modelId
stringlengths 5
122
| author
stringlengths 2
42
| last_modified
timestamp[us, tz=UTC] | downloads
int64 0
738M
| likes
int64 0
11k
| library_name
stringclasses 245
values | tags
listlengths 1
4.05k
| pipeline_tag
stringclasses 48
values | createdAt
timestamp[us, tz=UTC] | card
stringlengths 1
901k
|
---|---|---|---|---|---|---|---|---|---|
baxtos/bartik13-4
|
baxtos
| 2024-07-02T09:33:22Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:31:00Z |
Entry not found
|
YuChingLin/Taiwan-Llama-70B
|
YuChingLin
| 2024-07-02T10:17:36Z | 0 | 0 | null |
[
"gguf",
"license:apache-2.0",
"region:us"
] | null | 2024-07-02T09:31:26Z |
Temporary Redirect. Redirecting to /YuChingLin/Taiwan-Llama3-70B-Instruct/resolve/main/README.md
|
Chonlasitk/whisper-small-hi
|
Chonlasitk
| 2024-07-02T10:29:07Z | 0 | 0 |
transformers
|
[
"transformers",
"tensorboard",
"safetensors",
"whisper",
"automatic-speech-recognition",
"generated_from_trainer",
"hi",
"dataset:mozilla-foundation/common_voice_11_0",
"base_model:openai/whisper-small",
"license:apache-2.0",
"model-index",
"endpoints_compatible",
"region:us"
] |
automatic-speech-recognition
| 2024-07-02T09:31:34Z |
---
language:
- hi
license: apache-2.0
base_model: openai/whisper-small
tags:
- generated_from_trainer
datasets:
- mozilla-foundation/common_voice_11_0
metrics:
- wer
model-index:
- name: Whisper Small Hi - Sanchit Gandhi
results:
- task:
name: Automatic Speech Recognition
type: automatic-speech-recognition
dataset:
name: Common Voice 11.0
type: mozilla-foundation/common_voice_11_0
config: hi
split: None
args: 'config: hi, split: test'
metrics:
- name: Wer
type: wer
value: 37.175146025565056
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# Whisper Small Hi - Sanchit Gandhi
This model is a fine-tuned version of [openai/whisper-small](https://huggingface.co/openai/whisper-small) on the Common Voice 11.0 dataset.
It achieves the following results on the evaluation set:
- Loss: 0.3016
- Wer: 37.1751
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 1e-05
- train_batch_size: 5
- eval_batch_size: 5
- seed: 42
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- lr_scheduler_warmup_steps: 500
- training_steps: 1000
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Wer |
|:-------------:|:------:|:----:|:---------------:|:-------:|
| 0.2063 | 0.7645 | 1000 | 0.3016 | 37.1751 |
### Framework versions
- Transformers 4.41.2
- Pytorch 2.3.0+cu121
- Datasets 2.20.0
- Tokenizers 0.19.1
|
MarcoGr/q-FrozenLake-v1-4x4-noSlippery
|
MarcoGr
| 2024-07-02T09:31:35Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:31:35Z |
Entry not found
|
MarcoGr/Taxi_v3
|
MarcoGr
| 2024-07-02T09:31:54Z | 0 | 0 | null |
[
"Taxi-v3",
"q-learning",
"reinforcement-learning",
"custom-implementation",
"model-index",
"region:us"
] |
reinforcement-learning
| 2024-07-02T09:31:50Z |
---
tags:
- Taxi-v3
- q-learning
- reinforcement-learning
- custom-implementation
model-index:
- name: Taxi_v3
results:
- task:
type: reinforcement-learning
name: reinforcement-learning
dataset:
name: Taxi-v3
type: Taxi-v3
metrics:
- type: mean_reward
value: 7.54 +/- 2.74
name: mean_reward
verified: false
---
# **Q-Learning** Agent playing1 **Taxi-v3**
This is a trained model of a **Q-Learning** agent playing **Taxi-v3** .
## Usage
```python
model = load_from_hub(repo_id="MarcoGr/Taxi_v3", filename="q-learning.pkl")
# Don't forget to check if you need to add additional attributes (is_slippery=False etc)
env = gym.make(model["env_id"])
```
|
Ahmedelagamy/base_hive
|
Ahmedelagamy
| 2024-07-02T09:32:20Z | 0 | 0 | null |
[
"license:mit",
"region:us"
] | null | 2024-07-02T09:32:20Z |
---
license: mit
---
|
woransa/mistral-7B-slerp
|
woransa
| 2024-07-02T09:36:54Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"mistral",
"text-generation",
"merge",
"mergekit",
"lazymergekit",
"OpenPipe/mistral-ft-optimized-1218",
"mlabonne/NeuralHermes-2.5-Mistral-7B",
"base_model:OpenPipe/mistral-ft-optimized-1218",
"base_model:mlabonne/NeuralHermes-2.5-Mistral-7B",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T09:33:05Z |
---
base_model:
- OpenPipe/mistral-ft-optimized-1218
- mlabonne/NeuralHermes-2.5-Mistral-7B
tags:
- merge
- mergekit
- lazymergekit
- OpenPipe/mistral-ft-optimized-1218
- mlabonne/NeuralHermes-2.5-Mistral-7B
---
# mistral-7B-slerp
mistral-7B-slerp is a merge of the following models using [LazyMergekit](https://colab.research.google.com/drive/1obulZ1ROXHjYLn6PPZJwRR6GzgQogxxb?usp=sharing):
* [OpenPipe/mistral-ft-optimized-1218](https://huggingface.co/OpenPipe/mistral-ft-optimized-1218)
* [mlabonne/NeuralHermes-2.5-Mistral-7B](https://huggingface.co/mlabonne/NeuralHermes-2.5-Mistral-7B)
## 🧩 Configuration
```yaml
slices:
- sources:
- model: OpenPipe/mistral-ft-optimized-1218
layer_range: [0, 32]
- model: mlabonne/NeuralHermes-2.5-Mistral-7B
layer_range: [0, 32]
merge_method: slerp
base_model: OpenPipe/mistral-ft-optimized-1218
parameters:
t:
- filter: self_attn
value: [0, 0.5, 0.3, 0.7, 1]
- filter: mlp
value: [1, 0.5, 0.7, 0.3, 0]
- value: 0.5
dtype: bfloat16
```
## 💻 Usage
```python
!pip install -qU transformers accelerate
from transformers import AutoTokenizer
import transformers
import torch
model = "woransa/mistral-7B-slerp"
messages = [{"role": "user", "content": "What is a large language model?"}]
tokenizer = AutoTokenizer.from_pretrained(model)
prompt = tokenizer.apply_chat_template(messages, tokenize=False, add_generation_prompt=True)
pipeline = transformers.pipeline(
"text-generation",
model=model,
torch_dtype=torch.float16,
device_map="auto",
)
outputs = pipeline(prompt, max_new_tokens=256, do_sample=True, temperature=0.7, top_k=50, top_p=0.95)
print(outputs[0]["generated_text"])
```
|
wieheistdu/squad2-trained-ep4-batch16-finetuned-squad2-emrQA-msquad
|
wieheistdu
| 2024-07-02T11:34:02Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"distilbert",
"question-answering",
"endpoints_compatible",
"region:us"
] |
question-answering
| 2024-07-02T09:33:25Z |
---
tags:
- generated_from_trainer
model-index:
- name: squad2-trained-ep4-batch16-finetuned-squad2-emrQA-msquad
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# squad2-trained-ep4-batch16-finetuned-squad2-emrQA-msquad
This model was trained from scratch on an unknown dataset.
It achieves the following results on the evaluation set:
- Loss: 0.0319
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 32
- eval_batch_size: 32
- seed: 42
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- num_epochs: 3
### Training results
| Training Loss | Epoch | Step | Validation Loss |
|:-------------:|:-----:|:-----:|:---------------:|
| 0.2089 | 1.0 | 7836 | 0.1292 |
| 0.077 | 2.0 | 15672 | 0.0484 |
| 0.0357 | 3.0 | 23508 | 0.0319 |
### Framework versions
- Transformers 4.41.2
- Pytorch 1.13.1+cu116
- Datasets 2.19.2
- Tokenizers 0.19.1
|
finn03091993/naschainv122
|
finn03091993
| 2024-07-02T09:34:33Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:34:31Z |
Entry not found
|
multimolecule/rnabert
|
multimolecule
| 2024-07-02T09:35:33Z | 0 | 0 |
multimolecule
|
[
"multimolecule",
"pytorch",
"safetensors",
"rnabert",
"Biology",
"RNA",
"fill-mask",
"rna",
"dataset:multimolecule/rnacentral",
"license:agpl-3.0",
"region:us"
] |
fill-mask
| 2024-07-02T09:35:29Z |
---
language: rna
tags:
- Biology
- RNA
license: agpl-3.0
datasets:
- multimolecule/rnacentral
library_name: multimolecule
pipeline_tag: fill-mask
mask_token: "<mask>"
widget:
- example_title: "microRNA-21"
text: "UAGC<mask>UAUCAGACUGAUGUUGA"
output:
- label: "<null>"
score: 0.038491372019052505
- label: "."
score: 0.03848646208643913
- label: "<pad>"
score: 0.03846566751599312
- label: "U"
score: 0.03846472129225731
- label: "W"
score: 0.03846454620361328
---
# RNABERT
Pre-trained model on non-coding RNA (ncRNA) using masked language modeling (MLM) and structural alignment learning (SAL) objectives.
## Disclaimer
This is an UNOFFICIAL implementation of the [Informative RNA-base embedding for functional RNA clustering and structural alignment](https://doi.org/10.1093/nargab/lqac012) by Manato Akiyama and Yasubumi Sakakibara.
The OFFICIAL repository of RNABERT is at [mana438/RNABERT](https://github.com/mana438/RNABERT).
!!! Bug "Reproducibility"
The MultiMolecule team is aware of a potential risk in reproducing the results of RNABERT.
The original implementation of RNABERT does not prepend `<cls>` and append `<eos>` tokens to the input sequence.
This may lead to unexpected results when using the model.
!!! Success "Reproducibility"
The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing RNABERT did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
RNABERT is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
### Model Specification
| Num Layers | Hidden Size | Num Heads | Intermediate Size | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens |
| ---------- | ----------- | --------- | ----------------- | ------------------ | --------- | -------- | -------------- |
| 6 | 120 | 12 | 40 | 0.48 | 0.15 | 0.08 | 440 |
### Links
- **Code**: [multimolecule.rnabert](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnabert)
- **Weights**: [multimolecule/rnabert](https://huggingface.co/multimolecule/rnabert)
- **Data**: [RNAcentral](https://rnacentral.org)
- **Paper**: [Informative RNA-base embedding for functional RNA clustering and structural alignment](https://doi.org/10.1093/nargab/lqac012)
- **Developed by**: JManato Akiyama and Yasubumi Sakakibara
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased)
- **Original Repository**: [https://github.com/mana438/RNABERT](https://github.com/mana438/RNABERT)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
You can use this model directly with a pipeline for masked language modeling:
```python
>>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> unmasker = pipeline('fill-mask', model='multimolecule/rnabert')
>>> unmasker("uagc<mask>uaucagacugauguuga")
[{'score': 0.038491372019052505,
'token': 5,
'token_str': '<null>',
'sequence': 'U A G C U A U C A G A C U G A U G U U G A'},
{'score': 0.03848646208643913,
'token': 23,
'token_str': '.',
'sequence': 'U A G C. U A U C A G A C U G A U G U U G A'},
{'score': 0.03846566751599312,
'token': 0,
'token_str': '<pad>',
'sequence': 'U A G C U A U C A G A C U G A U G U U G A'},
{'score': 0.03846472129225731,
'token': 9,
'token_str': 'U',
'sequence': 'U A G C U U A U C A G A C U G A U G U U G A'},
{'score': 0.03846454620361328,
'token': 19,
'token_str': 'W',
'sequence': 'U A G C W U A U C A G A C U G A U G U U G A'}]
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, RnaBertModel
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnabert')
model = RnaBertModel.from_pretrained('multimolecule/rnabert')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
output = model(**input)
```
#### Sequence Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaBertForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnabert')
model = RnaBertForSequencePrediction.from_pretrained('multimolecule/rnabert')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Nucleotide Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaBertForNucleotidePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnabert')
model = RnaBertForNucleotidePrediction.from_pretrained('multimolecule/rnabert')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaBertForContactPrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnabert')
model = RnaBertForContactPrediction.from_pretrained('multimolecule/rnabert')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
RNABERT has two pre-training objectives: masked language modeling (MLM) and structural alignment learning (SAL).
- **Masked Language Modeling (MLM)**: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
- **Structural Alignment Learning (SAL)**: the model learns to predict the structural alignment of two RNA sequences. The model is trained to predict the alignment score of two RNA sequences using the Needleman-Wunsch algorithm.
### Training Data
The RNABERT model was pre-trained on [RNAcentral](https://rnacentral.org). RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 27 million RNA sequences in total. RNABERT used a subset of 76, 237 human ncRNA sequences from RNAcentral for pre-training.
RNABERT preprocessed all tokens by replacing "U"s with "T"s.
Note that during model conversions, "T" is replaced with "U". [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`.
### Training Procedure
#### Preprocessing
RNABERT preprocess the dataset by applying 10 different mask patterns to the 72, 237 human ncRNA sequences. The final dataset contains 722, 370 sequences. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### PreTraining
The model was trained on 1 NVIDIA V100 GPU.
## Citation
**BibTeX**:
```bibtex
@article{akiyama2022informative,
author = {Akiyama, Manato and Sakakibara, Yasubumi},
title = "{Informative RNA base embedding for RNA structural alignment and clustering by deep representation learning}",
journal = {NAR Genomics and Bioinformatics},
volume = {4},
number = {1},
pages = {lqac012},
year = {2022},
month = {02},
abstract = "{Effective embedding is actively conducted by applying deep learning to biomolecular information. Obtaining better embeddings enhances the quality of downstream analyses, such as DNA sequence motif detection and protein function prediction. In this study, we adopt a pre-training algorithm for the effective embedding of RNA bases to acquire semantically rich representations and apply this algorithm to two fundamental RNA sequence problems: structural alignment and clustering. By using the pre-training algorithm to embed the four bases of RNA in a position-dependent manner using a large number of RNA sequences from various RNA families, a context-sensitive embedding representation is obtained. As a result, not only base information but also secondary structure and context information of RNA sequences are embedded for each base. We call this ‘informative base embedding’ and use it to achieve accuracies superior to those of existing state-of-the-art methods on RNA structural alignment and RNA family clustering tasks. Furthermore, upon performing RNA sequence alignment by combining this informative base embedding with a simple Needleman–Wunsch alignment algorithm, we succeed in calculating structural alignments with a time complexity of O(n2) instead of the O(n6) time complexity of the naive implementation of Sankoff-style algorithm for input RNA sequence of length n.}",
issn = {2631-9268},
doi = {10.1093/nargab/lqac012},
url = {https://doi.org/10.1093/nargab/lqac012},
eprint = {https://academic.oup.com/nargab/article-pdf/4/1/lqac012/42577168/lqac012.pdf},
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [RNABERT paper](https://doi.org/10.1093/nargab/lqac012) for questions or comments on the paper/model.
## License
This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
```
|
multimolecule/rnaernie
|
multimolecule
| 2024-07-02T09:37:57Z | 0 | 0 |
multimolecule
|
[
"multimolecule",
"pytorch",
"safetensors",
"rnaernie",
"Biology",
"RNA",
"fill-mask",
"rna",
"dataset:multimolecule/rnacentral",
"license:agpl-3.0",
"region:us"
] |
fill-mask
| 2024-07-02T09:35:41Z |
---
language: rna
tags:
- Biology
- RNA
license: agpl-3.0
datasets:
- multimolecule/rnacentral
library_name: multimolecule
pipeline_tag: fill-mask
mask_token: "<mask>"
widget:
- example_title: "microRNA-21"
text: "UAGC<mask>UAUCAGACUGAUGUUGA"
output:
- label: "G"
score: 0.10253211855888367
- label: "R"
score: 0.09673436731100082
- label: "A"
score: 0.09126435220241547
- label: "V"
score: 0.08036787807941437
- label: "S"
score: 0.07541776448488235
---
# RNAErnie
Pre-trained model on non-coding RNA (ncRNA) using a multi-stage masked language modeling (MLM) objective.
## Statement
_Multi-purpose RNA language modelling with motif-aware pretraining and type-guided fine-tuning_ is published in [Nature Machine Intelligence](https://doi.org/10.1038/s42256-024-00836-4), which is a Closed Access / Author-Fee journal.
> Machine learning has been at the forefront of the movement for free and open access to research.
>
> We see no role for closed access or author-fee publication in the future of machine learning research and believe the adoption of these journals as an outlet of record for the machine learning community would be a retrograde step.
The MultiMolecule team is committed to the principles of open access and open science.
We do NOT endorse the publication of manuscripts in Closed Access / Author-Fee journals and encourage the community to support Open Access journals.
Please consider signing the [Statement on Nature Machine Intelligence](https://openaccess.engineering.oregonstate.edu).
## Disclaimer
This is an UNOFFICIAL implementation of the RNAErnie: An RNA Language Model with Structure-enhanced Representations by Ning Wang, Jiang Bian,
Haoyi Xiong, et al.
The OFFICIAL repository of RNAErnie is at [CatIIIIIIII/RNAErnie](https://github.com/CatIIIIIIII/RNAErnie).
!!! Danger "Reproducibility"
The MultiMolecule team is unable to confirm that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
This is because
The proposed method is published in a Closed Access / Author-Fee journal.
**The team releasing RNAErnie did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
RNAErnie is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
Note that during the conversion process, additional tokens such as `[IND]` and ncRNA class symbols are removed.
### Model Specification
| Num Layers | Hidden Size | Num Heads | Intermediate Size | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens |
| ---------- | ----------- | --------- | ----------------- | ------------------ | --------- | -------- | -------------- |
| 12 | 768 | 12 | 3072 | 86.06 | 22.36 | 11.17 | 512 |
### Links
- **Code**: [multimolecule.rnaernie](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnaernie)
- **Weights**: [`multimolecule/rnaernie`](https://huggingface.co/multimolecule/rnaernie)
- **Data**: [RNAcentral](https://rnacentral.org)
- **Paper**: Multi-purpose RNA language modelling with motif-aware pretraining and type-guided fine-tuning
- **Developed by**: Ning Wang, Jiang Bian, Yuchen Li, Xuhong Li, Shahid Mumtaz, Linghe Kong, Haoyi Xiong.
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ERNIE](https://huggingface.co/nghuyong/ernie-3.0-base-zh)
- **Original Repository**: [https://github.com/CatIIIIIIII/RNAErnie](https://github.com/CatIIIIIIII/RNAErnie)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
You can use this model directly with a pipeline for masked language modeling:
```python
>>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> unmasker = pipeline('fill-mask', model='multimolecule/rnaernie')
>>> unmasker("uagc<mask>uaucagacugauguuga")
[{'score': 0.10253211855888367,
'token': 8,
'token_str': 'G',
'sequence': 'U A G C G U A U C A G A C U G A U G U U G A'},
{'score': 0.09673436731100082,
'token': 18,
'token_str': 'R',
'sequence': 'U A G C R U A U C A G A C U G A U G U U G A'},
{'score': 0.09126435220241547,
'token': 6,
'token_str': 'A',
'sequence': 'U A G C A U A U C A G A C U G A U G U U G A'},
{'score': 0.08036787807941437,
'token': 13,
'token_str': 'V',
'sequence': 'U A G C V U A U C A G A C U G A U G U U G A'},
{'score': 0.07541776448488235,
'token': 20,
'token_str': 'S',
'sequence': 'U A G C S U A U C A G A C U G A U G U U G A'}]
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, RnaErnieModel
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnaernie')
model = RnaErnieModel.from_pretrained('multimolecule/rnaernie')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
output = model(**input)
```
#### Sequence Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaErnieForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnaernie')
model = RnaErnieForSequencePrediction.from_pretrained('multimolecule/rnaernie')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Nucleotide Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaErnieForNucleotidePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnaernie')
model = RnaErnieForNucleotidePrediction.from_pretrained('multimolecule/rnaernie')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaErnieForContactPrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnaernie')
model = RnaErnieForContactPrediction.from_pretrained('multimolecule/rnaernie')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
RNAErnie used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
### Training Data
The RNAErnie model was pre-trained on [RNAcentral](https://rnacentral.org). RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 34 million RNA sequences in total.
RNAErnie used a subset of RNAcentral for pre-training. The subset contains 23 million sequences.
RNAErnie preprocessed all tokens by replacing "T"s with "S"s.
Note that [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`.
### Training Procedure
#### Preprocessing
RNAErnie used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### PreTraining
RNAErnie uses a special 3-stage training pipeline to pre-train the model, each with a different masking strategy:
Base-level Masking: The masking applies to each nucleotide in the sequence.
Subsequence-level Masking: The masking applies to subsequences of 4-8bp in the sequence.
Motif-level Masking: The model is trained on motif datasets.
The model was trained on 4 NVIDIA V100 GPUs with 32GiB memories.
- Batch size: 50
- Learning rate: 1e-4
- Weight decay: 0.01
- Optimizer: AdamW
- Steps: 2,580,000
- Learning rate warm-up: 129,000 steps
- Learning rate cool-down: 129,000 steps
- Minimum learning rate: 5e-5
## Citation
Citation information is not available for papers published in Closed Access / Author-Fee journals.
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the RNAErnie paper for questions or comments on the paper/model.
## License
This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
```
|
Sodiegs/Baoahah
|
Sodiegs
| 2024-07-02T09:36:16Z | 0 | 0 | null |
[
"license:apache-2.0",
"region:us"
] | null | 2024-07-02T09:36:16Z |
---
license: apache-2.0
---
|
Peacoc/37_best_t_13_2
|
Peacoc
| 2024-07-02T09:38:36Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"llama",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T09:36:31Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
baxtos/bartik14-4
|
baxtos
| 2024-07-02T09:39:09Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:36:50Z |
Entry not found
|
sskaishev/OITE_Models
|
sskaishev
| 2024-07-02T09:39:41Z | 0 | 0 |
keras
|
[
"keras",
"region:us"
] | null | 2024-07-02T09:36:56Z |
# Models used in OntoUML Image Taxonomy Extractor (OITE)
See: https://github.com/SimeonKaishev/OntoUML_IMG_Converter
---
license: apache-2.0
---
|
Temo27Anas/videomae-base-ft-2824
|
Temo27Anas
| 2024-07-02T09:36:57Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:36:57Z |
Entry not found
|
peterkros/immunization-classification-model
|
peterkros
| 2024-07-02T09:42:04Z | 0 | 0 |
transformers
|
[
"transformers",
"pytorch",
"distilbert",
"text-classification",
"arxiv:1910.09700",
"license:mit",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-classification
| 2024-07-02T09:37:07Z |
---
license: mit
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
This model is a part of the COFOG immunization budget expenditure project developed in UNICEF.
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
Model is based on DistilBERT and trainined on custom dataset with immunization budget expenditures from variuos countries.
- **Developed by:** Piotr Krosniak
- **Model type:** DistilBERT
- **Language(s) (NLP):** English
- **License:** MIT
- **Finetuned from model [optional]:** DistilBERT
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
misszzzzz/zzzzz
|
misszzzzz
| 2024-07-02T09:37:07Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:37:07Z |
Entry not found
|
CatBarks/flant5small-lora-oasst1_50_model
|
CatBarks
| 2024-07-02T09:37:30Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2024-07-02T09:37:27Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
CatBarks/flant5small-lora-oasst1_50_tokenizer
|
CatBarks
| 2024-07-02T09:37:33Z | 0 | 0 |
transformers
|
[
"transformers",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2024-07-02T09:37:30Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
jnsalxs/hyundai_web_data
|
jnsalxs
| 2024-07-02T10:01:01Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"text-generation-inference",
"unsloth",
"llama",
"trl",
"en",
"base_model:unsloth/llama-3-8b-bnb-4bit",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | null | 2024-07-02T09:37:44Z |
---
base_model: unsloth/llama-3-8b-bnb-4bit
language:
- en
license: apache-2.0
tags:
- text-generation-inference
- transformers
- unsloth
- llama
- trl
---
# Uploaded model
- **Developed by:** jnsalxs
- **License:** apache-2.0
- **Finetuned from model :** unsloth/llama-3-8b-bnb-4bit
This llama model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library.
[<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)
|
lielbin/BabyBERTa-aochildes-french-without-Masking-finetuned-run3-Fr-SQuAD
|
lielbin
| 2024-07-02T10:20:32Z | 0 | 0 |
transformers
|
[
"transformers",
"tensorboard",
"safetensors",
"roberta",
"question-answering",
"generated_from_trainer",
"endpoints_compatible",
"region:us"
] |
question-answering
| 2024-07-02T09:37:57Z |
---
tags:
- generated_from_trainer
model-index:
- name: BabyBERTa-aochildes-french-without-Masking-finetuned-run3-Fr-SQuAD
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# BabyBERTa-aochildes-french-without-Masking-finetuned-run3-Fr-SQuAD
This model was trained from scratch on the None dataset.
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 0.0001
- train_batch_size: 8
- eval_batch_size: 8
- seed: 42
- gradient_accumulation_steps: 2
- total_train_batch_size: 16
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- num_epochs: 3
- mixed_precision_training: Native AMP
### Training results
### Framework versions
- Transformers 4.37.2
- Pytorch 2.3.1+cu121
- Datasets 2.18.0
- Tokenizers 0.15.2
|
QuantFactory/Vistral-7B-Chat-GGUF
|
QuantFactory
| 2024-07-02T10:22:14Z | 0 | 0 | null |
[
"gguf",
"region:us"
] | null | 2024-07-02T09:38:26Z |
Entry not found
|
NAkketikker/some
|
NAkketikker
| 2024-07-02T09:38:49Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:38:49Z |
Entry not found
|
Labeeq/trained-sd3
|
Labeeq
| 2024-07-02T09:39:11Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:39:11Z |
Entry not found
|
chaeunl/textual_inversion_cat
|
chaeunl
| 2024-07-02T09:39:14Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:39:14Z |
Entry not found
|
indrapurnayasa/mistral_categorization_unsloth_q4
|
indrapurnayasa
| 2024-07-02T09:48:14Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"mistral",
"text-generation",
"text-generation-inference",
"unsloth",
"trl",
"sft",
"en",
"base_model:unsloth/mistral-7b-v0.3-bnb-4bit",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"4-bit",
"bitsandbytes",
"region:us"
] |
text-generation
| 2024-07-02T09:40:55Z |
---
base_model: unsloth/mistral-7b-v0.3-bnb-4bit
language:
- en
license: apache-2.0
tags:
- text-generation-inference
- transformers
- unsloth
- mistral
- trl
- sft
---
# Uploaded model
- **Developed by:** indrapurnayasa
- **License:** apache-2.0
- **Finetuned from model :** unsloth/mistral-7b-v0.3-bnb-4bit
This mistral model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library.
[<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)
|
ayush7/CBSE_Test_Science_unpacked_10_v0.1
|
ayush7
| 2024-07-02T11:25:56Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"phi3",
"text-generation",
"custom_code",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:41:02Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
aks1s/01-flow-2
|
aks1s
| 2024-07-02T09:42:01Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:41:07Z |
Entry not found
|
irusl/01ktm1
|
irusl
| 2024-07-02T09:44:03Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:41:30Z |
Entry not found
|
baxtos/bartik15-4
|
baxtos
| 2024-07-02T09:44:55Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:42:28Z |
Entry not found
|
WeDoLLMs/dpo_test_model
|
WeDoLLMs
| 2024-07-02T10:15:36Z | 0 | 0 |
peft
|
[
"peft",
"safetensors",
"arxiv:1910.09700",
"base_model:SeaLLMs/SeaLLM-7B-v2",
"region:us"
] | null | 2024-07-02T09:43:35Z |
---
base_model: SeaLLMs/SeaLLM-7B-v2
library_name: peft
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
### Framework versions
- PEFT 0.11.1
|
aks1s/02-flow-2
|
aks1s
| 2024-07-02T09:45:24Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:44:35Z |
Entry not found
|
akashAD/fb_zeroshot_mnli_onnx
|
akashAD
| 2024-07-02T09:46:33Z | 0 | 0 |
transformers
|
[
"transformers",
"onnx",
"bart",
"text-classification",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-classification
| 2024-07-02T09:45:28Z |
Entry not found
|
dctruepf/test
|
dctruepf
| 2024-07-02T09:45:38Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:45:38Z |
Entry not found
|
MrGonk/Gonk_1
|
MrGonk
| 2024-07-02T09:49:51Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"llama",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T09:46:12Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
shr1chan/LunarLander-v2
|
shr1chan
| 2024-07-02T10:26:13Z | 0 | 0 |
stable-baselines3
|
[
"stable-baselines3",
"LunarLander-v2",
"deep-reinforcement-learning",
"reinforcement-learning",
"model-index",
"region:us"
] |
reinforcement-learning
| 2024-07-02T09:46:49Z |
---
library_name: stable-baselines3
tags:
- LunarLander-v2
- deep-reinforcement-learning
- reinforcement-learning
- stable-baselines3
model-index:
- name: PPO
results:
- task:
type: reinforcement-learning
name: reinforcement-learning
dataset:
name: LunarLander-v2
type: LunarLander-v2
metrics:
- type: mean_reward
value: 267.51 +/- 17.03
name: mean_reward
verified: false
---
# **PPO** Agent playing **LunarLander-v2**
This is a trained model of a **PPO** agent playing **LunarLander-v2**
using the [stable-baselines3 library](https://github.com/DLR-RM/stable-baselines3).
## Usage (with Stable-baselines3)
TODO: Add your code
```python
from stable_baselines3 import ...
from huggingface_sb3 import load_from_hub
...
```
|
KasuleTrevor/test-10
|
KasuleTrevor
| 2024-07-02T10:37:02Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"wav2vec2",
"automatic-speech-recognition",
"generated_from_trainer",
"base_model:facebook/wav2vec2-xls-r-300m",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] |
automatic-speech-recognition
| 2024-07-02T09:46:49Z |
---
base_model: facebook/wav2vec2-xls-r-300m
license: apache-2.0
metrics:
- wer
tags:
- generated_from_trainer
model-index:
- name: test-10
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
[<img src="https://raw.githubusercontent.com/wandb/assets/main/wandb-github-badge-28.svg" alt="Visualize in Weights & Biases" width="200" height="32"/>](https://wandb.ai/asr-africa-research-team/ASR%20Africa/runs/2yoddo8f)
# test-10
This model is a fine-tuned version of [facebook/wav2vec2-xls-r-300m](https://huggingface.co/facebook/wav2vec2-xls-r-300m) on an unknown dataset.
It achieves the following results on the evaluation set:
- Loss: 16.7472
- Wer: 1.0
- Cer: 0.9840
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 0.0001
- train_batch_size: 32
- eval_batch_size: 8
- seed: 42
- gradient_accumulation_steps: 2
- total_train_batch_size: 64
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: cosine
- lr_scheduler_warmup_steps: 500
- num_epochs: 100
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Wer | Cer |
|:-------------:|:-----:|:----:|:---------------:|:---:|:------:|
| 15.9209 | 1.0 | 9 | 15.2863 | 1.0 | 0.9693 |
| 15.8262 | 2.0 | 18 | 15.1525 | 1.0 | 0.9718 |
| 15.5563 | 3.0 | 27 | 14.8407 | 1.0 | 0.9925 |
| 15.1897 | 4.0 | 36 | 14.2567 | 1.0 | 0.9962 |
| 14.4177 | 5.0 | 45 | 13.3192 | 1.0 | 1.0 |
| 12.5935 | 6.0 | 54 | 10.9618 | 1.0 | 1.0 |
| 9.6217 | 7.0 | 63 | 8.3098 | 1.0 | 1.0 |
| 7.3097 | 8.0 | 72 | 6.6019 | 1.0 | 1.0 |
| 5.8747 | 9.0 | 81 | 5.6510 | 1.0 | 1.0 |
| 5.0618 | 10.0 | 90 | 4.9849 | 1.0 | 1.0 |
| 4.5962 | 11.0 | 99 | 4.5082 | 1.0 | 1.0 |
### Framework versions
- Transformers 4.42.3
- Pytorch 2.2.0+cu121
- Datasets 2.20.0
- Tokenizers 0.19.1
|
irusl/02ktm1
|
irusl
| 2024-07-02T09:49:42Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:47:10Z |
Entry not found
|
aks1s/03-flow-2
|
aks1s
| 2024-07-02T09:48:44Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:47:58Z |
Entry not found
|
femiari/Phi3-Mini-Moe
|
femiari
| 2024-07-02T09:48:13Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:48:13Z |
Entry not found
|
ghost613/whisper-small-voice-conversion
|
ghost613
| 2024-07-03T00:12:04Z | 0 | 0 |
transformers
|
[
"transformers",
"tensorboard",
"safetensors",
"whisper",
"automatic-speech-recognition",
"endpoints_compatible",
"region:us"
] |
automatic-speech-recognition
| 2024-07-02T09:48:17Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
ebra1234/mamba_text_classification
|
ebra1234
| 2024-07-02T16:52:43Z | 0 | 0 |
transformers
|
[
"transformers",
"pytorch",
"generated_from_trainer",
"endpoints_compatible",
"region:us"
] | null | 2024-07-02T09:48:26Z |
---
tags:
- generated_from_trainer
metrics:
- accuracy
model-index:
- name: mamba_text_classification
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# mamba_text_classification
This model was trained from scratch on the None dataset.
It achieves the following results on the evaluation set:
- Loss: 0.2533
- Accuracy: 0.9733
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 1e-05
- train_batch_size: 4
- eval_batch_size: 8
- seed: 42
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: cosine
- lr_scheduler_warmup_ratio: 0.01
- num_epochs: 5
### Training results
| Training Loss | Epoch | Step | Validation Loss | Accuracy |
|:-------------:|:-----:|:-----:|:---------------:|:--------:|
| 1.0624 | 0.5 | 4490 | 0.2826 | 0.9432 |
| 1.5729 | 1.0 | 8980 | 0.2010 | 0.9532 |
| 0.0001 | 1.5 | 13470 | 0.2179 | 0.9633 |
| 0.0001 | 2.0 | 17960 | 0.1711 | 0.9666 |
| 0.0 | 2.5 | 22450 | 0.2626 | 0.9644 |
| 0.0003 | 3.0 | 26940 | 0.2157 | 0.9688 |
| 0.0 | 3.5 | 31430 | 0.2305 | 0.9744 |
| 0.0 | 4.0 | 35920 | 0.2372 | 0.9755 |
| 0.0 | 4.5 | 40410 | 0.2547 | 0.9744 |
| 0.0 | 5.0 | 44900 | 0.2533 | 0.9733 |
### Framework versions
- Transformers 4.41.2
- Pytorch 2.3.0+cu121
- Datasets 2.20.0
- Tokenizers 0.19.1
|
gauravsirola/bge-base-financial-matryoshka-v1
|
gauravsirola
| 2024-07-02T09:49:03Z | 0 | 0 |
sentence-transformers
|
[
"sentence-transformers",
"safetensors",
"bert",
"sentence-similarity",
"feature-extraction",
"generated_from_trainer",
"dataset_size:6300",
"loss:MatryoshkaLoss",
"loss:MultipleNegativesRankingLoss",
"en",
"arxiv:1908.10084",
"arxiv:2205.13147",
"arxiv:1705.00652",
"base_model:BAAI/bge-base-en-v1.5",
"license:apache-2.0",
"model-index",
"autotrain_compatible",
"endpoints_compatible",
"text-embeddings-inference",
"region:us"
] |
sentence-similarity
| 2024-07-02T09:48:55Z |
---
base_model: BAAI/bge-base-en-v1.5
datasets: []
language:
- en
library_name: sentence-transformers
license: apache-2.0
metrics:
- cosine_accuracy@1
- cosine_accuracy@3
- cosine_accuracy@5
- cosine_accuracy@10
- cosine_precision@1
- cosine_precision@3
- cosine_precision@5
- cosine_precision@10
- cosine_recall@1
- cosine_recall@3
- cosine_recall@5
- cosine_recall@10
- cosine_ndcg@10
- cosine_mrr@10
- cosine_map@100
pipeline_tag: sentence-similarity
tags:
- sentence-transformers
- sentence-similarity
- feature-extraction
- generated_from_trainer
- dataset_size:6300
- loss:MatryoshkaLoss
- loss:MultipleNegativesRankingLoss
widget:
- source_sentence: ITEM 7. MANAGEMENT’S DISCUSSION AND ANALYSIS OF FINANCIAL CONDITION
AND RESULTS OF OPERATIONS The following discussion and analysis should be read
in conjunction with the consolidated financial statements and the related notes
included elsewhere in this Annual Report on Form 10-K. For further discussion
of our products and services, technology and competitive strengths, refer to Item
1- Business.
sentences:
- What was the total net automotive cash provided by investing activities in 2023?
- What is the purpose of the Management's Discussion and Analysis of Financial Condition
and Results of Operations section in the Annual Report on Form 10-K?
- What are the components included in the management discussion and analysis of
financial condition and results of operations?
- source_sentence: Kroger is committed to maintaining a net total debt to adjusted
EBITDA ratio target range of 2.30 to 2.50.
sentences:
- What was the remaining available amount of the share repurchase authorization
as of January 29, 2023?
- What range does Kroger aim for its net total debt to adjusted EBITDA ratio?
- What was the starting wage for all entry-level positions in the U.S. as of September
2023?
- source_sentence: Google Cloud operating income of $1.7 billion for 2023.
sentences:
- What was the operating income for Google Cloud in 2023?
- What types of products are offered in Garmin's Fitness segment?
- What was the net sales of the company in fiscal 2022?
- source_sentence: The effective income tax rate for Alphabet Inc. at the end of the
year 2023 was 13.9%.
sentences:
- What was the percentage change in Compute & Networking revenue from fiscal year
2022 to 2023?
- What factors primarily contributed to the increase in non-interest revenues across
all revenue categories?
- What was the effective income tax rate for Alphabet Inc. at the end of the year
2023?
- source_sentence: State legislation increasingly requires PBMs to conduct audits
of network pharmacies regarding claims submitted for payment. Non-compliance could
prevent the recoupment of overpaid amounts, potentially causing financial and
legal repercussions.
sentences:
- What are the potential consequences for a company if its PBMs fail to comply with
pharmacy audit regulations?
- What pages do the Consolidated Financial Statements and their accompanying Notes
and reports appear on in the document?
- What are the primary services provided by the company under the Xfinity, Comcast
Business, and Sky brands?
model-index:
- name: BGE base Financial Matryoshka
results:
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 768
type: dim_768
metrics:
- type: cosine_accuracy@1
value: 0.6785714285714286
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.8342857142857143
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 0.88
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 0.9085714285714286
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.6785714285714286
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.2780952380952381
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.176
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.09085714285714284
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.6785714285714286
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.8342857142857143
name: Cosine Recall@3
- type: cosine_recall@5
value: 0.88
name: Cosine Recall@5
- type: cosine_recall@10
value: 0.9085714285714286
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.7995179593313807
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.7638202947845802
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.7674168947978975
name: Cosine Map@100
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 512
type: dim_512
metrics:
- type: cosine_accuracy@1
value: 0.6685714285714286
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.8271428571428572
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 0.8685714285714285
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 0.9128571428571428
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.6685714285714286
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.2757142857142857
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.1737142857142857
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.09128571428571428
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.6685714285714286
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.8271428571428572
name: Cosine Recall@3
- type: cosine_recall@5
value: 0.8685714285714285
name: Cosine Recall@5
- type: cosine_recall@10
value: 0.9128571428571428
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.7954721927324272
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.7574353741496596
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.7606771546726785
name: Cosine Map@100
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 256
type: dim_256
metrics:
- type: cosine_accuracy@1
value: 0.6728571428571428
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.8142857142857143
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 0.8642857142857143
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 0.9042857142857142
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.6728571428571428
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.2714285714285714
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.17285714285714285
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.09042857142857141
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.6728571428571428
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.8142857142857143
name: Cosine Recall@3
- type: cosine_recall@5
value: 0.8642857142857143
name: Cosine Recall@5
- type: cosine_recall@10
value: 0.9042857142857142
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.7916203877025221
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.7552613378684805
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.7590698804335085
name: Cosine Map@100
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 128
type: dim_128
metrics:
- type: cosine_accuracy@1
value: 0.6528571428571428
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.8114285714285714
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 0.85
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 0.8885714285714286
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.6528571428571428
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.2704761904761904
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.16999999999999998
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.08885714285714286
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.6528571428571428
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.8114285714285714
name: Cosine Recall@3
- type: cosine_recall@5
value: 0.85
name: Cosine Recall@5
- type: cosine_recall@10
value: 0.8885714285714286
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.7754227314755763
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.738630385487528
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.7431237490151862
name: Cosine Map@100
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 64
type: dim_64
metrics:
- type: cosine_accuracy@1
value: 0.6157142857142858
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.7614285714285715
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 0.81
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 0.8642857142857143
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.6157142857142858
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.2538095238095238
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.16199999999999998
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.08642857142857142
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.6157142857142858
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.7614285714285715
name: Cosine Recall@3
- type: cosine_recall@5
value: 0.81
name: Cosine Recall@5
- type: cosine_recall@10
value: 0.8642857142857143
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.7413954849024657
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.701954648526077
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.707051130510896
name: Cosine Map@100
---
# BGE base Financial Matryoshka
This is a [sentence-transformers](https://www.SBERT.net) model finetuned from [BAAI/bge-base-en-v1.5](https://huggingface.co/BAAI/bge-base-en-v1.5). It maps sentences & paragraphs to a 768-dimensional dense vector space and can be used for semantic textual similarity, semantic search, paraphrase mining, text classification, clustering, and more.
## Model Details
### Model Description
- **Model Type:** Sentence Transformer
- **Base model:** [BAAI/bge-base-en-v1.5](https://huggingface.co/BAAI/bge-base-en-v1.5) <!-- at revision a5beb1e3e68b9ab74eb54cfd186867f64f240e1a -->
- **Maximum Sequence Length:** 512 tokens
- **Output Dimensionality:** 768 tokens
- **Similarity Function:** Cosine Similarity
<!-- - **Training Dataset:** Unknown -->
- **Language:** en
- **License:** apache-2.0
### Model Sources
- **Documentation:** [Sentence Transformers Documentation](https://sbert.net)
- **Repository:** [Sentence Transformers on GitHub](https://github.com/UKPLab/sentence-transformers)
- **Hugging Face:** [Sentence Transformers on Hugging Face](https://huggingface.co/models?library=sentence-transformers)
### Full Model Architecture
```
SentenceTransformer(
(0): Transformer({'max_seq_length': 512, 'do_lower_case': True}) with Transformer model: BertModel
(1): Pooling({'word_embedding_dimension': 768, 'pooling_mode_cls_token': True, 'pooling_mode_mean_tokens': False, 'pooling_mode_max_tokens': False, 'pooling_mode_mean_sqrt_len_tokens': False, 'pooling_mode_weightedmean_tokens': False, 'pooling_mode_lasttoken': False, 'include_prompt': True})
(2): Normalize()
)
```
## Usage
### Direct Usage (Sentence Transformers)
First install the Sentence Transformers library:
```bash
pip install -U sentence-transformers
```
Then you can load this model and run inference.
```python
from sentence_transformers import SentenceTransformer
# Download from the 🤗 Hub
model = SentenceTransformer("gauravsirola/bge-base-financial-matryoshka-v1")
# Run inference
sentences = [
'State legislation increasingly requires PBMs to conduct audits of network pharmacies regarding claims submitted for payment. Non-compliance could prevent the recoupment of overpaid amounts, potentially causing financial and legal repercussions.',
'What are the potential consequences for a company if its PBMs fail to comply with pharmacy audit regulations?',
'What pages do the Consolidated Financial Statements and their accompanying Notes and reports appear on in the document?',
]
embeddings = model.encode(sentences)
print(embeddings.shape)
# [3, 768]
# Get the similarity scores for the embeddings
similarities = model.similarity(embeddings, embeddings)
print(similarities.shape)
# [3, 3]
```
<!--
### Direct Usage (Transformers)
<details><summary>Click to see the direct usage in Transformers</summary>
</details>
-->
<!--
### Downstream Usage (Sentence Transformers)
You can finetune this model on your own dataset.
<details><summary>Click to expand</summary>
</details>
-->
<!--
### Out-of-Scope Use
*List how the model may foreseeably be misused and address what users ought not to do with the model.*
-->
## Evaluation
### Metrics
#### Information Retrieval
* Dataset: `dim_768`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.6786 |
| cosine_accuracy@3 | 0.8343 |
| cosine_accuracy@5 | 0.88 |
| cosine_accuracy@10 | 0.9086 |
| cosine_precision@1 | 0.6786 |
| cosine_precision@3 | 0.2781 |
| cosine_precision@5 | 0.176 |
| cosine_precision@10 | 0.0909 |
| cosine_recall@1 | 0.6786 |
| cosine_recall@3 | 0.8343 |
| cosine_recall@5 | 0.88 |
| cosine_recall@10 | 0.9086 |
| cosine_ndcg@10 | 0.7995 |
| cosine_mrr@10 | 0.7638 |
| **cosine_map@100** | **0.7674** |
#### Information Retrieval
* Dataset: `dim_512`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.6686 |
| cosine_accuracy@3 | 0.8271 |
| cosine_accuracy@5 | 0.8686 |
| cosine_accuracy@10 | 0.9129 |
| cosine_precision@1 | 0.6686 |
| cosine_precision@3 | 0.2757 |
| cosine_precision@5 | 0.1737 |
| cosine_precision@10 | 0.0913 |
| cosine_recall@1 | 0.6686 |
| cosine_recall@3 | 0.8271 |
| cosine_recall@5 | 0.8686 |
| cosine_recall@10 | 0.9129 |
| cosine_ndcg@10 | 0.7955 |
| cosine_mrr@10 | 0.7574 |
| **cosine_map@100** | **0.7607** |
#### Information Retrieval
* Dataset: `dim_256`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.6729 |
| cosine_accuracy@3 | 0.8143 |
| cosine_accuracy@5 | 0.8643 |
| cosine_accuracy@10 | 0.9043 |
| cosine_precision@1 | 0.6729 |
| cosine_precision@3 | 0.2714 |
| cosine_precision@5 | 0.1729 |
| cosine_precision@10 | 0.0904 |
| cosine_recall@1 | 0.6729 |
| cosine_recall@3 | 0.8143 |
| cosine_recall@5 | 0.8643 |
| cosine_recall@10 | 0.9043 |
| cosine_ndcg@10 | 0.7916 |
| cosine_mrr@10 | 0.7553 |
| **cosine_map@100** | **0.7591** |
#### Information Retrieval
* Dataset: `dim_128`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.6529 |
| cosine_accuracy@3 | 0.8114 |
| cosine_accuracy@5 | 0.85 |
| cosine_accuracy@10 | 0.8886 |
| cosine_precision@1 | 0.6529 |
| cosine_precision@3 | 0.2705 |
| cosine_precision@5 | 0.17 |
| cosine_precision@10 | 0.0889 |
| cosine_recall@1 | 0.6529 |
| cosine_recall@3 | 0.8114 |
| cosine_recall@5 | 0.85 |
| cosine_recall@10 | 0.8886 |
| cosine_ndcg@10 | 0.7754 |
| cosine_mrr@10 | 0.7386 |
| **cosine_map@100** | **0.7431** |
#### Information Retrieval
* Dataset: `dim_64`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.6157 |
| cosine_accuracy@3 | 0.7614 |
| cosine_accuracy@5 | 0.81 |
| cosine_accuracy@10 | 0.8643 |
| cosine_precision@1 | 0.6157 |
| cosine_precision@3 | 0.2538 |
| cosine_precision@5 | 0.162 |
| cosine_precision@10 | 0.0864 |
| cosine_recall@1 | 0.6157 |
| cosine_recall@3 | 0.7614 |
| cosine_recall@5 | 0.81 |
| cosine_recall@10 | 0.8643 |
| cosine_ndcg@10 | 0.7414 |
| cosine_mrr@10 | 0.702 |
| **cosine_map@100** | **0.7071** |
<!--
## Bias, Risks and Limitations
*What are the known or foreseeable issues stemming from this model? You could also flag here known failure cases or weaknesses of the model.*
-->
<!--
### Recommendations
*What are recommendations with respect to the foreseeable issues? For example, filtering explicit content.*
-->
## Training Details
### Training Dataset
#### Unnamed Dataset
* Size: 6,300 training samples
* Columns: <code>positive</code> and <code>anchor</code>
* Approximate statistics based on the first 1000 samples:
| | positive | anchor |
|:--------|:-----------------------------------------------------------------------------------|:----------------------------------------------------------------------------------|
| type | string | string |
| details | <ul><li>min: 7 tokens</li><li>mean: 44.73 tokens</li><li>max: 301 tokens</li></ul> | <ul><li>min: 8 tokens</li><li>mean: 20.57 tokens</li><li>max: 41 tokens</li></ul> |
* Samples:
| positive | anchor |
|:-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|:--------------------------------------------------------------------------------------------------------------------------------------|
| <code>Net loss was $396.6 million and $973.6 million during the years ended December 31, 2023, and December 31, 2022, respectively.</code> | <code>What was the net loss for the year ended December 31, 2022?</code> |
| <code>Under the 2023 IDA agreement, the service fee on client cash deposits held at the TD Depository Institutions remains at 15 basis points, as it was in the 2019 IDA agreement.</code> | <code>How much is the service fee on client cash deposits held at the TD Depository Institutions under the 2023 IDA agreement?</code> |
| <code>The total shareholders’ deficit is listed as $7,994.8 million in the latest financial statement.</code> | <code>What is the total shareholder's deficit according to the latest financial statement?</code> |
* Loss: [<code>MatryoshkaLoss</code>](https://sbert.net/docs/package_reference/sentence_transformer/losses.html#matryoshkaloss) with these parameters:
```json
{
"loss": "MultipleNegativesRankingLoss",
"matryoshka_dims": [
768,
512,
256,
128,
64
],
"matryoshka_weights": [
1,
1,
1,
1,
1
],
"n_dims_per_step": -1
}
```
### Training Hyperparameters
#### Non-Default Hyperparameters
- `eval_strategy`: epoch
- `per_device_train_batch_size`: 32
- `per_device_eval_batch_size`: 16
- `gradient_accumulation_steps`: 16
- `learning_rate`: 2e-05
- `num_train_epochs`: 4
- `lr_scheduler_type`: cosine
- `warmup_ratio`: 0.1
- `bf16`: True
- `tf32`: True
- `load_best_model_at_end`: True
- `optim`: adamw_torch_fused
- `batch_sampler`: no_duplicates
#### All Hyperparameters
<details><summary>Click to expand</summary>
- `overwrite_output_dir`: False
- `do_predict`: False
- `eval_strategy`: epoch
- `prediction_loss_only`: True
- `per_device_train_batch_size`: 32
- `per_device_eval_batch_size`: 16
- `per_gpu_train_batch_size`: None
- `per_gpu_eval_batch_size`: None
- `gradient_accumulation_steps`: 16
- `eval_accumulation_steps`: None
- `learning_rate`: 2e-05
- `weight_decay`: 0.0
- `adam_beta1`: 0.9
- `adam_beta2`: 0.999
- `adam_epsilon`: 1e-08
- `max_grad_norm`: 1.0
- `num_train_epochs`: 4
- `max_steps`: -1
- `lr_scheduler_type`: cosine
- `lr_scheduler_kwargs`: {}
- `warmup_ratio`: 0.1
- `warmup_steps`: 0
- `log_level`: passive
- `log_level_replica`: warning
- `log_on_each_node`: True
- `logging_nan_inf_filter`: True
- `save_safetensors`: True
- `save_on_each_node`: False
- `save_only_model`: False
- `restore_callback_states_from_checkpoint`: False
- `no_cuda`: False
- `use_cpu`: False
- `use_mps_device`: False
- `seed`: 42
- `data_seed`: None
- `jit_mode_eval`: False
- `use_ipex`: False
- `bf16`: True
- `fp16`: False
- `fp16_opt_level`: O1
- `half_precision_backend`: auto
- `bf16_full_eval`: False
- `fp16_full_eval`: False
- `tf32`: True
- `local_rank`: 0
- `ddp_backend`: None
- `tpu_num_cores`: None
- `tpu_metrics_debug`: False
- `debug`: []
- `dataloader_drop_last`: False
- `dataloader_num_workers`: 0
- `dataloader_prefetch_factor`: None
- `past_index`: -1
- `disable_tqdm`: False
- `remove_unused_columns`: True
- `label_names`: None
- `load_best_model_at_end`: True
- `ignore_data_skip`: False
- `fsdp`: []
- `fsdp_min_num_params`: 0
- `fsdp_config`: {'min_num_params': 0, 'xla': False, 'xla_fsdp_v2': False, 'xla_fsdp_grad_ckpt': False}
- `fsdp_transformer_layer_cls_to_wrap`: None
- `accelerator_config`: {'split_batches': False, 'dispatch_batches': None, 'even_batches': True, 'use_seedable_sampler': True, 'non_blocking': False, 'gradient_accumulation_kwargs': None}
- `deepspeed`: None
- `label_smoothing_factor`: 0.0
- `optim`: adamw_torch_fused
- `optim_args`: None
- `adafactor`: False
- `group_by_length`: False
- `length_column_name`: length
- `ddp_find_unused_parameters`: None
- `ddp_bucket_cap_mb`: None
- `ddp_broadcast_buffers`: False
- `dataloader_pin_memory`: True
- `dataloader_persistent_workers`: False
- `skip_memory_metrics`: True
- `use_legacy_prediction_loop`: False
- `push_to_hub`: False
- `resume_from_checkpoint`: None
- `hub_model_id`: None
- `hub_strategy`: every_save
- `hub_private_repo`: False
- `hub_always_push`: False
- `gradient_checkpointing`: False
- `gradient_checkpointing_kwargs`: None
- `include_inputs_for_metrics`: False
- `eval_do_concat_batches`: True
- `fp16_backend`: auto
- `push_to_hub_model_id`: None
- `push_to_hub_organization`: None
- `mp_parameters`:
- `auto_find_batch_size`: False
- `full_determinism`: False
- `torchdynamo`: None
- `ray_scope`: last
- `ddp_timeout`: 1800
- `torch_compile`: False
- `torch_compile_backend`: None
- `torch_compile_mode`: None
- `dispatch_batches`: None
- `split_batches`: None
- `include_tokens_per_second`: False
- `include_num_input_tokens_seen`: False
- `neftune_noise_alpha`: None
- `optim_target_modules`: None
- `batch_eval_metrics`: False
- `batch_sampler`: no_duplicates
- `multi_dataset_batch_sampler`: proportional
</details>
### Training Logs
| Epoch | Step | Training Loss | dim_128_cosine_map@100 | dim_256_cosine_map@100 | dim_512_cosine_map@100 | dim_64_cosine_map@100 | dim_768_cosine_map@100 |
|:----------:|:------:|:-------------:|:----------------------:|:----------------------:|:----------------------:|:---------------------:|:----------------------:|
| 0.8122 | 10 | 1.5585 | - | - | - | - | - |
| 0.9746 | 12 | - | 0.7207 | 0.7441 | 0.7510 | 0.6857 | 0.7493 |
| 1.6244 | 20 | 0.6691 | - | - | - | - | - |
| 1.9492 | 24 | - | 0.7392 | 0.7564 | 0.7601 | 0.7006 | 0.7661 |
| 2.4365 | 30 | 0.4702 | - | - | - | - | - |
| 2.9239 | 36 | - | 0.7430 | 0.7600 | 0.7619 | 0.7065 | 0.7685 |
| 3.2487 | 40 | 0.407 | - | - | - | - | - |
| **3.8985** | **48** | **-** | **0.7431** | **0.7591** | **0.7607** | **0.7071** | **0.7674** |
* The bold row denotes the saved checkpoint.
### Framework Versions
- Python: 3.10.6
- Sentence Transformers: 3.0.1
- Transformers: 4.41.2
- PyTorch: 2.1.2+cu121
- Accelerate: 0.31.0
- Datasets: 2.19.1
- Tokenizers: 0.19.1
## Citation
### BibTeX
#### Sentence Transformers
```bibtex
@inproceedings{reimers-2019-sentence-bert,
title = "Sentence-BERT: Sentence Embeddings using Siamese BERT-Networks",
author = "Reimers, Nils and Gurevych, Iryna",
booktitle = "Proceedings of the 2019 Conference on Empirical Methods in Natural Language Processing",
month = "11",
year = "2019",
publisher = "Association for Computational Linguistics",
url = "https://arxiv.org/abs/1908.10084",
}
```
#### MatryoshkaLoss
```bibtex
@misc{kusupati2024matryoshka,
title={Matryoshka Representation Learning},
author={Aditya Kusupati and Gantavya Bhatt and Aniket Rege and Matthew Wallingford and Aditya Sinha and Vivek Ramanujan and William Howard-Snyder and Kaifeng Chen and Sham Kakade and Prateek Jain and Ali Farhadi},
year={2024},
eprint={2205.13147},
archivePrefix={arXiv},
primaryClass={cs.LG}
}
```
#### MultipleNegativesRankingLoss
```bibtex
@misc{henderson2017efficient,
title={Efficient Natural Language Response Suggestion for Smart Reply},
author={Matthew Henderson and Rami Al-Rfou and Brian Strope and Yun-hsuan Sung and Laszlo Lukacs and Ruiqi Guo and Sanjiv Kumar and Balint Miklos and Ray Kurzweil},
year={2017},
eprint={1705.00652},
archivePrefix={arXiv},
primaryClass={cs.CL}
}
```
<!--
## Glossary
*Clearly define terms in order to be accessible across audiences.*
-->
<!--
## Model Card Authors
*Lists the people who create the model card, providing recognition and accountability for the detailed work that goes into its construction.*
-->
<!--
## Model Card Contact
*Provides a way for people who have updates to the Model Card, suggestions, or questions, to contact the Model Card authors.*
-->
|
SidXXD/3-only_cos-person-eps_10-alpha_5e-2-person
|
SidXXD
| 2024-07-02T10:07:01Z | 0 | 0 |
diffusers
|
[
"diffusers",
"tensorboard",
"safetensors",
"stable-diffusion",
"stable-diffusion-diffusers",
"text-to-image",
"custom-diffusion",
"base_model:stabilityai/stable-diffusion-2-1-base",
"license:creativeml-openrail-m",
"region:us"
] |
text-to-image
| 2024-07-02T09:49:52Z |
---
license: creativeml-openrail-m
base_model: stabilityai/stable-diffusion-2-1-base
instance_prompt: photo of a <v1*> person
tags:
- stable-diffusion
- stable-diffusion-diffusers
- text-to-image
- diffusers
- custom-diffusion
inference: true
---
# Custom Diffusion - SidXXD/3-only_cos-person-eps_10-alpha_5e-2-person
These are Custom Diffusion adaption weights for stabilityai/stable-diffusion-2-1-base. The weights were trained on photo of a <v1*> person using [Custom Diffusion](https://www.cs.cmu.edu/~custom-diffusion). You can find some example images in the following.
For more details on the training, please follow [this link](https://github.com/huggingface/diffusers/blob/main/examples/custom_diffusion).
|
tushar-r-pawar/gemma-2b-finetuned
|
tushar-r-pawar
| 2024-07-02T09:55:17Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"gemma",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T09:50:01Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
Salvatore/Persona_LoRA
|
Salvatore
| 2024-07-02T09:53:41Z | 0 | 0 |
diffusers
|
[
"diffusers",
"text-to-image",
"diffusers-training",
"lora",
"template:sd-lora",
"stable-diffusion-xl",
"stable-diffusion-xl-diffusers",
"base_model:stabilityai/stable-diffusion-xl-base-1.0",
"license:openrail++",
"region:us"
] |
text-to-image
| 2024-07-02T09:50:55Z |
---
base_model: stabilityai/stable-diffusion-xl-base-1.0
library_name: diffusers
license: openrail++
tags:
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
- text-to-image
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
instance_prompt: a photo of TOK person
widget: []
---
<!-- This model card has been generated automatically according to the information the training script had access to. You
should probably proofread and complete it, then remove this comment. -->
# SDXL LoRA DreamBooth - Salvatore/Persona_LoRA
<Gallery />
## Model description
These are Salvatore/Persona_LoRA LoRA adaption weights for stabilityai/stable-diffusion-xl-base-1.0.
The weights were trained using [DreamBooth](https://dreambooth.github.io/).
LoRA for the text encoder was enabled: False.
Special VAE used for training: madebyollin/sdxl-vae-fp16-fix.
## Trigger words
You should use a photo of TOK person to trigger the image generation.
## Download model
Weights for this model are available in Safetensors format.
[Download](Salvatore/Persona_LoRA/tree/main) them in the Files & versions tab.
## Intended uses & limitations
#### How to use
```python
# TODO: add an example code snippet for running this diffusion pipeline
```
#### Limitations and bias
[TODO: provide examples of latent issues and potential remediations]
## Training details
[TODO: describe the data used to train the model]
|
aks1s/05-flow-2
|
aks1s
| 2024-07-02T09:52:04Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:51:22Z |
Entry not found
|
Peacoc/37_best_t_14_4
|
Peacoc
| 2024-07-02T09:53:58Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"llama",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T09:51:51Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
Tuhaishi/distilbert-base-cased
|
Tuhaishi
| 2024-07-02T09:51:54Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:51:54Z |
Entry not found
|
irusl/04ktm1
|
irusl
| 2024-07-02T09:55:16Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:52:47Z |
Entry not found
|
ashrafdiab/Poultry
|
ashrafdiab
| 2024-07-02T09:53:40Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T09:53:40Z |
Entry not found
|
aks1s/06-flow-2
|
aks1s
| 2024-07-02T09:55:22Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:54:35Z |
Entry not found
|
femiari/Qwen1.5-1.8B-Moe
|
femiari
| 2024-07-02T09:56:40Z | 0 | 0 |
transformers
|
[
"transformers",
"qwen2_moe",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:56:39Z |
Entry not found
|
Elifay/Liflif
|
Elifay
| 2024-07-02T09:57:49Z | 0 | 0 |
asteroid
|
[
"asteroid",
"zero-shot-classification",
"ay",
"dataset:HuggingFaceFW/fineweb-edu",
"license:apache-2.0",
"region:us"
] |
zero-shot-classification
| 2024-07-02T09:57:01Z |
---
license: apache-2.0
datasets:
- HuggingFaceFW/fineweb-edu
language:
- ay
metrics:
- character
library_name: asteroid
pipeline_tag: zero-shot-classification
---
|
readerbench/RoGEC-robert-large
|
readerbench
| 2024-07-02T12:32:10Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"bert",
"token-classification",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
token-classification
| 2024-07-02T09:57:05Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
antoniolopez00/gemma-2-9b-it-quantized
|
antoniolopez00
| 2024-07-02T10:05:18Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"gemma2",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"4-bit",
"bitsandbytes",
"region:us"
] |
text-generation
| 2024-07-02T09:57:07Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
haophancs/code-llama-7b-text-to-sql
|
haophancs
| 2024-07-02T11:20:03Z | 0 | 0 | null |
[
"tensorboard",
"safetensors",
"region:us"
] | null | 2024-07-02T09:57:18Z |
Entry not found
|
aks1s/07-flow-2
|
aks1s
| 2024-07-02T09:58:39Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:57:59Z |
Entry not found
|
RachidAR/Phi-3-mini-4k-instruct-June2024-Q6_K-GGUF
|
RachidAR
| 2024-07-02T10:08:46Z | 0 | 0 | null |
[
"gguf",
"nlp",
"code",
"llama-cpp",
"gguf-my-repo",
"text-generation",
"en",
"base_model:microsoft/Phi-3-mini-4k-instruct",
"license:mit",
"region:us"
] |
text-generation
| 2024-07-02T09:58:10Z |
---
base_model: microsoft/Phi-3-mini-4k-instruct
language:
- en
license: mit
license_link: https://huggingface.co/microsoft/Phi-3-mini-4k-instruct/resolve/main/LICENSE
pipeline_tag: text-generation
tags:
- nlp
- code
- llama-cpp
- gguf-my-repo
inference:
parameters:
temperature: 0.0
widget:
- messages:
- role: user
content: Can you provide ways to eat combinations of bananas and dragonfruits?
---
# RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF (June 2024 Update)
This model was converted to GGUF format from [`microsoft/Phi-3-mini-4k-instruct`](https://huggingface.co/microsoft/Phi-3-mini-4k-instruct) using llama.cpp via the ggml.ai's [GGUF-my-repo](https://huggingface.co/spaces/ggml-org/gguf-my-repo) space.
Refer to the [original model card](https://huggingface.co/microsoft/Phi-3-mini-4k-instruct) for more details on the model.
## Release Notes
This is an update over the original instruction-tuned Phi-3-mini release based on valuable customer feedback.
The model used additional post-training data leading to substantial gains on instruction following and structure output.
We also **improve multi-turn conversation quality**, **explicitly support <|system|> tag**, and **significantly improve reasoning capability**.
We believe most use cases will benefit from this release, but we encourage users to test in their particular AI applications.
We appreciate the enthusiastic adoption of the Phi-3 model family, and continue to welcome all feedback from the community.
The table below highlights improvements on instruction following, structure output, and reasoning of the new release on publich and internal benchmark datasets.
| Benchmarks | Original | June 2024 Update |
|:------------|:----------|:------------------|
| Instruction Extra Hard | 5.7 | 6.0 |
| Instruction Hard | 4.9 | 5.1 |
| Instructions Challenge | 24.6 | 42.3 |
| JSON Structure Output | 11.5 | 52.3 |
| XML Structure Output | 14.4 | 49.8 |
| GPQA | 23.7 | 30.6 |
| MMLU | 68.8 | 70.9 |
| **Average** | **21.9** | **36.7** |
### Chat Format
Given the nature of the training data, the Phi-3 Mini-4K-Instruct model is best suited for prompts using the chat format as follows.
You can provide the prompt as a question with a generic template as follow:
```markdown
<|system|>
You are a helpful assistant.<|end|>
<|user|>
Question?<|end|>
<|assistant|>
```
For example:
```markdown
<|system|>
You are a helpful assistant.<|end|>
<|user|>
How to explain Internet for a medieval knight?<|end|>
<|assistant|>
```
where the model generates the text after `<|assistant|>` . In case of few-shots prompt, the prompt can be formatted as the following:
```markdown
<|system|>
You are a helpful travel assistant.<|end|>
<|user|>
I am going to Paris, what should I see?<|end|>
<|assistant|>
Paris, the capital of France, is known for its stunning architecture, art museums, historical landmarks, and romantic atmosphere. Here are some of the top attractions to see in Paris:\n\n1. The Eiffel Tower: The iconic Eiffel Tower is one of the most recognizable landmarks in the world and offers breathtaking views of the city.\n2. The Louvre Museum: The Louvre is one of the world's largest and most famous museums, housing an impressive collection of art and artifacts, including the Mona Lisa.\n3. Notre-Dame Cathedral: This beautiful cathedral is one of the most famous landmarks in Paris and is known for its Gothic architecture and stunning stained glass windows.\n\nThese are just a few of the many attractions that Paris has to offer. With so much to see and do, it's no wonder that Paris is one of the most popular tourist destinations in the world."<|end|>
<|user|>
What is so great about #1?<|end|>
<|assistant|>
```
## Use with llama.cpp
Install llama.cpp through brew (works on Mac and Linux)
```bash
brew install llama.cpp
```
Invoke the llama.cpp server or the CLI.
### CLI:
```bash
llama-cli --hf-repo RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF --hf-file phi-3-mini-4k-instruct-q6_k.gguf -p "The meaning to life and the universe is"
```
### Server:
```bash
llama-server --hf-repo RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF --hf-file phi-3-mini-4k-instruct-q6_k.gguf -c 2048
```
Note: You can also use this checkpoint directly through the [usage steps](https://github.com/ggerganov/llama.cpp?tab=readme-ov-file#usage) listed in the Llama.cpp repo as well.
Step 1: Clone llama.cpp from GitHub.
```
git clone https://github.com/ggerganov/llama.cpp
```
Step 2: Move into the llama.cpp folder and build it with `LLAMA_CURL=1` flag along with other hardware-specific flags (for ex: LLAMA_CUDA=1 for Nvidia GPUs on Linux).
```
cd llama.cpp && LLAMA_CURL=1 make
```
Step 3: Run inference through the main binary.
```
./llama-cli --hf-repo RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF --hf-file phi-3-mini-4k-instruct-q6_k.gguf -p "The meaning to life and the universe is"
```
or
```
./llama-server --hf-repo RachidAR/Phi-3-mini-4k-instruct-Q6_K-GGUF --hf-file phi-3-mini-4k-instruct-q6_k.gguf -c 2048
```
|
irusl/05ktm1
|
irusl
| 2024-07-02T10:00:53Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T09:58:23Z |
Entry not found
|
Peacoc/37_best_t_15_4
|
Peacoc
| 2024-07-02T10:02:19Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"llama",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T10:00:09Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
aks1s/08-flow-2
|
aks1s
| 2024-07-02T10:01:53Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T10:01:10Z |
Entry not found
|
Bighost/Songcomposer-tone-specific
|
Bighost
| 2024-07-02T10:01:20Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T10:01:20Z |
Invalid username or password.
|
anhtux1x/Madlad400-Zh-Vi-2k-data4
|
anhtux1x
| 2024-07-02T10:29:58Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"t5",
"text2text-generation",
"vi",
"en",
"zh",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text2text-generation
| 2024-07-02T10:01:33Z |
---
license: apache-2.0
language:
- vi
- en
- zh
---
```python
from transformers import AutoModelForSeq2SeqLM, AutoTokenizer
base_model_name = 'anhtux1x/Madlad400-Zh-Vi-2k-data4'
base_model = AutoModelForSeq2SeqLM.from_pretrained(base_model_name)
tokenizer = AutoTokenizer.from_pretrained(base_model_name)
base_model.to("cuda")
sentences = [
"1. 参考图片方向将1pcs mac ID label粘贴到main board上(barcode朝上)",
"2.按压reset按键3次以上,检查不可有卡键 、破损、手感弱等不良品.",
"3.用无尘布蘸取少量酒精(含量96%),将reset按键一圈的脏污及粉尘清洁干净",
"4.将1pcs rubber reset button置中粘贴到reset按键上,粘贴后按压reset按键3次以上,检查不可有卡键或手感弱等不良品",
"5.取1pcs已点胶的网口板然后装到主板上,如图5。",
"6.将测试排线插入主板中,扫描主板MAC ID label, 扫描主板另一面的HH label",
"7. 将网线插入位置,如上图8",
"8.出现如图所示界面时,点击确认.",
"9.出现如图画面PASS时,表示为良品,将产品取出",
"10.當出现如图画面FAIL时,交换机台重新测试,一机就当机重测,若再次不良,将产品取出使用铅笔标示不良代码于不良卡上放到不良品区"
]
for inputs in sentences:
inputs = tokenizer(f"<2vi> {inputs}", return_tensors="pt")
outputs = base_model.generate(**inputs.to('cuda'),max_length=500)
reusult = tokenizer.batch_decode(outputs, skip_special_tokens=True)
print(reusult,"\n")
```
|
imagepipeline/buda
|
imagepipeline
| 2024-07-02T10:01:49Z | 0 | 0 | null |
[
"imagepipeline",
"imagepipeline.io",
"text-to-image",
"ultra-realistic",
"license:creativeml-openrail-m",
"region:us"
] |
text-to-image
| 2024-07-02T10:01:47Z |
---
license: creativeml-openrail-m
tags:
- imagepipeline
- imagepipeline.io
- text-to-image
- ultra-realistic
pinned: false
pipeline_tag: text-to-image
---
## buda
<img src="https://via.placeholder.com/468x300?text=App+Screenshot+Here" alt="Generated on Image Pipeline" style="border-radius: 10px;">
**This lora model is uploaded on [imagepipeline.io](https://imagepipeline.io/)**
Model details - buda
[](https://imagepipeline.io/models/buda?id=a9932c22-7d2d-4480-8f46-7d2a260782ba/)
## How to try this model ?
You can try using it locally or send an API call to test the output quality.
Get your `API_KEY` from [imagepipeline.io](https://imagepipeline.io/). No payment required.
Coding in `php` `javascript` `node` etc ? Checkout our documentation
[](https://docs.imagepipeline.io/docs/introduction)
```python
import requests
import json
url = "https://imagepipeline.io/sd/text2image/v1/run"
payload = json.dumps({
"model_id": "sd1.5",
"prompt": "ultra realistic close up portrait ((beautiful pale cyberpunk female with heavy black eyeliner)), blue eyes, shaved side haircut, hyper detail, cinematic lighting, magic neon, dark red city, Canon EOS R3, nikon, f/1.4, ISO 200, 1/160s, 8K, RAW, unedited, symmetrical balance, in-frame, 8K",
"negative_prompt": "painting, extra fingers, mutated hands, poorly drawn hands, poorly drawn face, deformed, ugly, blurry, bad anatomy, bad proportions, extra limbs, cloned face, skinny, glitchy, double torso, extra arms, extra hands, mangled fingers, missing lips, ugly face, distorted face, extra legs, anime",
"width": "512",
"height": "512",
"samples": "1",
"num_inference_steps": "30",
"safety_checker": false,
"guidance_scale": 7.5,
"multi_lingual": "no",
"embeddings": "",
"lora_models": "a9932c22-7d2d-4480-8f46-7d2a260782ba",
"lora_weights": "0.5"
})
headers = {
'Content-Type': 'application/json',
'API-Key': 'your_api_key'
}
response = requests.request("POST", url, headers=headers, data=payload)
print(response.text)
}
```
Get more ready to use `MODELS` like this for `SD 1.5` and `SDXL` :
[](https://imagepipeline.io/models)
### API Reference
#### Generate Image
```http
https://api.imagepipeline.io/sd/text2image/v1
```
| Headers | Type | Description |
|:----------------------| :------- |:-------------------------------------------------------------------------------------------------------------------|
| `API-Key` | `str` | Get your `API_KEY` from [imagepipeline.io](https://imagepipeline.io/) |
| `Content-Type` | `str` | application/json - content type of the request body |
| Parameter | Type | Description |
| :-------- | :------- | :------------------------- |
| `model_id` | `str` | Your base model, find available lists in [models page](https://imagepipeline.io/models) or upload your own|
| `prompt` | `str` | Text Prompt. Check our [Prompt Guide](https://docs.imagepipeline.io/docs/SD-1.5/docs/extras/prompt-guide) for tips |
| `num_inference_steps` | `int [1-50]` | Noise is removed with each step, resulting in a higher-quality image over time. Ideal value 30-50 (without LCM) |
| `guidance_scale` | `float [1-20]` | Higher guidance scale prioritizes text prompt relevance but sacrifices image quality. Ideal value 7.5-12.5 |
| `lora_models` | `str, array` | Pass the model_id(s) of LoRA models that can be found in models page |
| `lora_weights` | `str, array` | Strength of the LoRA effect |
---
license: creativeml-openrail-m
tags:
- imagepipeline
- imagepipeline.io
- text-to-image
- ultra-realistic
pinned: false
pipeline_tag: text-to-image
---
### Feedback
If you have any feedback, please reach out to us at [email protected]
#### 🔗 Visit Website
[](https://imagepipeline.io/)
If you are the original author of this model, please [click here](https://airtable.com/apprTaRnJbDJ8ufOx/shr4g7o9B6fWfOlUR) to add credits
|
rgb2gbr/Rock_Paper_Scissors
|
rgb2gbr
| 2024-07-02T10:17:01Z | 0 | 0 |
keras
|
[
"keras",
"rpc",
"rock, paper, scissors",
"hand sign",
"en",
"region:us"
] | null | 2024-07-02T10:02:11Z |
---
language:
- en
metrics:
- accuracy
library_name: keras
tags:
- rpc
- rock, paper, scissors
- hand sign
---
RPC, Rock Paper Scissiors model using Convolutional Neural Network (CNN/ VGG16) KERAS architecture
|
TristanGraeble/finetuned_model
|
TristanGraeble
| 2024-07-02T11:24:52Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"llama",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T10:03:25Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
SaFire1/RynthLabs
|
SaFire1
| 2024-07-02T10:03:36Z | 0 | 0 | null |
[
"license:mit",
"region:us"
] | null | 2024-07-02T10:03:36Z |
---
license: mit
---
|
irusl/06ktm1
|
irusl
| 2024-07-02T10:06:37Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T10:03:58Z |
Entry not found
|
aks1s/09-flow-2
|
aks1s
| 2024-07-02T10:05:06Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T10:04:23Z |
Entry not found
|
hasininawoda/output
|
hasininawoda
| 2024-07-02T10:10:13Z | 0 | 0 |
diffusers
|
[
"diffusers",
"tensorboard",
"stable-diffusion",
"stable-diffusion-diffusers",
"text-to-image",
"diffusers-training",
"lora",
"base_model:CompVis/stable-diffusion-v1-4",
"license:creativeml-openrail-m",
"region:us"
] |
text-to-image
| 2024-07-02T10:04:39Z |
---
license: creativeml-openrail-m
library_name: diffusers
tags:
- stable-diffusion
- stable-diffusion-diffusers
- text-to-image
- diffusers
- diffusers-training
- lora
base_model: CompVis/stable-diffusion-v1-4
inference: true
---
<!-- This model card has been generated automatically according to the information the training script had access to. You
should probably proofread and complete it, then remove this comment. -->
# LoRA text2image fine-tuning - hasininawoda/output
These are LoRA adaption weights for CompVis/stable-diffusion-v1-4. The weights were fine-tuned on the None dataset. You can find some example images in the following.
## Intended uses & limitations
#### How to use
```python
# TODO: add an example code snippet for running this diffusion pipeline
```
#### Limitations and bias
[TODO: provide examples of latent issues and potential remediations]
## Training details
[TODO: describe the data used to train the model]
|
AIForge/Qwen2-0.5B-cpt
|
AIForge
| 2024-07-02T10:24:01Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"qwen2",
"text-generation",
"conversational",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T10:05:07Z |
Invalid username or password.
|
finn03091993/naschainv116
|
finn03091993
| 2024-07-02T10:05:21Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T10:05:20Z |
Entry not found
|
datakrems/test
|
datakrems
| 2024-07-02T14:07:50Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"llama",
"text-generation",
"finetuned",
"question-answering",
"arxiv:1910.09700",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"4-bit",
"bitsandbytes",
"region:us"
] |
question-answering
| 2024-07-02T10:05:34Z |
---
license: apache-2.0
pipeline_tag: question-answering
tags:
- finetuned
inference: true
widget:
- messages:
- role: user
content: What is your favorite condiment?
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
yaambe/mms-tts-spa
|
yaambe
| 2024-07-02T10:26:33Z | 0 | 0 | null |
[
"onnx",
"region:us"
] | null | 2024-07-02T10:06:39Z |
# Text-to-Speech Model
This is a sherpa-onnx compatible model of the mms-tts-spa. The original finetuned version was from https://huggingface.co/ylacombe/mms-spa-finetuned-argentinian-monospeaker
|
rubioh/whisper-small-hi
|
rubioh
| 2024-07-02T10:07:17Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T10:07:17Z |
Entry not found
|
aks1s/11-flow-2
|
aks1s
| 2024-07-02T10:08:19Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T10:07:34Z |
Entry not found
|
AERA-Batch1/finetune-phi-adapterv2-3epochs
|
AERA-Batch1
| 2024-07-02T10:10:22Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"gpt",
"text-generation",
"custom_code",
"arxiv:1910.09700",
"autotrain_compatible",
"region:us"
] |
text-generation
| 2024-07-02T10:08:56Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
debenoist/cube_merged
|
debenoist
| 2024-07-02T15:14:14Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"idefics2",
"pretraining",
"endpoints_compatible",
"4-bit",
"bitsandbytes",
"region:us"
] | null | 2024-07-02T10:09:19Z |
Entry not found
|
tosa-no-onchan/my_awesome_asr_mind_model
|
tosa-no-onchan
| 2024-07-02T16:05:13Z | 0 | 0 |
transformers
|
[
"transformers",
"tensorboard",
"safetensors",
"wav2vec2",
"automatic-speech-recognition",
"endpoints_compatible",
"region:us"
] |
automatic-speech-recognition
| 2024-07-02T10:10:40Z |
Entry not found
|
h-d-h/q-FrozenLake-v1-4x4-noSlippery
|
h-d-h
| 2024-07-02T10:10:49Z | 0 | 0 | null |
[
"FrozenLake-v1-4x4-no_slippery",
"q-learning",
"reinforcement-learning",
"custom-implementation",
"model-index",
"region:us"
] |
reinforcement-learning
| 2024-07-02T10:10:45Z |
---
tags:
- FrozenLake-v1-4x4-no_slippery
- q-learning
- reinforcement-learning
- custom-implementation
model-index:
- name: q-FrozenLake-v1-4x4-noSlippery
results:
- task:
type: reinforcement-learning
name: reinforcement-learning
dataset:
name: FrozenLake-v1-4x4-no_slippery
type: FrozenLake-v1-4x4-no_slippery
metrics:
- type: mean_reward
value: 1.00 +/- 0.00
name: mean_reward
verified: false
---
# **Q-Learning** Agent playing1 **FrozenLake-v1**
This is a trained model of a **Q-Learning** agent playing **FrozenLake-v1** .
## Usage
```python
model = load_from_hub(repo_id="h-d-h/q-FrozenLake-v1-4x4-noSlippery", filename="q-learning.pkl")
# Don't forget to check if you need to add additional attributes (is_slippery=False etc)
env = gym.make(model["env_id"])
```
|
aks1s/12-flow-2
|
aks1s
| 2024-07-02T10:11:34Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T10:10:47Z |
Entry not found
|
SamagraDataGov/e2e_deployment
|
SamagraDataGov
| 2024-07-02T12:52:05Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"bert",
"text-classification",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-classification
| 2024-07-02T10:11:06Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
Marouane50/llama2_finetuned_chatbot
|
Marouane50
| 2024-07-02T10:37:25Z | 0 | 0 | null |
[
"tensorboard",
"generated_from_trainer",
"license:llama2",
"region:us"
] | null | 2024-07-02T10:11:39Z |
---
license: llama2
tags:
- generated_from_trainer
model-index:
- name: llama2_finetuned_chatbot
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# llama2_finetuned_chatbot
This model is a fine-tuned version of [meta-llama/Llama-2-7b-hf](https://huggingface.co/meta-llama/Llama-2-7b-hf) on an unknown dataset.
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 0.0002
- train_batch_size: 16
- eval_batch_size: 16
- seed: 42
- gradient_accumulation_steps: 4
- total_train_batch_size: 64
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- training_steps: 10
### Training results
### Framework versions
- Transformers 4.30.2
- Pytorch 2.1.2
- Datasets 2.19.2
- Tokenizers 0.13.3
|
Cayetano/gpt2-imdb-pos-v2
|
Cayetano
| 2024-07-02T10:12:22Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"gpt2",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T10:11:58Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
multimolecule/rnafm
|
multimolecule
| 2024-07-02T10:14:56Z | 0 | 0 |
multimolecule
|
[
"multimolecule",
"pytorch",
"safetensors",
"rnafm",
"Biology",
"RNA",
"fill-mask",
"rna",
"dataset:multimolecule/rnacentral",
"license:agpl-3.0",
"region:us"
] |
fill-mask
| 2024-07-02T10:11:59Z |
---
language: rna
tags:
- Biology
- RNA
license: agpl-3.0
datasets:
- multimolecule/rnacentral
library_name: multimolecule
pipeline_tag: fill-mask
mask_token: "<mask>"
widget:
- example_title: "microRNA-21"
text: "UAGC<mask>UAUCAGACUGAUGUUGA"
output:
- label: "*"
score: 0.3237496316432953
- label: "I"
score: 0.28286001086235046
- label: "."
score: 0.11762786656618118
- label: "A"
score: 0.07875438779592514
- label: "U"
score: 0.06866674870252609
---
# RNA-FM
Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective.
## Disclaimer
This is an UNOFFICIAL implementation of the [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062) by Jiayang Chen, Zhihang Hue, Siqi Sun, et al.
The OFFICIAL repository of RNA-FM is at [ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM).
!!! Success "Reproducibility"
The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing RNA-FM did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
RNA-FM is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
### Variations
- **[`multimolecule/rnafm`](https://huggingface.co/multimolecule/rnafm)**: The RNA-FM model pre-trained on non-coding RNA sequences.
- **[`multimolecule/mrnafm`](https://huggingface.co/multimolecule/mrnafm)**: The RNA-FM model pre-trained on mRNA coding sequences.
### Model Specification
<table>
<thead>
<tr>
<th>Variants</th>
<th>Num Layers</th>
<th>Hidden Size</th>
<th>Num Heads</th>
<th>Intermediate Size</th>
<th>Num Parameters (M)</th>
<th>FLOPs (G)</th>
<th>MACs (G)</th>
<th>Max Num Tokens</th>
</tr>
</thead>
<tbody>
<tr>
<td>RNA-FM</td>
<td rowspan="2">12</td>
<td>640</td>
<td rowspan="2">20</td>
<td rowspan="2">5120</td>
<td>99.52</td>
<td>25.68</td>
<td>12.83</td>
<td rowspan="2">1024</td>
</tr>
<tr>
<td>mRNA-FM</td>
<td>1280</td>
<td>239.25</td>
<td>61.43</td>
<td>30.7</td>
</tr>
</tbody>
</table>
### Links
- **Code**: [multimolecule.rnafm](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnafm)
- **Data**: [RNAcentral](https://rnacentral.org)
- **Paper**: [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062)
- **Developed by**: Jiayang Chen, Zhihang Hu, Siqi Sun, Qingxiong Tan, Yixuan Wang, Qinze Yu, Licheng Zong, Liang Hong, Jin Xiao, Tao Shen, Irwin King, Yu Li
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ESM](https://huggingface.co/facebook/esm2_t48_15B_UR50D)
- **Original Repository**: [https://github.com/ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
You can use this model directly with a pipeline for masked language modeling:
```python
>>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> unmasker = pipeline('fill-mask', model='multimolecule/rnafm')
>>> unmasker("uagc<mask>uaucagacugauguuga")
[{'score': 0.3237496316432953,
'token': 24,
'token_str': '*',
'sequence': 'U A G C * U A U C A G A C U G A U G U U G A'},
{'score': 0.28286001086235046,
'token': 11,
'token_str': 'I',
'sequence': 'U A G C I U A U C A G A C U G A U G U U G A'},
{'score': 0.11762786656618118,
'token': 23,
'token_str': '.',
'sequence': 'U A G C. U A U C A G A C U G A U G U U G A'},
{'score': 0.07875438779592514,
'token': 6,
'token_str': 'A',
'sequence': 'U A G C A U A U C A G A C U G A U G U U G A'},
{'score': 0.06866674870252609,
'token': 9,
'token_str': 'U',
'sequence': 'U A G C U U A U C A G A C U G A U G U U G A'}]
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, RnaFmModel
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnafm')
model = RnaFmModel.from_pretrained('multimolecule/rnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
output = model(**input)
```
#### Sequence Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnafm')
model = RnaFmForSequencePrediction.from_pretrained('multimolecule/rnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Nucleotide Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForNucleotidePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnafm')
model = RnaFmForNucleotidePrediction.from_pretrained('multimolecule/rnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForContactPrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rnafm')
model = RnaFmForContactPrediction.from_pretrained('multimolecule/rnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
RNA-FM used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
### Training Data
The RNA-FM model was pre-trained on [RNAcentral](https://rnacentral.org). RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 27 million RNA sequences in total.
RNA-FM applied [CD-HIT (CD-HIT-EST)](https://sites.google.com/view/cd-hit) with a cut-off at 100% sequence identity to remove redundancy from the RNAcentral. The final dataset contains 23.7 million non-redundant RNA sequences.
RNA-FM preprocessed all tokens by replacing "U"s with "T"s.
Note that during model conversions, "T" is replaced with "U". [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`.
### Training Procedure
#### Preprocessing
RNA-FM used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### PreTraining
The model was trained on 8 NVIDIA A100 GPUs with 80GiB memories.
- Learning rate: 1e-4
- Weight decay: 0.01
- Learning rate scheduler: inverse square root
- Learning rate warm-up: 10,000 steps
## Citation
**BibTeX**:
```bibtex
@article{chen2022interpretable,
title={Interpretable rna foundation model from unannotated data for highly accurate rna structure and function predictions},
author={Chen, Jiayang and Hu, Zhihang and Sun, Siqi and Tan, Qingxiong and Wang, Yixuan and Yu, Qinze and Zong, Licheng and Hong, Liang and Xiao, Jin and King, Irwin and others},
journal={arXiv preprint arXiv:2204.00300},
year={2022}
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [RNA-FM paper](https://doi.org/10.1101/2022.08.06.503062) for questions or comments on the paper/model.
## License
This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
```
|
bethea/dialogue-samsum
|
bethea
| 2024-07-02T10:12:37Z | 0 | 0 |
transformers
|
[
"transformers",
"tensorboard",
"safetensors",
"bart",
"text2text-generation",
"generated_from_trainer",
"dataset:samsum",
"base_model:facebook/bart-base",
"license:apache-2.0",
"model-index",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text2text-generation
| 2024-07-02T10:12:07Z |
---
license: apache-2.0
base_model: facebook/bart-base
tags:
- generated_from_trainer
datasets:
- samsum
metrics:
- rouge
model-index:
- name: dialogue-samsum
results:
- task:
name: Sequence-to-sequence Language Modeling
type: text2text-generation
dataset:
name: samsum
type: samsum
config: samsum
split: validation
args: samsum
metrics:
- name: Rouge1
type: rouge
value: 48.0133
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# dialogue-samsum
This model is a fine-tuned version of [facebook/bart-base](https://huggingface.co/facebook/bart-base) on the samsum dataset.
It achieves the following results on the evaluation set:
- Loss: 0.3249
- Rouge1: 48.0133
- Rouge2: 24.9057
- Rougel: 40.6842
- Rougelsum: 40.6602
- Gen Len: 18.2384
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 4
- eval_batch_size: 4
- seed: 42
- gradient_accumulation_steps: 2
- total_train_batch_size: 8
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- num_epochs: 3
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Rouge1 | Rouge2 | Rougel | Rougelsum | Gen Len |
|:-------------:|:------:|:----:|:---------------:|:-------:|:-------:|:-------:|:---------:|:-------:|
| 0.3968 | 0.9997 | 1841 | 0.3374 | 47.4452 | 24.2213 | 40.0832 | 40.024 | 18.3875 |
| 0.3432 | 2.0 | 3683 | 0.3270 | 47.721 | 24.8189 | 40.4846 | 40.4736 | 18.143 |
| 0.324 | 2.9992 | 5523 | 0.3249 | 48.0133 | 24.9057 | 40.6842 | 40.6602 | 18.2384 |
### Framework versions
- Transformers 4.41.2
- Pytorch 2.3.0+cu121
- Datasets 2.20.0
- Tokenizers 0.19.1
|
multimolecule/mrnafm
|
multimolecule
| 2024-07-02T10:17:11Z | 0 | 0 |
multimolecule
|
[
"multimolecule",
"pytorch",
"safetensors",
"rnafm",
"Biology",
"RNA",
"fill-mask",
"rna",
"dataset:multimolecule/rnacentral",
"license:agpl-3.0",
"region:us"
] |
fill-mask
| 2024-07-02T10:12:14Z |
---
language: rna
tags:
- Biology
- RNA
license: agpl-3.0
datasets:
- multimolecule/rnacentral
library_name: multimolecule
pipeline_tag: fill-mask
mask_token: "<mask>"
widget:
- example_title: "PRNP"
text: "CTG<mask>AAGCGGCCCACGCGGACTGACGGGCGGGGG"
output:
- label: "GAG"
score: 0.09500275552272797
- label: "GGC"
score: 0.09362148493528366
- label: "AAG"
score: 0.07337076216936111
- label: "GAC"
score: 0.07307938486337662
- label: "GUG"
score: 0.06616155058145523
---
# mRNA-FM
Pre-trained model on mRNA CoDing Sequence (CDS) using a masked language modeling (MLM) objective.
## Disclaimer
This is an UNOFFICIAL implementation of the [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062) by Jiayang Chen, Zhihang Hue, Siqi Sun, et al.
The OFFICIAL repository of RNA-FM is at [ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM).
!!! Success "Reproducibility"
The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing RNA-FM did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
RNA-FM is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
### Variations
- **[`multimolecule/rnafm`](https://huggingface.co/multimolecule/rnafm)**: The RNA-FM model pre-trained on non-coding RNA sequences.
- **[`multimolecule/mrnafm`](https://huggingface.co/multimolecule/mrnafm)**: The RNA-FM model pre-trained on mRNA coding sequences.
### Model Specification
<table>
<thead>
<tr>
<th>Variants</th>
<th>Num Layers</th>
<th>Hidden Size</th>
<th>Num Heads</th>
<th>Intermediate Size</th>
<th>Num Parameters (M)</th>
<th>FLOPs (G)</th>
<th>MACs (G)</th>
<th>Max Num Tokens</th>
</tr>
</thead>
<tbody>
<tr>
<td>RNA-FM</td>
<td rowspan="2">12</td>
<td>640</td>
<td rowspan="2">20</td>
<td rowspan="2">5120</td>
<td>99.52</td>
<td>25.68</td>
<td>12.83</td>
<td rowspan="2">1024</td>
</tr>
<tr>
<td>mRNA-FM</td>
<td>1280</td>
<td>239.25</td>
<td>61.43</td>
<td>30.7</td>
</tr>
</tbody>
</table>
### Links
- **Code**: [multimolecule.rnafm](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rnafm)
- **Data**: [RNAcentral](https://rnacentral.org)
- **Paper**: [Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions](https://doi.org/10.1101/2022.08.06.503062)
- **Developed by**: Jiayang Chen, Zhihang Hu, Siqi Sun, Qingxiong Tan, Yixuan Wang, Qinze Yu, Licheng Zong, Liang Hong, Jin Xiao, Tao Shen, Irwin King, Yu Li
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ESM](https://huggingface.co/facebook/esm2_t48_15B_UR50D)
- **Original Repository**: [https://github.com/ml4bio/RNA-FM](https://github.com/ml4bio/RNA-FM)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
You can use this model directly with a pipeline for masked language modeling:
```python
>>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> unmasker = pipeline('fill-mask', model='multimolecule/mrnafm')
>>> unmasker("ctg<mask>aagcggcccacgcggactgacgggcggggg")
[{'score': 0.09500275552272797,
'token': 58,
'token_str': 'GAG',
'sequence': 'CUG GAG AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'},
{'score': 0.09362148493528366,
'token': 67,
'token_str': 'GGC',
'sequence': 'CUG GGC AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'},
{'score': 0.07337076216936111,
'token': 8,
'token_str': 'AAG',
'sequence': 'CUG AAG AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'},
{'score': 0.07307938486337662,
'token': 57,
'token_str': 'GAC',
'sequence': 'CUG GAC AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'},
{'score': 0.06616155058145523,
'token': 73,
'token_str': 'GUG',
'sequence': 'CUG GUG AAG CGG CCC ACG CGG ACU GAC GGG CGG GGG'}]
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, RnaFmModel
tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm')
model = RnaFmModel.from_pretrained('multimolecule/mrnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
output = model(**input)
```
#### Sequence Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm')
model = RnaFmForSequencePrediction.from_pretrained('multimolecule/mrnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Nucleotide Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForNucleotidePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm')
model = RnaFmForNucleotidePrediction.from_pretrained('multimolecule/mrnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, RnaFmForContactPrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm')
model = RnaFmForContactPrediction.from_pretrained('multimolecule/mrnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
RNA-FM used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
### Training Data
The RNA-FM model was pre-trained on [RNAcentral](https://rnacentral.org). RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 27 million RNA sequences in total.
RNA-FM applied [CD-HIT (CD-HIT-EST)](https://sites.google.com/view/cd-hit) with a cut-off at 100% sequence identity to remove redundancy from the RNAcentral. The final dataset contains 23.7 million non-redundant RNA sequences.
RNA-FM preprocessed all tokens by replacing "U"s with "T"s.
Note that during model conversions, "T" is replaced with "U". [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`.
### Training Procedure
#### Preprocessing
RNA-FM used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### PreTraining
The model was trained on 8 NVIDIA A100 GPUs with 80GiB memories.
- Learning rate: 1e-4
- Weight decay: 0.01
- Learning rate scheduler: inverse square root
- Learning rate warm-up: 10,000 steps
## Citation
**BibTeX**:
```bibtex
@article{chen2022interpretable,
title={Interpretable rna foundation model from unannotated data for highly accurate rna structure and function predictions},
author={Chen, Jiayang and Hu, Zhihang and Sun, Siqi and Tan, Qingxiong and Wang, Yixuan and Yu, Qinze and Zong, Licheng and Hong, Liang and Xiao, Jin and King, Irwin and others},
journal={arXiv preprint arXiv:2204.00300},
year={2022}
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [RNA-FM paper](https://doi.org/10.1101/2022.08.06.503062) for questions or comments on the paper/model.
## License
This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
```
|
nerualdreming/model_of_shame
|
nerualdreming
| 2024-07-02T10:25:25Z | 0 | 0 |
diffusers
|
[
"diffusers",
"safetensors",
"license:unknown",
"region:us"
] | null | 2024-07-02T10:12:47Z |
---
license: unknown
---
|
BobbBuilder/openai-whisper-tiny.en
|
BobbBuilder
| 2024-07-02T10:13:40Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2024-07-02T10:13:39Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
nttaii/run_20240702171328
|
nttaii
| 2024-07-02T10:13:46Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T10:13:46Z |
Invalid username or password.
|
Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF
|
Bakanayatsu
| 2024-07-02T10:14:26Z | 0 | 0 | null |
[
"gguf",
"llama-cpp",
"gguf-my-repo",
"text-generation",
"en",
"dataset:openbmb/UltraFeedback",
"base_model:UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3",
"license:gemma",
"region:us"
] |
text-generation
| 2024-07-02T10:13:52Z |
---
base_model: UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3
datasets:
- openbmb/UltraFeedback
language:
- en
license: gemma
pipeline_tag: text-generation
tags:
- llama-cpp
- gguf-my-repo
---
# Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF
This model was converted to GGUF format from [`UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3`](https://huggingface.co/UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3) using llama.cpp via the ggml.ai's [GGUF-my-repo](https://huggingface.co/spaces/ggml-org/gguf-my-repo) space.
Refer to the [original model card](https://huggingface.co/UCLA-AGI/Gemma-2-9B-It-SPPO-Iter3) for more details on the model.
## Use with llama.cpp
Install llama.cpp through brew (works on Mac and Linux)
```bash
brew install llama.cpp
```
Invoke the llama.cpp server or the CLI.
### CLI:
```bash
llama-cli --hf-repo Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF --hf-file gemma-2-9b-it-sppo-iter3-q5_k_m-imat.gguf -p "The meaning to life and the universe is"
```
### Server:
```bash
llama-server --hf-repo Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF --hf-file gemma-2-9b-it-sppo-iter3-q5_k_m-imat.gguf -c 2048
```
Note: You can also use this checkpoint directly through the [usage steps](https://github.com/ggerganov/llama.cpp?tab=readme-ov-file#usage) listed in the Llama.cpp repo as well.
Step 1: Clone llama.cpp from GitHub.
```
git clone https://github.com/ggerganov/llama.cpp
```
Step 2: Move into the llama.cpp folder and build it with `LLAMA_CURL=1` flag along with other hardware-specific flags (for ex: LLAMA_CUDA=1 for Nvidia GPUs on Linux).
```
cd llama.cpp && LLAMA_CURL=1 make
```
Step 3: Run inference through the main binary.
```
./llama-cli --hf-repo Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF --hf-file gemma-2-9b-it-sppo-iter3-q5_k_m-imat.gguf -p "The meaning to life and the universe is"
```
or
```
./llama-server --hf-repo Bakanayatsu/Gemma-2-9B-It-SPPO-Iter3-Q5_K_M-GGUF --hf-file gemma-2-9b-it-sppo-iter3-q5_k_m-imat.gguf -c 2048
```
|
Makkoen/whisper-medium.en-cit-do015-wd0-lr1e-06-1000
|
Makkoen
| 2024-07-02T12:16:19Z | 0 | 0 |
transformers
|
[
"transformers",
"tensorboard",
"safetensors",
"whisper",
"automatic-speech-recognition",
"generated_from_trainer",
"en",
"base_model:openai/whisper-medium.en",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] |
automatic-speech-recognition
| 2024-07-02T10:14:04Z |
---
language:
- en
license: apache-2.0
base_model: openai/whisper-medium.en
tags:
- generated_from_trainer
metrics:
- wer
model-index:
- name: ./openai/whisper-medium.en-cit-do015-wd0-lr1e-06-1000
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# ./openai/whisper-medium.en-cit-do015-wd0-lr1e-06-1000
This model is a fine-tuned version of [openai/whisper-medium.en](https://huggingface.co/openai/whisper-medium.en) on the SF 1000 dataset.
It achieves the following results on the evaluation set:
- Loss: 0.6953
- Wer Ortho: 26.2768
- Wer: 14.7572
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 1e-06
- train_batch_size: 4
- eval_batch_size: 8
- seed: 42
- distributed_type: multi-GPU
- gradient_accumulation_steps: 4
- total_train_batch_size: 16
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- lr_scheduler_warmup_steps: 100
- training_steps: 500
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Wer Ortho | Wer |
|:-------------:|:------:|:----:|:---------------:|:---------:|:-------:|
| No log | 0.4444 | 25 | 1.5811 | 45.2632 | 31.9044 |
| 1.7463 | 0.8889 | 50 | 1.3848 | 39.1033 | 27.0106 |
| 1.7463 | 1.3333 | 75 | 1.2178 | 35.7505 | 23.0273 |
| 1.3387 | 1.7778 | 100 | 1.0166 | 36.1014 | 23.4446 |
| 1.3387 | 2.2222 | 125 | 0.8784 | 31.9298 | 19.1958 |
| 0.988 | 2.6667 | 150 | 0.8340 | 30.8382 | 18.4750 |
| 0.988 | 3.1111 | 175 | 0.8027 | 30.3314 | 17.7162 |
| 0.8856 | 3.5556 | 200 | 0.7812 | 29.6686 | 17.4127 |
| 0.8856 | 4.0 | 225 | 0.7651 | 30.1365 | 17.6783 |
| 0.7927 | 4.4444 | 250 | 0.7515 | 29.2008 | 16.8816 |
| 0.7927 | 4.8889 | 275 | 0.7402 | 28.2651 | 15.6677 |
| 0.7482 | 5.3333 | 300 | 0.7300 | 27.9922 | 15.5159 |
| 0.7482 | 5.7778 | 325 | 0.7217 | 27.8752 | 15.6677 |
| 0.7275 | 6.2222 | 350 | 0.7153 | 27.4854 | 15.4021 |
| 0.7275 | 6.6667 | 375 | 0.7085 | 27.3684 | 15.3642 |
| 0.7003 | 7.1111 | 400 | 0.7041 | 26.6277 | 14.6813 |
| 0.7003 | 7.5556 | 425 | 0.7002 | 26.3158 | 14.7572 |
| 0.6763 | 8.0 | 450 | 0.6973 | 26.2378 | 14.6055 |
| 0.6763 | 8.4444 | 475 | 0.6963 | 26.4327 | 14.7951 |
| 0.6687 | 8.8889 | 500 | 0.6953 | 26.2768 | 14.7572 |
### Framework versions
- Transformers 4.42.3
- Pytorch 1.13.1+cu117
- Datasets 2.20.0
- Tokenizers 0.19.1
|
aks1s/13-flow-2
|
aks1s
| 2024-07-02T10:14:57Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T10:14:12Z |
Entry not found
|
finn03091993/naschainv248
|
finn03091993
| 2024-07-02T10:14:55Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T10:14:53Z |
Entry not found
|
nttaii/run_20240702171623
|
nttaii
| 2024-07-02T10:16:23Z | 0 | 0 | null |
[
"region:us"
] | null | 2024-07-02T10:16:23Z |
Invalid username or password.
|
Peacoc/37_best_t_16_5
|
Peacoc
| 2024-07-02T10:18:38Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"llama",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] |
text-generation
| 2024-07-02T10:16:27Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
fastinom/Ndebele_ASR
|
fastinom
| 2024-07-02T15:26:29Z | 0 | 0 |
transformers
|
[
"transformers",
"tensorboard",
"safetensors",
"wav2vec2",
"automatic-speech-recognition",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] |
automatic-speech-recognition
| 2024-07-02T10:16:46Z |
---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
|
aks1s/14-flow-2
|
aks1s
| 2024-07-02T10:18:19Z | 0 | 0 |
transformers
|
[
"transformers",
"safetensors",
"stablelm",
"text-generation",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] |
text-generation
| 2024-07-02T10:17:34Z |
Entry not found
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.