronic-diseases/osteoporosis.html]] | Extra colon before you. Assume the 'o' that after the colon should be capitalized.
Patient Male 65 | Topics | Bone health | Recommended for everyone 65 or older Your provider will determine when to repeat it | Lack of period.
Patient Female 18 | Topics | COVID-19 | First Nations, Métis, Inuit | The language seems wrong.
Patient Female 18 | Topics | COVID-19 | COVID-19 Español, Arabic, Mandarin and other languages | The language seems wrong.
Provider Female 65 | Topics | Falls in the elderly | The American Geriatrics Society and British Geriatrics Society recommend asking about falls every year | Lack of period.
Patient Female 18 | Topics | Family Planning | •Rubella, Hepatitis B, HIV:can affect your unborn child. | Lack of space after colon and the 'c' should be capitalized.
Patient Female 18 | Topics | Family Planning | •Chicken pox: which can be very serious for you in pregnancy. | Lack of space after colon and the 'w' should be capitalized.
Provider Female 18 | Topics | Family Planning | •Hepatitis B and HIV disease in women of childbearing age, | Should be a period.
Provider Female 18 | Topics | Heart disease | more potent than statins in preventing heart disease | No capitalization at the beginning of the sentence.
Provider Female 18 | Topics | Heart disease | see our physical activity section | No capitalization at the beginning of the sentence.
Patient Female 50 | Topics | Heart disease | or at the age of menopause. | No capitalization at the beginning of the sentence.
Provider Female 75 | Topics | Heart disease | •before 40 in men and 50 in women if risk factors | No capitalization at the beginning of the sentence.
Provider Female 75 | Topics | Heart disease | •for men age 40+:repeat every 3-5 years if N | No capitalization at the beginning of the sentence.
Provider Female 75 | Topics | Heart disease | •for women age 50+ or at menopause:repeat every 3-5 years if N | No capitalization at the beginning of the sentence.
Provider Female 75 | Topics | Heart disease | •age 75 + healthy: discouraged as have not been validated at this age | No capitalization at the beginning of the sentence.
Provider Female 30 | Topics | Lung | recommended by Canadian Task Force (CTF)for certain patients 55-74 | No capitalization at the beginning of the sentence.
Provider Female 50 | Topics | Physical Exam | •[["at appropriate medical visits" according to CTFPHC; | No capitalization at the beginning of the sentence.
Provider Male 18 | Topics | Sex & Prostate | •offer HIV testing to all: | No capitalization at the beginning of the sentence.
Provider Female 50 | Topics | Substance Abuse | Help available for patients addicted to a substance/gambling: each province or territory has a help line: [[more; https://www.canada.ca/en/health-canada/services/substance-use/get-help/get-help-problematic-substance-use.html]]: Screening and counseling USPSTF I (2018) under review | No capitalization at the beginning of the sentence. And there are two consecutice colons in the same sentences.
Provider Female 18 | Topics | Vision | Consensus only recommendation from Canadian Ophthalmol Society 2007 | No capitalization at the beginning of the sentence.
Provider Female 18 | Topics | Vision | Currently in many provinces this would be done by optometrists | No capitalization at the beginning of the sentence.
Clinicien Femme Tous ages | Tests | Dépistage des ITS | • Hommes: Une analyse d’urine et des analyses de sang | Lack of period
Clinicien Femme Tous ages | Tests | Dépistage des ITS | L’examen pelvien chez la femme porte sur la chlamydiose et la gonorrhée | Lack of period
|
const crypto = require('crypto');
const c = crypto.randomBytes(32, function (err, buffer) {
const token = buffer.toString('hex');
console.log(token);
});
console.log(c);
|
Working in corona-designated departments in a fortified underground hospital: Concerns about corona and predictors of job burnout
Background In August 2020 during Israel’s second COVID-19 wave Rambam Medical Center opened the Sammy Ofer Fortified Underground Emergency Hospital. This was declared a regional Corona center in the north of Israel, receiving the most severe Corona patients from the region. Alongside the advanced inpatient capacity and technology within the underground facility, there was a severe shortage of trained medical and paramedical staff, as well as harsh working conditions. The current study examined the implications and effects of working in an underground facility on healthcare workers, focusing on emotion regulation tendencies and profession as predictors of job burnout. Methods Seventy-six healthcare workers, who had worked in the underground hospital for a minimum continuous period of 2 weeks during the peak of the COVID-19 pandemic, and a control group of 40 healthcare workers from northern Israel were asked to fill out an online survey administered via Qualtrics (total sample 116). The survey comprised six questionnaires: a demographic survey questionnaire; a COVID-19 concerns questionnaire; a psychological distress questionnaire (DASS, Depression Anxiety Stress Scale); trait worry (PSWQ; Penn State Worry Questionnaire); emotion regulation (ERQ, Emotion Regulation Questionnaire), and burnout (SMBM, Shirom - Melamed Burnout Measure). Results Independent-samples t-tests revealed no significant differences in psychological distress or burnout between Rambam Underground hospital workers and the control group. Conversely, COVID-19 concern scores were significantly different in the two groups, the Rambam hospital workers showing less concern (M = 2.9, SD = 0.73) than the control group (M = 3.47, SD = 0.76) [t(114) = −3.974, p < 0.001]. Hierarchical linear regression analysis identified the significant predictors of burnout among healthcare workers. Participants’ profession (physician), psychological distress (total DASS score), and a personality trait of worry were statistically significant predictors for job burnout (p = 0.028, p < 0.001, p = 0.023, respectively). Concerns about COVID-19 marginally predicted job burnout (p = 0.09). Group (underground vs. control) and emotion regulation tendencies did not predict burnout. Conclusion The two groups showed no significant differences in psychological distress nor in burnout. Being a physician, having an intrinsic trait of being overly worried and experiencing psychological distress were significant predictors for job burnout among healthcare workers, regardless of work environment (underground vs. control).
Introduction
In December 2019 the corona virus (COVID-19) began spreading around the world from Wuhan, China. The clinical manifestations of COVID-19 infection are those of a respiratory disease, whose severity depends in part on the patient's age, medical history, and general physical condition. In previously healthy individuals the infection will mostly cause only mild symptoms, while older and/or sicker individuals are prone to develop severe disease, possibly resulting in respiratory failure and even death (1). During Israel's second COVID-19 wave in August 2020 289,799 people were infected, of whom 845 were critically ill, 232 of them requiring a ventilator. According to data from the Ministry of Health, the daily number of infected individuals in this period ranged from 3,708 to 5,691 despite a strict quarantine policy (2). These unique and rather extreme circumstances, forecasting a steep increase in infections rate and morbidity, led to Rambam Medical Center's decision to open the Sammy Ofer Fortified Underground Emergency Hospital.
The Sammy Ofer underground hospital was built to accommodate and maintain the full range of Haifa's clinical activity under all possible conditions of external threat, for example, in times of war and pandemic. It was established after the attack on Haifa's hospitals during Israel's Second Lebanon War and is considered the largest of its kind in the world. It covers an area of 60,000 square meters, has capacity for 2,000 beds, and contains operating rooms as well as other complex treatment infrastructure (3).
When it opened due to COVID-19, the hospital was declared a regional Corona center in the north of Israel, with 770 dedicated beds and 170 respirators for receiving the most severe Corona patients. One of the biggest shortcomings during this period was that, alongside the advanced inpatient capacity and technology within the underground facility, there was a severe shortage of trained medical and paramedical staff. These personnel had to work in an infected facility with the risk of bringing the potentially lethal infection back to their family members.
Several studies published during the past years have shown that healthcare workers who treated COVID-19 patients suffered more frequently from psychological distress and mental health issues, such as depression and anxiety, than those who did not treat COVID-19 patients (4)(5)(6). Psychological distress is defined as emotional suffering accompanied by symptoms of depression and anxiety (7). The distress can be triggered by personality traits and maladaptive coping strategies such as the tendency to worry or become concerned, i.e., a chain of relatively uncontrollable thoughts attempting to find solutions for issues with uncertain results (8,9). Worrying may also be characterized by the inability to let go of negative emotions leading to anxiety, stress and eventually depression (10,11).
Mental and psychological distress may also be associated with burnout at the workplace (12), particularly among populations experiencing prolonged work-related stress (13). Burnout syndrome refers to emotional exhaustion occurring among workers, regardless of a particular profession (14). An Israeli study in 2006 proposed a multidimensional approach to burnout syndrome, suggesting that it derives from emotional exhaustion, and physical and cognitive fatigue (15). Among health care workers burnout syndrome has been directly linked to the onset of depression, nervousness, helplessness, and anxiety (12, 16).
The COVID-19 pandemic has caused a global imbalance in negative versus positive emotions across all populations, leading to burnout across the entire healthcare system (5). The current study examines whether healthcare workers' work environment affects their psychological distress, COVID-related concerns, and burnout levels. Healthcare workers working in the underground hospital were compared to a similar population who did not work in the underground hospital at that time. Additionally, taking into account that the pandemic is yet to be resolved, we examined the impact of working in an underground facility and other personality-and profession-related factors on burnout to better understand how to optimally manage similar situations in the future.
Participants
The survey included healthcare medical and paramedical staff who worked in the underground hospital during the peak of the COVID-19 pandemic for a minimum of 2 weeks and healthcare staff who worked in their regular environment (control group). The study was approved by the Rambam Helsinki committee and by the IRB (Institutional Review Board) of the Faculty of Education, University of Haifa.
Non-underground sample
Data of control participants were taken from (17). This group included 40 healthcare workers from northern Israel who did not work at the underground hospital. They filled out the same questionnaire as the workers in the underground sample, except for the questions related to the work in the underground hospital in the "COVID-19 Concerns Questionnaire. " The control group received the online survey in April 2020, approximately half a year before the underground group filled in the survey.
Underground sample
This group included 76 participants. Initial contact was established with the staff of the underground hospital during February-June, 2021, during which an initial selection was made according to the study's inclusion criteria.
Inclusion criteria
(1) Hospital employees over the age of 18. (2) Employees who had been working or previously worked in the COVID-19 wards in the underground hospital for a minimum continuous period of 2 weeks.
Procedure
After signing an informed consent form, participants received a text message with an attached link to an Online questionnaire (Qualtrics, Online Survey Questionnaire). This was sent only once and in Hebrew. Filling out the questionnaire took about 20 min.
Questionnaires
The online survey included six questionnaires: Demographic Questionnaire. This questionnaire included questions about gender, age, origin, professional position and placement, salary and previous work experience. It also included questions related to the pandemic itself, for example: "Have you been previously diagnosed with a COVID-19 infection?" COVID-19 concerns questionnaire [based on (17)]. This questionnaire assessed the level of stress experienced by the employee due to the pandemic and, particularly, due to work in the underground hospital (e.g., the fear of becoming infected, of infecting family members, and fear of working with COVID-19 infected patients). This questionnaire also included questions about concerns related to the employee's personal socioeconomic situation, personal appearance and relationships during the pandemic. Participants responded on a 5-point scale ranging from 1 (not at all) to 5 (very much). This questionnaire was based on a questionnaires developed during the SARS outbreak (18).
The Depression Anxiety Stress Scale (DASS) (19,20). The DASS is a 21-item self-report instrument designed to measure the three related negative emotional states depression, anxiety and stress. Participants were asked to rate how often they experienced each item in the past week on a four-point scale ranging from 0 (does not apply to me at all) to 3 (applies to me very much or most of the time).
The Penn State Worry Questionnaire (PSWQ) (21). The PSWQ is a 16-item questionnaire assessing personality traits, such as the tendency to worry and the severity of concern. Participants were instructed to indicate the degree to which they regarded each item as typical of them on a five-point scale ranging from 1 (not at all typical of me) to 5 (very typical of me).
Emotion Regulation Questionnaire (ERQ) (22). The ERQ consists of 10 statements, examining two emotion regulation strategies; reappraisal and suppression. Participants were asked to rate whether they agreed or disagreed with each statement on a scale of 1 to 7 (1 = strongly disagree, 7 = strongly agree). (15). The SMBM assesses burnout at the workplace. It consists of 16 items divided into three sub-scales: physical fatigue (six items), cognitive weariness (six items) and emotional exhaustion (four items). Participants were asked to answer on a seven-point scale ranging from 1 = "almost never" to 5 = "almost always. "
Analytical strategy
Statistical significance was set a priori to <0.05 (two-tailed), with all analyses conducted using IBM SPSS Statistics version 26 (IBM, Armonk, NY). We first performed independent-samples t-tests to examine differences between the two study groups. Then, a hierarchical linear regression analysis was performed to determine the predictors of job burnout. In the first step, the demographic characteristics of group (underground hospital employees vs. health care workers in general), profession type (physician vs. non-physician), age and gender were entered into the model. In the second step, situational factors related to distress, such as overall psychological distress (total DASS score) and COVID-19 concerns were added. In the third step, trait characteristics related to emotion regulation tendencies (reappraisal, suppression, and worry) and personality traits were added to the model.
Results
A total of 116 healthcare workers participated in the study, 76 employees who worked in the underground hospital versus 40 employees who did not (control group). 68 of the participants (58.6%) were women, mean age was 34.1 (SD = 8.04). Full demographic information on all participants in the study is given in Table 1.
Group differences in psychological distress and burnout
We conducted five independent-samples t-tests to examine differences between the two groups in DASS total and sub-scale scores, SMBM scores and COVID-19 concerns. Surprisingly, COVID-19 concern scores showed a significant difference, with lower levels of concerns among Rambam hospital workers (M = 2.9, SD = 0.73) than other healthcare workers (M = 3.47, SD = 0.76, t (114) = −3.974, p < 0.001). Results are given in Table 2.
Discussion
The COVID-19 crisis forced major changes in healthcare facilities including opening new sites. Our study was conducted in northern Israel during 2021, half a year after transforming the Sammy Ofer fortified underground hospital into a COVID-19 treatment center. At that time several studies from Israel and around the world showed significant correlation between psychological distress and burnout among healthcare workers in the face of the COVID-19 pandemic (15,(23)(24)(25)(26)(27)(28)43). These studies led us to examine the effects on healthcare workers of working in an underground facility and to examine the factors predicting job burnout.
Based on the concept of "environmental medical syndromes" (29), we predicted that working in the underground hospital in sub-optimal conditions (no windows and view of the outside world, no sunlight, closed-loop air circulation, wearing restrictive protective equipment, longer shifts) would cause significantly greater psychological distress, COVID-19 concerns and burnout than in healthcare workers not exposed to the same work conditions. Surprisingly, our results did not support our hypotheses; there was no significant differences in psychological distress (Total-DASS) nor in burnout between the two groups. The study did, however, reveal a significant difference in COVID-19 concerns between the two groups, with lower mean scores among those working in the underground hospital. One explanation for this result may be the small sample size, particularly of the control group. Another cause may be that Rambam employees filled in the questionnaires approximately half a year later than the control group, when the expression of the COVID-19 pandemic was clearer and less acute and the benefits of protective gear were better understood. Also, Rambam Hospital employed social and psychological support teams for employees, which may have helped lower their distress.
We examined factors that may contribute to developing burnout. Our findings suggest that being a physician, having an intrinsic trait of being overly worried and experiencing psychological distress were significant predictors of job burnout among healthcare workers generally, whereas group (underground vs. controls) did not predict job burnout. Our results agree with previous findings around the world of a correlation between being a physicians and job burnout in the everyday work environment, regardless of the COVID-19 pandemic (30)(31)(32)(33)(34).
We hypothesized that physicians, who were exposed to COVID-19 patients, would be more likely to develop burnout syndrome (2). Due to the lack of a comparative follow-up questionnaires at different periods, testing this hypothesis requires more research.
Although several studies have investigated the link between psychological variables and job burnout (3,10,21,33,(35)(36)(37)(38), there are almost no studies on the correlation between the personality trait tendency to worry with job burnout among healthcare workers. We found that worrying greatly did predict job burnout independently of profession and external circumstances. Our findings are in line with previous studies demonstrating positive correlations between psychological distress and burnout during regular work (36, 39,40), as well as during a pandemic (15,27,41). Here, psychological distress predicted burnout to a greater degree than worry (β = 0.491 vs. β = 0.188).
Previous studies identified moderate to severe levels of psychological distress and burnout among healthcare workers during the COVID 19 pandemic (15, 24-26, 28, 38). However, to the best of our knowledge, no studies have examined the direct effect of COVID-19 concerns on job burnout among healthcare workers. Our study suggests a marginally significant association between COVID-19 concerns and job burnout among healthcare workers, making it a valuable addition to the available data.
The current study has several limitations. First, the underground sample was much larger than the control group and both groups consisted predominantly of women. Thus, the results may be less generalizable. Second, the current study was cross-sectional, which does not allow examination of directionality between variables. Furthermore, the two groups filled out the questionnaire half a year apart within different COVID-19 waves.
Data availability statement
The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.
|
Victor Krane
Biography
Krane is mentioned in Merry Glitchmas when Donald mentions him as a "Bionic Madman."
Legacy
Henchmen
Krane had bionic henchmen to help accomplish his evil goals:
Bionic Soldiers
Otis (formerly)
Powers and Abilities
* Pyrokinesis: He demonstrated a new ability, the ability to shoot fireballs.
* Super Speed: When he threw the security guard across the room, he used super speed.
Glitches:
Trivia
* His motives are revealed in Sink or Swim and Taken.
* Krane probably stole all the money Douglas stole from his brother.
* He gets mad at Douglas a lot when Douglas fails to do what he wants. (Sink or Swim)
* When his identity was yet to be revealed, many fans believed that he was Marcus.
* Krane has a gasket under his collarbone.
* He is a billionaire, who paid Douglas $80 million to implant him with bionics.
* Krane does not like Tasha Davenport's news reports.
* The actor who portrays him, Graham Shiels, was the first Canadian actor on Lab Rats.
* The mask that he wears is the Jabberwocky mask.
* He's the main antagonist of season 3, usurping Douglas.
* Douglas gave him a cyber mask and cyber cloak to wear on Halloween.
* Unlike Chase, he does not faint when he uses two abilities at the same time.
* Krane can control the Bionic Army with his brain.
* At the end of You Posted What?!?, Victor Krane and Taylor got arrested by the government.
* Victor Krane has had some references to Star Wars, specifically Sith Lords.
* Just like Darth Sidious and Darth Vader, Krane's face is deformed.
* In Taken, Krane laughs when he's in combat just like Darth Sidious does.
* In Rise of the Secret Soldiers, Krane activates his bionic army.
* Rise of the Secret Soldiers might be the final appearance of Victor Krane.
* Sebastian calls Krane his father.
* Krane is the first villain to have ever come close to killing someone onscreen.
* The true reason is unknown as why Krane wanted to take over the world.
* Kane believed that ordinary humans are inferior but bionic humans are superior.
* Kane wanted one great nation state under bionic dictatorship rule.
* It is unknown if Krane ever met Marcus Davenport.
* Victor Krane never took Douglas to the Florida Keys, even though he said he would.
* Victor Krane didn't like Douglas doing impressions of him at dinner parties.
* He has controlled the president with the Triton App before.
|
een yoars at Kew, where I was about I860, at which time Dr. Hooker made a trip to Syria and Asia Minor, and brought home seeds of the Molucella, which we raised. We continned to grow the plants, but I failed to notice any beauty in thorn — being more curious than beauti¬ ful. Yours, truly, T. Spanswiok, “ Publisher ‘ The Garden.’ ”
EULAE.IA JAPONICA VAR. ZEBRINA. The quantity of manure to be used need be measered only by the quantity that can be spared —for there is no danger of making the soil too rich. Bone, wood-ashes, salt, lime, &c., are all good. Then open trenches six inches deep and, spreading out the roots, place the plants at least a foot apart. The crowns will then be about three inches below the surface. The old prac¬ tice of planting very deep
|
package com.wing.gui.awt.keyboard;
import java.awt.*;
import java.awt.event.*;
import java.util.ArrayList;
import java.util.Iterator;
/**
* @author memory125
*/
public class KeyFrame extends Frame{
// 坐标记录
ArrayList points;
public void loadFrame() {
// 设置窗口属性: 标题
setTitle("KeyFrame");
// 设置窗口属性: 起始坐标和大小
setBounds(200, 200, 400, 600);
// 设置窗口属性: 可见
setVisible(true);
// 设置窗口属性: 背景色
setBackground(new Color(98, 160, 126));
points = new ArrayList<>();
// 添加键盘监听事件
addKeyListener(new KeyAdapter() {
@Override
public void keyPressed(KeyEvent e) {
//super.keyPressed(e);
// 获取键值
int keyCode = e.getKeyCode();
char keyChar = e.getKeyChar();
System.out.println("keyCode: " + keyCode);
System.out.println("keyChar: " + keyChar);
}
});
// 添加鼠标监听事件
addMouseListener(new MouseAdapter() {
// 鼠标事件: 按下，弹起，桉住不放
@Override
public void mousePressed(MouseEvent e) {
KeyFrame frame = (KeyFrame) e.getSource();
// 在点击的时候，在界面上会产生一个点，
// 这个点就是鼠标的点
frame.addPoint(new Point(e.getX(), e.getY()));
// 每次点击鼠标都需要重绘一次
frame.repaint(); // 刷新
}
});
// 添加窗口监听事件
addWindowListener(new WindowAdapter() {
@Override
public void windowClosing(WindowEvent e) {
System.exit(0);
}
});
}
// 添加点坐标到界面上
public void addPoint(Point point) {
points.add(point);
}
@Override
public void paint(Graphics g) {
// 监听鼠标事件，绘画
Iterator iterator = points.iterator();
while (iterator.hasNext()) {
Point point = (Point) iterator.next();
g.setColor(Color.RED);
g.fillOval(point.x, point.y, 10,10);
}
}
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.