modelId
stringlengths
5
122
author
stringlengths
2
42
last_modified
timestamp[us, tz=UTC]
downloads
int64
0
738M
likes
int64
0
11k
library_name
stringclasses
245 values
tags
listlengths
1
4.05k
pipeline_tag
stringclasses
48 values
createdAt
timestamp[us, tz=UTC]
card
stringlengths
1
901k
baxtos/bartik13-4
baxtos
2024-07-02T09:33:22Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:31:00Z
Entry not found
YuChingLin/Taiwan-Llama-70B
YuChingLin
2024-07-02T10:17:36Z
0
0
null
[ "gguf", "license:apache-2.0", "region:us" ]
null
2024-07-02T09:31:26Z
Temporary Redirect. Redirecting to /YuChingLin/Taiwan-Llama3-70B-Instruct/resolve/main/README.md
Chonlasitk/whisper-small-hi
Chonlasitk
2024-07-02T10:29:07Z
0
0
transformers
[ "transformers", "tensorboard", "safetensors", "whisper", "automatic-speech-recognition", "generated_from_trainer", "hi", "dataset:mozilla-foundation/common_voice_11_0", "base_model:openai/whisper-small", "license:apache-2.0", "model-index", "endpoints_compatible", "region:us" ]
automatic-speech-recognition
2024-07-02T09:31:34Z
--- language: - hi license: apache-2.0 base_model: openai/whisper-small tags: - generated_from_trainer datasets: - mozilla-foundation/common_voice_11_0 metrics: - wer model-index: - name: Whisper Small Hi - Sanchit Gandhi results: - task: name: Automatic Speech Recognition type: automatic-speech-recognition dataset: name: Common Voice 11.0 type: mozilla-foundation/common_voice_11_0 config: hi split: None args: 'config: hi, split: test' metrics: - name: Wer type: wer value: 37.175146025565056 --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # Whisper Small Hi - Sanchit Gandhi This model is a fine-tuned version of [openai/whisper-small](https://huggingface.co/openai/whisper-small) on the Common Voice 11.0 dataset. It achieves the following results on the evaluation set: - Loss: 0.3016 - Wer: 37.1751 ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 1e-05 - train_batch_size: 5 - eval_batch_size: 5 - seed: 42 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - lr_scheduler_warmup_steps: 500 - training_steps: 1000 - mixed_precision_training: Native AMP ### Training results | Training Loss | Epoch | Step | Validation Loss | Wer | |:-------------:|:------:|:----:|:---------------:|:-------:| | 0.2063 | 0.7645 | 1000 | 0.3016 | 37.1751 | ### Framework versions - Transformers 4.41.2 - Pytorch 2.3.0+cu121 - Datasets 2.20.0 - Tokenizers 0.19.1
MarcoGr/q-FrozenLake-v1-4x4-noSlippery
MarcoGr
2024-07-02T09:31:35Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:31:35Z
Entry not found
MarcoGr/Taxi_v3
MarcoGr
2024-07-02T09:31:54Z
0
0
null
[ "Taxi-v3", "q-learning", "reinforcement-learning", "custom-implementation", "model-index", "region:us" ]
reinforcement-learning
2024-07-02T09:31:50Z
--- tags: - Taxi-v3 - q-learning - reinforcement-learning - custom-implementation model-index: - name: Taxi_v3 results: - task: type: reinforcement-learning name: reinforcement-learning dataset: name: Taxi-v3 type: Taxi-v3 metrics: - type: mean_reward value: 7.54 +/- 2.74 name: mean_reward verified: false --- # **Q-Learning** Agent playing1 **Taxi-v3** This is a trained model of a **Q-Learning** agent playing **Taxi-v3** . ## Usage ```python model = load_from_hub(repo_id="MarcoGr/Taxi_v3", filename="q-learning.pkl") # Don't forget to check if you need to add additional attributes (is_slippery=False etc) env = gym.make(model["env_id"]) ```
Ahmedelagamy/base_hive
Ahmedelagamy
2024-07-02T09:32:20Z
0
0
null
[ "license:mit", "region:us" ]
null
2024-07-02T09:32:20Z
--- license: mit ---
woransa/mistral-7B-slerp
woransa
2024-07-02T09:36:54Z
0
0
transformers
[ "transformers", "safetensors", "mistral", "text-generation", "merge", "mergekit", "lazymergekit", "OpenPipe/mistral-ft-optimized-1218", "mlabonne/NeuralHermes-2.5-Mistral-7B", "base_model:OpenPipe/mistral-ft-optimized-1218", "base_model:mlabonne/NeuralHermes-2.5-Mistral-7B", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T09:33:05Z
--- base_model: - OpenPipe/mistral-ft-optimized-1218 - mlabonne/NeuralHermes-2.5-Mistral-7B tags: - merge - mergekit - lazymergekit - OpenPipe/mistral-ft-optimized-1218 - mlabonne/NeuralHermes-2.5-Mistral-7B --- # mistral-7B-slerp mistral-7B-slerp is a merge of the following models using [LazyMergekit](https://colab.research.google.com/drive/1obulZ1ROXHjYLn6PPZJwRR6GzgQogxxb?usp=sharing): * [OpenPipe/mistral-ft-optimized-1218](https://huggingface.co/OpenPipe/mistral-ft-optimized-1218) * [mlabonne/NeuralHermes-2.5-Mistral-7B](https://huggingface.co/mlabonne/NeuralHermes-2.5-Mistral-7B) ## 🧩 Configuration ```yaml slices: - sources: - model: OpenPipe/mistral-ft-optimized-1218 layer_range: [0, 32] - model: mlabonne/NeuralHermes-2.5-Mistral-7B layer_range: [0, 32] merge_method: slerp base_model: OpenPipe/mistral-ft-optimized-1218 parameters: t: - filter: self_attn value: [0, 0.5, 0.3, 0.7, 1] - filter: mlp value: [1, 0.5, 0.7, 0.3, 0] - value: 0.5 dtype: bfloat16 ``` ## 💻 Usage ```python !pip install -qU transformers accelerate from transformers import AutoTokenizer import transformers import torch model = "woransa/mistral-7B-slerp" messages = [{"role": "user", "content": "What is a large language model?"}] tokenizer = AutoTokenizer.from_pretrained(model) prompt = tokenizer.apply_chat_template(messages, tokenize=False, add_generation_prompt=True) pipeline = transformers.pipeline( "text-generation", model=model, torch_dtype=torch.float16, device_map="auto", ) outputs = pipeline(prompt, max_new_tokens=256, do_sample=True, temperature=0.7, top_k=50, top_p=0.95) print(outputs[0]["generated_text"]) ```
wieheistdu/squad2-trained-ep4-batch16-finetuned-squad2-emrQA-msquad
wieheistdu
2024-07-02T11:34:02Z
0
0
transformers
[ "transformers", "safetensors", "distilbert", "question-answering", "endpoints_compatible", "region:us" ]
question-answering
2024-07-02T09:33:25Z
--- tags: - generated_from_trainer model-index: - name: squad2-trained-ep4-batch16-finetuned-squad2-emrQA-msquad results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # squad2-trained-ep4-batch16-finetuned-squad2-emrQA-msquad This model was trained from scratch on an unknown dataset. It achieves the following results on the evaluation set: - Loss: 0.0319 ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 2e-05 - train_batch_size: 32 - eval_batch_size: 32 - seed: 42 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - num_epochs: 3 ### Training results | Training Loss | Epoch | Step | Validation Loss | |:-------------:|:-----:|:-----:|:---------------:| | 0.2089 | 1.0 | 7836 | 0.1292 | | 0.077 | 2.0 | 15672 | 0.0484 | | 0.0357 | 3.0 | 23508 | 0.0319 | ### Framework versions - Transformers 4.41.2 - Pytorch 1.13.1+cu116 - Datasets 2.19.2 - Tokenizers 0.19.1
finn03091993/naschainv122
finn03091993
2024-07-02T09:34:33Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:34:31Z
Entry not found
multimolecule/rnabert
multimolecule
2024-07-02T09:35:33Z
0
0
multimolecule
[ "multimolecule", "pytorch", "safetensors", "rnabert", "Biology", "RNA", "fill-mask", "rna", "dataset:multimolecule/rnacentral", "license:agpl-3.0", "region:us" ]
fill-mask
2024-07-02T09:35:29Z
--- language: rna tags: - Biology - RNA license: agpl-3.0 datasets: - multimolecule/rnacentral library_name: multimolecule pipeline_tag: fill-mask mask_token: "<mask>" widget: - example_title: "microRNA-21" text: "UAGC<mask>UAUCAGACUGAUGUUGA" output: - label: "<null>" score: 0.038491372019052505 - label: "." score: 0.03848646208643913 - label: "<pad>" score: 0.03846566751599312 - label: "U" score: 0.03846472129225731 - label: "W" score: 0.03846454620361328 --- # RNABERT Pre-trained model on non-coding RNA (ncRNA) using masked language modeling (MLM) and structural alignment learning (SAL) objectives. ## Disclaimer This is an UNOFFICIAL implementation of the [Informative RNA-base embedding for functional RNA clustering and structural alignment](https://doi.org/10.1093/nargab/lqac012) by Manato Akiyama and Yasubumi Sakakibara. The OFFICIAL repository of RNABERT is at [mana438/RNABERT](https://github.com/mana438/RNABERT). !!! Bug "Reproducibility" The MultiMolecule team is aware of a potential risk in reproducing the results of RNABERT. The original implementation of RNABERT does not prepend `<cls>` and append `<eos>` tokens to the input sequence. This may lead to unexpected results when using the model. !!! Success "Reproducibility" The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation. **The team releasing RNABERT did not write this model card for this model so this model card has been written by the MultiMolecule team.** ## Model Details RNABERT is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process. ### Model Specification | Num Layers | Hidden Size | Num Heads | Intermediate Size | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens | | ---------- | ----------- | --------- | ----------------- | ------------------ | --------- | -------- | -------------- | | 6 | 120 | 12 | 40 | 0.48 | 0.15 | 0.08 | 440 | ### Links - **Code**: [multimolecule.rnabert](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnabert) - **Weights**: [multimolecule/rnabert](https://huggingface.co/multimolecule/rnabert) - **Data**: [RNAcentral](https://rnacentral.org) - **Paper**: [Informative RNA-base embedding for functional RNA clustering and structural alignment](https://doi.org/10.1093/nargab/lqac012) - **Developed by**: JManato Akiyama and Yasubumi Sakakibara - **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - **Original Repository**: [https://github.com/mana438/RNABERT](https://github.com/mana438/RNABERT) ## Usage The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip: ```bash pip install multimolecule ``` ### Direct Use You can use this model directly with a pipeline for masked language modeling: ```python >>> import multimolecule # you must import multimolecule to register models >>> from transformers import pipeline >>> unmasker = pipeline('fill-mask', model='multimolecule/rnabert') >>> unmasker("uagc<mask>uaucagacugauguuga") [{'score': 0.038491372019052505, 'token': 5, 'token_str': '<null>', 'sequence': 'U A G C U A U C A G A C U G A U G U U G A'}, {'score': 0.03848646208643913, 'token': 23, 'token_str': '.', 'sequence': 'U A G C. U A U C A G A C U G A U G U U G A'}, {'score': 0.03846566751599312, 'token': 0, 'token_str': '<pad>', 'sequence': 'U A G C U A U C A G A C U G A U G U U G A'}, {'score': 0.03846472129225731, 'token': 9, 'token_str': 'U', 'sequence': 'U A G C U U A U C A G A C U G A U G U U G A'}, {'score': 0.03846454620361328, 'token': 19, 'token_str': 'W', 'sequence': 'U A G C W U A U C A G A C U G A U G U U G A'}] ``` ### Downstream Use #### Extract Features Here is how to use this model to get the features of a given sequence in PyTorch: ```python from multimolecule import RnaTokenizer, RnaBertModel tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnabert') model = RnaBertModel.from_pretrained('multimolecule/rnabert') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') output = model(**input) ``` #### Sequence Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression. Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaBertForSequencePrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnabert') model = RnaBertForSequencePrediction.from_pretrained('multimolecule/rnabert') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.tensor([1]) output = model(**input, labels=label) ``` #### Nucleotide Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression. Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaBertForNucleotidePrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnabert') model = RnaBertForNucleotidePrediction.from_pretrained('multimolecule/rnabert') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.randint(2, (len(text), )) output = model(**input, labels=label) ``` #### Contact Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression. Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaBertForContactPrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnabert') model = RnaBertForContactPrediction.from_pretrained('multimolecule/rnabert') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.randint(2, (len(text), len(text))) output = model(**input, labels=label) ``` ## Training Details RNABERT has two pre-training objectives: masked language modeling (MLM) and structural alignment learning (SAL). - **Masked Language Modeling (MLM)**: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling. - **Structural Alignment Learning (SAL)**: the model learns to predict the structural alignment of two RNA sequences. The model is trained to predict the alignment score of two RNA sequences using the Needleman-Wunsch algorithm. ### Training Data The RNABERT model was pre-trained on [RNAcentral](https://rnacentral.org). RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 27 million RNA sequences in total. RNABERT used a subset of 76, 237 human ncRNA sequences from RNAcentral for pre-training. RNABERT preprocessed all tokens by replacing "U"s with "T"s. Note that during model conversions, "T" is replaced with "U". [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`. ### Training Procedure #### Preprocessing RNABERT preprocess the dataset by applying 10 different mask patterns to the 72, 237 human ncRNA sequences. The final dataset contains 722, 370 sequences. The masking procedure is similar to the one used in BERT: - 15% of the tokens are masked. - In 80% of the cases, the masked tokens are replaced by `<mask>`. - In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace. - In the 10% remaining cases, the masked tokens are left as is. #### PreTraining The model was trained on 1 NVIDIA V100 GPU. ## Citation **BibTeX**: ```bibtex @article{akiyama2022informative, author = {Akiyama, Manato and Sakakibara, Yasubumi}, title = "{Informative RNA base embedding for RNA structural alignment and clustering by deep representation learning}", journal = {NAR Genomics and Bioinformatics}, volume = {4}, number = {1}, pages = {lqac012}, year = {2022}, month = {02}, abstract = "{Effective embedding is actively conducted by applying deep learning to biomolecular information. Obtaining better embeddings enhances the quality of downstream analyses, such as DNA sequence motif detection and protein function prediction. In this study, we adopt a pre-training algorithm for the effective embedding of RNA bases to acquire semantically rich representations and apply this algorithm to two fundamental RNA sequence problems: structural alignment and clustering. By using the pre-training algorithm to embed the four bases of RNA in a position-dependent manner using a large number of RNA sequences from various RNA families, a context-sensitive embedding representation is obtained. As a result, not only base information but also secondary structure and context information of RNA sequences are embedded for each base. We call this ‘informative base embedding’ and use it to achieve accuracies superior to those of existing state-of-the-art methods on RNA structural alignment and RNA family clustering tasks. Furthermore, upon performing RNA sequence alignment by combining this informative base embedding with a simple Needleman–Wunsch alignment algorithm, we succeed in calculating structural alignments with a time complexity of O(n2) instead of the O(n6) time complexity of the naive implementation of Sankoff-style algorithm for input RNA sequence of length n.}", issn = {2631-9268}, doi = {10.1093/nargab/lqac012}, url = {https://doi.org/10.1093/nargab/lqac012}, eprint = {https://academic.oup.com/nargab/article-pdf/4/1/lqac012/42577168/lqac012.pdf}, } ``` ## Contact Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card. Please contact the authors of the [RNABERT paper](https://doi.org/10.1093/nargab/lqac012) for questions or comments on the paper/model. ## License This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html). ```spdx SPDX-License-Identifier: AGPL-3.0-or-later ```
multimolecule/rnaernie
multimolecule
2024-07-02T09:37:57Z
0
0
multimolecule
[ "multimolecule", "pytorch", "safetensors", "rnaernie", "Biology", "RNA", "fill-mask", "rna", "dataset:multimolecule/rnacentral", "license:agpl-3.0", "region:us" ]
fill-mask
2024-07-02T09:35:41Z
--- language: rna tags: - Biology - RNA license: agpl-3.0 datasets: - multimolecule/rnacentral library_name: multimolecule pipeline_tag: fill-mask mask_token: "<mask>" widget: - example_title: "microRNA-21" text: "UAGC<mask>UAUCAGACUGAUGUUGA" output: - label: "G" score: 0.10253211855888367 - label: "R" score: 0.09673436731100082 - label: "A" score: 0.09126435220241547 - label: "V" score: 0.08036787807941437 - label: "S" score: 0.07541776448488235 --- # RNAErnie Pre-trained model on non-coding RNA (ncRNA) using a multi-stage masked language modeling (MLM) objective. ## Statement _Multi-purpose RNA language modelling with motif-aware pretraining and type-guided fine-tuning_ is published in [Nature Machine Intelligence](https://doi.org/10.1038/s42256-024-00836-4), which is a Closed Access / Author-Fee journal. > Machine learning has been at the forefront of the movement for free and open access to research. > > We see no role for closed access or author-fee publication in the future of machine learning research and believe the adoption of these journals as an outlet of record for the machine learning community would be a retrograde step. The MultiMolecule team is committed to the principles of open access and open science. We do NOT endorse the publication of manuscripts in Closed Access / Author-Fee journals and encourage the community to support Open Access journals. Please consider signing the [Statement on Nature Machine Intelligence](https://openaccess.engineering.oregonstate.edu). ## Disclaimer This is an UNOFFICIAL implementation of the RNAErnie: An RNA Language Model with Structure-enhanced Representations by Ning Wang, Jiang Bian, Haoyi Xiong, et al. The OFFICIAL repository of RNAErnie is at [CatIIIIIIII/RNAErnie](https://github.com/CatIIIIIIII/RNAErnie). !!! Danger "Reproducibility" The MultiMolecule team is unable to confirm that the provided model and checkpoints are producing the same intermediate representations as the original implementation. This is because The proposed method is published in a Closed Access / Author-Fee journal. **The team releasing RNAErnie did not write this model card for this model so this model card has been written by the MultiMolecule team.** ## Model Details RNAErnie is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process. Note that during the conversion process, additional tokens such as `[IND]` and ncRNA class symbols are removed. ### Model Specification | Num Layers | Hidden Size | Num Heads | Intermediate Size | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens | | ---------- | ----------- | --------- | ----------------- | ------------------ | --------- | -------- | -------------- | | 12 | 768 | 12 | 3072 | 86.06 | 22.36 | 11.17 | 512 | ### Links - **Code**: [multimolecule.rnaernie](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnaernie) - **Weights**: [`multimolecule/rnaernie`](https://huggingface.co/multimolecule/rnaernie) - **Data**: [RNAcentral](https://rnacentral.org) - **Paper**: Multi-purpose RNA language modelling with motif-aware pretraining and type-guided fine-tuning - **Developed by**: Ning Wang, Jiang Bian, Yuchen Li, Xuhong Li, Shahid Mumtaz, Linghe Kong, Haoyi Xiong. - **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ERNIE](https://huggingface.co/nghuyong/ernie-3.0-base-zh) - **Original Repository**: [https://github.com/CatIIIIIIII/RNAErnie](https://github.com/CatIIIIIIII/RNAErnie) ## Usage The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip: ```bash pip install multimolecule ``` ### Direct Use You can use this model directly with a pipeline for masked language modeling: ```python >>> import multimolecule # you must import multimolecule to register models >>> from transformers import pipeline >>> unmasker = pipeline('fill-mask', model='multimolecule/rnaernie') >>> unmasker("uagc<mask>uaucagacugauguuga") [{'score': 0.10253211855888367, 'token': 8, 'token_str': 'G', 'sequence': 'U A G C G U A U C A G A C U G A U G U U G A'}, {'score': 0.09673436731100082, 'token': 18, 'token_str': 'R', 'sequence': 'U A G C R U A U C A G A C U G A U G U U G A'}, {'score': 0.09126435220241547, 'token': 6, 'token_str': 'A', 'sequence': 'U A G C A U A U C A G A C U G A U G U U G A'}, {'score': 0.08036787807941437, 'token': 13, 'token_str': 'V', 'sequence': 'U A G C V U A U C A G A C U G A U G U U G A'}, {'score': 0.07541776448488235, 'token': 20, 'token_str': 'S', 'sequence': 'U A G C S U A U C A G A C U G A U G U U G A'}] ``` ### Downstream Use #### Extract Features Here is how to use this model to get the features of a given sequence in PyTorch: ```python from multimolecule import RnaTokenizer, RnaErnieModel tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnaernie') model = RnaErnieModel.from_pretrained('multimolecule/rnaernie') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') output = model(**input) ``` #### Sequence Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression. Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaErnieForSequencePrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnaernie') model = RnaErnieForSequencePrediction.from_pretrained('multimolecule/rnaernie') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.tensor([1]) output = model(**input, labels=label) ``` #### Nucleotide Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression. Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaErnieForNucleotidePrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnaernie') model = RnaErnieForNucleotidePrediction.from_pretrained('multimolecule/rnaernie') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.randint(2, (len(text), )) output = model(**input, labels=label) ``` #### Contact Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression. Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaErnieForContactPrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnaernie') model = RnaErnieForContactPrediction.from_pretrained('multimolecule/rnaernie') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.randint(2, (len(text), len(text))) output = model(**input, labels=label) ``` ## Training Details RNAErnie used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling. ### Training Data The RNAErnie model was pre-trained on [RNAcentral](https://rnacentral.org). RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 34 million RNA sequences in total. RNAErnie used a subset of RNAcentral for pre-training. The subset contains 23 million sequences. RNAErnie preprocessed all tokens by replacing "T"s with "S"s. Note that [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`. ### Training Procedure #### Preprocessing RNAErnie used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT: - 15% of the tokens are masked. - In 80% of the cases, the masked tokens are replaced by `<mask>`. - In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace. - In the 10% remaining cases, the masked tokens are left as is. #### PreTraining RNAErnie uses a special 3-stage training pipeline to pre-train the model, each with a different masking strategy: Base-level Masking: The masking applies to each nucleotide in the sequence. Subsequence-level Masking: The masking applies to subsequences of 4-8bp in the sequence. Motif-level Masking: The model is trained on motif datasets. The model was trained on 4 NVIDIA V100 GPUs with 32GiB memories. - Batch size: 50 - Learning rate: 1e-4 - Weight decay: 0.01 - Optimizer: AdamW - Steps: 2,580,000 - Learning rate warm-up: 129,000 steps - Learning rate cool-down: 129,000 steps - Minimum learning rate: 5e-5 ## Citation Citation information is not available for papers published in Closed Access / Author-Fee journals. ## Contact Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card. Please contact the authors of the RNAErnie paper for questions or comments on the paper/model. ## License This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html). ```spdx SPDX-License-Identifier: AGPL-3.0-or-later ```
Sodiegs/Baoahah
Sodiegs
2024-07-02T09:36:16Z
0
0
null
[ "license:apache-2.0", "region:us" ]
null
2024-07-02T09:36:16Z
--- license: apache-2.0 ---
Peacoc/37_best_t_13_2
Peacoc
2024-07-02T09:38:36Z
0
0
transformers
[ "transformers", "safetensors", "llama", "text-generation", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T09:36:31Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
baxtos/bartik14-4
baxtos
2024-07-02T09:39:09Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:36:50Z
Entry not found
sskaishev/OITE_Models
sskaishev
2024-07-02T09:39:41Z
0
0
keras
[ "keras", "region:us" ]
null
2024-07-02T09:36:56Z
# Models used in OntoUML Image Taxonomy Extractor (OITE) See: https://github.com/SimeonKaishev/OntoUML_IMG_Converter --- license: apache-2.0 ---
Temo27Anas/videomae-base-ft-2824
Temo27Anas
2024-07-02T09:36:57Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:36:57Z
Entry not found
peterkros/immunization-classification-model
peterkros
2024-07-02T09:42:04Z
0
0
transformers
[ "transformers", "pytorch", "distilbert", "text-classification", "arxiv:1910.09700", "license:mit", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-classification
2024-07-02T09:37:07Z
--- license: mit --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> This model is a part of the COFOG immunization budget expenditure project developed in UNICEF. ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> Model is based on DistilBERT and trainined on custom dataset with immunization budget expenditures from variuos countries. - **Developed by:** Piotr Krosniak - **Model type:** DistilBERT - **Language(s) (NLP):** English - **License:** MIT - **Finetuned from model [optional]:** DistilBERT ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
misszzzzz/zzzzz
misszzzzz
2024-07-02T09:37:07Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:37:07Z
Entry not found
CatBarks/flant5small-lora-oasst1_50_model
CatBarks
2024-07-02T09:37:30Z
0
0
transformers
[ "transformers", "safetensors", "arxiv:1910.09700", "endpoints_compatible", "region:us" ]
null
2024-07-02T09:37:27Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
CatBarks/flant5small-lora-oasst1_50_tokenizer
CatBarks
2024-07-02T09:37:33Z
0
0
transformers
[ "transformers", "arxiv:1910.09700", "endpoints_compatible", "region:us" ]
null
2024-07-02T09:37:30Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
jnsalxs/hyundai_web_data
jnsalxs
2024-07-02T10:01:01Z
0
0
transformers
[ "transformers", "safetensors", "text-generation-inference", "unsloth", "llama", "trl", "en", "base_model:unsloth/llama-3-8b-bnb-4bit", "license:apache-2.0", "endpoints_compatible", "region:us" ]
null
2024-07-02T09:37:44Z
--- base_model: unsloth/llama-3-8b-bnb-4bit language: - en license: apache-2.0 tags: - text-generation-inference - transformers - unsloth - llama - trl --- # Uploaded model - **Developed by:** jnsalxs - **License:** apache-2.0 - **Finetuned from model :** unsloth/llama-3-8b-bnb-4bit This llama model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library. [<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)
lielbin/BabyBERTa-aochildes-french-without-Masking-finetuned-run3-Fr-SQuAD
lielbin
2024-07-02T10:20:32Z
0
0
transformers
[ "transformers", "tensorboard", "safetensors", "roberta", "question-answering", "generated_from_trainer", "endpoints_compatible", "region:us" ]
question-answering
2024-07-02T09:37:57Z
--- tags: - generated_from_trainer model-index: - name: BabyBERTa-aochildes-french-without-Masking-finetuned-run3-Fr-SQuAD results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # BabyBERTa-aochildes-french-without-Masking-finetuned-run3-Fr-SQuAD This model was trained from scratch on the None dataset. ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 0.0001 - train_batch_size: 8 - eval_batch_size: 8 - seed: 42 - gradient_accumulation_steps: 2 - total_train_batch_size: 16 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - num_epochs: 3 - mixed_precision_training: Native AMP ### Training results ### Framework versions - Transformers 4.37.2 - Pytorch 2.3.1+cu121 - Datasets 2.18.0 - Tokenizers 0.15.2
QuantFactory/Vistral-7B-Chat-GGUF
QuantFactory
2024-07-02T10:22:14Z
0
0
null
[ "gguf", "region:us" ]
null
2024-07-02T09:38:26Z
Entry not found
NAkketikker/some
NAkketikker
2024-07-02T09:38:49Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:38:49Z
Entry not found
Labeeq/trained-sd3
Labeeq
2024-07-02T09:39:11Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:39:11Z
Entry not found
chaeunl/textual_inversion_cat
chaeunl
2024-07-02T09:39:14Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:39:14Z
Entry not found
indrapurnayasa/mistral_categorization_unsloth_q4
indrapurnayasa
2024-07-02T09:48:14Z
0
0
transformers
[ "transformers", "safetensors", "mistral", "text-generation", "text-generation-inference", "unsloth", "trl", "sft", "en", "base_model:unsloth/mistral-7b-v0.3-bnb-4bit", "license:apache-2.0", "autotrain_compatible", "endpoints_compatible", "4-bit", "bitsandbytes", "region:us" ]
text-generation
2024-07-02T09:40:55Z
--- base_model: unsloth/mistral-7b-v0.3-bnb-4bit language: - en license: apache-2.0 tags: - text-generation-inference - transformers - unsloth - mistral - trl - sft --- # Uploaded model - **Developed by:** indrapurnayasa - **License:** apache-2.0 - **Finetuned from model :** unsloth/mistral-7b-v0.3-bnb-4bit This mistral model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library. [<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)
ayush7/CBSE_Test_Science_unpacked_10_v0.1
ayush7
2024-07-02T11:25:56Z
0
0
transformers
[ "transformers", "safetensors", "phi3", "text-generation", "custom_code", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:41:02Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
aks1s/01-flow-2
aks1s
2024-07-02T09:42:01Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:41:07Z
Entry not found
irusl/01ktm1
irusl
2024-07-02T09:44:03Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:41:30Z
Entry not found
baxtos/bartik15-4
baxtos
2024-07-02T09:44:55Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:42:28Z
Entry not found
WeDoLLMs/dpo_test_model
WeDoLLMs
2024-07-02T10:15:36Z
0
0
peft
[ "peft", "safetensors", "arxiv:1910.09700", "base_model:SeaLLMs/SeaLLM-7B-v2", "region:us" ]
null
2024-07-02T09:43:35Z
--- base_model: SeaLLMs/SeaLLM-7B-v2 library_name: peft --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed] ### Framework versions - PEFT 0.11.1
aks1s/02-flow-2
aks1s
2024-07-02T09:45:24Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:44:35Z
Entry not found
akashAD/fb_zeroshot_mnli_onnx
akashAD
2024-07-02T09:46:33Z
0
0
transformers
[ "transformers", "onnx", "bart", "text-classification", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-classification
2024-07-02T09:45:28Z
Entry not found
dctruepf/test
dctruepf
2024-07-02T09:45:38Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:45:38Z
Entry not found
MrGonk/Gonk_1
MrGonk
2024-07-02T09:49:51Z
0
0
transformers
[ "transformers", "safetensors", "llama", "text-generation", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T09:46:12Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
shr1chan/LunarLander-v2
shr1chan
2024-07-02T10:26:13Z
0
0
stable-baselines3
[ "stable-baselines3", "LunarLander-v2", "deep-reinforcement-learning", "reinforcement-learning", "model-index", "region:us" ]
reinforcement-learning
2024-07-02T09:46:49Z
--- library_name: stable-baselines3 tags: - LunarLander-v2 - deep-reinforcement-learning - reinforcement-learning - stable-baselines3 model-index: - name: PPO results: - task: type: reinforcement-learning name: reinforcement-learning dataset: name: LunarLander-v2 type: LunarLander-v2 metrics: - type: mean_reward value: 267.51 +/- 17.03 name: mean_reward verified: false --- # **PPO** Agent playing **LunarLander-v2** This is a trained model of a **PPO** agent playing **LunarLander-v2** using the [stable-baselines3 library](https://github.com/DLR-RM/stable-baselines3). ## Usage (with Stable-baselines3) TODO: Add your code ```python from stable_baselines3 import ... from huggingface_sb3 import load_from_hub ... ```
KasuleTrevor/test-10
KasuleTrevor
2024-07-02T10:37:02Z
0
0
transformers
[ "transformers", "safetensors", "wav2vec2", "automatic-speech-recognition", "generated_from_trainer", "base_model:facebook/wav2vec2-xls-r-300m", "license:apache-2.0", "endpoints_compatible", "region:us" ]
automatic-speech-recognition
2024-07-02T09:46:49Z
--- base_model: facebook/wav2vec2-xls-r-300m license: apache-2.0 metrics: - wer tags: - generated_from_trainer model-index: - name: test-10 results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> [<img src="https://raw.githubusercontent.com/wandb/assets/main/wandb-github-badge-28.svg" alt="Visualize in Weights & Biases" width="200" height="32"/>](https://wandb.ai/asr-africa-research-team/ASR%20Africa/runs/2yoddo8f) # test-10 This model is a fine-tuned version of [facebook/wav2vec2-xls-r-300m](https://huggingface.co/facebook/wav2vec2-xls-r-300m) on an unknown dataset. It achieves the following results on the evaluation set: - Loss: 16.7472 - Wer: 1.0 - Cer: 0.9840 ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 0.0001 - train_batch_size: 32 - eval_batch_size: 8 - seed: 42 - gradient_accumulation_steps: 2 - total_train_batch_size: 64 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: cosine - lr_scheduler_warmup_steps: 500 - num_epochs: 100 - mixed_precision_training: Native AMP ### Training results | Training Loss | Epoch | Step | Validation Loss | Wer | Cer | |:-------------:|:-----:|:----:|:---------------:|:---:|:------:| | 15.9209 | 1.0 | 9 | 15.2863 | 1.0 | 0.9693 | | 15.8262 | 2.0 | 18 | 15.1525 | 1.0 | 0.9718 | | 15.5563 | 3.0 | 27 | 14.8407 | 1.0 | 0.9925 | | 15.1897 | 4.0 | 36 | 14.2567 | 1.0 | 0.9962 | | 14.4177 | 5.0 | 45 | 13.3192 | 1.0 | 1.0 | | 12.5935 | 6.0 | 54 | 10.9618 | 1.0 | 1.0 | | 9.6217 | 7.0 | 63 | 8.3098 | 1.0 | 1.0 | | 7.3097 | 8.0 | 72 | 6.6019 | 1.0 | 1.0 | | 5.8747 | 9.0 | 81 | 5.6510 | 1.0 | 1.0 | | 5.0618 | 10.0 | 90 | 4.9849 | 1.0 | 1.0 | | 4.5962 | 11.0 | 99 | 4.5082 | 1.0 | 1.0 | ### Framework versions - Transformers 4.42.3 - Pytorch 2.2.0+cu121 - Datasets 2.20.0 - Tokenizers 0.19.1
irusl/02ktm1
irusl
2024-07-02T09:49:42Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:47:10Z
Entry not found
aks1s/03-flow-2
aks1s
2024-07-02T09:48:44Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:47:58Z
Entry not found
femiari/Phi3-Mini-Moe
femiari
2024-07-02T09:48:13Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:48:13Z
Entry not found
ghost613/whisper-small-voice-conversion
ghost613
2024-07-03T00:12:04Z
0
0
transformers
[ "transformers", "tensorboard", "safetensors", "whisper", "automatic-speech-recognition", "endpoints_compatible", "region:us" ]
automatic-speech-recognition
2024-07-02T09:48:17Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
ebra1234/mamba_text_classification
ebra1234
2024-07-02T16:52:43Z
0
0
transformers
[ "transformers", "pytorch", "generated_from_trainer", "endpoints_compatible", "region:us" ]
null
2024-07-02T09:48:26Z
--- tags: - generated_from_trainer metrics: - accuracy model-index: - name: mamba_text_classification results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # mamba_text_classification This model was trained from scratch on the None dataset. It achieves the following results on the evaluation set: - Loss: 0.2533 - Accuracy: 0.9733 ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 1e-05 - train_batch_size: 4 - eval_batch_size: 8 - seed: 42 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: cosine - lr_scheduler_warmup_ratio: 0.01 - num_epochs: 5 ### Training results | Training Loss | Epoch | Step | Validation Loss | Accuracy | |:-------------:|:-----:|:-----:|:---------------:|:--------:| | 1.0624 | 0.5 | 4490 | 0.2826 | 0.9432 | | 1.5729 | 1.0 | 8980 | 0.2010 | 0.9532 | | 0.0001 | 1.5 | 13470 | 0.2179 | 0.9633 | | 0.0001 | 2.0 | 17960 | 0.1711 | 0.9666 | | 0.0 | 2.5 | 22450 | 0.2626 | 0.9644 | | 0.0003 | 3.0 | 26940 | 0.2157 | 0.9688 | | 0.0 | 3.5 | 31430 | 0.2305 | 0.9744 | | 0.0 | 4.0 | 35920 | 0.2372 | 0.9755 | | 0.0 | 4.5 | 40410 | 0.2547 | 0.9744 | | 0.0 | 5.0 | 44900 | 0.2533 | 0.9733 | ### Framework versions - Transformers 4.41.2 - Pytorch 2.3.0+cu121 - Datasets 2.20.0 - Tokenizers 0.19.1
gauravsirola/bge-base-financial-matryoshka-v1
gauravsirola
2024-07-02T09:49:03Z
0
0
sentence-transformers
[ "sentence-transformers", "safetensors", "bert", "sentence-similarity", "feature-extraction", "generated_from_trainer", "dataset_size:6300", "loss:MatryoshkaLoss", "loss:MultipleNegativesRankingLoss", "en", "arxiv:1908.10084", "arxiv:2205.13147", "arxiv:1705.00652", "base_model:BAAI/bge-base-en-v1.5", "license:apache-2.0", "model-index", "autotrain_compatible", "endpoints_compatible", "text-embeddings-inference", "region:us" ]
sentence-similarity
2024-07-02T09:48:55Z
--- base_model: BAAI/bge-base-en-v1.5 datasets: [] language: - en library_name: sentence-transformers license: apache-2.0 metrics: - cosine_accuracy@1 - cosine_accuracy@3 - cosine_accuracy@5 - cosine_accuracy@10 - cosine_precision@1 - cosine_precision@3 - cosine_precision@5 - cosine_precision@10 - cosine_recall@1 - cosine_recall@3 - cosine_recall@5 - cosine_recall@10 - cosine_ndcg@10 - cosine_mrr@10 - cosine_map@100 pipeline_tag: sentence-similarity tags: - sentence-transformers - sentence-similarity - feature-extraction - generated_from_trainer - dataset_size:6300 - loss:MatryoshkaLoss - loss:MultipleNegativesRankingLoss widget: - source_sentence: ITEM 7. MANAGEMENT’S DISCUSSION AND ANALYSIS OF FINANCIAL CONDITION AND RESULTS OF OPERATIONS The following discussion and analysis should be read in conjunction with the consolidated financial statements and the related notes included elsewhere in this Annual Report on Form 10-K. For further discussion of our products and services, technology and competitive strengths, refer to Item 1- Business. sentences: - What was the total net automotive cash provided by investing activities in 2023? - What is the purpose of the Management's Discussion and Analysis of Financial Condition and Results of Operations section in the Annual Report on Form 10-K? - What are the components included in the management discussion and analysis of financial condition and results of operations? - source_sentence: Kroger is committed to maintaining a net total debt to adjusted EBITDA ratio target range of 2.30 to 2.50. sentences: - What was the remaining available amount of the share repurchase authorization as of January 29, 2023? - What range does Kroger aim for its net total debt to adjusted EBITDA ratio? - What was the starting wage for all entry-level positions in the U.S. as of September 2023? - source_sentence: Google Cloud operating income of $1.7 billion for 2023. sentences: - What was the operating income for Google Cloud in 2023? - What types of products are offered in Garmin's Fitness segment? - What was the net sales of the company in fiscal 2022? - source_sentence: The effective income tax rate for Alphabet Inc. at the end of the year 2023 was 13.9%. sentences: - What was the percentage change in Compute & Networking revenue from fiscal year 2022 to 2023? - What factors primarily contributed to the increase in non-interest revenues across all revenue categories? - What was the effective income tax rate for Alphabet Inc. at the end of the year 2023? - source_sentence: State legislation increasingly requires PBMs to conduct audits of network pharmacies regarding claims submitted for payment. Non-compliance could prevent the recoupment of overpaid amounts, potentially causing financial and legal repercussions. sentences: - What are the potential consequences for a company if its PBMs fail to comply with pharmacy audit regulations? - What pages do the Consolidated Financial Statements and their accompanying Notes and reports appear on in the document? - What are the primary services provided by the company under the Xfinity, Comcast Business, and Sky brands? model-index: - name: BGE base Financial Matryoshka results: - task: type: information-retrieval name: Information Retrieval dataset: name: dim 768 type: dim_768 metrics: - type: cosine_accuracy@1 value: 0.6785714285714286 name: Cosine Accuracy@1 - type: cosine_accuracy@3 value: 0.8342857142857143 name: Cosine Accuracy@3 - type: cosine_accuracy@5 value: 0.88 name: Cosine Accuracy@5 - type: cosine_accuracy@10 value: 0.9085714285714286 name: Cosine Accuracy@10 - type: cosine_precision@1 value: 0.6785714285714286 name: Cosine Precision@1 - type: cosine_precision@3 value: 0.2780952380952381 name: Cosine Precision@3 - type: cosine_precision@5 value: 0.176 name: Cosine Precision@5 - type: cosine_precision@10 value: 0.09085714285714284 name: Cosine Precision@10 - type: cosine_recall@1 value: 0.6785714285714286 name: Cosine Recall@1 - type: cosine_recall@3 value: 0.8342857142857143 name: Cosine Recall@3 - type: cosine_recall@5 value: 0.88 name: Cosine Recall@5 - type: cosine_recall@10 value: 0.9085714285714286 name: Cosine Recall@10 - type: cosine_ndcg@10 value: 0.7995179593313807 name: Cosine Ndcg@10 - type: cosine_mrr@10 value: 0.7638202947845802 name: Cosine Mrr@10 - type: cosine_map@100 value: 0.7674168947978975 name: Cosine Map@100 - task: type: information-retrieval name: Information Retrieval dataset: name: dim 512 type: dim_512 metrics: - type: cosine_accuracy@1 value: 0.6685714285714286 name: Cosine Accuracy@1 - type: cosine_accuracy@3 value: 0.8271428571428572 name: Cosine Accuracy@3 - type: cosine_accuracy@5 value: 0.8685714285714285 name: Cosine Accuracy@5 - type: cosine_accuracy@10 value: 0.9128571428571428 name: Cosine Accuracy@10 - type: cosine_precision@1 value: 0.6685714285714286 name: Cosine Precision@1 - type: cosine_precision@3 value: 0.2757142857142857 name: Cosine Precision@3 - type: cosine_precision@5 value: 0.1737142857142857 name: Cosine Precision@5 - type: cosine_precision@10 value: 0.09128571428571428 name: Cosine Precision@10 - type: cosine_recall@1 value: 0.6685714285714286 name: Cosine Recall@1 - type: cosine_recall@3 value: 0.8271428571428572 name: Cosine Recall@3 - type: cosine_recall@5 value: 0.8685714285714285 name: Cosine Recall@5 - type: cosine_recall@10 value: 0.9128571428571428 name: Cosine Recall@10 - type: cosine_ndcg@10 value: 0.7954721927324272 name: Cosine Ndcg@10 - type: cosine_mrr@10 value: 0.7574353741496596 name: Cosine Mrr@10 - type: cosine_map@100 value: 0.7606771546726785 name: Cosine Map@100 - task: type: information-retrieval name: Information Retrieval dataset: name: dim 256 type: dim_256 metrics: - type: cosine_accuracy@1 value: 0.6728571428571428 name: Cosine Accuracy@1 - type: cosine_accuracy@3 value: 0.8142857142857143 name: Cosine Accuracy@3 - type: cosine_accuracy@5 value: 0.8642857142857143 name: Cosine Accuracy@5 - type: cosine_accuracy@10 value: 0.9042857142857142 name: Cosine Accuracy@10 - type: cosine_precision@1 value: 0.6728571428571428 name: Cosine Precision@1 - type: cosine_precision@3 value: 0.2714285714285714 name: Cosine Precision@3 - type: cosine_precision@5 value: 0.17285714285714285 name: Cosine Precision@5 - type: cosine_precision@10 value: 0.09042857142857141 name: Cosine Precision@10 - type: cosine_recall@1 value: 0.6728571428571428 name: Cosine Recall@1 - type: cosine_recall@3 value: 0.8142857142857143 name: Cosine Recall@3 - type: cosine_recall@5 value: 0.8642857142857143 name: Cosine Recall@5 - type: cosine_recall@10 value: 0.9042857142857142 name: Cosine Recall@10 - type: cosine_ndcg@10 value: 0.7916203877025221 name: Cosine Ndcg@10 - type: cosine_mrr@10 value: 0.7552613378684805 name: Cosine Mrr@10 - type: cosine_map@100 value: 0.7590698804335085 name: Cosine Map@100 - task: type: information-retrieval name: Information Retrieval dataset: name: dim 128 type: dim_128 metrics: - type: cosine_accuracy@1 value: 0.6528571428571428 name: Cosine Accuracy@1 - type: cosine_accuracy@3 value: 0.8114285714285714 name: Cosine Accuracy@3 - type: cosine_accuracy@5 value: 0.85 name: Cosine Accuracy@5 - type: cosine_accuracy@10 value: 0.8885714285714286 name: Cosine Accuracy@10 - type: cosine_precision@1 value: 0.6528571428571428 name: Cosine Precision@1 - type: cosine_precision@3 value: 0.2704761904761904 name: Cosine Precision@3 - type: cosine_precision@5 value: 0.16999999999999998 name: Cosine Precision@5 - type: cosine_precision@10 value: 0.08885714285714286 name: Cosine Precision@10 - type: cosine_recall@1 value: 0.6528571428571428 name: Cosine Recall@1 - type: cosine_recall@3 value: 0.8114285714285714 name: Cosine Recall@3 - type: cosine_recall@5 value: 0.85 name: Cosine Recall@5 - type: cosine_recall@10 value: 0.8885714285714286 name: Cosine Recall@10 - type: cosine_ndcg@10 value: 0.7754227314755763 name: Cosine Ndcg@10 - type: cosine_mrr@10 value: 0.738630385487528 name: Cosine Mrr@10 - type: cosine_map@100 value: 0.7431237490151862 name: Cosine Map@100 - task: type: information-retrieval name: Information Retrieval dataset: name: dim 64 type: dim_64 metrics: - type: cosine_accuracy@1 value: 0.6157142857142858 name: Cosine Accuracy@1 - type: cosine_accuracy@3 value: 0.7614285714285715 name: Cosine Accuracy@3 - type: cosine_accuracy@5 value: 0.81 name: Cosine Accuracy@5 - type: cosine_accuracy@10 value: 0.8642857142857143 name: Cosine Accuracy@10 - type: cosine_precision@1 value: 0.6157142857142858 name: Cosine Precision@1 - type: cosine_precision@3 value: 0.2538095238095238 name: Cosine Precision@3 - type: cosine_precision@5 value: 0.16199999999999998 name: Cosine Precision@5 - type: cosine_precision@10 value: 0.08642857142857142 name: Cosine Precision@10 - type: cosine_recall@1 value: 0.6157142857142858 name: Cosine Recall@1 - type: cosine_recall@3 value: 0.7614285714285715 name: Cosine Recall@3 - type: cosine_recall@5 value: 0.81 name: Cosine Recall@5 - type: cosine_recall@10 value: 0.8642857142857143 name: Cosine Recall@10 - type: cosine_ndcg@10 value: 0.7413954849024657 name: Cosine Ndcg@10 - type: cosine_mrr@10 value: 0.701954648526077 name: Cosine Mrr@10 - type: cosine_map@100 value: 0.707051130510896 name: Cosine Map@100 --- # BGE base Financial Matryoshka This is a [sentence-transformers](https://www.SBERT.net) model finetuned from [BAAI/bge-base-en-v1.5](https://huggingface.co/BAAI/bge-base-en-v1.5). It maps sentences & paragraphs to a 768-dimensional dense vector space and can be used for semantic textual similarity, semantic search, paraphrase mining, text classification, clustering, and more. ## Model Details ### Model Description - **Model Type:** Sentence Transformer - **Base model:** [BAAI/bge-base-en-v1.5](https://huggingface.co/BAAI/bge-base-en-v1.5) <!-- at revision a5beb1e3e68b9ab74eb54cfd186867f64f240e1a --> - **Maximum Sequence Length:** 512 tokens - **Output Dimensionality:** 768 tokens - **Similarity Function:** Cosine Similarity <!-- - **Training Dataset:** Unknown --> - **Language:** en - **License:** apache-2.0 ### Model Sources - **Documentation:** [Sentence Transformers Documentation](https://sbert.net) - **Repository:** [Sentence Transformers on GitHub](https://github.com/UKPLab/sentence-transformers) - **Hugging Face:** [Sentence Transformers on Hugging Face](https://huggingface.co/models?library=sentence-transformers) ### Full Model Architecture ``` SentenceTransformer( (0): Transformer({'max_seq_length': 512, 'do_lower_case': True}) with Transformer model: BertModel (1): Pooling({'word_embedding_dimension': 768, 'pooling_mode_cls_token': True, 'pooling_mode_mean_tokens': False, 'pooling_mode_max_tokens': False, 'pooling_mode_mean_sqrt_len_tokens': False, 'pooling_mode_weightedmean_tokens': False, 'pooling_mode_lasttoken': False, 'include_prompt': True}) (2): Normalize() ) ``` ## Usage ### Direct Usage (Sentence Transformers) First install the Sentence Transformers library: ```bash pip install -U sentence-transformers ``` Then you can load this model and run inference. ```python from sentence_transformers import SentenceTransformer # Download from the 🤗 Hub model = SentenceTransformer("gauravsirola/bge-base-financial-matryoshka-v1") # Run inference sentences = [ 'State legislation increasingly requires PBMs to conduct audits of network pharmacies regarding claims submitted for payment. Non-compliance could prevent the recoupment of overpaid amounts, potentially causing financial and legal repercussions.', 'What are the potential consequences for a company if its PBMs fail to comply with pharmacy audit regulations?', 'What pages do the Consolidated Financial Statements and their accompanying Notes and reports appear on in the document?', ] embeddings = model.encode(sentences) print(embeddings.shape) # [3, 768] # Get the similarity scores for the embeddings similarities = model.similarity(embeddings, embeddings) print(similarities.shape) # [3, 3] ``` <!-- ### Direct Usage (Transformers) <details><summary>Click to see the direct usage in Transformers</summary> </details> --> <!-- ### Downstream Usage (Sentence Transformers) You can finetune this model on your own dataset. <details><summary>Click to expand</summary> </details> --> <!-- ### Out-of-Scope Use *List how the model may foreseeably be misused and address what users ought not to do with the model.* --> ## Evaluation ### Metrics #### Information Retrieval * Dataset: `dim_768` * Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator) | Metric | Value | |:--------------------|:-----------| | cosine_accuracy@1 | 0.6786 | | cosine_accuracy@3 | 0.8343 | | cosine_accuracy@5 | 0.88 | | cosine_accuracy@10 | 0.9086 | | cosine_precision@1 | 0.6786 | | cosine_precision@3 | 0.2781 | | cosine_precision@5 | 0.176 | | cosine_precision@10 | 0.0909 | | cosine_recall@1 | 0.6786 | | cosine_recall@3 | 0.8343 | | cosine_recall@5 | 0.88 | | cosine_recall@10 | 0.9086 | | cosine_ndcg@10 | 0.7995 | | cosine_mrr@10 | 0.7638 | | **cosine_map@100** | **0.7674** | #### Information Retrieval * Dataset: `dim_512` * Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator) | Metric | Value | |:--------------------|:-----------| | cosine_accuracy@1 | 0.6686 | | cosine_accuracy@3 | 0.8271 | | cosine_accuracy@5 | 0.8686 | | cosine_accuracy@10 | 0.9129 | | cosine_precision@1 | 0.6686 | | cosine_precision@3 | 0.2757 | | cosine_precision@5 | 0.1737 | | cosine_precision@10 | 0.0913 | | cosine_recall@1 | 0.6686 | | cosine_recall@3 | 0.8271 | | cosine_recall@5 | 0.8686 | | cosine_recall@10 | 0.9129 | | cosine_ndcg@10 | 0.7955 | | cosine_mrr@10 | 0.7574 | | **cosine_map@100** | **0.7607** | #### Information Retrieval * Dataset: `dim_256` * Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator) | Metric | Value | |:--------------------|:-----------| | cosine_accuracy@1 | 0.6729 | | cosine_accuracy@3 | 0.8143 | | cosine_accuracy@5 | 0.8643 | | cosine_accuracy@10 | 0.9043 | | cosine_precision@1 | 0.6729 | | cosine_precision@3 | 0.2714 | | cosine_precision@5 | 0.1729 | | cosine_precision@10 | 0.0904 | | cosine_recall@1 | 0.6729 | | cosine_recall@3 | 0.8143 | | cosine_recall@5 | 0.8643 | | cosine_recall@10 | 0.9043 | | cosine_ndcg@10 | 0.7916 | | cosine_mrr@10 | 0.7553 | | **cosine_map@100** | **0.7591** | #### Information Retrieval * Dataset: `dim_128` * Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator) | Metric | Value | |:--------------------|:-----------| | cosine_accuracy@1 | 0.6529 | | cosine_accuracy@3 | 0.8114 | | cosine_accuracy@5 | 0.85 | | cosine_accuracy@10 | 0.8886 | | cosine_precision@1 | 0.6529 | | cosine_precision@3 | 0.2705 | | cosine_precision@5 | 0.17 | | cosine_precision@10 | 0.0889 | | cosine_recall@1 | 0.6529 | | cosine_recall@3 | 0.8114 | | cosine_recall@5 | 0.85 | | cosine_recall@10 | 0.8886 | | cosine_ndcg@10 | 0.7754 | | cosine_mrr@10 | 0.7386 | | **cosine_map@100** | **0.7431** | #### Information Retrieval * Dataset: `dim_64` * Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator) | Metric | Value | |:--------------------|:-----------| | cosine_accuracy@1 | 0.6157 | | cosine_accuracy@3 | 0.7614 | | cosine_accuracy@5 | 0.81 | | cosine_accuracy@10 | 0.8643 | | cosine_precision@1 | 0.6157 | | cosine_precision@3 | 0.2538 | | cosine_precision@5 | 0.162 | | cosine_precision@10 | 0.0864 | | cosine_recall@1 | 0.6157 | | cosine_recall@3 | 0.7614 | | cosine_recall@5 | 0.81 | | cosine_recall@10 | 0.8643 | | cosine_ndcg@10 | 0.7414 | | cosine_mrr@10 | 0.702 | | **cosine_map@100** | **0.7071** | <!-- ## Bias, Risks and Limitations *What are the known or foreseeable issues stemming from this model? You could also flag here known failure cases or weaknesses of the model.* --> <!-- ### Recommendations *What are recommendations with respect to the foreseeable issues? For example, filtering explicit content.* --> ## Training Details ### Training Dataset #### Unnamed Dataset * Size: 6,300 training samples * Columns: <code>positive</code> and <code>anchor</code> * Approximate statistics based on the first 1000 samples: | | positive | anchor | |:--------|:-----------------------------------------------------------------------------------|:----------------------------------------------------------------------------------| | type | string | string | | details | <ul><li>min: 7 tokens</li><li>mean: 44.73 tokens</li><li>max: 301 tokens</li></ul> | <ul><li>min: 8 tokens</li><li>mean: 20.57 tokens</li><li>max: 41 tokens</li></ul> | * Samples: | positive | anchor | |:-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|:--------------------------------------------------------------------------------------------------------------------------------------| | <code>Net loss was $396.6 million and $973.6 million during the years ended December 31, 2023, and December 31, 2022, respectively.</code> | <code>What was the net loss for the year ended December 31, 2022?</code> | | <code>Under the 2023 IDA agreement, the service fee on client cash deposits held at the TD Depository Institutions remains at 15 basis points, as it was in the 2019 IDA agreement.</code> | <code>How much is the service fee on client cash deposits held at the TD Depository Institutions under the 2023 IDA agreement?</code> | | <code>The total shareholders’ deficit is listed as $7,994.8 million in the latest financial statement.</code> | <code>What is the total shareholder's deficit according to the latest financial statement?</code> | * Loss: [<code>MatryoshkaLoss</code>](https://sbert.net/docs/package_reference/sentence_transformer/losses.html#matryoshkaloss) with these parameters: ```json { "loss": "MultipleNegativesRankingLoss", "matryoshka_dims": [ 768, 512, 256, 128, 64 ], "matryoshka_weights": [ 1, 1, 1, 1, 1 ], "n_dims_per_step": -1 } ``` ### Training Hyperparameters #### Non-Default Hyperparameters - `eval_strategy`: epoch - `per_device_train_batch_size`: 32 - `per_device_eval_batch_size`: 16 - `gradient_accumulation_steps`: 16 - `learning_rate`: 2e-05 - `num_train_epochs`: 4 - `lr_scheduler_type`: cosine - `warmup_ratio`: 0.1 - `bf16`: True - `tf32`: True - `load_best_model_at_end`: True - `optim`: adamw_torch_fused - `batch_sampler`: no_duplicates #### All Hyperparameters <details><summary>Click to expand</summary> - `overwrite_output_dir`: False - `do_predict`: False - `eval_strategy`: epoch - `prediction_loss_only`: True - `per_device_train_batch_size`: 32 - `per_device_eval_batch_size`: 16 - `per_gpu_train_batch_size`: None - `per_gpu_eval_batch_size`: None - `gradient_accumulation_steps`: 16 - `eval_accumulation_steps`: None - `learning_rate`: 2e-05 - `weight_decay`: 0.0 - `adam_beta1`: 0.9 - `adam_beta2`: 0.999 - `adam_epsilon`: 1e-08 - `max_grad_norm`: 1.0 - `num_train_epochs`: 4 - `max_steps`: -1 - `lr_scheduler_type`: cosine - `lr_scheduler_kwargs`: {} - `warmup_ratio`: 0.1 - `warmup_steps`: 0 - `log_level`: passive - `log_level_replica`: warning - `log_on_each_node`: True - `logging_nan_inf_filter`: True - `save_safetensors`: True - `save_on_each_node`: False - `save_only_model`: False - `restore_callback_states_from_checkpoint`: False - `no_cuda`: False - `use_cpu`: False - `use_mps_device`: False - `seed`: 42 - `data_seed`: None - `jit_mode_eval`: False - `use_ipex`: False - `bf16`: True - `fp16`: False - `fp16_opt_level`: O1 - `half_precision_backend`: auto - `bf16_full_eval`: False - `fp16_full_eval`: False - `tf32`: True - `local_rank`: 0 - `ddp_backend`: None - `tpu_num_cores`: None - `tpu_metrics_debug`: False - `debug`: [] - `dataloader_drop_last`: False - `dataloader_num_workers`: 0 - `dataloader_prefetch_factor`: None - `past_index`: -1 - `disable_tqdm`: False - `remove_unused_columns`: True - `label_names`: None - `load_best_model_at_end`: True - `ignore_data_skip`: False - `fsdp`: [] - `fsdp_min_num_params`: 0 - `fsdp_config`: {'min_num_params': 0, 'xla': False, 'xla_fsdp_v2': False, 'xla_fsdp_grad_ckpt': False} - `fsdp_transformer_layer_cls_to_wrap`: None - `accelerator_config`: {'split_batches': False, 'dispatch_batches': None, 'even_batches': True, 'use_seedable_sampler': True, 'non_blocking': False, 'gradient_accumulation_kwargs': None} - `deepspeed`: None - `label_smoothing_factor`: 0.0 - `optim`: adamw_torch_fused - `optim_args`: None - `adafactor`: False - `group_by_length`: False - `length_column_name`: length - `ddp_find_unused_parameters`: None - `ddp_bucket_cap_mb`: None - `ddp_broadcast_buffers`: False - `dataloader_pin_memory`: True - `dataloader_persistent_workers`: False - `skip_memory_metrics`: True - `use_legacy_prediction_loop`: False - `push_to_hub`: False - `resume_from_checkpoint`: None - `hub_model_id`: None - `hub_strategy`: every_save - `hub_private_repo`: False - `hub_always_push`: False - `gradient_checkpointing`: False - `gradient_checkpointing_kwargs`: None - `include_inputs_for_metrics`: False - `eval_do_concat_batches`: True - `fp16_backend`: auto - `push_to_hub_model_id`: None - `push_to_hub_organization`: None - `mp_parameters`: - `auto_find_batch_size`: False - `full_determinism`: False - `torchdynamo`: None - `ray_scope`: last - `ddp_timeout`: 1800 - `torch_compile`: False - `torch_compile_backend`: None - `torch_compile_mode`: None - `dispatch_batches`: None - `split_batches`: None - `include_tokens_per_second`: False - `include_num_input_tokens_seen`: False - `neftune_noise_alpha`: None - `optim_target_modules`: None - `batch_eval_metrics`: False - `batch_sampler`: no_duplicates - `multi_dataset_batch_sampler`: proportional </details> ### Training Logs | Epoch | Step | Training Loss | dim_128_cosine_map@100 | dim_256_cosine_map@100 | dim_512_cosine_map@100 | dim_64_cosine_map@100 | dim_768_cosine_map@100 | |:----------:|:------:|:-------------:|:----------------------:|:----------------------:|:----------------------:|:---------------------:|:----------------------:| | 0.8122 | 10 | 1.5585 | - | - | - | - | - | | 0.9746 | 12 | - | 0.7207 | 0.7441 | 0.7510 | 0.6857 | 0.7493 | | 1.6244 | 20 | 0.6691 | - | - | - | - | - | | 1.9492 | 24 | - | 0.7392 | 0.7564 | 0.7601 | 0.7006 | 0.7661 | | 2.4365 | 30 | 0.4702 | - | - | - | - | - | | 2.9239 | 36 | - | 0.7430 | 0.7600 | 0.7619 | 0.7065 | 0.7685 | | 3.2487 | 40 | 0.407 | - | - | - | - | - | | **3.8985** | **48** | **-** | **0.7431** | **0.7591** | **0.7607** | **0.7071** | **0.7674** | * The bold row denotes the saved checkpoint. ### Framework Versions - Python: 3.10.6 - Sentence Transformers: 3.0.1 - Transformers: 4.41.2 - PyTorch: 2.1.2+cu121 - Accelerate: 0.31.0 - Datasets: 2.19.1 - Tokenizers: 0.19.1 ## Citation ### BibTeX #### Sentence Transformers ```bibtex @inproceedings{reimers-2019-sentence-bert, title = "Sentence-BERT: Sentence Embeddings using Siamese BERT-Networks", author = "Reimers, Nils and Gurevych, Iryna", booktitle = "Proceedings of the 2019 Conference on Empirical Methods in Natural Language Processing", month = "11", year = "2019", publisher = "Association for Computational Linguistics", url = "https://arxiv.org/abs/1908.10084", } ``` #### MatryoshkaLoss ```bibtex @misc{kusupati2024matryoshka, title={Matryoshka Representation Learning}, author={Aditya Kusupati and Gantavya Bhatt and Aniket Rege and Matthew Wallingford and Aditya Sinha and Vivek Ramanujan and William Howard-Snyder and Kaifeng Chen and Sham Kakade and Prateek Jain and Ali Farhadi}, year={2024}, eprint={2205.13147}, archivePrefix={arXiv}, primaryClass={cs.LG} } ``` #### MultipleNegativesRankingLoss ```bibtex @misc{henderson2017efficient, title={Efficient Natural Language Response Suggestion for Smart Reply}, author={Matthew Henderson and Rami Al-Rfou and Brian Strope and Yun-hsuan Sung and Laszlo Lukacs and Ruiqi Guo and Sanjiv Kumar and Balint Miklos and Ray Kurzweil}, year={2017}, eprint={1705.00652}, archivePrefix={arXiv}, primaryClass={cs.CL} } ``` <!-- ## Glossary *Clearly define terms in order to be accessible across audiences.* --> <!-- ## Model Card Authors *Lists the people who create the model card, providing recognition and accountability for the detailed work that goes into its construction.* --> <!-- ## Model Card Contact *Provides a way for people who have updates to the Model Card, suggestions, or questions, to contact the Model Card authors.* -->
SidXXD/3-only_cos-person-eps_10-alpha_5e-2-person
SidXXD
2024-07-02T10:07:01Z
0
0
diffusers
[ "diffusers", "tensorboard", "safetensors", "stable-diffusion", "stable-diffusion-diffusers", "text-to-image", "custom-diffusion", "base_model:stabilityai/stable-diffusion-2-1-base", "license:creativeml-openrail-m", "region:us" ]
text-to-image
2024-07-02T09:49:52Z
--- license: creativeml-openrail-m base_model: stabilityai/stable-diffusion-2-1-base instance_prompt: photo of a <v1*> person tags: - stable-diffusion - stable-diffusion-diffusers - text-to-image - diffusers - custom-diffusion inference: true --- # Custom Diffusion - SidXXD/3-only_cos-person-eps_10-alpha_5e-2-person These are Custom Diffusion adaption weights for stabilityai/stable-diffusion-2-1-base. The weights were trained on photo of a <v1*> person using [Custom Diffusion](https://www.cs.cmu.edu/~custom-diffusion). You can find some example images in the following. For more details on the training, please follow [this link](https://github.com/huggingface/diffusers/blob/main/examples/custom_diffusion).
tushar-r-pawar/gemma-2b-finetuned
tushar-r-pawar
2024-07-02T09:55:17Z
0
0
transformers
[ "transformers", "safetensors", "gemma", "text-generation", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T09:50:01Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
Salvatore/Persona_LoRA
Salvatore
2024-07-02T09:53:41Z
0
0
diffusers
[ "diffusers", "text-to-image", "diffusers-training", "lora", "template:sd-lora", "stable-diffusion-xl", "stable-diffusion-xl-diffusers", "base_model:stabilityai/stable-diffusion-xl-base-1.0", "license:openrail++", "region:us" ]
text-to-image
2024-07-02T09:50:55Z
--- base_model: stabilityai/stable-diffusion-xl-base-1.0 library_name: diffusers license: openrail++ tags: - text-to-image - diffusers-training - diffusers - lora - template:sd-lora - stable-diffusion-xl - stable-diffusion-xl-diffusers - text-to-image - text-to-image - diffusers-training - diffusers - lora - template:sd-lora - stable-diffusion-xl - stable-diffusion-xl-diffusers instance_prompt: a photo of TOK person widget: [] --- <!-- This model card has been generated automatically according to the information the training script had access to. You should probably proofread and complete it, then remove this comment. --> # SDXL LoRA DreamBooth - Salvatore/Persona_LoRA <Gallery /> ## Model description These are Salvatore/Persona_LoRA LoRA adaption weights for stabilityai/stable-diffusion-xl-base-1.0. The weights were trained using [DreamBooth](https://dreambooth.github.io/). LoRA for the text encoder was enabled: False. Special VAE used for training: madebyollin/sdxl-vae-fp16-fix. ## Trigger words You should use a photo of TOK person to trigger the image generation. ## Download model Weights for this model are available in Safetensors format. [Download](Salvatore/Persona_LoRA/tree/main) them in the Files & versions tab. ## Intended uses & limitations #### How to use ```python # TODO: add an example code snippet for running this diffusion pipeline ``` #### Limitations and bias [TODO: provide examples of latent issues and potential remediations] ## Training details [TODO: describe the data used to train the model]
aks1s/05-flow-2
aks1s
2024-07-02T09:52:04Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:51:22Z
Entry not found
Peacoc/37_best_t_14_4
Peacoc
2024-07-02T09:53:58Z
0
0
transformers
[ "transformers", "safetensors", "llama", "text-generation", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T09:51:51Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
Tuhaishi/distilbert-base-cased
Tuhaishi
2024-07-02T09:51:54Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:51:54Z
Entry not found
irusl/04ktm1
irusl
2024-07-02T09:55:16Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:52:47Z
Entry not found
ashrafdiab/Poultry
ashrafdiab
2024-07-02T09:53:40Z
0
0
null
[ "region:us" ]
null
2024-07-02T09:53:40Z
Entry not found
aks1s/06-flow-2
aks1s
2024-07-02T09:55:22Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:54:35Z
Entry not found
femiari/Qwen1.5-1.8B-Moe
femiari
2024-07-02T09:56:40Z
0
0
transformers
[ "transformers", "qwen2_moe", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:56:39Z
Entry not found
Elifay/Liflif
Elifay
2024-07-02T09:57:49Z
0
0
asteroid
[ "asteroid", "zero-shot-classification", "ay", "dataset:HuggingFaceFW/fineweb-edu", "license:apache-2.0", "region:us" ]
zero-shot-classification
2024-07-02T09:57:01Z
--- license: apache-2.0 datasets: - HuggingFaceFW/fineweb-edu language: - ay metrics: - character library_name: asteroid pipeline_tag: zero-shot-classification ---
readerbench/RoGEC-robert-large
readerbench
2024-07-02T12:32:10Z
0
0
transformers
[ "transformers", "safetensors", "bert", "token-classification", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "region:us" ]
token-classification
2024-07-02T09:57:05Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
antoniolopez00/gemma-2-9b-it-quantized
antoniolopez00
2024-07-02T10:05:18Z
0
0
transformers
[ "transformers", "safetensors", "gemma2", "text-generation", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "4-bit", "bitsandbytes", "region:us" ]
text-generation
2024-07-02T09:57:07Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
haophancs/code-llama-7b-text-to-sql
haophancs
2024-07-02T11:20:03Z
0
0
null
[ "tensorboard", "safetensors", "region:us" ]
null
2024-07-02T09:57:18Z
Entry not found
aks1s/07-flow-2
aks1s
2024-07-02T09:58:39Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:57:59Z
Entry not found
RachidAR/Phi-3-mini-4k-instruct-June2024-Q6_K-GGUF
RachidAR
2024-07-02T10:08:46Z
0
0
null
[ "gguf", "nlp", "code", "llama-cpp", "gguf-my-repo", "text-generation", "en", "base_model:microsoft/Phi-3-mini-4k-instruct", "license:mit", "region:us" ]
text-generation
2024-07-02T09:58:10Z
--- base_model: microsoft/Phi-3-mini-4k-instruct language: - en license: mit license_link: https://huggingface.co/microsoft/Phi-3-mini-4k-instruct/resolve/main/LICENSE pipeline_tag: text-generation tags: - nlp - code - llama-cpp - gguf-my-repo inference: parameters: temperature: 0.0 widget: - messages: - role: user content: Can you provide ways to eat combinations of bananas and dragonfruits? --- # RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF (June 2024 Update) This model was converted to GGUF format from [`microsoft/Phi-3-mini-4k-instruct`](https://huggingface.co/microsoft/Phi-3-mini-4k-instruct) using llama.cpp via the ggml.ai's [GGUF-my-repo](https://huggingface.co/spaces/ggml-org/gguf-my-repo) space. Refer to the [original model card](https://huggingface.co/microsoft/Phi-3-mini-4k-instruct) for more details on the model. ## Release Notes This is an update over the original instruction-tuned Phi-3-mini release based on valuable customer feedback. The model used additional post-training data leading to substantial gains on instruction following and structure output. We also **improve multi-turn conversation quality**, **explicitly support <|system|> tag**, and **significantly improve reasoning capability**. We believe most use cases will benefit from this release, but we encourage users to test in their particular AI applications. We appreciate the enthusiastic adoption of the Phi-3 model family, and continue to welcome all feedback from the community. The table below highlights improvements on instruction following, structure output, and reasoning of the new release on publich and internal benchmark datasets. | Benchmarks | Original | June 2024 Update | |:------------|:----------|:------------------| | Instruction Extra Hard | 5.7 | 6.0 | | Instruction Hard | 4.9 | 5.1 | | Instructions Challenge | 24.6 | 42.3 | | JSON Structure Output | 11.5 | 52.3 | | XML Structure Output | 14.4 | 49.8 | | GPQA | 23.7 | 30.6 | | MMLU | 68.8 | 70.9 | | **Average** | **21.9** | **36.7** | ### Chat Format Given the nature of the training data, the Phi-3 Mini-4K-Instruct model is best suited for prompts using the chat format as follows. You can provide the prompt as a question with a generic template as follow: ```markdown <|system|> You are a helpful assistant.<|end|> <|user|> Question?<|end|> <|assistant|> ``` For example: ```markdown <|system|> You are a helpful assistant.<|end|> <|user|> How to explain Internet for a medieval knight?<|end|> <|assistant|> ``` where the model generates the text after `<|assistant|>` . In case of few-shots prompt, the prompt can be formatted as the following: ```markdown <|system|> You are a helpful travel assistant.<|end|> <|user|> I am going to Paris, what should I see?<|end|> <|assistant|> Paris, the capital of France, is known for its stunning architecture, art museums, historical landmarks, and romantic atmosphere. Here are some of the top attractions to see in Paris:\n\n1. The Eiffel Tower: The iconic Eiffel Tower is one of the most recognizable landmarks in the world and offers breathtaking views of the city.\n2. The Louvre Museum: The Louvre is one of the world's largest and most famous museums, housing an impressive collection of art and artifacts, including the Mona Lisa.\n3. Notre-Dame Cathedral: This beautiful cathedral is one of the most famous landmarks in Paris and is known for its Gothic architecture and stunning stained glass windows.\n\nThese are just a few of the many attractions that Paris has to offer. With so much to see and do, it's no wonder that Paris is one of the most popular tourist destinations in the world."<|end|> <|user|> What is so great about #1?<|end|> <|assistant|> ``` ## Use with llama.cpp Install llama.cpp through brew (works on Mac and Linux) ```bash brew install llama.cpp ``` Invoke the llama.cpp server or the CLI. ### CLI: ```bash llama-cli --hf-repo RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF --hf-file phi-3-mini-4k-instruct-q6_k.gguf -p "The meaning to life and the universe is" ``` ### Server: ```bash llama-server --hf-repo RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF --hf-file phi-3-mini-4k-instruct-q6_k.gguf -c 2048 ``` Note: You can also use this checkpoint directly through the [usage steps](https://github.com/ggerganov/llama.cpp?tab=readme-ov-file#usage) listed in the Llama.cpp repo as well. Step 1: Clone llama.cpp from GitHub. ``` git clone https://github.com/ggerganov/llama.cpp ``` Step 2: Move into the llama.cpp folder and build it with `LLAMA_CURL=1` flag along with other hardware-specific flags (for ex: LLAMA_CUDA=1 for Nvidia GPUs on Linux). ``` cd llama.cpp && LLAMA_CURL=1 make ``` Step 3: Run inference through the main binary. ``` ./llama-cli --hf-repo RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF --hf-file phi-3-mini-4k-instruct-q6_k.gguf -p "The meaning to life and the universe is" ``` or ``` ./llama-server --hf-repo RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF --hf-file phi-3-mini-4k-instruct-q6_k.gguf -c 2048 ```
irusl/05ktm1
irusl
2024-07-02T10:00:53Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T09:58:23Z
Entry not found
Peacoc/37_best_t_15_4
Peacoc
2024-07-02T10:02:19Z
0
0
transformers
[ "transformers", "safetensors", "llama", "text-generation", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T10:00:09Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
aks1s/08-flow-2
aks1s
2024-07-02T10:01:53Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T10:01:10Z
Entry not found
Bighost/Songcomposer-tone-specific
Bighost
2024-07-02T10:01:20Z
0
0
null
[ "region:us" ]
null
2024-07-02T10:01:20Z
Invalid username or password.
anhtux1x/Madlad400-Zh-Vi-2k-data4
anhtux1x
2024-07-02T10:29:58Z
0
0
transformers
[ "transformers", "safetensors", "t5", "text2text-generation", "vi", "en", "zh", "license:apache-2.0", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text2text-generation
2024-07-02T10:01:33Z
--- license: apache-2.0 language: - vi - en - zh --- ```python from transformers import AutoModelForSeq2SeqLM, AutoTokenizer base_model_name = 'anhtux1x/Madlad400-Zh-Vi-2k-data4' base_model = AutoModelForSeq2SeqLM.from_pretrained(base_model_name) tokenizer = AutoTokenizer.from_pretrained(base_model_name) base_model.to("cuda") sentences = [ "1. 参考图片方向将1pcs mac ID label粘贴到main board上(barcode朝上)", "2.按压reset按键3次以上,检查不可有卡键 、破损、手感弱等不良品.", "3.用无尘布蘸取少量酒精(含量96%),将reset按键一圈的脏污及粉尘清洁干净", "4.将1pcs rubber reset button置中粘贴到reset按键上,粘贴后按压reset按键3次以上,检查不可有卡键或手感弱等不良品", "5.取1pcs已点胶的网口板然后装到主板上,如图5。", "6.将测试排线插入主板中,扫描主板MAC ID label, 扫描主板另一面的HH label", "7. 将网线插入位置,如上图8", "8.出现如图所示界面时,点击确认.", "9.出现如图画面PASS时,表示为良品,将产品取出", "10.當出现如图画面FAIL时,交换机台重新测试,一机就当机重测,若再次不良,将产品取出使用铅笔标示不良代码于不良卡上放到不良品区" ] for inputs in sentences: inputs = tokenizer(f"<2vi> {inputs}", return_tensors="pt") outputs = base_model.generate(**inputs.to('cuda'),max_length=500) reusult = tokenizer.batch_decode(outputs, skip_special_tokens=True) print(reusult,"\n") ```
imagepipeline/buda
imagepipeline
2024-07-02T10:01:49Z
0
0
null
[ "imagepipeline", "imagepipeline.io", "text-to-image", "ultra-realistic", "license:creativeml-openrail-m", "region:us" ]
text-to-image
2024-07-02T10:01:47Z
--- license: creativeml-openrail-m tags: - imagepipeline - imagepipeline.io - text-to-image - ultra-realistic pinned: false pipeline_tag: text-to-image --- ## buda <img src="https://via.placeholder.com/468x300?text=App+Screenshot+Here" alt="Generated on Image Pipeline" style="border-radius: 10px;"> **This lora model is uploaded on [imagepipeline.io](https://imagepipeline.io/)** Model details - buda [![Try this model](https://img.shields.io/badge/try_this_model-image_pipeline-BD9319)](https://imagepipeline.io/models/buda?id=a9932c22-7d2d-4480-8f46-7d2a260782ba/) ## How to try this model ? You can try using it locally or send an API call to test the output quality. Get your `API_KEY` from [imagepipeline.io](https://imagepipeline.io/). No payment required. Coding in `php` `javascript` `node` etc ? Checkout our documentation [![documentation](https://img.shields.io/badge/documentation-image_pipeline-blue)](https://docs.imagepipeline.io/docs/introduction) ```python import requests import json url = "https://imagepipeline.io/sd/text2image/v1/run" payload = json.dumps({ "model_id": "sd1.5", "prompt": "ultra realistic close up portrait ((beautiful pale cyberpunk female with heavy black eyeliner)), blue eyes, shaved side haircut, hyper detail, cinematic lighting, magic neon, dark red city, Canon EOS R3, nikon, f/1.4, ISO 200, 1/160s, 8K, RAW, unedited, symmetrical balance, in-frame, 8K", "negative_prompt": "painting, extra fingers, mutated hands, poorly drawn hands, poorly drawn face, deformed, ugly, blurry, bad anatomy, bad proportions, extra limbs, cloned face, skinny, glitchy, double torso, extra arms, extra hands, mangled fingers, missing lips, ugly face, distorted face, extra legs, anime", "width": "512", "height": "512", "samples": "1", "num_inference_steps": "30", "safety_checker": false, "guidance_scale": 7.5, "multi_lingual": "no", "embeddings": "", "lora_models": "a9932c22-7d2d-4480-8f46-7d2a260782ba", "lora_weights": "0.5" }) headers = { 'Content-Type': 'application/json', 'API-Key': 'your_api_key' } response = requests.request("POST", url, headers=headers, data=payload) print(response.text) } ``` Get more ready to use `MODELS` like this for `SD 1.5` and `SDXL` : [![All models](https://img.shields.io/badge/Get%20All%20Models-image_pipeline-BD9319)](https://imagepipeline.io/models) ### API Reference #### Generate Image ```http https://api.imagepipeline.io/sd/text2image/v1 ``` | Headers | Type | Description | |:----------------------| :------- |:-------------------------------------------------------------------------------------------------------------------| | `API-Key` | `str` | Get your `API_KEY` from [imagepipeline.io](https://imagepipeline.io/) | | `Content-Type` | `str` | application/json - content type of the request body | | Parameter | Type | Description | | :-------- | :------- | :------------------------- | | `model_id` | `str` | Your base model, find available lists in [models page](https://imagepipeline.io/models) or upload your own| | `prompt` | `str` | Text Prompt. Check our [Prompt Guide](https://docs.imagepipeline.io/docs/SD-1.5/docs/extras/prompt-guide) for tips | | `num_inference_steps` | `int [1-50]` | Noise is removed with each step, resulting in a higher-quality image over time. Ideal value 30-50 (without LCM) | | `guidance_scale` | `float [1-20]` | Higher guidance scale prioritizes text prompt relevance but sacrifices image quality. Ideal value 7.5-12.5 | | `lora_models` | `str, array` | Pass the model_id(s) of LoRA models that can be found in models page | | `lora_weights` | `str, array` | Strength of the LoRA effect | --- license: creativeml-openrail-m tags: - imagepipeline - imagepipeline.io - text-to-image - ultra-realistic pinned: false pipeline_tag: text-to-image --- ### Feedback If you have any feedback, please reach out to us at [email protected] #### 🔗 Visit Website [![portfolio](https://img.shields.io/badge/image_pipeline-BD9319?style=for-the-badge&logo=gocd&logoColor=white)](https://imagepipeline.io/) If you are the original author of this model, please [click here](https://airtable.com/apprTaRnJbDJ8ufOx/shr4g7o9B6fWfOlUR) to add credits
rgb2gbr/Rock_Paper_Scissors
rgb2gbr
2024-07-02T10:17:01Z
0
0
keras
[ "keras", "rpc", "rock, paper, scissors", "hand sign", "en", "region:us" ]
null
2024-07-02T10:02:11Z
--- language: - en metrics: - accuracy library_name: keras tags: - rpc - rock, paper, scissors - hand sign --- RPC, Rock Paper Scissiors model using Convolutional Neural Network (CNN/ VGG16) KERAS architecture
TristanGraeble/finetuned_model
TristanGraeble
2024-07-02T11:24:52Z
0
0
transformers
[ "transformers", "safetensors", "llama", "text-generation", "conversational", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T10:03:25Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
SaFire1/RynthLabs
SaFire1
2024-07-02T10:03:36Z
0
0
null
[ "license:mit", "region:us" ]
null
2024-07-02T10:03:36Z
--- license: mit ---
irusl/06ktm1
irusl
2024-07-02T10:06:37Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T10:03:58Z
Entry not found
aks1s/09-flow-2
aks1s
2024-07-02T10:05:06Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T10:04:23Z
Entry not found
hasininawoda/output
hasininawoda
2024-07-02T10:10:13Z
0
0
diffusers
[ "diffusers", "tensorboard", "stable-diffusion", "stable-diffusion-diffusers", "text-to-image", "diffusers-training", "lora", "base_model:CompVis/stable-diffusion-v1-4", "license:creativeml-openrail-m", "region:us" ]
text-to-image
2024-07-02T10:04:39Z
--- license: creativeml-openrail-m library_name: diffusers tags: - stable-diffusion - stable-diffusion-diffusers - text-to-image - diffusers - diffusers-training - lora base_model: CompVis/stable-diffusion-v1-4 inference: true --- <!-- This model card has been generated automatically according to the information the training script had access to. You should probably proofread and complete it, then remove this comment. --> # LoRA text2image fine-tuning - hasininawoda/output These are LoRA adaption weights for CompVis/stable-diffusion-v1-4. The weights were fine-tuned on the None dataset. You can find some example images in the following. ## Intended uses & limitations #### How to use ```python # TODO: add an example code snippet for running this diffusion pipeline ``` #### Limitations and bias [TODO: provide examples of latent issues and potential remediations] ## Training details [TODO: describe the data used to train the model]
AIForge/Qwen2-0.5B-cpt
AIForge
2024-07-02T10:24:01Z
0
0
transformers
[ "transformers", "safetensors", "qwen2", "text-generation", "conversational", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T10:05:07Z
Invalid username or password.
finn03091993/naschainv116
finn03091993
2024-07-02T10:05:21Z
0
0
null
[ "region:us" ]
null
2024-07-02T10:05:20Z
Entry not found
datakrems/test
datakrems
2024-07-02T14:07:50Z
0
0
transformers
[ "transformers", "safetensors", "llama", "text-generation", "finetuned", "question-answering", "arxiv:1910.09700", "license:apache-2.0", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "4-bit", "bitsandbytes", "region:us" ]
question-answering
2024-07-02T10:05:34Z
--- license: apache-2.0 pipeline_tag: question-answering tags: - finetuned inference: true widget: - messages: - role: user content: What is your favorite condiment? --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
yaambe/mms-tts-spa
yaambe
2024-07-02T10:26:33Z
0
0
null
[ "onnx", "region:us" ]
null
2024-07-02T10:06:39Z
# Text-to-Speech Model This is a sherpa-onnx compatible model of the mms-tts-spa. The original finetuned version was from https://huggingface.co/ylacombe/mms-spa-finetuned-argentinian-monospeaker
rubioh/whisper-small-hi
rubioh
2024-07-02T10:07:17Z
0
0
null
[ "region:us" ]
null
2024-07-02T10:07:17Z
Entry not found
aks1s/11-flow-2
aks1s
2024-07-02T10:08:19Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T10:07:34Z
Entry not found
AERA-Batch1/finetune-phi-adapterv2-3epochs
AERA-Batch1
2024-07-02T10:10:22Z
0
0
transformers
[ "transformers", "safetensors", "gpt", "text-generation", "custom_code", "arxiv:1910.09700", "autotrain_compatible", "region:us" ]
text-generation
2024-07-02T10:08:56Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
debenoist/cube_merged
debenoist
2024-07-02T15:14:14Z
0
0
transformers
[ "transformers", "safetensors", "idefics2", "pretraining", "endpoints_compatible", "4-bit", "bitsandbytes", "region:us" ]
null
2024-07-02T10:09:19Z
Entry not found
tosa-no-onchan/my_awesome_asr_mind_model
tosa-no-onchan
2024-07-02T16:05:13Z
0
0
transformers
[ "transformers", "tensorboard", "safetensors", "wav2vec2", "automatic-speech-recognition", "endpoints_compatible", "region:us" ]
automatic-speech-recognition
2024-07-02T10:10:40Z
Entry not found
h-d-h/q-FrozenLake-v1-4x4-noSlippery
h-d-h
2024-07-02T10:10:49Z
0
0
null
[ "FrozenLake-v1-4x4-no_slippery", "q-learning", "reinforcement-learning", "custom-implementation", "model-index", "region:us" ]
reinforcement-learning
2024-07-02T10:10:45Z
--- tags: - FrozenLake-v1-4x4-no_slippery - q-learning - reinforcement-learning - custom-implementation model-index: - name: q-FrozenLake-v1-4x4-noSlippery results: - task: type: reinforcement-learning name: reinforcement-learning dataset: name: FrozenLake-v1-4x4-no_slippery type: FrozenLake-v1-4x4-no_slippery metrics: - type: mean_reward value: 1.00 +/- 0.00 name: mean_reward verified: false --- # **Q-Learning** Agent playing1 **FrozenLake-v1** This is a trained model of a **Q-Learning** agent playing **FrozenLake-v1** . ## Usage ```python model = load_from_hub(repo_id="h-d-h/q-FrozenLake-v1-4x4-noSlippery", filename="q-learning.pkl") # Don't forget to check if you need to add additional attributes (is_slippery=False etc) env = gym.make(model["env_id"]) ```
aks1s/12-flow-2
aks1s
2024-07-02T10:11:34Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T10:10:47Z
Entry not found
SamagraDataGov/e2e_deployment
SamagraDataGov
2024-07-02T12:52:05Z
0
0
transformers
[ "transformers", "safetensors", "bert", "text-classification", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-classification
2024-07-02T10:11:06Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
Marouane50/llama2_finetuned_chatbot
Marouane50
2024-07-02T10:37:25Z
0
0
null
[ "tensorboard", "generated_from_trainer", "license:llama2", "region:us" ]
null
2024-07-02T10:11:39Z
--- license: llama2 tags: - generated_from_trainer model-index: - name: llama2_finetuned_chatbot results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # llama2_finetuned_chatbot This model is a fine-tuned version of [meta-llama/Llama-2-7b-hf](https://huggingface.co/meta-llama/Llama-2-7b-hf) on an unknown dataset. ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 0.0002 - train_batch_size: 16 - eval_batch_size: 16 - seed: 42 - gradient_accumulation_steps: 4 - total_train_batch_size: 64 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - training_steps: 10 ### Training results ### Framework versions - Transformers 4.30.2 - Pytorch 2.1.2 - Datasets 2.19.2 - Tokenizers 0.13.3
Cayetano/gpt2-imdb-pos-v2
Cayetano
2024-07-02T10:12:22Z
0
0
transformers
[ "transformers", "safetensors", "gpt2", "text-generation", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T10:11:58Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
multimolecule/rnafm
multimolecule
2024-07-02T10:14:56Z
0
0
multimolecule
[ "multimolecule", "pytorch", "safetensors", "rnafm", "Biology", "RNA", "fill-mask", "rna", "dataset:multimolecule/rnacentral", "license:agpl-3.0", "region:us" ]
fill-mask
2024-07-02T10:11:59Z
--- language: rna tags: - Biology - RNA license: agpl-3.0 datasets: - multimolecule/rnacentral library_name: multimolecule pipeline_tag: fill-mask mask_token: "<mask>" widget: - example_title: "microRNA-21" text: "UAGC<mask>UAUCAGACUGAUGUUGA" output: - label: "*" score: 0.3237496316432953 - label: "I" score: 0.28286001086235046 - label: "." score: 0.11762786656618118 - label: "A" score: 0.07875438779592514 - label: "U" score: 0.06866674870252609 --- # RNA-FM Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective. ## Disclaimer This is an UNOFFICIAL implementation of the [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062) by Jiayang Chen, Zhihang Hue, Siqi Sun, et al. The OFFICIAL repository of RNA-FM is at [ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM). !!! Success "Reproducibility" The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation. **The team releasing RNA-FM did not write this model card for this model so this model card has been written by the MultiMolecule team.** ## Model Details RNA-FM is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process. ### Variations - **[`multimolecule/rnafm`](https://huggingface.co/multimolecule/rnafm)**: The RNA-FM model pre-trained on non-coding RNA sequences. - **[`multimolecule/mrnafm`](https://huggingface.co/multimolecule/mrnafm)**: The RNA-FM model pre-trained on mRNA coding sequences. ### Model Specification <table> <thead> <tr> <th>Variants</th> <th>Num Layers</th> <th>Hidden Size</th> <th>Num Heads</th> <th>Intermediate Size</th> <th>Num Parameters (M)</th> <th>FLOPs (G)</th> <th>MACs (G)</th> <th>Max Num Tokens</th> </tr> </thead> <tbody> <tr> <td>RNA-FM</td> <td rowspan="2">12</td> <td>640</td> <td rowspan="2">20</td> <td rowspan="2">5120</td> <td>99.52</td> <td>25.68</td> <td>12.83</td> <td rowspan="2">1024</td> </tr> <tr> <td>mRNA-FM</td> <td>1280</td> <td>239.25</td> <td>61.43</td> <td>30.7</td> </tr> </tbody> </table> ### Links - **Code**: [multimolecule.rnafm](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnafm) - **Data**: [RNAcentral](https://rnacentral.org) - **Paper**: [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062) - **Developed by**: Jiayang Chen, Zhihang Hu, Siqi Sun, Qingxiong Tan, Yixuan Wang, Qinze Yu, Licheng Zong, Liang Hong, Jin Xiao, Tao Shen, Irwin King, Yu Li - **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ESM](https://huggingface.co/facebook/esm2_t48_15B_UR50D) - **Original Repository**: [https://github.com/ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM) ## Usage The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip: ```bash pip install multimolecule ``` ### Direct Use You can use this model directly with a pipeline for masked language modeling: ```python >>> import multimolecule # you must import multimolecule to register models >>> from transformers import pipeline >>> unmasker = pipeline('fill-mask', model='multimolecule/rnafm') >>> unmasker("uagc<mask>uaucagacugauguuga") [{'score': 0.3237496316432953, 'token': 24, 'token_str': '*', 'sequence': 'U A G C * U A U C A G A C U G A U G U U G A'}, {'score': 0.28286001086235046, 'token': 11, 'token_str': 'I', 'sequence': 'U A G C I U A U C A G A C U G A U G U U G A'}, {'score': 0.11762786656618118, 'token': 23, 'token_str': '.', 'sequence': 'U A G C. U A U C A G A C U G A U G U U G A'}, {'score': 0.07875438779592514, 'token': 6, 'token_str': 'A', 'sequence': 'U A G C A U A U C A G A C U G A U G U U G A'}, {'score': 0.06866674870252609, 'token': 9, 'token_str': 'U', 'sequence': 'U A G C U U A U C A G A C U G A U G U U G A'}] ``` ### Downstream Use #### Extract Features Here is how to use this model to get the features of a given sequence in PyTorch: ```python from multimolecule import RnaTokenizer, RnaFmModel tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnafm') model = RnaFmModel.from_pretrained('multimolecule/rnafm') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') output = model(**input) ``` #### Sequence Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression. Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaFmForSequencePrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnafm') model = RnaFmForSequencePrediction.from_pretrained('multimolecule/rnafm') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.tensor([1]) output = model(**input, labels=label) ``` #### Nucleotide Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression. Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaFmForNucleotidePrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnafm') model = RnaFmForNucleotidePrediction.from_pretrained('multimolecule/rnafm') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.randint(2, (len(text), )) output = model(**input, labels=label) ``` #### Contact Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression. Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaFmForContactPrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnafm') model = RnaFmForContactPrediction.from_pretrained('multimolecule/rnafm') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.randint(2, (len(text), len(text))) output = model(**input, labels=label) ``` ## Training Details RNA-FM used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling. ### Training Data The RNA-FM model was pre-trained on [RNAcentral](https://rnacentral.org). RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 27 million RNA sequences in total. RNA-FM applied [CD-HIT (CD-HIT-EST)](https://sites.google.com/view/cd-hit) with a cut-off at 100% sequence identity to remove redundancy from the RNAcentral. The final dataset contains 23.7 million non-redundant RNA sequences. RNA-FM preprocessed all tokens by replacing "U"s with "T"s. Note that during model conversions, "T" is replaced with "U". [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`. ### Training Procedure #### Preprocessing RNA-FM used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT: - 15% of the tokens are masked. - In 80% of the cases, the masked tokens are replaced by `<mask>`. - In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace. - In the 10% remaining cases, the masked tokens are left as is. #### PreTraining The model was trained on 8 NVIDIA A100 GPUs with 80GiB memories. - Learning rate: 1e-4 - Weight decay: 0.01 - Learning rate scheduler: inverse square root - Learning rate warm-up: 10,000 steps ## Citation **BibTeX**: ```bibtex @article{chen2022interpretable, title={Interpretable rna foundation model from unannotated data for highly accurate rna structure and function predictions}, author={Chen, Jiayang and Hu, Zhihang and Sun, Siqi and Tan, Qingxiong and Wang, Yixuan and Yu, Qinze and Zong, Licheng and Hong, Liang and Xiao, Jin and King, Irwin and others}, journal={arXiv preprint arXiv:2204.00300}, year={2022} } ``` ## Contact Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card. Please contact the authors of the [RNA-FM paper](https://doi.org/10.1101/2022.08.06.503062) for questions or comments on the paper/model. ## License This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html). ```spdx SPDX-License-Identifier: AGPL-3.0-or-later ```
bethea/dialogue-samsum
bethea
2024-07-02T10:12:37Z
0
0
transformers
[ "transformers", "tensorboard", "safetensors", "bart", "text2text-generation", "generated_from_trainer", "dataset:samsum", "base_model:facebook/bart-base", "license:apache-2.0", "model-index", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text2text-generation
2024-07-02T10:12:07Z
--- license: apache-2.0 base_model: facebook/bart-base tags: - generated_from_trainer datasets: - samsum metrics: - rouge model-index: - name: dialogue-samsum results: - task: name: Sequence-to-sequence Language Modeling type: text2text-generation dataset: name: samsum type: samsum config: samsum split: validation args: samsum metrics: - name: Rouge1 type: rouge value: 48.0133 --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # dialogue-samsum This model is a fine-tuned version of [facebook/bart-base](https://huggingface.co/facebook/bart-base) on the samsum dataset. It achieves the following results on the evaluation set: - Loss: 0.3249 - Rouge1: 48.0133 - Rouge2: 24.9057 - Rougel: 40.6842 - Rougelsum: 40.6602 - Gen Len: 18.2384 ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 2e-05 - train_batch_size: 4 - eval_batch_size: 4 - seed: 42 - gradient_accumulation_steps: 2 - total_train_batch_size: 8 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - num_epochs: 3 - mixed_precision_training: Native AMP ### Training results | Training Loss | Epoch | Step | Validation Loss | Rouge1 | Rouge2 | Rougel | Rougelsum | Gen Len | |:-------------:|:------:|:----:|:---------------:|:-------:|:-------:|:-------:|:---------:|:-------:| | 0.3968 | 0.9997 | 1841 | 0.3374 | 47.4452 | 24.2213 | 40.0832 | 40.024 | 18.3875 | | 0.3432 | 2.0 | 3683 | 0.3270 | 47.721 | 24.8189 | 40.4846 | 40.4736 | 18.143 | | 0.324 | 2.9992 | 5523 | 0.3249 | 48.0133 | 24.9057 | 40.6842 | 40.6602 | 18.2384 | ### Framework versions - Transformers 4.41.2 - Pytorch 2.3.0+cu121 - Datasets 2.20.0 - Tokenizers 0.19.1
multimolecule/mrnafm
multimolecule
2024-07-02T10:17:11Z
0
0
multimolecule
[ "multimolecule", "pytorch", "safetensors", "rnafm", "Biology", "RNA", "fill-mask", "rna", "dataset:multimolecule/rnacentral", "license:agpl-3.0", "region:us" ]
fill-mask
2024-07-02T10:12:14Z
--- language: rna tags: - Biology - RNA license: agpl-3.0 datasets: - multimolecule/rnacentral library_name: multimolecule pipeline_tag: fill-mask mask_token: "<mask>" widget: - example_title: "PRNP" text: "CTG<mask>AAGCGGCCCACGCGGACTGACGGGCGGGGG" output: - label: "GAG" score: 0.09500275552272797 - label: "GGC" score: 0.09362148493528366 - label: "AAG" score: 0.07337076216936111 - label: "GAC" score: 0.07307938486337662 - label: "GUG" score: 0.06616155058145523 --- # mRNA-FM Pre-trained model on mRNA CoDing Sequence (CDS) using a masked language modeling (MLM) objective. ## Disclaimer This is an UNOFFICIAL implementation of the [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062) by Jiayang Chen, Zhihang Hue, Siqi Sun, et al. The OFFICIAL repository of RNA-FM is at [ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM). !!! Success "Reproducibility" The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation. **The team releasing RNA-FM did not write this model card for this model so this model card has been written by the MultiMolecule team.** ## Model Details RNA-FM is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process. ### Variations - **[`multimolecule/rnafm`](https://huggingface.co/multimolecule/rnafm)**: The RNA-FM model pre-trained on non-coding RNA sequences. - **[`multimolecule/mrnafm`](https://huggingface.co/multimolecule/mrnafm)**: The RNA-FM model pre-trained on mRNA coding sequences. ### Model Specification <table> <thead> <tr> <th>Variants</th> <th>Num Layers</th> <th>Hidden Size</th> <th>Num Heads</th> <th>Intermediate Size</th> <th>Num Parameters (M)</th> <th>FLOPs (G)</th> <th>MACs (G)</th> <th>Max Num Tokens</th> </tr> </thead> <tbody> <tr> <td>RNA-FM</td> <td rowspan="2">12</td> <td>640</td> <td rowspan="2">20</td> <td rowspan="2">5120</td> <td>99.52</td> <td>25.68</td> <td>12.83</td> <td rowspan="2">1024</td> </tr> <tr> <td>mRNA-FM</td> <td>1280</td> <td>239.25</td> <td>61.43</td> <td>30.7</td> </tr> </tbody> </table> ### Links - **Code**: [multimolecule.rnafm](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnafm) - **Data**: [RNAcentral](https://rnacentral.org) - **Paper**: [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062) - **Developed by**: Jiayang Chen, Zhihang Hu, Siqi Sun, Qingxiong Tan, Yixuan Wang, Qinze Yu, Licheng Zong, Liang Hong, Jin Xiao, Tao Shen, Irwin King, Yu Li - **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ESM](https://huggingface.co/facebook/esm2_t48_15B_UR50D) - **Original Repository**: [https://github.com/ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM) ## Usage The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip: ```bash pip install multimolecule ``` ### Direct Use You can use this model directly with a pipeline for masked language modeling: ```python >>> import multimolecule # you must import multimolecule to register models >>> from transformers import pipeline >>> unmasker = pipeline('fill-mask', model='multimolecule/mrnafm') >>> unmasker("ctg<mask>aagcggcccacgcggactgacgggcggggg") [{'score': 0.09500275552272797, 'token': 58, 'token_str': 'GAG', 'sequence': 'CUG GAG AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'}, {'score': 0.09362148493528366, 'token': 67, 'token_str': 'GGC', 'sequence': 'CUG GGC AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'}, {'score': 0.07337076216936111, 'token': 8, 'token_str': 'AAG', 'sequence': 'CUG AAG AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'}, {'score': 0.07307938486337662, 'token': 57, 'token_str': 'GAC', 'sequence': 'CUG GAC AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'}, {'score': 0.06616155058145523, 'token': 73, 'token_str': 'GUG', 'sequence': 'CUG GUG AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'}] ``` ### Downstream Use #### Extract Features Here is how to use this model to get the features of a given sequence in PyTorch: ```python from multimolecule import RnaTokenizer, RnaFmModel tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm') model = RnaFmModel.from_pretrained('multimolecule/mrnafm') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') output = model(**input) ``` #### Sequence Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression. Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaFmForSequencePrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm') model = RnaFmForSequencePrediction.from_pretrained('multimolecule/mrnafm') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.tensor([1]) output = model(**input, labels=label) ``` #### Nucleotide Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression. Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaFmForNucleotidePrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm') model = RnaFmForNucleotidePrediction.from_pretrained('multimolecule/mrnafm') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.randint(2, (len(text), )) output = model(**input, labels=label) ``` #### Contact Classification / Regression **Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression. Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RnaFmForContactPrediction tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm') model = RnaFmForContactPrediction.from_pretrained('multimolecule/mrnafm') text = "UAGCUUAUCAGACUGAUGUUGA" input = tokenizer(text, return_tensors='pt') label = torch.randint(2, (len(text), len(text))) output = model(**input, labels=label) ``` ## Training Details RNA-FM used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling. ### Training Data The RNA-FM model was pre-trained on [RNAcentral](https://rnacentral.org). RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 27 million RNA sequences in total. RNA-FM applied [CD-HIT (CD-HIT-EST)](https://sites.google.com/view/cd-hit) with a cut-off at 100% sequence identity to remove redundancy from the RNAcentral. The final dataset contains 23.7 million non-redundant RNA sequences. RNA-FM preprocessed all tokens by replacing "U"s with "T"s. Note that during model conversions, "T" is replaced with "U". [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`. ### Training Procedure #### Preprocessing RNA-FM used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT: - 15% of the tokens are masked. - In 80% of the cases, the masked tokens are replaced by `<mask>`. - In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace. - In the 10% remaining cases, the masked tokens are left as is. #### PreTraining The model was trained on 8 NVIDIA A100 GPUs with 80GiB memories. - Learning rate: 1e-4 - Weight decay: 0.01 - Learning rate scheduler: inverse square root - Learning rate warm-up: 10,000 steps ## Citation **BibTeX**: ```bibtex @article{chen2022interpretable, title={Interpretable rna foundation model from unannotated data for highly accurate rna structure and function predictions}, author={Chen, Jiayang and Hu, Zhihang and Sun, Siqi and Tan, Qingxiong and Wang, Yixuan and Yu, Qinze and Zong, Licheng and Hong, Liang and Xiao, Jin and King, Irwin and others}, journal={arXiv preprint arXiv:2204.00300}, year={2022} } ``` ## Contact Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card. Please contact the authors of the [RNA-FM paper](https://doi.org/10.1101/2022.08.06.503062) for questions or comments on the paper/model. ## License This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html). ```spdx SPDX-License-Identifier: AGPL-3.0-or-later ```
nerualdreming/model_of_shame
nerualdreming
2024-07-02T10:25:25Z
0
0
diffusers
[ "diffusers", "safetensors", "license:unknown", "region:us" ]
null
2024-07-02T10:12:47Z
--- license: unknown ---
BobbBuilder/openai-whisper-tiny.en
BobbBuilder
2024-07-02T10:13:40Z
0
0
transformers
[ "transformers", "safetensors", "arxiv:1910.09700", "endpoints_compatible", "region:us" ]
null
2024-07-02T10:13:39Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
nttaii/run_20240702171328
nttaii
2024-07-02T10:13:46Z
0
0
null
[ "region:us" ]
null
2024-07-02T10:13:46Z
Invalid username or password.
Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF
Bakanayatsu
2024-07-02T10:14:26Z
0
0
null
[ "gguf", "llama-cpp", "gguf-my-repo", "text-generation", "en", "dataset:openbmb/UltraFeedback", "base_model:UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3", "license:gemma", "region:us" ]
text-generation
2024-07-02T10:13:52Z
--- base_model: UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3 datasets: - openbmb/UltraFeedback language: - en license: gemma pipeline_tag: text-generation tags: - llama-cpp - gguf-my-repo --- # Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF This model was converted to GGUF format from [`UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3`](https://huggingface.co/UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3) using llama.cpp via the ggml.ai's [GGUF-my-repo](https://huggingface.co/spaces/ggml-org/gguf-my-repo) space. Refer to the [original model card](https://huggingface.co/UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3) for more details on the model. ## Use with llama.cpp Install llama.cpp through brew (works on Mac and Linux) ```bash brew install llama.cpp ``` Invoke the llama.cpp server or the CLI. ### CLI: ```bash llama-cli --hf-repo Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF --hf-file gemma-2-9b-it-sppo-iter3-q5_k_m-imat.gguf -p "The meaning to life and the universe is" ``` ### Server: ```bash llama-server --hf-repo Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF --hf-file gemma-2-9b-it-sppo-iter3-q5_k_m-imat.gguf -c 2048 ``` Note: You can also use this checkpoint directly through the [usage steps](https://github.com/ggerganov/llama.cpp?tab=readme-ov-file#usage) listed in the Llama.cpp repo as well. Step 1: Clone llama.cpp from GitHub. ``` git clone https://github.com/ggerganov/llama.cpp ``` Step 2: Move into the llama.cpp folder and build it with `LLAMA_CURL=1` flag along with other hardware-specific flags (for ex: LLAMA_CUDA=1 for Nvidia GPUs on Linux). ``` cd llama.cpp && LLAMA_CURL=1 make ``` Step 3: Run inference through the main binary. ``` ./llama-cli --hf-repo Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF --hf-file gemma-2-9b-it-sppo-iter3-q5_k_m-imat.gguf -p "The meaning to life and the universe is" ``` or ``` ./llama-server --hf-repo Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF --hf-file gemma-2-9b-it-sppo-iter3-q5_k_m-imat.gguf -c 2048 ```
Makkoen/whisper-medium.en-cit-do015-wd0-lr1e-06-1000
Makkoen
2024-07-02T12:16:19Z
0
0
transformers
[ "transformers", "tensorboard", "safetensors", "whisper", "automatic-speech-recognition", "generated_from_trainer", "en", "base_model:openai/whisper-medium.en", "license:apache-2.0", "endpoints_compatible", "region:us" ]
automatic-speech-recognition
2024-07-02T10:14:04Z
--- language: - en license: apache-2.0 base_model: openai/whisper-medium.en tags: - generated_from_trainer metrics: - wer model-index: - name: ./openai/whisper-medium.en-cit-do015-wd0-lr1e-06-1000 results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # ./openai/whisper-medium.en-cit-do015-wd0-lr1e-06-1000 This model is a fine-tuned version of [openai/whisper-medium.en](https://huggingface.co/openai/whisper-medium.en) on the SF 1000 dataset. It achieves the following results on the evaluation set: - Loss: 0.6953 - Wer Ortho: 26.2768 - Wer: 14.7572 ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 1e-06 - train_batch_size: 4 - eval_batch_size: 8 - seed: 42 - distributed_type: multi-GPU - gradient_accumulation_steps: 4 - total_train_batch_size: 16 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - lr_scheduler_warmup_steps: 100 - training_steps: 500 - mixed_precision_training: Native AMP ### Training results | Training Loss | Epoch | Step | Validation Loss | Wer Ortho | Wer | |:-------------:|:------:|:----:|:---------------:|:---------:|:-------:| | No log | 0.4444 | 25 | 1.5811 | 45.2632 | 31.9044 | | 1.7463 | 0.8889 | 50 | 1.3848 | 39.1033 | 27.0106 | | 1.7463 | 1.3333 | 75 | 1.2178 | 35.7505 | 23.0273 | | 1.3387 | 1.7778 | 100 | 1.0166 | 36.1014 | 23.4446 | | 1.3387 | 2.2222 | 125 | 0.8784 | 31.9298 | 19.1958 | | 0.988 | 2.6667 | 150 | 0.8340 | 30.8382 | 18.4750 | | 0.988 | 3.1111 | 175 | 0.8027 | 30.3314 | 17.7162 | | 0.8856 | 3.5556 | 200 | 0.7812 | 29.6686 | 17.4127 | | 0.8856 | 4.0 | 225 | 0.7651 | 30.1365 | 17.6783 | | 0.7927 | 4.4444 | 250 | 0.7515 | 29.2008 | 16.8816 | | 0.7927 | 4.8889 | 275 | 0.7402 | 28.2651 | 15.6677 | | 0.7482 | 5.3333 | 300 | 0.7300 | 27.9922 | 15.5159 | | 0.7482 | 5.7778 | 325 | 0.7217 | 27.8752 | 15.6677 | | 0.7275 | 6.2222 | 350 | 0.7153 | 27.4854 | 15.4021 | | 0.7275 | 6.6667 | 375 | 0.7085 | 27.3684 | 15.3642 | | 0.7003 | 7.1111 | 400 | 0.7041 | 26.6277 | 14.6813 | | 0.7003 | 7.5556 | 425 | 0.7002 | 26.3158 | 14.7572 | | 0.6763 | 8.0 | 450 | 0.6973 | 26.2378 | 14.6055 | | 0.6763 | 8.4444 | 475 | 0.6963 | 26.4327 | 14.7951 | | 0.6687 | 8.8889 | 500 | 0.6953 | 26.2768 | 14.7572 | ### Framework versions - Transformers 4.42.3 - Pytorch 1.13.1+cu117 - Datasets 2.20.0 - Tokenizers 0.19.1
aks1s/13-flow-2
aks1s
2024-07-02T10:14:57Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T10:14:12Z
Entry not found
finn03091993/naschainv248
finn03091993
2024-07-02T10:14:55Z
0
0
null
[ "region:us" ]
null
2024-07-02T10:14:53Z
Entry not found
nttaii/run_20240702171623
nttaii
2024-07-02T10:16:23Z
0
0
null
[ "region:us" ]
null
2024-07-02T10:16:23Z
Invalid username or password.
Peacoc/37_best_t_16_5
Peacoc
2024-07-02T10:18:38Z
0
0
transformers
[ "transformers", "safetensors", "llama", "text-generation", "arxiv:1910.09700", "autotrain_compatible", "endpoints_compatible", "text-generation-inference", "region:us" ]
text-generation
2024-07-02T10:16:27Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
fastinom/Ndebele_ASR
fastinom
2024-07-02T15:26:29Z
0
0
transformers
[ "transformers", "tensorboard", "safetensors", "wav2vec2", "automatic-speech-recognition", "arxiv:1910.09700", "endpoints_compatible", "region:us" ]
automatic-speech-recognition
2024-07-02T10:16:46Z
--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]
aks1s/14-flow-2
aks1s
2024-07-02T10:18:19Z
0
0
transformers
[ "transformers", "safetensors", "stablelm", "text-generation", "autotrain_compatible", "endpoints_compatible", "region:us" ]
text-generation
2024-07-02T10:17:34Z
Entry not found