_id
stringlengths 7
16
| description
stringlengths 55
95.2k
|
|---|---|
pmc-6326137-1
|
A 29-year-old man presented at the emergency department with a gunshot wound to the left arm that had transfixed the anterior area of the arm (near the shoulder) and hit the thorax in the axillary area ( ). There was no exit wound.
The patient was hemodynamically stable, but exhibited dyspnea and decreased breath sounds from the left chest. The remainder of the physical examination was unremarkable. The left thorax was drained through a chest tube, and the patient was then transferred to a reference trauma hospital.
The initial radiographic examination showed a projectile in the upper left thigh. Contrast-enhanced tomography showed a pseudo-aneurysm in the descending thoracic aorta ( ) and located the bullet inside the proximal superficial femoral artery ( ). The secondary physical examination found diminished left pedal pulses, with no temperature change in comparison to the contralateral limb, and the patient experienced left toe numbness.
The patient was then transferred to a hybrid operation room and, after initial right femoral puncture and pigtail angiographic control ( ), a left femoral incision was made followed by retrograde positioning of a 24 mm × 130 mm endograft that adequately sealed the descending thoracic aortic defect ( ) and allowed for bullet retrieval and thromboembolectomy ( ). The patient had an uneventful recovery and was discharged on postoperative day 5.
|
pmc-6326140-1
|
The patient was a 63-year-old female with hypertension and diabetes. She had no history of smoking or heart disease. She had undergone surgery to clip a cerebral aneurysm 3 years previously and the treating neurosurgeon responsible at the time had reported difficulty with catheterization of cervical arteries. She was examined with Doppler ultrasonography of carotid and vertebral arteries, which showed that the left common carotid artery had a smaller caliber than the right ( ), the left carotid bifurcation could not be observed, and the left common carotid artery only led to the left external carotid artery ( ). Angiotomography was ordered, showing agenesis of the left internal carotid artery ( ). The patient remains asymptomatic and attends regular follow-up consultations.
|
pmc-6326142-1
|
A 29-year-old woman was found unresponsive near a snowy mountain trail in winter. On that day, the outside air temperature ranged from − 2.0 to 1.0 °C. When emergency medical services arrived on the scene, they found that the patient was in cardiac arrest and in asystole. It was noticed that she also had mandibular rigidity. On the way to the hospital, emergency medical service staff were unable to insert an oral airway device for ventilation because the mandibular rigidity prevented sufficient mouth opening. The chest was compressible. CPR was performed with manual chest compression and bag valve mask ventilation ratio of 30:2 during transportation. When she was admitted to the hospital, 52 min had passed since she was discovered. She remained in cardiac arrest with an asystolic cardiac rhythm. Her initial core temperature was 22 °C measured by bladder thermistor. Her mandibular rigidity remained, and neck mobility was also restricted. Both elbows and knees could be passively bent with resistance and the chest wall was not stiff. We were concerned that postmortem changes (i.e., rigor mortis) had begun. We tried to force open her mouth for intubation and found that it could be slightly opened. Although this was insufficient to visualize the vocal cords with a conventional laryngoscope because of the impossibility of controlling it, we were able to insert an “Airway scope™” video laryngoscope, which allowed successful intubation. Although the patient was in cardiac arrest due to severe accidental hypothermia, which indicated an enhanced possibility of successful resuscitation, the mandibular rigidity connected, along with the supposition of rigor mortis initiation made us believe that it would be difficult to resuscitate successfully. However, her initial blood gas analysis revealed that her serum potassium level was 5.4 mmol/L (Table ). We decided to use veno-arterial ECMO to generate effective systemic perfusion and to rewarm the patient. After ECMO initiated, her temperature transiently dropped to 20.9 °C, then little by little turned to rise. Although she initially remained in asystole after ECMO was introduced, low amplitude ventricular fibrillation gradually appeared as her temperature rose, and the amplitude of ventricular fibrillation progressively increased. At this time, she started breathing spontaneously and her mandibular rigidity disappeared. Once her temperature reached 28 °C, we used defibrillation to achieve sinus rhythm and restore her circulation. Her temperature reached 36 °C after 165 min of ECMO (Fig. ).
After admission to the intensive care unit, her hemodynamic status gradually improved, ECMO was stopped on day 2, and she was discharged from the intensive care unit on day 12. The content of the patient’s bag revealed empty packages of a sleeping drug and a half-finished bottle of alcohol. On regaining consciousness, the patient confessed that she consumed the sleeping drugs and alcohol in an effort to commit suicide.
She was moved to another ward for rehabilitation and showed no neurological impairments on day 42 after the cardiac arrest event.
|
pmc-6326144-1
|
A 57-year-old female with medical history significant for seizures and breast cancer status-post mastectomy presented to a free-standing ED with chief complaint of headaches, lethargy, diarrhea, and light headedness. She had been treated with neoadjuvant therapy for the breast cancer 12 years prior to admission and was in remission at the time of presentation. The patient reported dysuria, urinary frequency, and urgency 2 days prior to admission for which she took over-the-counter phenazopyridine for symptom relief. Over the subsequent 48 h, she took approximately 24 tablets for persistent symptoms, and started to develop a headache, lethargy, and light-headedness, prompting the visit to the free-standing ED. The patient denied fevers, productive sputum, or recent changes in her regular medications apart from starting the phenazopyridine. Her medications included amitriptyline, cetirizine, clonazepam, diclofenac gel, fluticasone, pramipexole, pregabalin, and vitamin D supplements.
While in the ED, the patient was noted to be tachycardic to 100–110, blood pressure 146/77, and respiratory rate 18 with clear breath sounds bilaterally, but pale and cyanotic appearing lips, hands, toes, with pulse oximeter readings of 80–88%. Chest X-ray did not show focal infiltrates. A non-contrasted head CT scan was negative. A basic metabolic panel was unremarkable, the white blood cell count was normal, but the hemoglobin was 10.5 g/dl and hematocrit 33.6%. The patient was placed on supplemental oxygen via nasal cannula with no change in her O2 saturations via pulse oximetry. Urinalysis showed positive white blood cells and was noted to be a deep red-orange color (attributed to the phenazopyridine).
Given continued hypoxia despite supplemental oxygen administration and in the context of phenazopyridine use, prior malignancy, and lack of current anticoagulation, drug-induced methemoglobinemia and pulmonary embolus were considered the most likely diagnoses. An arterial blood gas (ABG) was obtained and revealed a PO2 151 mmHg and arterial O2 saturation of 99% making methemoglobinemia the most likely diagnosis. The blood was noted to be dark. This free-standing ED does not have capabilities to test co-oximetry and did not have methylene blue available, so the patient was transferred to the hospital-based ED where she was found to have a methemoglobin level of 24.2% on arterial blood gas and CT chest negative for pulmonary embolus. Methylene blue (100 mg intravenous) was administered with near immediate improvement in oxygenation and headache.
Upon hospital admission to the internal medicine service, the patient was started on nitrofurantoin for a urinary tract infection and did not require additional doses of methylene blue. Her methemoglobin level improved to 5.6% the following day. Her oxygenation remained appropriate throughout the hospitalization. The patient was discharged with resolution of symptoms and has remained symptom free.
|
pmc-6326148-1
|
A 72-year-old man was injured when the bicycle he was riding collided with a car (we estimated that the time of injury was 4 h after the last taking of dabigatran). On hospital arrival, his Glasgow Coma Scale (GCS) score was 14 (eyes, 3; verbal, 5; motor, 6), and his vital signs were stable.
Arterial blood gas analysis results while receiving oxygen by reservoir mask at a rate of 8 L/min and blood test findings are shown in Table . Whole-body computed tomography (CT) showed a right temporal lobe contusion, acute subdural hematoma, zygomatic bone fracture, and third lumbar compression fracture. A representative head CT image is shown in Fig. .
We planned a follow-up CT 3 h later and observed him carefully in the intensive care unit. The second CT showed that the temporal lobe hematoma had increased to 80 × 80 × 40 mm (Fig. ). At this time (7.5 h after the last taking of dabigatran), his GCS score was 13 (eyes, 3; verbal, 4; motor, 6) and manual muscle test results of 3/5 degrees indicated left hemiplegia. We decided to perform an emergency craniotomy for hematoma removal. At this time, we were informed of his medical history and daily prescriptions by his primary care hospital.
His past medical history included atrial fibrillation, and his daily prescriptions included dabigatran 220 mg. Immediately after learning this, we administered 5 g of idarucizumab by intravenous injection at 5.5 h after the injury (9.5 h after the last taking of dabigatran), and the craniotomy was begun at 6.5 h after the injury. There was no bleeding tendency during surgery, no blood transfusions were required, and the amount of bleeding was small.
After the surgery, the CT findings revealed that the intracranial hematoma had been removed (Fig. ), and blood test findings were PT 46%, aPTT 43.9 s, and FDP D-dimer 22.6 μg/mL. The clinical course, laboratory data, and head CT images are shown in Fig. . We resumed his dabigatran on postoperative day (POD) 7. A ventriculoperitoneal shunt operation was performed for hydrocephalus on POD 47. He was transferred to a rehabilitation hospital with a Glasgow Outcome Scale score of 3 on POD 102.
Idarucizumab is a humanized monoclonal antibody fragment that binds dabigatran with 350-fold higher affinity than that of dabigatran for thrombin and rapidly reverses its anticoagulant activity. Guidelines for the use of idarucizumab include life-threatening bleeding, bleeding into a critical organ or closed space, prolonged bleeding despite local hemostatic measures, high risk of recurrent bleeding because of overdose or delayed clearance of a drug, and the need for an urgent intervention associated with a high risk of bleeding [].
Dabigatran has the longest half-life (12–17 h) of any of the DOACs [, ]. The dabigatran concentration in the blood in the present patient was thought to be at a high level from the time of injury to the administration of idarucizumab, which likely resulted in the expansion of the intracranial hematoma. It has been recognized that trauma-associated coagulopathy is more common in patients with traumatic brain injury. The coagulopathy results in poor outcomes due to delayed or progressive bleeding and ischemic secondary injury [–].
|
pmc-6326434-1
|
A 24-year-old female patient presented to our clinic with dyspnea. She had undergone
a left pneumonectomy for advanced and complicated bronchiectasis 10 years ago.
She had marfanoid habitus, pectus excavatum, scoliosis, and a grade 4,
pansystolic, high-pitched, blowing murmur best heard at the right sternal border
( and ).
Transthoracic echocardiogram revealed severe mitral regurgitation due to
myxomatous mitral valve with bileaflet prolapse and chordal elongation,
secondary pulmonary hypertension, and tricuspid regurgitation with a dilated
right atrium. Her ejection fraction was 35%, left ventricle end-diastolic
diameter was 72 mm, and end-systolic diameter was 59 mm. She also had a
borderline ascending aortic aneurysm measuring 40 mm in diameter. Pulmonary
function test demonstrated reduced forced vital capacity (FVC), 1.11 L (31.7% of
predicted), and reduced forced expiratory volume in 1st second
(FEV1), 1.05 L (34.6% of predicted). A contrast-enhanced computed
tomography (CT) scan was performed to examine the mediastinal structures and
alternative cannulation sites ().
Heart and great vessels were displaced to the left, and the right lung was
enlarged and crossing the midline, anterior to the heart. The proxymal ascending
aorta was 40 mm in diameter. Additionally, a chronic type B aortic dissection
was present. CT scan revealed that the ascending aorta and the superior and
inferior venae cavae were suitable for cannulation.
The patient received intensive chest physiotherapy before surgery to reduce
postoperative pulmonary complications.
A vertical midline incision on skin, subcutaneous tissues, and pectoralis fascia
was made over the sternum. Following elevation of pectoralis muscles from the
anterior chest wall, a median sternotomy was performed. Costal cartilages of the
3rd to 8th ribs were removed. The right lung was
retracted from the midline. Cardiopulmonary bypass (CPB) was initiated via
ascending aortic and bicaval cannulation, and cardiac arrest was obtained. We
did not use topical cardiac hypothermia to prevent phrenic nerve injury. Both
atria were relatively easy to expose due to leftward shift and rotation of the
heart. A mitral valve replacement and a tricuspid ring annuloplasty was
performed using biatrial approach. CPB was terminated. A bar was placed behind
the sternum and fixed to the pectoralis muscle fibers bilaterally. After
completion of the Ravitch procedure, the sternum was closed. The patient was
transferred to a dedicated cardiac surgery intensive care unit and she was
successfully extubated at the postoperative 6th hour. Her recovery
was uneventful and she was discharged on postoperative day 9 ( and ).
The patient remains symptom-free 3 months after surgery and she is scheduled to
have a bar removal 3 months later ( and ).
The presents a timeline of
interventions and outcomes.
|
pmc-6326445-1
|
A 59-year-old male patient had no complaints about AVF previously. His medical
history includes hypertension, type 2 diabetes mellitus, 4 CAGs, and a coronary
artery bypass graft surgery six years ago. In 2016, the latest history of CAG was
available. During the examination for the fifth angiogram, DUS was performed on the
leg with slight edema and murmur present on the previous CAG procedure site. An AVF
was detected, between the right superficial femoral artery and superficial femoral
vein with a diameter of about 3 mm in the DUS.
After consultation of interventional radiology, endovascular treatment was decided.
Under local anesthesia, the right femoral artery was reached, and the right lower
extremity angiograms were obtained after appropriate manipulations. A fistula was
located between the superficial femoral arter and the superficial femoral vein
(). The femoral vein was reached
after passing through the fistula tract. The catheter was then withdrawn slowly to
try to embolize with cyanoacrylate (glue). However, the glue could not be stabilized
due to the high flow. Although the balloon catheter was inflated for a long period
with low pressure in the fistula region, the flow to the vein via fistula could not
be prevented. Then, the patient was informed about the endovascular stent. However,
the patient preferred a surgical intervention instead of stenting.
Common femoral artery, superficial femoral artery and superficial femoral vein were
turned by right inguinal exploration with local anesthesia. An AVF of about 3 mm in
diameter was seen 1 cm distal to the bifurcation. Clamps were placed on the arterial
and venous sides and the fistula tract was cut from the center. Both vascular
structures, first by the artery, were repaired by 6/0 prolene. The postoperative
murmur disappeared and no fistula tract was seen in DUS.
|
pmc-6326446-1
|
RRF, male, 30 years old, who complained of dyspnea on average efforts since
childhood, with no other associated symptoms, which showed improvement at rest. He
did not present antecedent of angina pain and syncope. Smoker of 20 cigarettes a day
since 15 years of age, without comorbidities or previous surgeries. At physical
examination, cardiac auscultation identified normal rhythmic sound, two-click, with
a holosystolic (3+/6+) audible murmur in aortic and mitral foci, with irradiation to
the left axilla.
There was no carotid murmur, jugular swelling, hepatomegaly or lower limb edema.
Other systems did not present alterations. The patient was admitted to the Cardiac
Surgery Service for evaluation.
A transthoracic echocardiogram was performed, which showed left ventricular
hypertrophy with presence of subaortic membrane, determining medium/maximum left
ventricular outflow tract gradient of 64/139 mmHg at rest.
Discrete mitral regurgitation and aortic valve dysplasia with mild to moderate
insufficiency were also noted. The overall systolic performance of the left
ventricle was preserved, with ejection fraction of 75% by the Teichholz method. In
order to correct aortic subvalvar stenosis, the patient was referred to cardiac
surgery via median sternotomy with cardiopulmonary bypass and intermittent cold
blood cardioplegia, the cavas were cleared. Oblique aortotomy and transeptal access
to the mitral valve were performed. During surgery, papillary muscle anomaly, with
two supernumerary muscles inserted at the base of the anterior cusp of the mitral
valve, obstructing the left ventricular outflow tract was identified. There was a
subaortic membrane in the region of the interventricular septum and the aortic valve
was slightly thickened and with prolapse of the non-coronary cusp. The papillary
anomalous muscles and the subaortic membrane were resected through aortotomy after
soft traction of the aortic valve cusps ( to ). Finally, a Carpentier 26
ring was implanted in the mitral valve by transeptal access. The patient left
surgery hemodynamically stable, without vasoactive drugs, and was referred to the
Intensive Care Unit of the Service, where he stayed for two days under intensive
care and monitoring.
After surgery the patient had an uneventful recovery and was discharged on the fifth
postoperative day. At the time of hospital discharge, a new transthoracic
echocardiogram was performed, which showed mild aortic insufficiency, absence of
mitral regurgitation, and left ventricular outflow tract maximal gradient of 32
mmHg.
One month after surgery, a 24-hour Holter, which showed no significant changes, and a
new transthoracic echocardiogram, which showed maintenance of mild aortic failure
and absence of mitral regurgitation were performed. The left ventricular outflow
tract maximal gradient was 16 mmHg. The patient remained asymptomatic. After six
months, the patient remained symptom-free and a new echocardiogram revealed mild
aortic and mitral valve thickening, maximum/median gradient through the aortic valve
of 28/18 mmHg and through the mitral valve of 9/4 mmHg, without failure.
|
pmc-6326454-1
|
Case 1: 65-year-old female patient, underwent triple CABG three months ago, applied
to us with angina pectoris appearing after 50-100 m of walking. She had been under
medical treatment of acetylsalicylic acid 100 mg and metoprolol 100 mg. Effort test
of the patient whose physical examination and resting electrocardiography (ECG) were
normal unveiled ST depression ().
Coronary angiography performed in the patient revealed a well-developed LITA side
branch at a distance of 2-2.5 cm from the origin of LITA (). The accessory branch, being one and a half times the
diameter of LITA, was extending to the lateral thoracic wall, where it was making
anastomoses with lateral intercostal arteries and thus supplying blood to anterior
and posterior side of the lateral thoracic wall. It was detected that this accessory
thoracic artery, the LCA, was stealing a large part of the myocardial blood flow to
lateral thoracic wall. The LCA was obliterated via coil embolization (). The patient's effort capacity had
improved and no ST segment change was observed in the effort test performed one
month after the coil embolization of the lateral costal artery.
|
pmc-6326454-2
|
Case 2: 56-year-old female patient expressed unstable angina pectoris and dyspnea
within the first week after CABG. Transthoracic ECG revealed left ventricular free
wall motion abnormality and 1-2 mitral valve regurgitation. Ejection fraction was
30-35% (). Coronary angiography was
performed in the patient who has been under medical treatment for diabetes mellitus
for 15 years. It exposed the LCA which arose from the LITA at a distance of 2-2.5 cm
from the origin of LITA. It was extending to the 6th intercostal space
and was two thirds the diameter of the LITA. It was postulated that the LCA had
aggravated the steal phenomenon, therefore it was obliterated via coil embolization.
After LCA obliteration, the patient's angina disappeared, but dyspnea persisted.
Since she had advanced restrictive lung disease, she referred to a pulmonologist
with medical treatment comprising of acetylsalicylic acid 100 mg, metoprolol 100 mg,
spironolactone 50 mg and hydrochlorothiazide 50 mg.
|
pmc-6326454-3
|
Case 3: 71-year-old male patient, underwent triple CABG one month ago, applied to our
emergency department with unstable angina pectoris. His ECG record displayed ST
segment elevation and troponin-T value was measured 0.45 ng/ml (). In primary percutaneous coronary
intervention, it was detected that the left subclavian artery (SCA) was proximally
occluded, the LITA graft was patent, and there was a LITA side branch, thought to be
the LCA, which was one third the diameter of the LITA. The LCA was extending to the
6th rib and making anastomoses with intercostal arteries. First,
balloon angioplasty was performed in the left SCA. Then, the lesion causing 80% left
anterior descending artery (LAD) stenosis was stented. After that, the LCA was
obliterated via coil embolization. Finally, the left SCA was stented. Stent placed
in the SCA also occluded the LITA ostium inadvertently. The patient, being
hemodynamically stable, was discharged from the hospital a week after admission with
a medical treatment comprising of acetylsalicylic acid mg and metoprolol 100 mg. In
follow-up visits, cardiac parameters have been found to be normal.
In our institution, LITA flow measurement is done by intraoperative free-bleeding
technique. LITA is harvested and explored using electrocautery and metallic clips.
Topical application of 0.2% papaverin solution at 37ºC is routinely done to prevent
LITA spams. In the free-bleeding technique, the harvested LITA graft, before any
balloon dilatation or topical papaverin application, is let to freely bleed from the
distal end to a measuring cylinder for a minute while the heart rate and arterial
tension are within normal limits. After measuring the total volume of blood in the
cylinder, LITA graft with flow of 30 ml/min or more is considered to be proper for
bypass grafting ().
|
pmc-6326915-1
|
A 63-year-old Japanese man without any medical history was referred to our hospital for right-sided pleuritic chest pain and fever. Laboratory investigations revealed a total leukocyte count of 7690/mm3 and serum C-reactive protein level of 17.8 mg/dL. Liver and kidney function tests were normal; sputum culture was negative. Chest computed tomography (CT) revealed a right basilar peripheral opacity and an ipsilateral reactive pleural effusion (Fig. a). The patient was treated for bacterial pneumonia with ceftriaxone (1.0 g twice per day), but experienced persistent fever of 39 °C until day 7 after admission. Therefore, contrast-enhanced CT was performed (Fig. b, c). Increased right pleural effusion and aggravated infiltration were observed, for which the patient was referred to our department (respiratory surgery). Contrast-enhanced CT showed a filling defect in the inferior lobar artery of the right lung, supporting a diagnosis of pulmonary embolism with reactive pleural effusion (Fig. b, c). The treatment strategies included anticoagulation therapy, thoracic drainage of the affected side, meropenem administration, and antibiotic protocol escalation. However, the fever did not subside; moreover, the leukocyte count increased to 15,300/mm3 by the third day after initiation of the new treatment (day 10 of admission). Therefore, contrast-enhanced CT was repeated, which revealed residual infiltration at the pulmonary embolism site in the right inferior lobe, with a cavity that measured 1.2 cm (Fig. d). Based on these findings, necrosis at the pulmonary parenchymal embolism site was considered progressive. Because we suspected that medical therapy alone would not be curative, we performed resection of the right lower lobe containing the embolism site. Pathology analysis showed a light brown thrombus in the pulmonary artery, with septic necrosis only in the peripheral parenchyma of the infarcted lung (Fig. a–c). Macroscopic examination in this case revealed three layers of tissues (proximal to distal): normal lung, intra-alveolar hemorrhage, and pulmonary necrosis (Fig. b). Postoperatively, meropenem was administered for 8 days; a new oral anticoagulant was administered for 3 months beginning on postoperative day 1 (edoxaban 30 mg/day). The postoperative course was uneventful; the patient has remained alive and disease-free for 18 months.
|
pmc-6327260-1
|
A 9-year-old girl visited a local clinic with a major complaint of asymptomatic macroscopic hematuria. Her height was 129 cm and weight was 29 kg. No particular family/medical/birth history was noted. Results of biochemical tests and urine analyses were within the normal range, and urine cytology showed class I. Plain computed tomography (CT) () and plain magnetic resonance imaging (MRI) () showed a 10-mm nodular tumor in the bladder neck, located in the direction of 10 o'clock. The patient was diagnosed with bladder tumor, and transurethral resection of the bladder tumor (TUR-Bt) was performed in the local clinic (). Histopathological tests showed alveolar-structured intense proliferation of tumor cells with a large acidophilic cytoplasm accompanied by abundant capillary vessels (). Tumor cells were positive for periodic acid-Schiff (PAS) (), but negative for PAS after diastase digestion. Immunostaining results were positive for TFE3 (), smooth muscle actin, MyoD1, and p53, while they were negative for HMB45, melan A, S100, CD1a, desmin, h-caldesmon, myogenin, myoglobin, EMA, and CAM5.2. Muscular, epithelial, and melanoma markers were negative. According to those findings, the patient was diagnosed with ASPS. As a positive surgical margin of TUR indicated residual tumor cells, the patient was referred to our children's hospital for more detailed investigation and specialized care. Additional examinations performed in our hospital including cystoscopy, contrast-enhanced CT, contrast-enhanced MRI, and positron emission tomography (PET) did not indicate any obvious residual tumor in the bladder. However, after careful consideration regarding a therapeutic strategy, we determined that cystourethrectomy was indicated due to the possibility of residual tumor in the bladder. For urinary diversion, construction of a continent urinary reservoir for self-catheterization (Mainz pouch technique) and the abdominal (umbilical) continent catheterizable stoma using the appendix were selected. No residual tumor was observed macroscopically or histopathologically in the removed bladder. The patient's clinical course after surgery has been favorable. She performs clean intermittent self-catheterization using the abdominal (umbilical) continent catheterizable stoma six times per day, and to date, no urinary incontinence or stricture of the catheterization route has been observed. The patient is under the postoperative follow-up observation with triannual contrast-enhanced CT and annual PET scan. To date, for 2.5 years postoperatively, the patient has been free of any local recurrence or distant metastasis of sarcoma.
|
pmc-6327269-1
|
The first case we present is that of a 29-year-old woman who presented to the clinic with the complaint of an enlarging left breast mass. She first noticed that this mass almost 2 years ago and mentions that it has been growing in size and becoming more erythematous and tender. She did not report any recent weight loss or change in appetite. She is married with 2 children, and she does not have any illnesses. She smokes hubble-bubble almost 4 times per week and does not drink alcohol. Surgical history is significant for 2 previous Cesarean sections with no complications. History of her current illness dates back to June 2016 when the patient felt a mass in her left breast; upon further investigation, she was diagnosed with idiopathic granulomatous mastitis and later (December 2017) developed an abscess that drained on its own. She was initially treated with methotrexate and later switched to prednisone and mycophenolate with minimal improvement. At the clinic, her vitals were within normal limits, and on physical examination, there was a left breast lump found at the upper inner quadrant with some erythema and inflammation surrounding it. Moreover, there was some skin retraction in this area.
Core biopsy done at an outside hospital in June 2017 revealed no granulomas. Ultrasound done at that time showed a persistent ill-defined hypoechoic mass that appeared initially subdermally and was spanning more than 4 × 1.4 cm. Moreover, multiple deeper masses were seen, one of which was not located within the breast measuring 12.3 × 8.5 mm. Axillary nodes were insignificant and not well appreciated on imaging.
Fine-needle aspirate done in July 2017 was negative for malignancy and was reported to have abscess formation. The slides revealed a heavy inflammatory infiltrate predominantly composed of polymorphonuclear leukocytes. No ductal epithelial cells were seen.
Core biopsy done in November of the same year showed multiple noncaseating epithelioid granulomas composed of epithelioid histiocytes, lymphocytes, neutrophils, and occasional multinucleated giant cells. Some granulomas contained neutrophils forming microabscesses with surrounding empty microcysts ().
The Ziehl–Neelsen stain for acid-fast bacilli was negative. This leads to the diagnosis of idiopathic granulomatous mastitis which is a diagnosis of exclusion.
A repeat MRI done during June 2018 showed heterogeneous fibroglandular tissue with mild background enhancement. There are also numerous tiny rim-enhancing fluid collections in the left breast, the largest measuring 8 mm involving the upper inner and lower inner quadrants, some of which are fistulizing to the skin. Findings have regressed compared to the prior MRI.
As with the previous MRI, no enlarged axillary or internal mammary adenopathy was seen.
Those findings are consistent with biopsy-proven idiopathic granulomatous mastitis extensively involving the upper and lower inner quadrants of the left breast.
|
pmc-6327269-2
|
Our second patient is a 47-year-old woman, mother of 4 children with a past medical history of a left renal stone for which she underwent lithotripsy. Her past surgical history includes an appendectomy and cholecystectomy. She presented to the clinic in June 2016 as she felt a lump in her right breast along with some induration that has been present for the past 3 months. She was treated with augmentin, with no significant improvement.
On physical exam, there were 2 areas of induration associated with palpable masses that were tender to touch, but there were no palpable lymph nodes.
Ultrasound done in May 2016 showed a persistent large area of decreased echogenicity involving predominantly the upper outer quadrant of the right breast showing areas of fistulization to the skin and exhibiting increased vascularity. No suspicious lesions or enlarged lymph nodes were palpated on the left.
Core biopsy showed moderate acute and chronic inflammation predominantly around the ducts. Multiple, noncaseating granulomas were noted containing multinucleated giant cells. There was no evidence of malignancy. Methenamine stain (GMS) and acid-fast stains for fungi and mycobacteria were both negative.
A fine-needle aspirate (FNA) performed on an enlarged lymph node showed no metastatic carcinoma. Findings were consistent with a reactive lymph node.
She underwent a partial mastectomy in August 2016, and her wound was healing well. Moreover, the surgical pathology showed the same findings as the core biopsy which includes severe granulomatous mastitis with no evidence of malignancy. The patient would continuously follow up at the clinic, and her last appointment was in August 2017 where she presented with another nodule away from the scar site without any nipple discharge or erythema. The lesion is almost 1.3 cm big. It was shown that she has recurrent disease which is typical of granulomatous mastitis as it is chronic with high rates of recurrence.
|
pmc-6327270-1
|
A one-year-old girl presented with a 1 x 1 cm occipital swelling, present since birth, with no associated neurological symptoms. CT brain revealed the soft tissue swelling to be extracranial with calcific specks. Operatively, the swelling was located in the occipital skin with no intracranial connection. It was excised and sent for histopathological examination.
The specimen consisted of skin and subcutaneous tissue measuring 2 x 1 x 1 cm. A nodular projection 1 cm across was present on the skin. Cut surface of the specimen was diffusely grey white and smooth with no distinct nodularity or cysts. The entire tissue was paraffin processed.
Haematoxylin–eosin stained sections showed the lesion, located in the deep dermis and subcutis, with ill-defined boundaries and consisting of haphazardly oriented collagen bands, lobules of fat, and clusters of blood vessels ().
The connective tissue was edematous at places and showed many plump fibroblastic cells. A striking feature was the presence of anastamosing spaces resembling vascular channels. These, along with the prominent clusters of larger blood vessels, suggested the possibility of an angiomatous neoplasm or hamartomatous lesion. ()
Careful examination under higher magnification revealed a few irregular clusters of cells insinuated between collagen fibres and encircling collagen bands (Figures and ).
Some of these clusters showed mild nuclear irregularity and hyperchromasia ().
Focal calcification was present along with a few histiocytes and giant cells around. Immunostaining was performed for meningothelial and endothelial markers. Cells lining the spaces and forming clusters
Strongly expressed vimentin and EMA. Endothelial markers (CD 34 and CD 31) gave negative results. (Figures and ) [].
A diagnosis of ectopic meningothelial hamartoma of the scalp was made.
|
pmc-6327282-1
|
The authors report a case of a 36-year-old active man with no relevant medical history, who went to the emergency department due to a diffuse headache and dizziness, with a 3-day course after a long bicycle ride. The patient referred that these symptoms were usual after an intense physical activity as he regularly performed in cycle races. He was admitted to Neurology observation in the Emergency Room (ER). On examination, there were no evident de novo neurological signs. A cerebral CT was performed, and it was normal. He was then referred to Ear, Nose, and Throat (ENT) observation due to suspicion of peripheral vertigo.
The ENT examination revealed a horizontal-rotatory nystagmus, with rapid phase to the right, that was exhaustible in the gaze, however with a normal head impulse test. The Neurology ER team assumed noncentral vertigo since at this time there was no evidence of any signs of a central cause, neither in physical examination nor in the imaging test performed. This diagnosis seemed the most likely to the team. He was admitted to the ENT ward, and symptomatic and medical treatment was initiated. There was clinical stabilization until the 3rd day, when sudden symptoms and signs emerged: ipsilateral downward fall, right hemifacial paresthesia, right hemifacial pain, ipsilateral limb ataxia with ataxic gait, and diplopia. An emergent magnetic resonance angiography revealed “(…) hyperintense area in T2 and T2 FLAIR in the dorsal lateral aspect of the right bulb that in the diffusion study showed a marked restriction (…).” In the arteriography study, it was identified that “an occlusion of the right vertebral artery was identified in segment V2, after showing progressive reduction and contour irregularity” ().
The patient was transferred to the Cerebrovascular Accidents Unit (CVAU) and started treatment with antiplatelet therapy, rehabilitation with obvious improvement. At the time of hospital discharge (15 days after admission), he had just a slight alteration in gait and left eye ophthalmoparesis.
|
pmc-6327407-1
|
A 16-year-old girl was referred to our service from another hospital for further management of recurrent germ cell malignancy. Her initial presentation was abdominal bloating with an adnexal 18-cm mass and tumor marker elevation (Alpha-fetoprotein (AFP): 131.53 (0–20) ng/mL, CA 125: 521 (0–35) U/mL, Lactate dehydrogenase (LDH): 242 (98–192) IU/L). She received optimally debulked fertility-sparing staging surgery (unilateral salpingo-oophorectomy, unilateral pelvic and para-aortic lymph node dissection, omentectomy, and cul-de-sac tumor excision) followed by chemotherapy with 4 cycles of BEP (bleomycin, etoposide, and cisplatin) at age 14. Final pathology reported a mixed germ cell tumor composed of mainly immature teratoma (grade 3, FIGO stage IIIC, pT3cN0M0) with components of embryonal carcinoma (23%) and yolk sac tumor (3%).
During follow-up, disease recurrence was suspected due to tumor marker elevation (AFP: 118.82 ng/mL, CA 125: 58.82 U/mL) and pelvic cystic lesions with ascites on abdominal computed tomography (CT) scan. Thus, she was referred to our hospital and received second fertility-sparing debulking surgery. Intra-operative findings were a 6 × 5-cm solid tumor at omentum, another gray tan soft tissue measuring 5 × 3 cm upon bladder, and some small cul-de-sac tumors. No residual disease was noted. All lesions were reported to be metastatic mixed germ cell tumors, which was mainly composed of an immature teratoma with focal areas of yolk sac tumors. The teratoma component is composed of squamous epithelium, intestinal-type epithelium, respiratory epithelium, mesenchymal tissue and neuroglial tissue. The immature element is found focally and is composed of fetal-type epithelium and mesenchymal tissue. This neuroglial tissue is characterized by GFAP (glial fibrillary acidic protein)-positive astrocytic cells and scattered ganglion cells. Adjuvant chemotherapy with 4 cycles of EP (etoposide and cisplatin) was completed uneventfully.
However, 4 years later (at age 20), the magnetic resonance imaging (MRI) detected an 8 × 7-cm cystic mass at the right adnexa with suspicious pelvic tumor seedings (Fig. ). AFP was 42.31 ng/mL, and CA 125 was 13.5 U/mL. The patient underwent a third conservative debulking surgery with excision of a right ovarian cystic lesion and pelvic tumors. The surgery was considered optimal, but some residual tumors remained in the cul-de-sac, all of which were less than 10 mm in diameter. The pathology results of the right ovarian tumor suggested a teratoma and associated mucinous cystadenoma, whereas the intrapelvic tissue sections revealed a mixed germ cell tumor composed of teratoma with somatic type malignancy (melanoma and leiomyosarcoma) and foci of yolk sac tumor (Figs. and ). No immature component is identified within the teratoma. Pelvic recurrence and multiple metastases were noted 8 months later after a third debulking surgery. Biopsy of sacral bone, lung, and liver were compatible with the presence of sarcomatous cells. The patient received palliative radiotherapy, salvage chemotherapy with high-dose doxorubicin and ifosfamide for leiomyosarcoma, and immunotherapy with pembrolizumab for melanoma. She died of disease 10 months later.
|
pmc-6327444-1
|
A 64-year-old man, with severe multi-valvular disease detected during preoperative evaluation for colon diverticulitis, was referred for heart valve surgery. He had suffered recurrent life-threatening diverticular bleeding and accompanying heart failure. Transthoracic echocardiography (TTE) showed severe aortic regurgitation classified as type II (cusp prolapse) according to the functional classification developed by El Khoury et al., and severe mitral regurgitation caused by degenerative bi-leaflet prolapse with multiple eccentric regurgitant jets, exacerbated by secondary factors, including mitral annular and left ventricular (LV) dilation. Secure mitral repair with a shorter cardiopulmonary bypass (CPB) time would have been difficult due to the complex lesion; double valve replacement (DVR) was a safer and simpler procedure.
The anterior leaflet of the mitral valve was excised and its chordae cut at their insertion into the papillary muscles. The posterior leaflet and its subvalvular apparatus were preserved. A 29-mm bovine pericardial bioprosthesis was implanted in the intra-annular position and a 25-mm bovine pericardial bioprosthesis replaced the prolapsed aortic valve (Carpentier-Edwards Magna Mitral Ease Valve and Magna Ease Aortic Valve, respectively; Edwards Lifesciences; Irvine, CA, USA).
After DVR completion, extensive hematoma occurred surrounding the posterior atrioventricular groove during weaning from CPB. We suspected that deeply placed sutures around the posterior mitral annulus might have cut through the left ventricular wall. Full CPB support, aimed at a prompt reduction of the intraventricular pressure, was re-instituted immediately, and inotropic agents were tapered off to weaken the force of muscular contractions with the hope of suppressing the exacerbation of the injury. Routine intraoperative transesophageal echocardiography (TEE) monitoring was not utilized in this case; stable left ventricular contractility without bleeding was confirmed only by direct inspection before choosing conservative management. The re-weaning process was performed without any hemodynamic instability. The sternum was closed under stable conditions after administration of protamine sulfate.
The patient was taken into intensive care and extubated 12 h postoperatively. Postoperative routine TTE was unremarkable, whereas contrast-enhanced, electrocardiography (ECG)-gated, multi-detector computed tomography (CT) imaging on postoperative day 18 revealed a pseudoaneurysm (20 × 12 mm) arising from the posterior wall of the left ventricle just below the implanted mitral valve (Fig. ). The fistulous tract of the pseudoaneurysm was 2 mm in diameter. We chose conservative management because the patient was asymptomatic, the pseudoaneurysm was not large, and the fistulous tract was narrow. After CT imaging confirmed aneurysm regression on postoperative day 32, the patient was discharged in good condition.
Six months postoperatively, the pseudoaneurysm had completely disappeared on CT imaging (Fig. ). Three years after spontaneous resolution of the pseudoaneurysm, the patient has no cardiac complications, no recurrence of lower intestinal bleeding after colon surgery, and remains in good clinical condition.
|
pmc-6327474-1
|
A 71-year-old woman presented to the Division of General Surgery and Liver Transplantation, POIT Department, San Camillo Hospital – “Lazzaro Spallanzani” National Institute for Infectious Diseases (INMI) in Rome with the acute onset of severe burning sensation for 1 week, referred to the right chest wall and the back, graded as a 8 on a 0 to 10 numeric rating scale. The pain was worsening with deep breathing and during walking. The patient complained of occasional, sharp, moderate, right upper quadrant abdominal discomfort and flu-like symptoms, such as fatigue, low-grade fever, night sweats and generalize bony pains. The treatment with acetaminophen 1 g three times daily and pregabalin 75 mg twice daily for 5 days, prescribed by her general practitioner, was not successful. Medical history included current mild hypertension and hypothyroidism, under pharmacological treatment, chickenpox at the age of 40 years, and an episode of acute pericarditis and pleuritis 10 years before. The patient was retired, living in Rome and owner of three dogs. However, during childhood, she spent 10 years in a rural area in central Italy (the region of Abruzzo), where contact with animals was common. Of note, the patient’s father underwent thoracic surgery for pulmonary hydatid cyst.
On physical exam, blood pressure was 120/75 mmHg, heart rate 90 beats per minute, and respiratory rate 16 breaths per minute. Heart, lung and abdomen findings were within normal limits with the exception of tenderness upon palpation of the right upper abdominal quadrant. Murphy’s and Blumberg’s signs were negative. Allodynia and hyperesthesia upon palpation of the right chest wall were observed, without any identifiable neural root involvement.
Routine laboratory work up showed White Blood Cell (WBC) count 9960/mm3, with eosinophil count 360 /mm3 (3.7%) and neutrophil count 7120 /mm3 (71.5%), platelets count (plt) 352,000/mm3, hemoglobin 13.3 g/dl, erythrocyte sedimentation rate (ESR) 33 mm/hr., and C-reactive protein (CRP) 98.7 mg/L. Total protein count was in the normal range (7.0 g/dL), with some alterations of the electrophoretic profile, including increased alpha-1 and alpha-2 protein [0.56 (8%) and 1.12 (16%) g/dL3, respectively]. Hepatic enzymes profile was unremarkable with a γ-glutamyl tranferase (GGT) of 33 Us/L, and both Alanine Aminotransferase (ALT) and Aspartate Aminotransferase (AST) of 19 Us/L. No alterations of amylase and lipase levels were detected.
Abdominal CT scan showed a thick walled cystic lesion with egg-shell calcification in the right lobe of the liver measuring about 93 × 70 mm (Fig. ). The wall of the cyst showed discontinuity from which fluid leaked outside the cyst wall and the liver capsule into the retroperitoneum, with initial compression of the right kidney (Fig. ). A contrast-enhanced MRI of the upper abdomen confirmed the presence of a cystic lesion in the right hepatic lobe (Fig. ).
An interruption in the posterior face of the wall, hypointense in T2 weighted image, was visualized, confirming the cyst rupture and the extravasation of the cyst contents (Fig. ).
Serology for Echinococcus granulosus (commercial enzyme-linked immunosorbent assay confirmed by western blot) was positive with both tests. In addition, an experimental test based on IL-4 detection after whole blood stimulation with AgB peptides was performed. The IL-4 level was 0.62 pg/mL, suggesting the presence of viable cysts based on the previously identified cut-off of > 0.59 pg/mL in serology-positive patients [].
Based on the findings, the diagnosis was spontaneous rupture of hepatic hydatid cyst, as no history of major trauma was reported. No symptoms of anaphylaxis (rash, laryngeal edema, bronchospasm, severe hypotension) were detected. Treatment with oral albendazole (400 mg twice daily) was started immediately, and the patient underwent right hepatectomy and the operatory field was protected with 20% hypertonic saline to help preventing secondary echinococcosis. Macroscopically the cyst contained many daughter vesicles, compatible with a CE2 stage (Figs. and ). Surgery resulted in the complete resolution of chest allodynia.
One month after operation the physical conditions of the patient were good. The treatment with albendazole was continued for additional 6 months.
Written informed consent for publication of clinical details and clinical images were obtained from the patient. A copy of the consent form is available for review by the Editor of this journal.
|
pmc-6327496-1
|
The patient was referred to our third-level Paediatric Endocrinology Unit when she was 9 years old for short stature and suspected precocious puberty. She was of Russian origin and was adopted at the age of 2 years. Limited data were available about her family and perinatal history. The biological mother was affected by insulin-dependent diabetes mellitus and arterial hypertension. Nothing was known about the biological father. No data were available about gestational age, neonatal weight and length as well as general conditions at birth. She was born with agenesis of the right tibia and fibula, and underwent mid-thigh amputation when she was 5 years old. She also presented a supernumerary digit of the left foot, which was excised when she was 8 years old.
At the age of 9 years, she was referred to our Paediatric Endocrinology Unit for short stature and with potential precocious puberty. Her height was <3rd percentile on CDC growth charts for sex and age (parental target was not known), her weight was in the 25th percentile () with a body mass index in the overweight range according to International Obesity Task Force cut-offs []. The pubertal stage was a B3 PH2 according to Tanner criteria. She had dorsal scoliosis, a short neck, upturned nose and hypotelorism (Fig. ). Her systolic and diastolic blood pressure values were in the 90th percentile for sex and height. Biochemical evaluations excluded celiac disease and revealed a normal blood cell count, normal thyroid, kidney, liver and adrenal function. The levels of LH/FSH were > 1 (LH 8.6 mIU/ml, FSH 7.5 mIU/ml) with pubertal oestrogens level, normal fasting insulin and glucose levels with normal glycosylated haemoglobin. Growth hormone (GH) secretion, which was evaluated by Arginine and L-Dopa provocative tests (2.5 ng/ml and 6.8 ng/ml, respectively), revealed a GH deficiency. Cerebral magnetic resonance (MR) showed that her pituitary gland had anormal size, morphology and contrastographic characteristics. Echocardiography and abdominal ultrasonography were performed, and there were no pathological findings. In particular, pelvic ultrasonography showed a uterus with an apparent normal size and morphology as well as a thin endometrium and ovaries with an initial follicular pattern, but the reliability of the exam was limited by bowel gases.
Treatments with human recombinant GH and triptorelin were started to achieve the best growth gain. Triptorelin was able to block the puberty progression. At 14 years, triptorelin was withdrawn, and, at 15 years, menarche appeared. Her final height was 137.5 cm, which corresponds to <3rd percentile.
When she was 17 years old, she complained severe abdominal pain during a menses. A pelvic ultrasonography was performed revealing a picture of hematocolpos. The abdomen MR showed uterus didelphys with double vagina. Due to the presence of these uro-genital anomalies, arterial hypertension at a young age and the family history for insulin-dependent diabetes, molecular analyses of the HNF-1β gene was performed. No alteration was found in this gene.
Because of the complexity of the case with multi-system involvement, array comparative genomic hybridization (aCGH) analysis was performed using the standard Agilent Human Genome G3 SurePrint 8x60K Microarray (Agilent Technologies, California, USA). Two distinct duplications flanking the SHOX gene on Xp22.1 (Fig. ) and an additional duplication of 1.6–2.5 Mb on 15q25.2 (Fig. ) were detected. To better characterize the Xp22.1 imbalances, confirmed by MLPA, a custom CGH array was used with a high probe density (371 bp average probe spacing) in the PAR1 region (Fig. ). This analysis revealed the presence of a triple dose of two distinct segments of 302 Kb (chrX:192,136–494,191 × 3, NCBI build 37, hg 19) and 767 Kb (chrX:686,753–1453,835 × 3) that included the upstream and downstream enhancer regions respectively, whereas the SHOX coding gene was present in two normal copies (Fig. ).
The presence of the 15q25.2 duplication was confirmed through MLPA (Multiplex Ligation Probe Amplification) with a probe specifically designed within the CPEB1 gene. The 15q25.2 duplicated region was examined using the Human resource websites () at NCBI and the Archive EnsEMBL (). This region contains 13 genes, some of them with a known function (Additional file : Table S1). Three of these, namely RPS17, CPEB1 and HOMER, have been previously associated to well defined disorders albeit none of these is apparently related to the clinical features observed in our patient.
Unfortunately, the biological parents were not available to establish the origin of the duplications.
We performed a search in DECIPHER database () and identified 4 patients carrying similar micro-duplications (Fig. ).
|
pmc-6327507-1
|
A 72-year-old female patient was referred to our institute due to chest discomfort. The radiologic investigations revealed a giant aneurysm of the ascending aorta, extending but confined to the proximal aortic arch and 7.5 cm in size (Fig. ).
We performed a median sternotomy with initial arterial cannulation of the right axillary artery using an 8 mm vascular graft and the right femoral artery for a second arterial line with a Y-limb preparing the circuit. The arm of the circuit going to the femoral artery was clamped. A two-stage venous cannula was inserted into the right atrium. The bypass was initiated via the right axillary arterial line and systemic cooling was applied to reach a bladder temperature of 32 °C. During cooling, vessel loops with tourniquets were placed around the completely freed innominate and left common carotid arteries (Fig. a). Once the vessel loop on the innominate artery was secured, a cross clamp was applied distal to the innominate artery in an oblique fashion (Fig. b), and then the arm of the circuit going to the femoral artery was unclamped. One pump circuit was used for the axillary and femoral artery, and the perfusion pressure was maintained at approximately 50~60 mmHg, as measured in the bilateral radial artery. Cerebral saturation was monitored using near-infrared spectroscopy (NIRO 300: Hamamatsu Phototonics, Hamamatsu, Japan). The anterior arch resection was performed via a long beveled incision, starting at the right side of the origin of the innominate artery and ending in the lesser curvature of the arch in front of the clamp. The distal hemiarch anastomosis was carried out by means of a continuous 3–0 polypropylene suture with interrupted U-shape pledget stitches, and the graft was cross-clamped proximally; the pump flow was then returned to the antegrade arterial inflow through the axillary arterial line, and the proximal end of the aortic graft was completed just up to the sinotubular junction (Fig. a). The postoperative course was uneventful. Postoperative computed tomography showed a well-reconstructed aorta (Fig. b). At the one-year follow-up, there was no sign of a thromboembolic event or renal or hepatic failure.
|
pmc-6327517-1
|
A 26-year-old woman, G1P0A0, was referred to the Medical Genetic Centre of Guangdong Women and Children Hospital for prenatal diagnosis at 24 weeks of gestation due to imbalanced development of twins. The patient’s medical history revealed no remarkable abnormalities. The patient got pregnant naturally and had no family history of twins or multiple births. Fetal ultrasound scans showed a monochorionic diamniotic pregnancy with imbalanced development of twins. Twin 1 presented with normal development of brain, abdomen, skeleton and cardiovascular system. Twin 2 had normal brain and abdomen, with underdeveloped/absent radius, ventricular septal defect, cleft lip and palate (Fig. ).
Ultrasound parameters for twin 1 (Fig. up): Biparietal diameter (BPD) 59 mm, Head circumference (HC) 223 mm, Abdominal circumference (AC) 198 mm, Femur length (FL) 45 mm, Heart rate (HR) 154/min.
Ultrasound parameters for Twin 2 (Fig. down): BPD 51 mm, HC192mm, AC1 41 mm, FL 35 mm, HR 141/min.
Data from ultrasound examination indicated the imbalanced development of the two fetuses might due to the Twin-to-twin transfusion syndrome (TTTS), but can’t exclude chromosomal abnormalities. After genetic counseling, the couple agreed to receive a diagnostic amniocentesis for the normal fetus (twin 1).
Amniotic cells were cultured in CHANG Medium (CHANG Amnio, Irvine Scientific) for 7–10 days for karyotyping and CMA analysis. Conventional G-banded karyotyping from peripheral blood lymphocytes and cord blood were performed according standard protocols. Array Comparative Genomic Hybridization (aCGH) analysis was performed using Agilent’s 8 × 60 K commercial arrays (Agilent Technologies, CA, USA) and the data was analyzed with AgilentGenomic Workbench Lite Edition 6.5.0.18 software (Agilent Technologies) as described in our previous report []. QF-PCR for detecting common chromosome numerical anomalies was carried out using a modified version of previous report []. FISH based on cultured amniotic cells was performed by using AneuVysion Multicolor DNA Probe Kit (Abbott Molecular Inc., USA).
|
pmc-6327531-1
|
An 83-year-old man was referred to our hospital for the occasional finding, with routine blood tests for oral anticoagulant therapy monitoring, of severe increase of the prothrombin time (PT). The patient also complained weeklong history of fever (up to 39 °C), diarrhoea and vomiting. His medical history included chronic ischemic heart disease, valvular heart disease (mitral valve replacement in 2001 with mechanical prosthesis), permanent atrial fibrillation, arterial hypertension, chronic cerebrovascular disease, peripheral atherosclerosis of the lower extremities, stage 0 chronic obstructive pulmonary disease, stage IIIb chronic kidney disease, chronic gastritis, gastric resection for perforated gastric ulcer in 1975, cholecystectomy for cholelithiasis in 2009, benign prostatic hyperplasia, recent bacterial pneumonia (four months earlier). The patient was admitted to the Department of Internal Medicine.
At presentation the patient was febrile (37.5 °C); physical examination revealed abdominal distension, diffused tenderness and bloating. No stool passage had been observed since the previous day. Blood tests confirmed severe prolongation of PT (22.48, with normal liver function tests), and showed an increase of C reactive protein (CRP, 12.54 mg/dl), normal leucocyte and neutrophil count with mild lymphopenia (860/mm3) and monocytosis (1040/mm3), acute kidney failure with creatinine 1.7 mg/dl, no acidosis nor increase in lactic acid. Chest X-ray showed mild pulmonary congestion. Abdominal X-ray showed small intestine loop dilation and air-fluid levels, suggesting intestinal obstruction; abdominal computed tomography confirmed these findings and showed wall thickening of the terminal ileum, which the radiologist described as compatible with either inflammatory bowel disease or intestinal ischemia. No surgical indication was established by the general surgeon.
We deemed inflammatory bowel disease unlikely because of the advanced age and the acute onset; intestinal ischemia was also considered improbable because of the intestinal region involved (terminal ileus, with no apparent involvement of the caecum and ascending colon) and because of normal lactate levels. An acute intestinal infection was considered the most likely diagnosis. Samples for blood cultures, stool cultures, stool ova and parasite test and Clostridium difficile toxin assay were collected. Empirical antibiotic therapy with metronidazole and piperacillin-tazobactam was started at admission and vitamin K was administered.
We observed an initial favourable response to therapy: the patient became afebrile, CRP levels decreased (from 12.54 mg/dl to 5.11 mg/dl); constipation resolved, with appearance of loose stool, that rapidly progressed to overt diarrhoea. Microbiologic tests all came back negative. This positive trend was however transient, and on the fifth day since admission, the patient developed fever (38.2 °C) and a drop in peripheral oxygen saturation was observed. Samples for blood and urine cultures were collected and came back negative; chest X-ray showed a basal opacity of the right lung. Levofloxacin was then added to ongoing therapy. No response to therapy was observed and during the next three weeks the patient was persistently febrile, respiratory function progressively worsened and bilateral opacities appeared at the chest X-ray controls; furthermore, the stool remained loose or liquid. Several microbiologic tests were performed and they all were negative: two more blood culture sets (obtained during temperature spikes), two more stool cultures, stool ova and parasite test and Clostridium difficile toxin assay, urine culture, serology for Chlamydia, Legionella and Mycoplasma, Legionella and Pneumococcal urinary antigen, serum galactomannan assay, stool cultures for Mycobacterium tuberculosis and Quantiferon. Echocardiography was negative for vegetations. Colonoscopy was also performed to investigate persistent diarrhoea and showed a single linear erosion in front of the ileocecal valve, compatible with infectious colitis, with no abnormal findings in the terminal ileum; two biopsies of the caecum were performed.
Antibiotic therapy was repeatedly modified: initial therapy with piperacillin-tazobactam, metronidazole and levofloxacin was replaced with cefepime and linezolid, then with meropenem, linezolid and azithromycin, lastly with meropenem and ceftaroline. None of these changes resulted in clinical improvement.
At the same time, the patient’s general conditions worsened: heart failure progressed with development of anasarca, respiratory function was impaired so that respiratory support by non invasive continuous positive airway pressure was needed. Furthermore, consciousness was progressively compromised, with the onset of delirium.
After almost three weeks of persistent fever, samples were then collected for Adenovirus and Rotavirus stool test, assays for detection of influenza from nasal and throat swabs, Brucella and Leishmania serology, CMV DNA detection in blood. CMV DNA test was positive, with 57,679 copies/ml, while all other tests were negative. The patient was then assessed for risk factors for immunodeficiency: HIV serology was negative, CD4 count was normal (925/mm3) and the patient had never been on immunosuppressive drugs and had no history of organ transplantations or malignancy. CMV serology showed low immunoglobulin M (IgM) titre and high immunoglobulin G (IgG) titre, suggesting reactivation of CMV infection. To assess the patient for further organ involvement, ophthalmologic evaluation was performed and no ocular manifestations of CMV infection were detected. Histological examination of colon biopsies showed mild non-specific chronic inflammation, but no CMV-induced cytopathic alterations; immunohistochemical study was negative for CMV antigens and PCR on biopsy specimens was negative for CMV.
Antibiotic therapy was then stopped and the patient was started on antiviral therapy with ganciclovir. Quick defervescence followed, the patient remained stably afebrile and consciousness steadily improved. Over the next three weeks, we observed a progressive recovery in respiratory function, with almost complete resolution of lung opacities, and a decrease in watery diarrhoea, although it did not resolve completely during hospital stay. CMV DNA was no longer detected in blood after 14 days since the start of antiviral therapy. The patient was kept on intravenous therapy with ganciclovir for a month and was then discharged from hospital in stable and globally improved clinical conditions, with the indication to continue antiviral therapy with oral valganciclovir, which was prosecuted for at least three and a half months until admission to the Neurology Department for a serious ischemic stroke. The patient was then lost to follow up. Our patient experienced mild elevation of alkaline phosphatase (up to 199 U/l) and gamma-glutamyl transferase (up to 83 U/l) as the only side effects of ganciclovir, without indication to interruption of antiviral therapy. A spontaneous decrease of both was later observed, with a progressive return to normal levels.
|
pmc-6327550-1
|
A 48-years-old woman with trisomy 21 and history of ostium primum atrial septal defect and hypothyroidism, on effective replacement therapy, was transferred from the Cardiology of another hospital to our Internal Medicine Department because of dyspnea with acute and worsening respiratory failure. She had been in her usual health until 2 months before admission, when a flu-like syndrome occurred in November. After 15 days, during an admission in other hospital for syncope with sphincter incontinence, a mild pericardial effusion (7 mm) was diagnosed and treated with ibuprofen 600 mg every 8 h and colchicine 0.5 mg twice day. Two weeks later, due to worsening of dyspnea and appearance of diarrhea, therapy had to be suspended. Trans-thoracic echocardiogram showed a diffuse increase in pericardial effusion (30 mm) without inspiratory collapse of the inferior vena cava (Fig. ). Chest CT confirmed massive pericardial effusion and highlighted bilateral basal and left upper lobe pleural effusion with atelectasis. Therefore, a metilprednisolone 60 mg/day (1 mg/Kg) and furosemide 40 mg/day therapy was started.
On admission, blood pressure was 110/70 mmHg, heart rate 75 beats per minute, respiratory rate 16 breaths per minute, body temperature 99 °F, and oxygen saturation 86% while the patient was breathing ambient air. Cardiac examination revealed muffled heart sounds and a 3/6 ejection murmur on aortic area. Pulmonary evaluation revealed a stony dull percussion with diminished vesicular breath sounds on basal region bilaterally and widespread rhonchi. The total leukocyte count was 8400/μL (neutrophils 93% and lymphocytes 15%), erythrocyte sedimentation rate (ESR) 120 mm/h, CRP 16 mg/L, procalcitonin 0.05 ng/mL, MR-pro-adrenomedullin 0.96 nmol/L, ferritin 3799 ng/mL, NT-proBNP 254 pg/mL, and TSH 0.33 mcU/L; ANA, anti-dsDNA, ENA, c-ANCA and p-ANCA were in the normal range. Arterial blood gas analysis revealed severe hypoxemia with respiratory and metabolic alkalosis (pH 7.48, pO2 47.3 mmHg, pCO2 36.1 mmHg, HCO3− 26.6 mmol/l). ECG highlighted incomplete right bundle branch block, while trans-thoracic echocardiogram showed large circumferential pericardial effusion (25, 23, and 30 mm respectively on apical, posterior, and lateral ventricular walls, 20 mm on right ventricular wall) without right ventricular compression; grade 2 diastolic dysfunction; mild left-right shunt due to ostium primum atrial septal defect; mild tricuspidal and minimal mitral regurgitations with cleft of the anterior mitral valve leaflet; mild enlargement of the right cardiac chamber with pulmonary artery pressure of 40 mmHg. Chest X-ray showed widespread bronchial wall thickening and enlargement of the cardiac silhouette (Fig. ).
The absence of other causes for pericardial effusion and the history of recent flu-like syndrome rose the suspicion of a viral etiology; therefore, laboratory evaluation identified the presence of influenza B virus on molecular assay of tracheal aspirate. Antiviral therapy with oseltamivir 75 mg twice a day for 5 days was added to ongoing treatment with metilprednisolone 30 mg (0.5 mg/kg/day) and colchicine 0.5 mg/day therapy [].
The patient showed a progressive clinical and CRP improvement with disappearance of the pericardial effusion on 15-days echocardiographic follow-up.
The patient was discharged in good medical conditions with 1-month prednisone 30 mg/day followed by dose reduction of 2.5 mg every 5 days and 3-months colchicine 0.5 mg/day therapy [].
At 1-month follow-up, patient was asymptomatic with normal physical examination, CRP 1.1 mg/L, and echocardiogram showed mild pericardial detachment on right atrium without sign of compression (Fig. ). At 6-month follow-up, clinical and echocardiographic features was preserved, with complete normalization of inflammatory markers (CRP 0,26 mg/L) even when treatment was suspended.
|
pmc-6327553-1
|
The patient was a 4-year-old boy, the first child of non-consanguineous parents of Croatian origin. The family history was unremarkable. The pregnancy was complicated by polyhydramnios. The boy was delivered by caesarean section at 39 weeks of gestation with a length of 56 cm (+ 1.8 SD), weight of 3640 g (+ 0.4 SD) and occipitofrontal head circumference (OFC) of 35 cm (mean). The Apgar scores were 10, 10, and 10 at 1, 5, and 10 min, respectively, and the umbilical arterial cord pH was normal with 7.30. After birth, physical examination showed a maldescensus of testes which was surgically corrected in the first year of life.
He started walking at 14 months. His speech development was delayed. At the age of 2 years and 6 months his speech and language development was assessed as that of a child of one year and 6 months. At 33 months, he was able to comprehend simple questions and commands and could speak two word sentences. At this time, his length was 84 cm (− 3 SD), his weight was 11.7 kg (− 2 SD) and his OFC was 45.5 cm (− 3.8 SD). His facial features included thick and laterally broad eyebrows, wide set eyes, a short nose with a broad nasal bridge and nasal tip, epicanthus, a wide mouth with full lips, uplifted earlobes, low posterior hairline and dorsal hypertrichosis (Fig. ). His fingers were short with bilateral clinodactyly V. His toes were also short. At the age of 3 years, septic arthritis of the left hip occurred requiring antibiotic drug treatment. During this treatment a closure of the left femoral artery occurred which required surgical recanalization. X-ray examination of the hand showed that, according to Greulich and Pyle, his skeletal age of 1.5 years, at the chronological age of 2.5 years, was retarded. Furthermore, re-infected cancellous bone markings, cup-shaped metaphyses of the distal radius and ulna on the left with incipient sclerosis, only slight blurring and narrow cortex of the phalanges were detected, indicating compensated hypophosphatemic rickets.
At that time, abdominal ultrasound examination indicated that bilateral nephrocalcinosis was at stage IIa. Further diagnosis revealed partially generalized hyperaminoaciduria as seen in Fanconi syndrome, macroalbuminuria and hypophosphatemia (Additional file : Table S1). In addition, there was pronounced tubular proteinuria. The findings were compatible with tubulo-intestinal nephropathy. He was treated with an angiotensin-converting-enzyme inhibitor, he was supplemented with phosphate and vitamin D.
In the neuropediatric examination at the age of 4 4/12 years, the patient showed mild global developmental delay, including speech delay and mild intellectual disability. He was able to speak fluently in short sentences, but grammatical structure and articulation were reduced. Speech comprehension was good. Fine motor function was slightly reduced. He showed adequate social contact with good face-to-face-interaction and no sign of an autistic spectrum disorder. At this time, he received speech therapy and occupational therapy.. He achieved sphincter control during the day at the age of 3 3/12 years, but had not achieved sphincter control during the night at the age of 4 4/12 years. Echocardiography showed no discernible valve defects. At the age of 4 4/12 years, his length was 92 cm (− 3.2 SD), his weight was 14.0 kg (− 1.81 SD), his OFC was 46.5 cm (− 3.8 SD) and his body-mass-index was 16.5 kg/m2 (+ 0.71 SD). His mother was tall (180 cm), had nystagmus but was otherwise healthy. Low-molecular proteinuria was found in her urine analysis.
The results of cytogenetic analysis of the index patient were normal. A microdeletion 22q11.2 was excluded by Fluorescence in situ Hybridization (FISH) analysis.
Standard cytogenetic analysis with a high resolution 550 GTG-banding was performed according to standard procedures, using a lithium-heparin peripheral blood sample from the patient and his mother.
High molecular weight genomic DNA from the patient was isolated from an EDTA peripheral blood sample (Qiagen, QIAamp DNA Blood Midi Kit) and processed according to manufacturer’s protocol for the CytoScan 750 K assay. The genomic DNA was cut by restriction digest, adaptor-ligated and PCR-amplified. Purified amplicons were fragmented by DNAse digest, end-labeled with biotin and hybridized onto an array. After washing and staining, the array was scanned using the Affymetrix GCS3000Dx V2 system. The DNA sample from this patient was analyzed with the Affymetrix microarray platform (GeneChip® System 3000Dx v.2). Primary Image Data were analyzed using the Chromosome Analysis Suite (ChAS) software version 3.1.1.27 with parameter settings allowing the detection of copy number changes of at least 50 kb and smaller and detection of contiguous regions of homozygosity (ROH) > 5 Mb. The copy number changes were analyzed by using multiple clinically relevant databases (e.g. DECIPHER, OMIM, DGV, UCSC, PubMed) and our own patient database. Interpretation and classification in terms of pathogenicity were carried out according to the American College of Medical Genetics guidelines [] [].
To clarify whether SHROOM4 is also affected by the microdeletion Xp11.23p11.22, we performed real-time quantitative PCR (qPCR) for the patient and his mother, measuring two amplicons covering the SHROOM4 and the CLCN5 genes. Genomic DNA from the patient and his mother was extracted from EDTA peripheral blood samples. LNA (locked nucleic acid) probes, contained within the Universal Probe Library, and primers were designed with the Roche Probe Finder Software. Real-time quantification of primer and probe pairs was carried out in comparison to a single-copy gene with efficiency correction using a calibrator normalization to determine the copy number. The qPCR analysis was performed on a Roche LightCycler v2 Instrument. The primer sequences are annotated in Additional file : Table S2.
Whole exome sequencing was performed on DNA extracted from blood. Library preparation of 100 ng DNA was performed according to the manufacturer’s protocol using SureSelect Human All Exon V6 (Agilent, Waldbronn Germany). Sequencing was performed on the Illumina HiSeq 2500 platform. Reads were aligned to the reference genome (Human Genome Assembly GRCh37) with Burrows-Wheeler Aligner (BWA) [] and variants were called according to best practice guidelines []. For further analysis, all variants that have been reported in a homozygous state in more than three individuals in the cohorts of the 1kGP project, ExAC, gnomAD, or variants that have been classified as benign in ClinVar, were removed.
Variant analysis was carried out with GeneTalk []. Rare and coding, heterozygous, compound heterozygous, homozygous, and hemizygous variants in known ID (intellectual disability) genes were assessed with MutationTaster [].
While the standard cytogenetic analysis showed a normal male karyotype in this patient, we identified, by molecular karyotyping, a hemizygous interstitial microdeletion Xp11.23p.11.22 of about 700 kb, according to HG19 arr Xp11.23p.11.22 (49,649,226_50,351,579)× 0 (Fig. a).
The genome coordinates chrX: 49649226_50,351,579 in the UCSC human genome 19 indicated that the deletion included CLCN5, the last three exons of SHROOM4 and four additional genes (Fig. b and c).
For confirmation, we used target-specific qPCR analysis and validated this microdeletion, including a deletion of SHROOM4 in the patient and his mother. The coordinates for the minimum and maximum deletion intervals are chrX: 49649226–50,351,579 bp and chrX:. 49648874–50,358,217 bp, respectively.
To rule out mutations in known genes related to intellectual disability, whole exome sequencing was performed. No known or predicted pathogenic mutations, that could explain the phenotypic features, were identified. However, the alignment of reads on chromosome X confirmed the deletion identified by array CGH.
|
pmc-6327555-1
|
A 43-year-old Caucasian man presented with a moderate loss of visual acuity in his left eye (20/40) and normal right eye acuity (20/20). His medical, family, and psychosocial history was irrelevant. He did not have a history of medication use or previous diseases other than common childhood infectious diseases. For 12 months he complained of blurring, progressive alteration of night vision, and reduced contrast sensitivity in both eyes, with a much more pronounced effect in his left eye. Clinical diagnosis of DHRD was made after full ophthalmologic examination and detailed retinal imaging. Figure shows OCT and fundus autofluorescence in both eyes. ERG, including mesopic and photopic full-field ERGs as well as multifocal ERGs (mfERG), were performed at baseline and 7 days after treatment. Genetic analysis confirmed the common heterozygous DHRD mutation in EFEMP1: (2p16.1) (p.R345W; c.1033C > T).
He was offered NSLT for his left eye. After written informed consent and full explanation of methods and procedure were completed, he underwent the treatment in his left eye, which applies ultra-low energy laser pulses in 24 spots around the macula of one eye (0.15–0.45 mJ), using 400 μm diameter laser spots, 3 nanosecond pulse length, 532 nm wavelength and energy titrated to the patient. Clinical follow-up was conducted at 60 and 180 days after treatment. Table summarizes the clinical ophthalmological testing performed during follow-up. Visual acuity improved from baseline by two letters. There was a subjective improvement in blurring in his left eye. No morphological changes were apparent on fundoscopy, but increased autofluorescence in the treated eye was observed on imaging (Fig. ). Rod-mediated and cone-mediated ERG b-wave amplitudes showed an increase from baseline in both the treated eye (300%) and fellow eye (50%) (Fig. ). mfERG amplitudes did not change significantly from baseline, but the implicit time of the main positive component decreased by 8 milliseconds compared to baseline in the treated eye and by 5 milliseconds in the fellow eye (Fig. ). Subjective and clinical improvements persisted unchanged at 6-month follow-up. The rod-mediated and cone-mediated ERG b-wave amplitude remained unchanged (300% increase) in the treated eye and returned to the pre-treatment value in the fellow eye.
|
pmc-6327855-1
|
A 45-year-old woman with a 3-year history of chronic anemia was followed up at the Gastroenterology outpatient department of another hospital, with a 6-month history of abdominal pain. The pain was intermittent, worse in the mornings, and localized to the epigastric region. The patient noticed that her abdomen became distended after meals and distension was relieved after a bowel movement. The patient noticed a 12-kg weight loss over the last 6 months. There was a history of nausea but no vomiting. The patient denied any history of loss of appetite, diarrhea or constipation, and upper or lower gastrointestinal bleeding. There was no significant past medical history other than anemia and multiple blood transfusions. The patient denied any history of tobacco smoking, alcohol consumption, drug abuse, Helicobacter pylori (H. pylori) infection, chronic renal failure, peptic ulcer disease, and chronic pancreatitis. Her family history was unremarkable. The patient did not have any prior surgeries or history of malignancy. Workup for her chronic anemia included CT scan of the abdomen and pelvis with intravenous and oral contrast, which revealed duodenal intussusception. The patient was booked for upper gastrointestinal endoscopy in the referral hospital but missed her appointment and asked for a referral to another hospital.
Upon arrival at our hospital, she appeared underweight (height, 162 cm; weight, 43 kg). Her vitals were stable, and she was afebrile (blood pressure, 118/67 mm/Hg; heart rate, 96 bpm; respiratory rate, 23 bpm; oxygen saturation, 98% in room air; temperature: 36.9 °C). On examination, her abdomen was soft and laxative, with no tenderness, or organomegaly. A complete blood count on the day of admission revealed the following: low hemoglobin level, 7.2 g/dL (12.0–17.0 g/dL); mean corpuscular volume (MCV), 78.0 fL (80.0–100.0 fL); low hematocrit, 24.8% (40.0%–51.0%); leukocyte count, 8.2 × 109/L (4.5-11.0 × 109/L); and platelet count, 323 × 109/L (150-450 × 109/L). Other laboratory profiles were unremarkable. Contrast CT of the abdomen and pelvis revealed significant dilation of the stomach with no detectable gastric lesion. The third part of the duodenum was distended by a sausage-shaped intraluminal structure with alternating fat planes and dilated vessels reaching up to the first part of the duodenum, suggesting retrograde jejuno-duodenal intussusception. There was no detectable soft tissue lesion, and the rest of the bowel was unremarkable (A–C). Endoscopic examination of the upper digestive tract revealed a large, long, mobile submucosal longitudinal and tortuous bulge extending from the first to the second part of the duodenum that moved freely with bowel contraction. The papilla of Vater was normal with no neoplastic process.
The patient underwent laparoscopic exploration, which revealed antiperistaltic intussusception in the proximal jejunum (). A jejunostomy was performed, and the mass was pulled through in the proximal jejunum (A).
A cholecystectomy was performed, and a pediatric feeding tube was passed through the cystic duct to locate the ampulla of Vater. The mass was not resectable without affecting the ampulla, so the decision was made to perform a pancreas-sparing duodenal resection. The excised duodenum with mass was sent for histopathological examination (B).
Pathological findings showed a large polypoid mass with the mucosa pedunculated from the bowel lumen, measuring 12 × 7.5 × 2.0 cm3. Microscopic examination revealed a bowel mucosa with underlying submucosa showing lobules of benign normal-appearing Brunner's glands separated by fibrous stroma. The nodular proliferation of Brunner glands was accompanied by cystically dilated ducts and adipose tissue with no microscopic features of malignancy (A–C). The patient was discharged postoperatively in good condition, given an appointment after 1 month.
|
pmc-6327917-1
|
A 62-year-old man presented with a moderately severe non-radiating frontal headache. Brain MRI 9 months later showed multiple discrete regions of abnormal signal and mild swelling involving white matter and overlying cortex. Susceptibility-weighted imaging (SWI) demonstrated numerous cortical lobar microbleeds throughout both cerebral hemispheres. Repeat MRI another 9 months later showed resolution of many of the parenchymal abnormalities, but with several new regions containing more peripheral microbleeds. Amyloid-PET (using 18F-florbetapir) demonstrated moderate widespread amyloid deposition; CSF analysis showed reduced amyloid-beta 1–42 and high-normal total tau. Formal neuropsychological testing suggested mild compromise in frontal functioning only. The patient was treated with 5 days of intravenous methylprednisolone (1 g daily), followed by an oral taper from prednisolone 60 mg over 8 weeks. Follow-up MRI after 8 months showed almost complete resolution of the parenchymal abnormalities, but with persisting lobar microbleeds. At 24 months following symptom onset, he remains asymptomatic, with stable brain imaging.
|
pmc-6327917-2
|
A 74-year-old man presented with mild subjective memory difficulties only, with no objective neuropsychological deficits. MRI demonstrated a substantial region of abnormal signal in the right temporal and occipital white matter, with no enhancement. Repeat imaging after a few weeks showed partial regression. Over the following 4 years, three further MRIs showed multiple areas of abnormal white matter (sometimes involving cortex as well) within the temporal, parietal and occipital lobes, which largely resolved. SWI demonstrated progressive accumulation of lobar microbleeds, mainly in the affected areas. The patient remains asymptomatic with no change in his subjective cognitive symptoms, without having received immunosuppressive treatment.
|
pmc-6327917-3
|
A 54-year-old woman presented with a bright flashing light in her left visual field and a sudden onset headache. After initial CT of the brain demonstrated right-sided occipital hypoattenuation, she was treated for ischaemic stroke and then antiepileptic drugs for presumed seizures. Approximately 6 months later, she developed worsening headache; MRI showed an area of abnormal signal and mild parenchymal swelling in the right temporo-occipital area. A diagnostic brain biopsy showed CAA-ri (Vonsattel grade 3 CAA with associated chronic inflammatory cell infiltration within and around the vessel wall, with angiodestructive and occlusive features). After a further 8 months, she was still experiencing occasional left-sided visual flickering and some subtle memory difficulties. MRI () demonstrated progression of the right temporo-occipital abnormality, together with a new separate focus in the anterior right temporal lobe and multiple lobar microbleeds in these regions. Formal neuropsychological testing was normal. Although clinically stable, further MRI 7 weeks later showed extension of the right temporal lobe lesion. She was treated with intravenous methylprednisolone (1 g daily, 5 days, followed by tapering dose prednisolone); 1 month later, the parenchymal signal abnormalities had improved significantly, with no increase in the number of microbleeds.
One year after intravenous corticosteroid treatment, while still taking oral steroids, the patient developed headache and new left-sided visual disturbances. MRI showed recurrence and extension of the right-sided temporo-occipital region abnormalities, with local swelling and numerous new cortical microbleeds in the affected area. The patient was once again treated with intravenous corticosteroids (as previously); follow-up MRI 3 months after this showed almost complete regression of the right temporal abnormalities and no change in the appearance or number of peripheral microbleeds.
|
pmc-6328641-1
|
A 54-year-old woman presented with nausea, vomiting, epigastric, and retrosternal crampiform pain three weeks after atrial fibrillation catheter ablation (AFCA). This pain was resistant to analgesics, accentuated by meals, and partially improved by sitting. Biology revealed inflammatory syndrome with CRP at 57 mg/L raising to 441 mg/L in the following 48 hours. Chest computed tomography angiography (CTA) found massive hydropneumopericardium (white arrows on Figure ) and gastroscopy showed a transparietal ulcer with purulent content on the anterior face of the oesophagus 30 centimetres below the dental arches (white arrow, Figure ). Retrospective review of the CT images identified this ulcer just in front of the posterior wall of the left atrial appendage (red circles on Figure and ). Oesophageal-pericardial fistula (OPF) secondary to AFCA was the final diagnosis. Minimally invasive approach associating surgical pericardial drainage and oesophageal stenting to cover the ulcer allowed a slow but effective evolution towards healing.
|
pmc-6328643-1
|
A nine-month-old girl presented to the pediatrician with signs of bronchitis. A few weeks earlier the parents had also noticed a sternal swelling, which was located paramedian right to the xiphoid process. On clinical examination (Figure ) the swelling was painless, nontender, and showed neither rubor nor calor. X-ray (Figure ) showed peribronchial accentuation compatible with the diagnosis of (peri)bronchitis. On the lateral view (Figure ) a presternal tissue swelling without any periosteal reaction of the sternum was noticed. Ultrasonography (Figure ) showed a soft tissue swelling which was composed of a retrosternal component, a neck between the sternum and the cartilage of the rib, and a presternal component. The lesion was sharply defined, inhomogeneous but mostly hypoechoic compared to the subcutaneous fat tissue, and showed no internal vascularization. There was no invasion of the surrounding tissues nor was there a connection to the skin. The absence of local/systemic inflammation as well as the absence of aggressive behavior led to a wait-and-see approach. On a follow-up ultrasound one week later, shrinkage of the mass was noticed. Taking into account the asymptomatic presentation of the lesion, the typical ‘dumbbell sign’ on ultrasound, and the spontaneous resolution, the diagnosis of a self-limiting sternal tumor of childhood (SELSTOC) was made.
|
pmc-6328711-1
|
A two-year-old girl had a fever up to 40°C for six days before admission. She had no cough, rhinorrhea, vomiting, diarrhea, or abdominal pain. She had previously been treated with amoxicillin and cefixmycin prescribed by a local medical doctor for five days, but a low-grade fever persisted. On admission, the results of the hematological and biochemical studies, urinalysis, and adenovirus rapid test were normal. Two days after admission, conscious disturbance was observed. Analysis of cerebrospinal fluid (CSF) revealed white blood cells of 144/μl (lymphocytes 99%, neutrophils 1%), but protein and glucose were within normal limits. Brain MRI revealed hyperintense lesions in the midbrain, dorsal pons, and cerebellar dentate nuclei on fluid-attenuation inversion recovery (FLAIR) and T2-weighted images (T2WI) (Figure ). These lesions did not demonstrate enhancement after administration of contrast medium. Based on the MRI findings, the initial diagnosis was enterovirus 71 (EV71) encephalitis. Intravenous immunoglobulin was administered immediately after the MRI. However, anti-EV71, anti-mycoplasma, anti-herpes simplex virus (HSV), and anti-Epstein Barr virus immunoglobulin M and immunoglobulin G antibodies were all absent in the serum. EV71 RNA and HSV DNA were not detected in the CSF by polymerase chain reaction (PCR). None of the viruses was isolated in the throat and rectal swabs, CSF, or serum. There was no bacteria growth in blood and CSF cultures. Finally, CVB3 was detected in the CSF by reverse transcription-PCR. The girl recovered gradually and uneventfully, and was discharged without neurological sequelae.
|
pmc-6328977-1
|
A 32y old woman was referred to Yas hospital due to severe low abdominal pain and vomiting on May 2017. Ultrasonographic examination of her pelvis revealed bilateral ovarian cysts. During the 5 days before the admission, she had experienced severe right lower abdominal pain and vomiting especially after a meal. She had a long history of dysmenorrhea and, one cesarean delivery 3 years before. She was taking no medication. Her physical examination report included the temperature of 37°C, systolic blood pressure of 100 mmHg and heart rate of 120 beats per minute. The right lower quadrant of her abdomen was tender along with hypoactive bowel sounds. Laboratory data reported leukocytosis (16×109/L) with neutrophilia, C-reactive protein of 20 mg/dl and erythrocyte sedimentation rate of 60 mm/hr. Abdominal erect X-ray showed dilatation of small bowel segments. Colonoscopy was requested by gastroenterologist for finding the cause and excluding colon neoplasm. Diagnostic colonoscopy showed one small ulcer (8 mm) with the pressure effect of mass like lesion at cecum and scope couldn’t find the ileocecal valve. It was thought that a mass like lesion had caused the ileum obstruction. Colonoscopic biopsies were taken and histopathological examination revealed endometriosis. Afterwards, the patient was taken to the operating room for excision of the mass. At the exploration of the abdominal cavity, adequate exposure was attained by a vertical incision across the midline of the abdomen with a transverse extension to the right. The ileocecal part was covered by the omentum and was adherent to the abdominal wall. The ileocolic intussusception was seen without ischemic changes. Reduction of the intussusception was performed at first. After reduction, a firm mass was recognized at cecum, located close to the ileocecal valve. Then, the ileocecal resection was performed (). Pathological examination confirmed endometriosis.
The postoperative period was uneventful and she was discharged on the third postoperative day. She was doing well at the 6 months follow up.
Written informed consent was obtained from the patient for publication of this case report and accompanying images.
|
pmc-6329043-1
|
A 26-year-old Japanese man was a previously healthy athlete with no prior hip joint problems. He was informed about the report in detail prior to providing written informed consent for enrollment, including consent for postoperative CT imaging. He fell off a wakeboard and impacted the water’s surface, causing excessive flexion of his bilateral hips and bilateral knees. He felt immediate and severe pain in his left hip, and was taken to a nearby hospital by ambulance. He had no signs of vascular injury or neurogenic deficits. A plain radiograph showed posterior dislocation (Epstein–Thompson type 1) of his left hip without fractures (Fig. ) [].
Closed reduction was performed under general anesthesia. A postoperative anteroposterior radiograph confirmed concentric reduction without joint space incongruity. A hip spica cast was used for 3 weeks to prevent hip dislocation recurrence. He was discharged from the hospital and returned to wakeboarding 3 months after the first dislocation. One year after the first injury, however, he sustained a second dislocation of his left hip, also while wakeboarding. He was taken to a hospital and a closed reduction was easily performed, but he subsequently experienced frequent posterior subluxation while wakeboarding or assuming a crouch position.
He was referred to our hospital for definitive treatment of recurrent dislocation of the hip. A physical examination showed that he was 174 cm tall and weighed 73.2 kg. Patrick’s test was negative and there was tenderness in Scarpa’s triangle. The anterior impingement sign was positive. The Japanese Orthopaedic Association (JOA) scores for evaluating hip joint function were 93 and 98 on the left and right, respectively. The JOA hip score is assessed using a 100-point scale that consists of the following subcategories: pain (0–40 points), ability to walk (0–20 points), range of motion (ROM; 0–20 points), and ability to complete daily living tasks (0–20 points). Higher scores indicate a better condition. Scores at the final follow-up were compared to the preoperative scores.
Radiographic evaluation showed that the center-edge angle of both his left and right hips was 30° [], and the α angles on the left and right were 43° and 40°, respectively []. There was retroversion of the bilateral acetabulum as indicated by a positive crossover sign [] and a positive ischial spine sign (Fig. a, b) [].
Three-dimensional CT scans were performed using a Philips Brilliance 64 scanner (Marconi Medical System, Best, The Netherlands). The scanning technique parameters were: 120 kV, 250 effective mAs, and a 0.5-second rotation time. Contiguous slices (2.0 mm) were obtained from the bilateral anterior superior iliac spines to the distal end of his femur, with our patient in a supine position, his hips extended, and thighs horizontal and parallel. All raw CT scan data were entered in a Digital Imaging and Communications in Medicine (DICOM) format into ZedHIP® planning software (LEXI Co., Tokyo, Japan) [] and into a CT-based Hip Navigation System (Stryker Orthopaedics, Mahwah, NJ, USA).
CT scans revealed anterior over-coverage and posterior acetabular deficiency with an anterior acetabular sector angle (AASA) of 61° and a PASA of 85° [, ]. MRI images showed complete detachment of the capsulolabral complex from the posterior acetabulum.
The angle at which impingement occurred in the ROM simulation was calculated by the ZedHIP® software based on CT images. The impingement angle between the anterior acetabular margin and the anterior portion of the femoral neck was 119° of flexion or 16° of internal rotation and 20° of adduction at 90° of flexion in the ROM simulation (Fig. a, b).
For the hip joint coordinate system [], the plane that connects both anterior superior iliac spines and the pubic symphysis was defined as the anterior pelvic plane. The table-top plane was defined as the functional pelvic plane []. In addition, for the femoral coordinate system the reference plane for the femur was defined as follows: the plane that connects the most posterior points of the medial and lateral condyles and the most posterior point of the greater trochanter (in the table-top plane). The line connecting the piriform fossa of the femur and the center of the knee was defined as the femoral axis. The axis constructed by projecting the femoral axis to the femoral reference plane was defined as the Z-axis. The axis passing through the piriformis fossa perpendicular to the Z-axis and parallel to the formed plane was defined as the X-axis, and the cross-product of the X-axis and Z-axis was defined as the Y-axis.
Based on the clinical and radiographic examinations demonstrating acetabular retroversion accompanied by posterior wall deficiency, the causes of recurrent dislocation of our patient’s hip were considered to be anterior impingement between the anterior acetabular margin and the anterior portion of the femoral neck, as well as rupture of the posterior joint capsule.
We performed conservative treatment for 3 months with a hip spica cast but an apprehension of a dislocation with excessive flexion or 30° of internal rotation at 90° of flexion of his left hip did not improve, so we scheduled operative treatment via anteverting ERAO. We used the ZedHIP® software to plan moving the osteotomized fragment so that it could reach more than 125° of hip flexion or more than 20° of adduction and internal rotation at 90° of flexion (Fig. a–d).
The anteverting ERAO was performed according to the technique described by Hasegawa et al. []. Our patient was positioned in the lateral position. A ball used by the infrared light navigation system was fixed with three pins onto the left iliac crest. The greater trochanter was detached with an oscillating saw and reflected proximally. The piriformis, obturator internus, and gemellus muscles were tagged and divided rather than torn. The posterior capsule was torn at the lower ischial femoral ligament.
Posterior subluxation of the femoral head was defined when the hip joint reached more than 20° of adduction and internal rotation at 90° of flexion. A curved osteotomy chisel was introduced proximally 15 mm superior to the joint space, and anteverting ERAO was performed with a curved 45-mm-radius chisel. The planning angle and direction of the osteotomized fragment, both of which were calculated using the ZedHIP® software, were implemented using the CT-based navigation system during the operation (Fig. a–d). An intraoperative anteroposterior radiograph was also obtained, which confirmed the presence of adequate posterior bone support and the disappearance of the crossover sign (Fig. ). Four hydroxyapatite screws were used to achieve fixation of the osteotomized fragment, and then the capsule and short rotator muscles were repaired. After fixation of the fragment, we verified that there was no tendency for the hip to sublux due to impingement by ensuring hip flexion of at least 120° or adduction and internal rotation of at least 20°, at 90° of flexion. When any subluxations due to impingement occurred, the osteotomy fragment was moved back into place. After verifying a lower rate of subluxation due to impingement, a drainage tube was placed and the wound was closed.
On postoperative day 1, our patient was in good overall clinical condition. The drain was therefore removed and gait training with partial weight bearing was initiated. We performed a three-dimensional CT scan 2 weeks postoperatively (Fig. a–d). Based on the images obtained, the ZedHIP® software indicated that our patient was capable of at least 126° of hip flexion or at least 20° of adduction and at least 20° of internal rotation at 90° of flexion until impingement occurred between the anterior osteotomized fragment and the anterior portion of the femoral neck (Fig. a, b). The anterior impingement sign disappeared 3 months after surgery. Our patient gradually started to practice wakeboarding beginning 6 months after surgery, at which time the JOA hip score was 100 on the left side, and he returned to full wakeboarding activity at 1 year after surgery.
|
pmc-6329052-1
|
A 17-year-old girl was referred to our endocrinology clinic for hyperkeratotic and pigmented lesions on her neck and whole trunk, which initially appeared when she was 4 years old. Her height was within the normal range during childhood (< 4 years) but gradually began to be under the normal growth curve, ultimately resulting in grown-up short stature.
The patient was the first child of an unrelated Chinese couple. Her mother underwent vaginal delivery after a full-term pregnancy. The birth weight of the girl was 4 kg and the birth length was 50 cm. She exhibited no neurological defects or skeletal abnormalities, no diabetes mellitus or its related symptoms, and no family history of cancer. The patient’s parents, younger sister and brother had no significant medical history (Fig. ).
On physical examination, the patient exhibited extensive, velvety, thick, hyperpigmented plaques involving the neck, back, and axillae (Fig. ). The patient was a non-dysmorphic girl with the height of 146 cm (<-2SD).
Laboratory tests revealed no abnormal biochemical findings (Table ). The thyroid hormone, cortisol and androgen levels were within the normal range (the testosterone level demonstrated in Table was under the reference range, we tested testosterone one more time, and the other value was normal: 31.8 ng/dl). Fasting blood glucose and fasting insulin level were 88.2 mg/dL and 13.78μU/ml, respectively. The homeostasis assessment index for insulin resistance (HOMA-IR) as the outcome of the fasting insulin (mUI/ml) × glucose (mmol/l) /22.5 was 3.0. This result indicated no insulin resistance. These findings excluded the diagnosis of insulin resistance, T2D, Cushing’s syndrome and hyperandrogenism.
X-ray examination (done at 14 years old) revealed no abnormalities (Fig. ).
As genetic mutations have been recognized in several cases of syndromic AN, a mutational analysis was performed in the proband and parents. Written informed consent was signed by the proband and her parents.
Peripheral blood samples (4 ml) of the proband and her parents were collected. Genomic DNA was extracted from the blood using a QIAamp DNA Mini Kit (Qiagen China Co., Ltd., Shanghai, China) according to the manufacturer’s recommendations. We first performed whole exome sequencing for the proband. Next, based on the test results of whole exome sequencing, the presence of the mutation in the proband and her parents was confirmed with direct Sanger sequencing of the affected exon.
All coding exons were enriched using the xGen Exome Research Panel v1.0 (Integrated DNA Technology, Inc). Captured DNA libraries were sequenced on Illumina Hiseq X Ten according to the manufacturer’s instructions for paired-end 150 bp reads. Variants were considered as pathogenic mutations if they exhibited the following components: i) rare or absent in the above genome databases; ii) variation expected to have a drastic effect on the protein (nonsense mutation, frame shift mutation, mutation at a splice site, or missense mutation is highly conserved among species); and iii) variation predicted to be damaging.
Sanger sequencing of the affected exon in FGFR3 was performed on DNA samples from the proband and her parents. According to the DNA sequence of the FGFR3 gene, primers of exon 14 of FGFR3 were designed using Primer Premier 5 software. The functional effects of protein variants were predicted by PolyPhen2 (/), SIFT () and Mutation Taster ().
Through data mining, combined with genetic characteristics and clinical manifestations, we identified a heterozygous c.1949A > C, p.Lys650Thr mutation in FGFR3 of the proband, which is considered to be a pathogenic mutation. As the proband’s parents did not carry the mutation, the mutation identified in the proband was a de novo mutation. Sanger sequencing confirmation is shown in Fig. . The mutation caused change in the protein from K to T at p. Lys650, which is located in exon 14 of FGFR3. The pathogenicity of the mutation on bone and skin has been previously reported [–] and was confirmed using 3 different software programmes (The expected score scales of the mutation from each software programme are shown in Additional file : Table S1): SIFT (0), PolyPhen-2 (1) and Mutation taster (disease-causing).
|
pmc-6329058-1
|
A 75-year-old woman was diagnosed as having stage IV transverse colon cancer in our hospital and began to receive chemotherapy in another hospital. As the first therapy, mFOLFOX6 (modified fluorouracil, leucovorin and oxaliplatin) plus bevacizumab (anti-VEGF-A antibody) was administered for 23 courses over 1 year with few side effects (Fig. ). Since her cancer status was progressive disease after the above treatment, the secondary therapy, FOLFILI (fluorouracil, leucovorin and irinotecan) plus ramucirumab (anti-VEGFR2 antibody) was started. After 2 courses of therapy (on days 1 and 22), she gradually developed anasarca and nephrotic syndrome and was referred to our nephrology clinic. On immediate admission on day 44, her blood test showed thrombocytopenia (platelets 57,000/μL), slight normocytic anemia (hemoglobin 11.3 g/dL), mild hypoalbuminemia (3.0 g/dL), and mild increase of lactate dehydrogenase level (433 IU/L) (Table ). Schistocytes were not found on the peripheral blood smear. Haptoglobin level was not measured. Urinary protein was 5.1 g/g-creatinine and dysmorphic erythrocytes were found in the urine. Renal biopsy on day 45 showed fibrin thrombi within capillary loops, mesangiolysis and double contour of the basement membrane of glomeruli (Fig. a, b, c). Immunofluorescence showed weak deposition of IgM, fibrinogen and C1q in mesangio-capillary regions (Fig. d). Electron micrograph showed diffuse endothelial swelling with obliteration of capillary lumina (Fig. ). Pathology was diagnosed as renal-limited TMA. Other causes of nephrotic syndrome, such as focal segmental glomerulosclerosis, membranous nephropathy and membranoproliferative glomerulonephritis, were denied. Ramucirumab was discontinued after the biopsy. By 6 weeks (day 69) after the last ramucirumab injection, thrombocytopenia (101,000/μL) and hypoalbuminemia (3.2 g/dL) showed improvement.
|
pmc-6329067-1
|
A 57-year-old Chinese man presented with repeated lumbago, chest congestion, and dyspnea on exertion for more than 6 months. The patient was found to have a left renal AVF by color Doppler ultrasonography 2 years ago. A pulsatile abdominal mass was palpable. No history of hypertension, diabetes mellitus, calculus of kidney, renal biopsy, abdominal operation or trauma. No family history. Both renal arterial computed tomography angiogram (CTA) and color Doppler ultrasonography showed a high-output IRAVF and dilated, tortuous renal artery and vein. Based on renal arterial CTA, the maximum diameter of an abnormal vascular mass in the left renal hilum was 6.2 cm and the left renal arterial trunk was 1.3 cm (Fig. ). Ultrasound cardiogram revealed an enlarged left ventricle with myocardial hypertrophy, and a reduced left ventricular ejection fraction (LVEF) of 57%.
Puncture and catheterization were performed in the right femoral artery under local anesthesia. The fistula was shown by superselective arteriography. The guidewire was inserted into the draining vein directly through the fistula. Then, a catheter was successfully introduced into the left renal vein and the drainage vein of the fistula via the right femoral vein. The guidewire could also enter arterial end against the direction of blood flow through the draining vein of the fistula.
The right internal jugular vein was successfully punctured and a 14 French sheath was implanted after dilation. A Lunderquist ultrahard guidewire (COOK®, Bloomington, IN, USA) was delivered into the feeding arterial segment of the left renal AVF via the right internal jugular vein, inferior vena cava, and left renal vein, successively. Then, a 14 French conveying device of the ASDO (26 mm in diameter, Shanghai Shape Memory Alloy Material Co., Shanghai, China) was introduced into the draining vein of the AVF via the left renal vein. The transported ASDO was placed in the dilated segment of the drainage vein of the AVF at the point of its maximum diameter. A remarkably reduced blood flow velocity in the AVF was observed without any indications of escape of the ASDO.
An 8 French guiding catheter (Medtronic, Inc., Minneapolis, MN, USA) was introduced into the drainage vein through the right femoral vein, and three vascular plugs (16 mm in diameter, AMPLATZER Vascular Plug II) were placed over the proximal end of the ASDO. Then, a 5 French Simmons catheter (Terumo LECo., Tokyo, Japan) was introduced and a detachable elastic coil (14 mm in diameter, Boston Scientific Co., Natick, MA, USA) was placed into the gap of the vascular plugs (Fig. ). Left renal arteriography manifested that the blood flow in the AVF was stagnant, the shunt disappeared, and blood flow of the normal renal artery was unobstructed.
Abdominal aortic angiography demonstrated an enlarged left renal arterial trunk with increased blood flow velocity and volume. A dilated branch of the renal artery was directly pouring into the drainage vein, the left renal vein, and the inferior vena cava. The diameters of the abdominal aorta and left renal artery were 2.2 cm and 1.3 cm, respectively. On left renal arteriography, the left renal artery and vein displayed almost simultaneously and the feeding artery of the fistula was uniformly dilated and tortuous. The fistula was measured as 1.4 cm in diameter (Fig. ). The digital subtraction angiography (DSA) of the feeding artery and the drainage vein of the fistula showed that the drainage vein was tortuous and not uniformly dilated; the maximum diameter of the segment approaching the fistula was up to 2.2 cm.
The patient had no chills, fever, vomiting, or other symptoms postoperatively. No obvious abnormalities were found on urinalysis and renal function testing (creatinine, Cr: 85 μmol/L; range 53–123 μmol/L).
The patient’s symptoms of lumbago, chest congestion, and dyspnea on exertion completely remitted 3 months postoperatively. No obvious abnormalities were found in blood pressure and renal function (Cr: 82 μmol/L). Renal arterial CTA showed that the diameter of the renal artery reduced remarkably to 1.1 cm. Formation of intravascular thrombus within the renal AVF was observed (Fig. ). Color Doppler ultrasonography showed that no obvious blood flow signals were found in the vasculature of the AVF. LVEF was 60% postoperatively. No postoperative complications, such as pulmonary embolism and shifting of occluders, occurred during the last 2 years of follow-up. Emission computed tomography revealed that the left renal glomerular filtration rate (GFR) was 35.3 mL/min and the right renal GFR was 23.6 mL/min. The serum creatinine was 100.3 μmol/L, the LVEF was 67% at 2 years postoperatively.
|
pmc-6329072-1
|
In May 2016, a 67-year-old woman came primarily to our hospital for a consultation about painless mass of the left lower gingiva. Intra-oral examination showed a 46 × 25-mm tumor with induration on the left lower gingiva (Fig. ). A submucosal mass, independent of the gingival tumor, was palpable in the left buccal region. Several cervical lymph nodes on the left side were also palpable. Pathological examination of a biopsy sample taken from the gingival tumor revealed a well-differentiated squamous cell carcinoma.
A computed tomography (CT) scan with contrast showed a large gingival tumor, with destruction of the adjacent mandibular bone, and four metastatic left-cervical lymph nodes that were markedly enlarged, non-homogeneously enhanced, and partially necrotic. These lymph nodes included two left submandibular and two left upper jugular nodes. CT imaging showed no metastases to the lungs. Magnetic resonance imaging (MRI) showed a large primary tumor on the left side, with its epicenter located in the lower gingiva. The tumor appeared to extend into the sublingual space medially and into the buccinator muscle laterally. A non-homogeneously enhanced mass was identified in the buccinator space along the facial vessels, anterior to the anterior edge of the masseter muscle, and lateral to the buccinator muscle (Fig. ). This mass lay on the cranial side of the primary tumor. The mandibular ramus and pterygoid region that are on the cranial side of BN were not invaded by primary tumor (Fig. ). Moreover, T1-weighted MRI showed a thin layer with high signal, indicative of fatty tissue, between this mass and the primary tumor, indicating that the mass was independent of the primary tumor. Based on its anatomic location, the mass appeared to be metastatic disease to BN. Greyscale sonogram showed some metastatic cervical lymph nodes on the left, and metastatic BN. These cervical lymph nodes were markedly enlarged, round in shape, heterogenous hypoechoic, and without an echogenic hilus. Metastatic BN was round in shape, hypoechoic, with well-defined borders, and without an echogenic hilus.
The tumor was diagnosed as a cT4aN2bM0 squamous cell carcinoma of the lower gingiva. The patient received neoadjuvant chemotherapy, consisting of docetaxel 60–70 mg/m2 and cisplatin 70 mg/m2 on day 1, and 5-fluorouracil 700 mg/m2/day 96 h continuous infusion. Gross examination after two cycles of chemotherapy showed marked shrinkage of the primary tumor. A slight reduction in BN size was observed. According to the Response Evaluation Criteria in Solid Tumors (RECIST) guidelines, version 1.1 [], this patient showed a partial response to treatment.
Three weeks after the end of neoadjuvant chemotherapy, the patient underwent surgery, consisting of suprahyoid neck dissection (levels I–II) on the right side, classical radical neck dissection (levels I–V) on the left side, segmental mandibulectomy, and oromandibular reconstruction with a scapular osteocutaneous flap. The primary tumor and buccinator space including BN were dissected in continuity with neck dissection. Histopathological examination of the segmental mandibulectomy specimens showed that the alveolar bone and part of the bone trabeculae of the mandible had been resorbed and replaced by fibrous connective tissue. This tissue contained a few nests of squamous cell carcinoma, composed mainly of necrotic tissue with a small number of viable cancer cells and remnants of keratin pearls. The surgical margins were free from tumor. Metastatic disease was detected in five cervical lymph nodes, including one left submandibular aggregated-node, three left upper jugular nodes, and one left middle jugular node. No metastatic nodes revealed extra-nodal extension. Metastasis to BN was also present (Fig. ). These metastatic regions contained few viable cancer cells and consisted primarily of necrotic tissue.
Following surgery, the patient was treated with adjuvant radiotherapy (50 Gy/25 fractions) with concurrent oral chemotherapy (S-1, 100 mg/day for 5 days per week for 5 weeks) []. Two years later, there has been no evidence of tumor recurrence or metastasis.
|
pmc-6329093-1
|
A 48-year-old female, active smoker (36 pack-years) and without any occupational or environmental exposure, had been followed up for sporadic LAM since 2004. In her case, LAM was not associated with tuberous sclerosis complex. Initial computed tomography (CT) of the chest revealed diffuse bilateral cysts with thin walls that are typical of LAM, in addition to retroperitoneal involvement with left iliac, hypogastric, and latero-aortic angiomyolipomas. In April 2004, a biopsy of a retroperitoneal mass was performed revealing fusiform proliferation of smooth muscle-differentiated cells within a rich vascular and adipose stroma, with strong positivity for HMB45 staining, evocative of an angiomyolipoma. In 2006, the patient developed New York Heart Association Class II dyspnea on exercise, along with a chronic cough. From 2006 to 2007, she received several sequential anti-estrogen treatments, specifically tamoxifen and letrozole combined with triptorelin, with stable respiratory function. In 2007, the patient exhibited lung function deterioration, which led to the prescription of the mTOR inhibitor sirolimus (2 mg once daily, while the daily dose for treating renal cancer is 10 mg daily), resulting in the disappearance of retroperitoneal lesions.
In 2013, CT showed a right apical lung mass, highly suggestive of cancer, due to its size, radiological features, and hypermetabolism (SUVmax = 4.8) on TEP-CT. Sirolimus was stopped owing to its immunosuppressive effect, which may have induced cancer development. First, a CT-guided biopsy was then performed despite pulmonary functional impairment, with pathological analysis revealing neither tumoral lesion nor LAM cells, but rather fibroelastosic scarring. The decision to monitor CT without immediately repeating transthoracic biopsy was made, owing to the very small lesion size in a patient with functional impairment. For this reason, we thought that performing such a biopsy would have been too risky (Fig. ).
Upon follow-up in 2015, due to the target lesions’ further growing while, another CT biopsy was carried out, showing mucin-producing adenocarcinoma (CK7+, CK20-, TTF1-) along with inflammatory stroma. EGFR and ALK testing proved negative. Additional molecular analyses revealed only a potentially oncogenic B-RAF mutation (c1406G > T; p.Gly469Val; COSM459) in exon 11. No c-met skip exon 14, PIK3CA, KRAS, or HER2 mutations were observed. PD-L1 immunohistochemistry testing was negative. No other distant lesion was observed. Cyberknife treatment of the lung lesion was carried out in April 2015.
However, a new patient assessment in July 2015 disclosed distant relapse in adrenal glands and left iliac lymph node, despite the thoracic lesion’s partial response. Due to high evidence of relapse on imaging, another tumor biopsy was not performed at that time. A first-line chemotherapy comprising cisplatin plus pemetrexed was initiated. As reassessment after two cycles in November 2015 showed local progression, a second-line treatment of weekly paclitaxel plus bevacizumab was initiated. In December 2015, performance status worsened from 1 to 2, with tumor assessment showing further progression in the adrenal glands.
Third-line therapy with nivolumab was started on December 11, 2015, given that no other viable treatment options were available. PD-L1 staining was negative at diagnosis and not tested again at relapse. Within 2 h of the first infusion, the patient developed complete right pneumothorax requiring pleural drainage. The persistence of pneumothorax at 48 h justified surgical pleurodesis, along with a 2-month hospitalization in the thoracic surgery department, owing to prolonged air leaking. A CT scan conducted 20 days after the only nivolumab infusion demonstrated a dramatic partial response in the lung and adrenal lesions (Fig. ). Given that the pneumothorax occurred very shortly after nivolumab infusion, we hypothesized that the complication would more likely have been caused by LAM, rather than being directly related to nivolumab. Accordingly, we resumed nivolumab in January 2016, with no other recurrence of this adverse event.
Since that time the patient’s performance status has been 1 and she proved able to undergo pulmonary rehabilitation while gradually resuming work. Treatment was well tolerated with no major safety issues. The patient developed Grade II hypothyroidism treated with hormone replacement therapy. Lung function tests and symptoms worsened progressively from June 2013 to May 2017 (decline of CVF from 3700 mL in June 2013 to 2250 mL in May 2017, the decline being progressive). A bronchoalveolar lavage was performed showing no evidence of infection, tumoral cells, or lymphocytosis. This worsening was not accounted for by infection, tumor progression, or visible nivolumab-associated pneumonitis upon CT-scan follow-up. The patient’s deterioration was, therefore, attributed to LAM. While we observed a decline in lung function tests, there was no accelerated decline of lung function tests during nivolumab treatment, nor was there any argument for a LAM exacerbation.
In May 2017, sirolimus, stopped since 2013, was reinitiated in conjunction with nivolumab. It was a collective decision that was shared with the patient, because of the ethical challenge raised due to the lack of scientifically-sound evidence. CT-scans were performed every 2 to 3 months, and lung function tests every 6 months.”
She presented without any undesirable effects with improving lung function tests and a good partial response continuing up to February 2018 (Fig. ).
|
pmc-6329119-1
|
We report a 15-year-old African-American male who presented with a six-week history of polyarthralgias, fevers, and bilateral eye and foot swelling. Initial laboratory studies revealed an elevated ALT of 337 units/L and AST 380 units/L. Infectious workup was negative. Over the next 3 weeks, he developed worsening polyarthralgias and progressive muscle weakness.
Review of systems revealed substernal chest pain while lying down, intermittent dysphagia and Raynaud’s phenomenon in his hands and feet. Physical examination revealed 4/5 proximal muscle weakness in upper and lower extremities, heliotrope rash, and telangiectasias upon nail fold capillaroscopy but no Gottron’s papules. Laboratory values included: CK 11426 units/L (19–191 units/L), aldolase> 50.0 units/L (3.4–8.6 U/L), CRP 64.5 mg/L (< 8 mg/L), ESR 77 mm/h (0–15 mm/h), positive ANA (1:640 titer, nuclear membrane pattern). MRI hip and femur revealed bilateral multifocal patchy muscular edema, most markedly within the distal gluteus medius proximally and the distal semimembranosus muscles. The patient was subsequently diagnosed with JDM based on fulfillment of Bohan and Peter criteria. He was admitted for further workup and treatment.
While admitted, prior to treatment, he developed tachycardia (96–121 bpm), with diastolic blood pressures in the 30–40s despite normal systolic blood pressures at 99–111 mmHg. The cardiovascular examination showed regular rhythm without a murmur, rub, or gallop. Echocardiogram revealed diffuse dilation of the left main coronary artery (LMCA) (5.91 mm, Z-score 4.2) as well as the left anterior descending (LAD) artery (4.42 mm, Z-score 3.1), with normal intracardiac anatomy and normal ventricular size, wall thickness, and systolic function. Electrocardiogram showed sinus tachycardia. Chest x-ray was negative, without any evidence of interstitial lung disease. He was treated with IV methylprednisolone (IVMP) 1 g daily for 4 days and intravenous immunoglobulin (IVIG) at 1 g/kg for 1 dose. Afterward, his diastolic BP improved and tachycardia resolved. CK improved to 3300 units/L. He went home on 40 mg daily prednisone, 100 mg cyclosporine twice daily, 25 mg methotrexate weekly, 1 mg folic acid daily, and aspirin 81 mg daily.
Four weeks after discharge, he developed progressive right-sided shoulder pain, shortness of breath, and dyspnea, with 10 pound weight loss. CT chest showed bilateral diffuse pulmonary infiltrate, with lower lobe predominance, with prominent parenchymal interlobular septa, ground-glass opacities, subpleural cystic changes, consistent with non-specific interstitial pneumonia pattern. Due to progressive symptoms refractory to outpatient management, he was admitted again for further workup and treatment. Subsequent lung biopsy showed severe, extensive interstitial fibrosis with a mixed inflammatory infiltrate and focal subpleural cystic change. Muscle biopsy revealed mild variation of muscle fiber size, mild atrophy of fibers, predominately type 2, and a slight increase of internal nuclei. Immunohistochemistry demonstrated positive MHC1 stain with a membranous pattern. An inflammatory infiltrate, perifasicular atrophy, calcifications, necrosis, fibrosis or tubulo-reticular inclusions were not seen. Myositis-specific antibody panel was positive for an anti-PL-12 antibody. Given the severity of symptoms, monthly cyclophosphamide IV was added to his treatment regimen, and methylprednisolone IV ‘pulses’ at 1 g IV daily for 3 days were started. Follow up echocardiogram revealed borderline dilation of the left main coronary artery (4.6 mm, Z-score of 2) and a left anterior descending coronary artery of normal size (2.9 mm). There was no evidence of coronary artery aneurysm. Three weeks after discharge, he reported symptomatic improvement with improved joint mobility, muscle strength, and no further chest pain.
|
pmc-6329120-1
|
A 78-years old male was admitted to the Hematology of the University Hospital Sant’Andrea-Sapienza, because of worsening fatigue and abdominal pain. Written informed consent was obtained from the patient and the study was approved by our institutional review board.
The peripheral blood count showed hyperleucocytosis (WBC 118 × 109/L), anemia (hemoglobin 8.6 g/dl) and mild thrombocytopenia (98 × 109/L), with no associated splenomegaly. Peripheral blood smear showed hypercellularity with 90% blast cells.
The morphological examination of bone marrow (BM) aspirate showed 90% agranular blast cells of medium and large size (Fig. ) and the immunophenotypic analysis performed on a FACScalibur flow cytometer using standard protocol revealed that blast cells were CD34+, CD117+, CD33+, CD13+, HLA-DR+, CD2+ MPO+/−, CD7+/− [].
A diagnosis of AML (M2) was established and the patient started cytoreduction with hydroxyurea obtaining after seven days of treatment a WBC count of 39 × 109/L.
Conventional karyotyping was performed on the BM diagnostic aspirate after short-term culture and analyzed after G-banding. The description of the karyotype was made according to the International System for Human Cytogenetic Nomenclature. The cytogenetic analysis on G-banded metaphases disclosed a 46,XY,t(9;22)(q34;q11) karyotype. Then, interphase FISH experiments were carried out using BCR-ABL1 probes (Vysis) and demonstrated the presence of BCR-ABL1 fusion gene.
At the resolution of a pulmonary aspergillus infection treated with voriconazole, while the cytogenetic and molecular analyses were ongoing, the patient started treatment with 5-aza-2′-deoxycytidine (otherwise called decitabine, 20 mg/m2 for 5 days) for a total of two cycles. Subsequently, nested RT-PCR revealed the simultaneous presence of the common p190 e1a2 and the rare e6a2 isoforms (Fig. ). PCR products, corresponding to BCR-ABL1 p190 amplification, were purified from agarose gel (QIAquick PCR Purification Kit - Qiagen) and directly sequenced on ABI/Prism 3130 Sequencer (Thermo Fisher Scientific) using BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific). RQ-PCR for e6a2 BCR-ABL1 transcript analysis was performed using the forward primer Q-BCR_ex6_F (GATCCAACGACCAAGAACTCTCT), the reverse primer ENR561 and the ENP541 probe reported elsewhere []. The p190 e6a2 values were normalized on the number of ABL1 transcripts and expressed as the number of p190 e6a2 copies every 104 copies of ABL1. To assess molecular response after treatment, a real-time quantitative RT-PCR assay (RQ-PCR) for p190 e6a2 was designed by which we observed significant different kinetics through the e1a2 and e6a2 transcripts with consistent persistence of e6a2 [].
After the first, BM aspirated showed 70% blast cells and two transcripts e1a2 and e6a2 were respectively 3.09 and 5805.47/104 ABL1, while after second cycles blast cells were 20% and e1a2 and e6a2 5.71 and 5747.52.
Because of persistent pancytopenia and presence of blasts after two cycles of decitabine and in light of molecular data, the patient was then switched to TKI treatment.
The initial therapy consisted of imatinib 600 mg/day for two weeks that was subsequently reduced to 400 mg/day due to febrile neutropenia. After one month of imatinib, bone marrow showed 60% blast cells with small improvement of thrombocytopenia. Therefore, treatment was switched to dasatinib 100 mg/day, but it was discontinued five days later because of pulmonary embolism. At 10 days of TKI discontinuation, e1a2 and e6a2 were 0.17 and 9477.16/104 ABL1, respectively. After two months of continuous therapy with TKIs, bone marrow infiltration was present and the two transcripts were e1a2 1.6 and e6a2 23727.06/104 ABL1 (Fig. ).
The patient, still refractory to second-line treatment, died of pulmonary infection.
|
pmc-6329170-1
|
A 76-year old male presenting as a one-month history of dry cough and left chest pain was admitted to our hospital. The patient had a past history of aortic stenosis, abdominal aortic aneurysm, and chronic atrial fibrillation, and he had smoked one and a half pack of cigarettes per day for 27 years from the age of 20 to 47. CT scan of the chest showed left hilar lung mass, left pleural effusion, atelectasis of the left lower lobe and multiple lung nodules predominantly in the right lung (Fig. ). Cytological examination of the pleural effusion revealed adenocarcinoma cells and immunohistochemistry (IHC) analysis of pleural effusion cell block was performed to determine the primary organ from which the cancer developed. Malignant cells in the pleural effusion were positive for Cytokeratin 7 (CK7) and negative for cytokeratin 20 (CK20) (Fig. ). These cells were negative for two lung adenocarcinoma (LUAD) markers; TTF1 and Napsin A, and IHC analysis could not determine the primary organ of the tumor. Adenocarcinoma cells in the pleural effusion were also negative for LUAD specific oncogenic driver mutations: EGFR mutation and ALK translocation determined using the PCR-invader method [] and the intercalated antibody-enhanced polymer (iAEP) method (HISTOFINE ALK iAEP® kit, Nichirei Biosciences, Inc., Tokyo, Japan) [], respectively. The values of serum tumor markers were as follows: CEA 2.9 ng/ml (normal range, 0 to 5); CA19–92326 U/ml (normal range, 0 to 37); CYFRA 57.7 ng/ml (normal range, 0 to 3.5); pro-GRP 34.5 pg/ml (normal range, 0 to 80.9); PSA 0.96 ng/ml (normal range, 0 to 4). Although the primary organ was not clear, the patient was treated by the combination of carboplatin (AUC 5) and paclitaxel (200 mg/m2), which is one of the standard chemotherapy for both LUAD and CUP.
A tumor of the palate mucosa was noticed on physical examination of the oral cavity. The tumor of the palate mucosa was a small (major axis; 7 mm) and round mass with smooth surface. It located in the middle of his palate. Magnetic Resonance Imaging (MRI) showed this tumor in the palate; however, deep invasion was not observed (Fig. ). 18F-Fluorodeoxyglucose-positron emission tomography/computed tomography (FDG-PET/CT) indicated abnormal intake of FDG of the palate mucosa and both lungs, which were considered malignant lesions (Additional file : Figure S1). Multiple lymph node metastases, multiple bone metastasis, and pleural dissemination were also suspected.
A biopsy was performed for the tumor of the palate mucosa under the local anesthesia. The histology revealed an adenocarcinoma consisting of tubular or papillary proliferation of columnar-shaped tumor cells invading the subepithelial tissue (Fig. ). The tumor cells were positive for CK7 and negative for CK20, TTF-1 and Napsin A, which was consistent with the result of the pleural effusion. Whether the tumor of the palate mucosa was a metastatic or primary tumor remained inconclusive at this time.
Then, we evaluated the possibility of this tumor in the palate mucosa as a primary tumor. Most common malignant neoplasms of the palate mucosa are known to be MSGTs. Especially, SC is one of the common MSGT [], however mammaglobin and S-100 protein was immunohistochemically negative and ETV6-NTRK3 (EN) fusion was not observed in fluorescence in situ hybridization (FISH) analysis by using Vysis®LSI® ETV6 Break Apart Rearrangement Probe (Abbott Molecular/Vysis) (Additional file : Figure S2). Other MSGT such as AcCC, AdCC, PLGA, and MEC were also excluded as a diagnosis based on histological and immunohistochemical findings.
Because of the absence of EGFR mutation and ALK translocation, this case was registered to Lung Cancer Genomic Screening Project for Indivisualized Medicine in Japan (LC-SCRUM-Japan). The cancer genome screening of the fresh frozen tumor of the palate mucosa was performed using Oncomine® Cancer Research Panel (OCP, Thermo Fisher Scientific, MA, USA), which successfully identified an oncogenic KRAS mutation at codon 12 (p.G12D). Furthermore, presence or abscense of KRAS mutation in pleural effusion was examined. Genomic DNA was purified from formalin-fixed paraffin-embedded (FFPE) cells of pleural effusion using Deparaffinization Solution (QIAGEN) and QIAamp DNA FFPE Tissue Kit (QIAGEN). PCR was performed using 40 ng genomic DNA and the following primers; forward primer, 5′- AGGCCTGCTGAAAATGACTG -3′, and reverse primer, 5′- GGTCCTGCACCAGTAATATGCA -3′ (annealing temperature: 55 °C) []. As a result, KRAS mutation at codon 12 (p.G12D) was also identified in pleural effusion by direct sequencing (Fig. ). The KRAS mutation is known to exist in one third of the LUAD, but it is quite rare in MSGT [, ]. Although the KRAS mutation is also known to be one of the common abnormalities in pancreatic and colorectal cancers [], the possibility of metastasis from colorectal cancer is quite unlikely because gastrointestinal endoscopy did not show the presence of malignant lesions. The metastasis of pancreatic cancer is also unlikely from the results of CT scan and FDG-PET/CT. Together with the cytological similarities between tumor cells in the pleural effusion and those of the palate mucosa, we concluded that the tumor of the palate is a metastatic stage IV LUAD (cT3N3M1c according to the 8th edition of TNM staging of lung cancer). Adenocarcinoma, not otherwise specified (NOS), that shows glandular or ductal differentiation but lacks the prominent histomorphologic features was excluded as a diagnosis because the carcinoma in this study was characterized other, more specific types of carcinoma.
The disease progressed after two cycles of chemotherapy with carboplatin and paclitaxel. The patient received two cycles of immunotherapy with nivolumab as a second line therapy, but died due to disease progression four months after the first admission.
|
pmc-6329613-1
|
A 57-year-old male presented with left upper extremity swelling and pain for five days. He had been recently discharged from another facility after treatment of left lower extremity cellulitis. On that admission he was told that his white blood cell (WBC) count was more than 200 X 103 and that they were suspecting CLL, but before further testing could be done to confirm the diagnosis he left against medical advice. On further questioning, the patient was found to be homeless, with no insurance or money, and he said that he lived on a road crossing opposite the hospital. He did not have any significant past medical or surgical history. On examination he was afebrile and did not have tachycardia. His left upper extremity was swollen from below the elbow to the hand, was red, indurated, and tender. His left lower extremity was also swollen and indurated but did not show any redness or tenderness. Initial labs revealed a WBC of 256 with 87.5% atypical lymphocytes, hemoglobin of 13.4 g/dl, a platelet count of 166 x 109/L. His electrolytes were significant for a potassium level of 5.4 meq/L. A peripheral blood smear showed smudge cells (Figure ). Further testing showed enlarged lymph nodes within retroperitoneal, mesenteric, pelvic and inguinal distribution, as well as axillary and right hilar areas. Flow cytometry revealed CLL with monoclonal B cells (CD19+, CD20DIM+, CD5+, CD23+, CD10-, FMC7-, CD38-, ZAP70- SURFACE KAPPA DIM+). Over the course of the hospital stay the labs of the patient showed a potassium level as high as 8 meq/L. At other times it ranged between 6 meq/L and 8 meq/L, while the patient remained asymptomatic and the electrocardiogram did not show any changes. A decision was made to not treat the patient's potassium since it was concluded to be falsely elevated. The patient was discharged from the hospital on cephalexin for cellulitis with outpatient follow-up with hematology-oncology.
|
pmc-6329616-1
|
An 83-year-old female patient, with a history of breast cancer diagnosed at the age of 68, for which she underwent lumpectomy followed by radiotherapy and chemotherapy, was referred to the ob-gyn department of our hospital for an evaluation of the right adnexal mass discovered during her yearly follow-up. On physical examination, a palpable mass was found in the right hypogastric area without tenderness. Tumor markers were within normal rates, with a mild elevation of serum carcinoembryonic antigen (CEA) 5.3ng/ml (normal rates< 4.7) and of serum cancer antigen 15-3 (CA 15-3) 31.4U/ml (normal rates <28). An abdominal ultrasound showed a hypoechoic formation, sized 80.0 x 36.6 mm, below the uterus. An intravaginal ultrasound revealed a mixed texture mass, sized 8.7cm, with a solid and a cystic part in the right ovary. No free fluid was seen in the Douglas pouch. An abdominal magnetic resonance imaging (MRI) scan was carried out, which identified a cystic mass, sized 9 cm, in the right iliac fossa. The mass was in contact with the right ovary, uterus, and intestines. It was described as thin-walled without a disturbance in its molecular diffusion and with low-grade heterogeneity in its upper part, as can be seen in Figure .
The patient underwent an exploratory laparotomy under the diagnosis of a pelvic mass. The perioperative bilateral adnexa and uterus were found normal during the abdominal exploration. An appendiceal mass was revealed and a formal appendectomy was performed (Figure ).
A frozen section of the appendix specimen diagnosed cystadenoma. The postoperative course was uneventful. A pathological examination of the surgical specimen revealed a low-grade mucinous neoplasm of the appendix (Figure ).
After a year of follow-up, the patient is asymptomatic, with no pathological imaging findings.
|
pmc-6329617-1
|
A 38-year-old female with no past medical history came to the hospital with complaints of episodic chest discomfort, mild dyspnea, and occasional non-productive cough. On physical examination, she was hemodynamically stable without any pathological finding. A chest x-ray was done and it showed mass-like opacities abutting the right heart (Figure ).
To have a better idea of the cause of opacity, a further assessment with computed tomography (CT) chest with contrast was ordered and it showed a large, well-circumscribed, heterogeneously enhancing mass of 10 cm with peripheral calcification in the right mediastinum. Also, there was a dilated vessel along the posteromedial and inferior of the mass (Figure ).
After the chest CT findings, the patient was admitted to the hospital for further evaluation and cardiac consult was called. In order to differentiate if the mass was due to some tumor or some anomaly of the coronary vessel, coronary CT angiography with contrast was ordered. A subsequent coronary CT angiography (CCTA) showed a 9.7 cm aneurysm and an anomalous vessel emanating from the left coronary artery and the proximal circumflex, fistulizing into the right atrial appendage. CCTA also showed a dilated right atrium likely due to fistula formation (Figures -).
When the right heart catheterization was performed, a rise in saturation was noted in the right side of the heart due to shunting of blood from the left side to the right side of the heart as a result of coronary cameral fistula formation between the right heart and the anomalous vessel originating from the left coronary artery and proximal circumflex artery. On transesophageal echocardiogram (TEE), an enlarged right atrial chamber was noted due to the fistulous tract draining into the right atrium. The cardiothoracic department then scheduled the patient for surgery. Sternotomy was performed to repair the coronary artery aneurysm with ligation and resection of the coronary cameral fistula and repair of the right atrium. Surgery went well and no intra-operative and postoperative complications were noted.
|
pmc-6329688-1
|
An 86-year-old woman was admitted to our hospital with symptoms of dysphagia. Upper gastrointestinal endoscopy showed an elevated lesion 33–36 cm from an incisor tooth accompanied by ulcers at the center of lesion, which was located in the lower thoracic esophagus (Fig. a). Another submucosal tumor located at the anal site of the lower thoracic esophagus was considered intramural metastasis. Esophagography showed the main tumor lesion on the left antero-lateral wall of the lower esophagus and a submucosal tumor on the other side causing constriction of the esophagus. The main lesion had good extension on its basal part, indicating that the depth of invasion was the submucosal level (Fig. b). Contrast-enhanced computed tomography (CT) showed the protruded tumor lesion to be 3 cm in size, with no findings of lymph node or distant metastasis (Fig. c). Positron emission tomography-CT (PET-CT) showed an increased uptake of fluorodeoxyglucose (18F-FDG) in the lower thoracic esophagus and no findings of lymph metastasis (Fig. d). A blood test showed that tumor markers, such as carcinoembryonic antigen (CEA) and squamous cell carcinoma associated antigen (SCC), were not elevated. A pathological examination of an endoscopic biopsy revealed moderately to poorly differentiated squamous cell carcinoma. Based on these preoperative analyses, the patient was diagnosed with cT2N0M0, cStageII esophageal squamous cell carcinoma.
Because the patient was elderly and had a poor performance status (PS 2), she did not undergo preoperative therapy, postoperative therapy, or lymph node dissection of the superior to mid-mediastinum regions. We instead performed thoracoscopy- and laparoscopy-assisted subtotal esophagectomy and reconstruction with the gastric tube. Under thoracoscopy and laparoscopy, we performed subtotal esophagectomy and lymphadenectomy, and reconstruction was performed through the retrosternal route. The total operation time was 377 min, and intraoperative blood loss was 105 ml. Oral diet was started 11 days after the operation, and the patient was transferred to another hospital for rehabilitation on day 25 in a good general condition.
Three tumors were found in the resected specimen; the biggest tumor was 58 × 52 mm in size, and none were stained with Lugol or showed deposition of melanocytes (Fig. a–c). A pathological examination showed that the tumors were located at the mucosa and submucosa of the esophageal wall and were composed of atypical epithelioid cells in a sheeted pattern with necrosis and spindle-shaped cells in a haphazard pattern; however, no melanocytes were observed. Immunohistochemically, atypical epithelioid cells were positive focally for S-100 and HMB45 and partially for Melan-A (Fig. ), and spindle-shaped cells were positive focally for these markers. However, all of them were negative for almost all of the epithelial markers. We thus decided on a diagnosis of amelanotic type PMME. Although lymph node metastasis at the paracardial lymph nodes (No. 2) was detected, a CT scan performed at 12 months after surgery showed no findings of recurrence.
|
pmc-6329739-1
|
In November 1969, an 18-year-old woman underwent a subtotal thyroidectomy with a right modified neck dissection for bilateral thyroid cancers. The pathological diagnosis was bilateral medullary thyroid carcinomas with multiple nodal metastases. In 1975, when the measurement of calcitonin became available, she was found to have hypercalcitoninemia indicating persistent disease (Fig. ). However, imaging studies failed to reveal metastatic lesions. In 1984, she underwent a bilateral total adrenalectomy for bilateral pheochromocytoma through an abdominal approach. Multiple small nodules were found on her liver surface, a biopsy of which showed metastatic medullary carcinoma. In 1987, she underwent a completion thyroidectomy and left modified neck dissection and extirpation of an enlarged parathyroid gland for recurrent MTC and the appearance of primary hyperparathyroidism. In 2014, at 63 years old, she was asymptomatic with elevated serum calcitonin (3900 pg/ml) and CEA (177 ng/ml) levels. Imaging studies revealed multiple small low-density lesions with spotty calcifications in her liver, consistent with multiple small liver metastases. She carries RET codon 634 mutation.
The changes in her serum calcitonin levels over time and major clinical events are shown in Fig. . Periodic measurements of serum calcitonin following the initial thyroid surgery showed a moderate increase in the values with the Ct-DT of 8.7 years, a decrease after the second neck surgery followed by a similar increase with Ct-DT of 9.1 years, and interestingly, a significant gradual decrease in serum calcitonin levels, giving a negative value to Ct-DT at −63.0 years since approx. 45–50 years of age, without any causative events.
|
pmc-6329901-1
|
A 22-year-old East African woman with vertically acquired HIV had been diagnosed shortly after birth. Her baseline viral load (VL) was 375 000 copies/mL, her CD4 was 150 cells/mm3, and she had subtype D infection. At diagnosis, zidovudine monotherapy was commenced. Didanosine was added 2 years later, and she was switched to stavudine, lamivudine, and nelfinavir at 3 years of age. The VL dropped to 700 copies/mL; however, it rebounded to 6000 copies/mL: at that time, a first resistance test showed M184V and D30N mutations. The patient then received zalcitabine, abacavir, and amprenavir. Subsequently, she maintained poor virological control despite changing antiretrovirals three times, with NNRTIs introduced during these changes (). Poor adherence continued until 11 years of age, when virological suppression was achieved with maraviroc, etravirine, and twice-daily darunavir/ritonavir. Subsequently, she disengaged from care, with inconsistent attendance over a period of 8 years. On re-engagement in care, her VL was 1610 copies/mL, and her CD4 was 104 cells/mm3. At that time, resistance testing showed NRTI (M184V, T69D, T215S, D67N, K219Q), NNRTI (Y181C, Y188L, H221Y) and PI (L10I, D30N, K20T, L33F, K43T, N88D) resistance, with PI resistance to nelfinavir. Integrase polymorphisms (17N, 256E, 112V, 113V, 201I, 234I) were detected. Maraviroc, etravirine, and darunavir/ritonavir (twice daily) were restarted. This regimen was simplified to darunavir/ritonavir and maraviroc, and subsequently to darunavir/ritonavir monotherapy once virological suppression was achieved. Six months later, the VL rebounded to 8600 copies/mL, and DTG 50 mg once a day was added. Poor engagement continued for 18 months; at this later, time integrase resistance testing showed the R263K mutation conferring low-level resistance to DTG and raltegravir, with intermediate resistance to elvitegravir. R263K was confirmed by next-generation sequencing (NGS) using an analysis percentage minority variant threshold of >20%. To avoid accumulation of integrase resistance mutations with ongoing poor adherence, she was switched to tenofovir, darunavir/ritonavir. Follow-up NGS sequencing 3 months after the first resistance test showed the R263K mutation at <5% in a sample with a VL of 61 000 copies/mL.
Reasons for poor adherence and disengagement over time included drug adverse reactions and pill burden, a lack of family support, and lack of finances to attend outpatient appointments. The patient reported low mood, which reduced her motivation to take ARVs and engage in care. Despite multiple strategies to facilitate adherence, this patient declined psychological and mental health support.
|
pmc-6330383-1
|
A 59 year-old female patient, who has been employed as rehabilitation worker, has observed gradually enlarging formations under both her right and left scapula for approximately eight months. In anteflexion, elevation of the upper extremities and when stretching the arms forward, swellings reaching up to the rear axillary lines appear bilaterally subscapularly. They were of soft consistency at palpation. The patient also described pain in the upper extremities, and in the region of arms. She had no recollection of any accident or fall. However, she had undergone neurosurgical operating procedures of disc extrusion in the cervical and thoracic spine, and the findings of bilateral resistances were present already pre-operatively. In the another surgical workplace repeated punctures and partial resection of the swelling on the right side were implemented 5 months ago, and it came to its subsequent recurrence.
The magnetic resonance ((b) and (c)) on thoracic wall showed in dorsolateral parts in subscapular regions in the level of 3rd to 7th rib symmetrical limited fluid collections with dimensions of 120 × 37 x 115 mm on the right side with a volume of 250 ml and on the left side 120 × 24 x 90 mm with a volume of 130 ml. The collections were localised in the intermuscular spaces between the external intercostal muscles and the heads of the muscle serratus anterior. The contents of collections were moderately heterogeneous with sporadic internal septa. Cystic formations had slightly distinct signal, native image in T1 weighing displayed hypersensitive contents on the right side. It could be a case of chronic post haemorrhagic changes. Postcontrastly the collections were without amplification of signal intensity. On the left side postcontrastly there was present a moderate reinforcement of capsule of fluid collection. In diffuse weighing the lesions were without marks of diffusion restriction. Axillary lymphatic nodes were of physiological size, the displayed pulmonary parenchyma was without inflammatory and focal changes, without mediastinal and hilar lymphadenopathy, the pleural cavities without effusion, the pleura was without hypertrophy, the recorded skeleton was without traumatic change.
Owing to progressing swelling and increasing difficulties a surgical resection was indicated in the female patient. She was operated on under general anaesthesia, and a resection of the encapsulated collections of fluid was implemented bilaterally ((d)), two Redon drains were introduced. In the left collection serous fluid was present, on the right side also serous fluid with admixture of old blood was present. A histological examination of cystic collections proved that it concerned pseudocystic lesions with relation to subscapular bursa without marks of malignancy. Their walls were created by collagenous, hyalinised and vascularised connective tissue with predominately perivascular nonspecific chronic inflammatory cellulation ((a)), the internal surface of which was lined by a layer of fibrin and by a nonspecific granulation tissue with a focally accentuated xanthogranulomatous, siderophagous and giant-cell reaction without epithelium ((b)). In the lumen of the cysts there were remnants of blood clots with fibrinous or fibrinoid substances with dispersive admixture of siderophages, lymphocytes, neutrophils and giant polynuclear cells ((c)). The proof of amyloid by Congo red was negative. On the lesion periphery soft-tissue structures were caught, including striated muscularis. The drains were removed the 10th postoperative day due to higher production, the surgical wounds were healed-up per primam intentionem. After the operation the female patient had a full range of movements and was without trouble and pains.
|
pmc-6330411-1
|
A 58-year-old Japanese woman (patient 1; height, 157 cm; weight, 74.5 kg; body mass index, 30.2 kg/m2) and a 73-year-old Japanese woman (patient 2; height, 153 cm; weight, 48 kg; body mass index, 20.5 kg/m2) were still doing classical ballet and hula dance, respectively, after primary THA for osteoarthritis (OA) due to developmental dysplasia of the hip. They received medication and rehabilitation prior to surgery for 2 and 10 years, respectively. Patient 1 could not do classical ballet before surgery, and returned to doing classical ballet recreationally with satisfaction after surgery. Patient 1’s preoperative Oxford Hip Score (OHS) [, ] and University of California-Los Angeles (UCLA) activity scale score [, ] were 4 and 1, respectively. Patient 2 did hula dance with difficulty due to right coxalgia, and enjoyed hula dancing after surgery. Patient 2’s preoperative OHS and UCLA score were 4 and 2, respectively. The occupation of both patients was homemaker. The OHS, the UCLA score, and the Harris Hip Score (HHS) [] in patient 1 were 48, 8, and 100, respectively, at 4 years of follow-up after surgery. The OHS, the UCLA score, and the HHS in patient 2 were 48, 5, and 80, respectively, at 6 years of follow-up after surgery. The OHS and UCLA score are validated, reliable, and self-reported metric assessments for patients with hip OA [–]. The OHS assesses the pain and function of the hip during daily activities, while the UCLA score measures physical activity levels. Both patients provided written consent for this institutional review board-approved study and were willing to participate and enroll in the study.
A cementless hemispherical press fit cup, straight metaphyseal fit stem, alumina ceramic femoral heads (patient 1, 32 mm; patient 2, 26 mm), and highly cross-linked ultra-high molecular weight polyethylene liner with a 15° elevated rim (AMS® and PerFix HA, Aeonian; Kyocera Medical, Osaka, Japan) were used [, , ]. All operations were performed using combined anteversion technique via a posterolateral approach [, ].
The three-dimensional positions and orientations of the pelvis, acetabular cup, femur, and femoral stem during dance were determined using image-matching techniques []. The patients performed dance under continuous radiographic surveillance using a flat panel X-ray detector (Ultimax-I, Toshiba, Tochigi, Japan): image area, 420 mm × 420 mm; resolution, 0.274 mm × 0.274 mm/pixel; and frame rate, 3.5 frames/second (Figs. , , , and ). Each patient routinely underwent computed tomography (CT; Aquilion, Toshiba, Tochigi, Japan) with a 512 × 512 image matrix, 0.35 × 0.35 pixel dimensions, and 1-mm slice thickness from the superior edge of the pelvis to just below the knee joint line. Anatomical coordinate systems of the pelvis and femur were embedded in each bone model derived from CT data according to our previous study []. Computer simulation was performed to generate virtual digitally reconstructed radiographs (DRRs), in which the light source and projected plane parameters were set to be identical to the actual radiographic imaging conditions. Each model silhouette was matched with the actual silhouette by translating and rotating the three-dimensional model to minimize the number of unmatched pixels between the silhouettes. The orientation of the femur relative to the pelvis: hip movements, was determined using the Cardan/Euler angle system in x-y-z order (flexion/extension, adduction/abduction, internal/external rotation). Contact between the acetabular liner and the stem neck (liner-to-neck contact) was also evaluated using a computer-aided design (CAD) software program (CATIA V5; Dassault Systèmes). The maximum errors associated with tracking the position of the femur/stem relative to the pelvis/acetabular cup were 0.36/0.43 mm, 0.37/0.48 mm, and 0.48°/0.52°, respectively, for in-plane translation, out-of-plane translation, and rotation, respectively [].
The orientations of the acetabular cup and stem were measured using postoperative CT data. Cup inclination was measured as the angle of abduction using the inter-tear-drop line as the baseline (radiographic inclination). Cup anteversion was measured as the angle of anteversion in the sagittal plane (operative anteversion). Femoral anteversion was measured as the angle of anteversion between the prosthetic femoral neck and transe-epicondylar axis (TEA). The cup inclination, cup anteversion, and stem anteversion in patients 1 and 2 were: 40.1°, 41.0°; 14.4°, 25.9°; and 34.8°, 21.8°, respectively.
For the ballet movements of développé (Fig. ) and plié (Fig. ), there were gradual three-dimensional hip movements (Figs. and ). Développé produced 75.3° of maximum femoral flexion with 27.8° of posterior pelvic tilt (Fig. ). Hip flexion peaked on the way of movement with 47.5° of maximum flexion. The maximum hip abduction was 36.1° with 49.3° of hip external rotation. Plié produced 41.6° of maximum femoral flexion with 10.7° of posterior pelvic tilt in the sagittal plane (Fig. ). Hip flexion peaked on the way of movement with 33.5° of maximum flexion. The maximum hip abduction was 29.4° with 43.3° of hip external rotation. No liner-to-neck contact was found in either développé or plié.
In the hula dance movement called kao (Fig. ), hip flexion/extension ranged from 4.6° of flexion to 30.6° of flexion with 15.1° of maximum hip abduction and 11.1° of maximum hip external rotation (Fig. ). We observed 13.3° of total amount of ipsilateral pelvic obliquity with 16.0° and 15.6° of total amount of posterior pelvic tilt and contralateral pelvic rotation, respectively. In the kaholo (Fig. ), hip flexion/extension ranged from 7.9° of flexion to 16.7° of flexion with 11° of maximum hip abduction and 10.7° of maximum hip external rotation (Fig. ). We observed 9.3° of total amount of ipsilateral pelvic obliquity with 15.1° and 0.8° of total amount of posterior pelvic tilt and contralateral pelvic rotation, respectively. No liner-to-neck contact was found in either kao or kaholo.
|
pmc-6330443-1
|
A 4-year old Saudi boy presented to the Hand Clinic for surgical correction of his angulated thumbs. He was an only child of non-consanguineous parents. He was born vaginally at term after an uneventful pregnancy. The birth weight and length were at the 30th centile. Family history was unremarkable. The patient had all the hallmark features of RSTS Type 1 including: intellectual disability, typical facial dysmorphism (highly-arched eyebrows, down-slanted palpebral fissures, a broad nasal bridge, a columella hanging below the alae nasi, low-set posteriorly-rotated ears, a thin upper lip, pouting of the lower lip, a highly-arched palate, and mild micrognathia), broad / flat/ angulated thumbs, broad big toes, and overlapping post-axial toes (Figs. , , and ). The child also had the following distinct features: a midline notch of the upper lip, a bifid tip of the tongue, a midline groove of the lower lip, plump fingers with broad / flat fingertips, and brachydactyly (Figs. , , ). The child had a history of cardiac surgery (correction of an atrial septal defect and repair of hemi-anomalous pulmonary venous drainage) as well as orchiopexy (for an undescended left testis). Full systemic examination and radiological investigations did not reveal any other defects. Both parents had no abnormalities.
After informed consent was obtained, genomic DNA was extracted from the peripheral blood of the child and both parents. For testing, a combination of Next Generation Sequencing (NGS) and Sanger Sequencing was used to cover the full coding regions of the tested genes plus 20 bases of the non-coding DNA flanking each exon. The most important two syndromes with features overlapping with those of RSTS are the Cornelia de Lang (OMIM12247) and Floating-Harbor (OMIM 136140) syndromes [, ]. Hence, all the genes known to cause RSTS, Cornelia de Lang syndrome, and the Floating-Harbor syndrome (see Table ) were sequenced. The sequences were then aligned and compared with reference sequences. All differences from the reference sequences (sequence variants) were assigned to one of the five interpretation categories as per ACMG guidelines [].
The child was found to be heterozygous in the CREBBP gene for a sequence variant designated c.4963del, which is predicted to result in premature protein termination p.Leu1655Cysfs*89. This variant has been reported to be causative of RSTS Type 1 []. The variant was not detected in the parents (Fig. a), which indicates that it is a de novo event. According to the criteria of the ACMG, this variant is classified as pathogenic.
The child and his father were also found to be heterozygous in the EP300 gene for a sequence variant designated c.586A > G, which is predicted to result in the amino-acid substitution p.Ile196Val (Fig. b). This variant appears to be rare in large population databases of genetic variations (). The amino-acid residue p.Ile196 of the EP300 protein has been highly conserved during evolution. The variant is predicted by SIFT, Polyphen-2, and Mutation Taster to be benign. According to Clinvar, the variant has been designated of uncertain significance by one submitter and likely benign by another submitter (). According to the criteria of the ACMG, this variant is classified as likely benign.
|
pmc-6330477-1
|
The proband was a 35-year-old male from Hebei province in the north of China. He is of Han ethnicity and was born to consanguineous parents. His family pedigree is shown in Fig. . The proband was normally delivered after a full-term pregnancy, and birth weight and length were within normal ranges. The initial signs and symptoms appeared when he was 6 years old. Deformity of interphalangeal joints initially appeared in the fingers. Hips, knees, and wrists were then gradually involved. Diagnosis of JRA was considered by local hospitals, and glucocorticoids were prescribed without any efficacy. As he grew up, his symptoms deteriorated. He had to walk with crutches at 16 years of age because of arthritis of the lower extremities. At 26 years of age, he first experienced progressive pain with numbness radiating down his entire left leg and right thigh. At 34, he started to have mild difficulty in urination. Thereafter, his leg pain progressed and he became immobile. Treatment with tramadol, physical therapy, and spine injection were tried but were not effective. He had a younger brother with a similar clinical presentation but who also had mild neurological impairment (Fig. ).
The proband’s height and weight were 162 cm and 72.5 kg when he was admitted to our hospital. His visual analogue scale (VAS) score was 9. He did not have behavioral difficulties and was not retarded in his intellectual development. Physical examination showed multiple malformations of the major limb joints, especially of the knees and hands (Fig. ). Amyotrophy of both lower limbs was obvious. Cervical and lumbar movements were limited with compensatory kyphosis. The muscular strength of all four limbs was normal. Dysesthesia was found in the posterolateral left calf, dorsolateral left foot, and perineal area. Bilateral knee-jerk reflexes and ankle reflexes were hypo-induced. The erythrocyte sedimentation rate (13 mm/h) and C-reactive protein level (2 mg/L) were both within the normal range. Tests for rheumatoid factors were negative.
Spinal x-rays showed flat and osteoporotic vertebral bodies. Pedicles were short, and end plates were irregular. Bone bridges were seen at many levels. Kyphosis was detected in both the cervical and upper thoracic spine. Magnetic resonance imaging showed multilevel Schmorl nodes. Multilevel disc herniation and hypertrophic ligamentum flavum caused lumbar canal stenosis from L2 to S1 (Fig. ).
|
pmc-6330490-1
|
A 28-year-old woman, gravida 3 para 1, had a medical termination of a miscarriage at seven weeks, with no dilation and curettage, in 2008. In 2015, a baby was delivered by caesarean section in the breech position, weighing 3900 g. She had no significant past medical history, and her antenatal care had been uneventful. On August 9, 2018, at 19:15, she was admitted to our hospital due to a pregnancy of 9+ months and irregular contractions for 4+ hours. Periodic uterine contractions occurred every 6–8 min. The patient was not accompanied by abdominal pain or vaginal bleeding and had intermittent term after contractions. Clinical examination showed that her body temperature was 36.7 °C, blood pressure was 102/65 mmHg, pulse rate was 100 bpm, and oxygen saturation was 100%. Blood tests showed mild leucocytosis (16.61 × 109/L), normal platelet count, normal coagulation test, and haemoglobin of 102 g/L. Vaginal examination showed the cervix was tightly closed; no vaginal bleeding or fluid was found. The ultrasonography indicated that the foetal head was located above the uterine cavity, the foetal size was consistent with the gestational age, the placental position was normal, and the scar thickness of the previous caesarean section was approximately 0.2 cm. Uterine contractions declined after admission. During admission, the patient was clinically and biochemically stable, and daily cardiotocograms showed a reassuring foetal heart rate pattern. Because of the patient’s progressive anaemia (blood tests revealed a slow decline in haemoglobin to 93 g/L, 87 g/L) and sudden increasing abdominal pain, ultrasound was used but did not show ruptured abdominal fluid. An urgent laparotomy was performed and revealed a massive haemoperitoneum caused by the rupture of the uterine posterior wall. A haemoperitoneum with approximately 1 liter of blood was recovered. The lower uterine segment was intact and not ruptured. A boy with a body weight of 2900 g was delivered. Apgar scores were 9 at 1 min and 10 at 5 min. The amniotic fluid was clear, the placental was completely delivered, and no placental abruption occurred. The patient’s uterus was closed in two layers. After removing the blood and clots, a 12 cm-long tear in the posterior wall and active bleeding from the uterine rupture were found. Uterine tissue adhered to the bowel (see Fig. ). After separation of the adhesions between the bowel and the uterine wall, two layer of uninterrupted stitches restored the uterine integrity, and interrupted stitches closed the mesentery defect (see Fig. ). It was suspected that future conceptions would be dangerous, so bilateral tubal ligation was performed at the same time, under the permission of the patient and the patient’s family member. Our patient’s uterine and pelvis showed no abnormalities and, particularly, no evidence of endometriosis. Inspection of her liver showed no rupture. The placenta was sent for pathological examination. Syntocinon (oxytocin) (Ma an Mountain Company, China, SFDA approval number: H34020474) was administered intravenously. The operation was uncomplicated, and the estimated total blood loss was 2500 ml. Ten units of blood and 400 ml of blood plasma were transfused. The patient’s postoperative course was regular, and she was discharged 6 days later.
|
pmc-6330555-1
|
An 8-year-old female patient, weighed 17 kg had been diagnosed with congenital heart disease during her infancy, with unknown follow-up and treatment. She was admitted to the hospital due to fatigue, shortness of breath while playing with friends one month ago. Physical examination on admission revealed a systolic murmur in the left para-sternum, trans-thoracic echocardiography showed a peri-membranous VSD extended into inlet septum with a diameter of 12 mm, left to right shunting, pressure gradient via the defect was 20 mmHg, a PDA of 4 mm in diameter. The patient had undergone trans-catheter PDA closure first, and 3 weeks later, TES was performed for VSD repair without robotic assistance.
Patient was placed in supine position; two arms were along the body, under general anesthesia with single-lumen endotracheal tube. We used a no.6 Knitted Dacron graft (Vascutek Terumo, Bangkok, Thailand) which was connected to the right common FA of the patient with an end-to-side anastomosis. The other side of the graft was connected to the arterial line of cardiopulmonary bypass (CPB) machine. Superior vena cava (SVC) and inferior vena cava (IVC) cannulae were inserted via internal jugular vein (IJV) and femoral vein, respectively, using Seldinger technique. When CPB was started, the arterial pressure gradually increased to 260 mmHg, we switched to bilateral FA cannulation with an additional 10Fr FA cannula (Medtronic, Inc., Minneapolis, Minn, USA) (the predicted size was 16Fr) was directly inserted to the left common FA. After having additional femoral cannula, the arterial pressure declined and stabilized at 180–200 mmHg.
Four soft trocars (Covidien, Hampshire, Mansfield, USA) were placed in the right chest of the patient, included: one 12 mm trocar in the 5th intercostal space (ICS) at the anterior axillary line as the main working port, one 5 mm trocar in the 4th ICS at the mid-axillary line as the second working port, one 5 mm trocar in the 5th ICS at mid-axillary line as the camera port and one 5 mm trocar in the 6th ICS at the mid-axillary line for left atrium sucker. After snaring SVC, we pushed a 16 G Surflo® I.V. Catheters (Terumo Corporation, Laguna, Philippines) into the ascending aorta through the anterior right chest wall and used it as an aortic root needle. Myocardial protection was achieved by antegrade Custodiol® HTK solution (Koehler Chemi, Alsbach-Haenlien, Germany) through aortic root after clamping aorta by Chitwood clamp (Scanlan International, Inc, St Paul, MN, USA).
Right atrium (RA) was opened in parallel to atrioventricular groove, atrial septal was intact, and we punctured atrial septum at the location of ovale foramen to place the drainage of left atrium. The defect was exposed by taking some stitches to hang RA wall to the pericardium. The lesion extended into the inlet septum, some chordae tendineae of septal and anterior leaflets of tricuspid valve crossed the defect. We split the commissure of anterior and septal leaflets to clearly expose the defect. The VSD was closed using artificial patch, continuous combined with interrupted suture (). The RA was closed using two layer of continuous suture after the split in the leaflets and the ovale foramen had been closed. After declamping the aorta, the heart re-beat in sinus rhythm, de-airing via aortic root needle. Extracorporeal circulation was then stopped and the operation was finished with no difficulties. CPB time and aorta cross-clamp (ACC) time were 185 and 150 min, respectively. Echocardiography prior to discharge showed completely closed VSD, no tricuspid regurgitation. The patient was discharged at the postoperative day 8 without any symptoms; no neurological or vascular complications were noted at the follow-up visit 3 months after surgery. Her family was very satisfied with the results ().
|
pmc-6330567-1
|
A 59-year-old postmenopausal woman (gravida 2, para 2) was referred to the gynecologist because of abnormal vaginal bleeding. She had a past medical history of hyperthyroidism and was on thyroid hormone replacement therapy at presentation. She denied any familial history of ovarian and/or breast cancer. Blood tests revealed that serum CA125 was slightly high (96.2 U/mL). Pelvic ultrasonography was notable for a polycystic mass, measuring 117 × 71 mm, adjacent to the normal-appearing uterus. Abdominopelvic computed tomography showed a polycystic and solid mass, measuring 135 × 92 × 100 mm, which was connected to the right ovarian vein. In addition, contrast enhanced-magnetic resonance imaging revealed enhancement in the septal area and heterogeneity of intracystic signal intensity, suggesting ovarian mucinous carcinoma (Fig. a). Her disease was diagnosed as early ovarian cancer, FIGO Stage IA (cT1aN0M0); then, she received total hysterectomy with bilateral salpingo-oophorectomy, omentectomy, intra-pelvic and para-aortic lymphadenectomy.
The right ovarian tumor contained a serous fluid; the inside was multicystic and partially solid (Fig. b and c). Histologically, the cancer cells showed high-grade nuclear atypia and various histological patterns, including solid (Fig. a), pseudo-endometrioid (Fig. b), and transitional cell-like patterns (Fig. c). Such SET-type patterns were observed in approximately 90% of the tumor, while conventional HGSC histology was limited. In addition, Alcian blue and PAS staining demonstrated that some of the cancer cells contained intracytoplasmic mucin (Fig. d–h). The mucinous differentiated foci, which overlapped with other morphological patterns, were approximately 30% of the tumor, suggesting that the degree of deviation from the mucinous phenotype formed the heterogeneous multicystic image in this tumor (Fig. a). The cancer cells had spread into the left ovary and para-aortic lymph nodes, thus confirming the pathological FIGO stage IIIA (pT1bN1aM0). No benign and/or borderline mucin-producing epithelium, STIC, and endometriosis-related lesion were observed in the extensive histological analysis of the ovarian tumor (total 49 slides) and the fallopian tubes.
In our immunohistochemical analyses, the cancer cells showed diffuse positive staining for p53 (clone: DO-7; Fig. i); block positive for p16 (Fig. j); partial positive for WT1 (Fig. k), ER, PgR (Fig. l), CDX2 and PAX8; and negative for p40, p63, GATA3, Napsin A and vimentin (data not shown). The Ki-67 labeling index of the cancer cells was 60–80% (Fig. m).
Since an aberrant p53 expression pattern was displayed by immunohistochemistry, we performed TP53 mutation analysis of ovarian cancer by direct sequencing according to the methods described previously []. The results showed that the cancer cells contain a c.730G>A mutation, which alters glycine to serine in codon 244 of exon 7 in TP53 (Fig. ). Finally, we diagnosed the ovarian tumor as a HGSC with SET feature and mucinous differentiation.
|
pmc-6330668-1
|
A 25-year-old woman presented with diminished vision and redness in both eyes. She had a history of resected nodular melanoma in her right shoulder and was under vemurafenib therapy (960 mg/day) initiated at another center, though her family history was unremarkable.
She had 20/200 visual acuity in her right eye which did not improve with correction. Corrected visual acuity was 20/20 in her left eye. Both eyes had normal intraocular pressure readings. Slit-lamp biomicroscopy revealed bilateral 2-3+ cells in the anterior chamber, posterior synechia, and pigment precipitates on the lens, all of which were more severe in the right eye. The fundus was not clear in the right eye due to cells in the vitreous. There were vitreous cells in the left eye; however, the optic nerve, macula, and the peripheral retina seemed normal. On fluorescein angiography, the right eye could not be visualized due to vitreal inflammation; the left eye was normal except peripheral vascular leakage in the late phases of the angiogram. The right eye could not be visualized on optical coherence tomography either; however, in the left eye the retina was normal, with clumps of cells in the posterior vitreous (). The patient was hospitalized for investigation with the diagnosis of bilateral panuveitis.
The results of diagnostic tests investigating possible etiologies were unremarkable. Systemic workup also failed to lead to a specific diagnosis.
When the patient was questioned in more detail regarding her history, she reported she had had similar symptoms in the past which resolved with cessation of vemurafenib therapy. The patient was evaluated in the oncology department of our hospital and they suggested discontinuing vemurafenib. Oral prednisone 1 mg/kg, topical prednisolone acetate (hourly) and cycloplegic drops (three times daily) were started for both eyes.
Her inflammatory findings subsided and the systemic and topical steroids were tapered. She has been under follow-up for 8 months and has exhibited no signs of recurrence of the uveitis or melanoma.
|
pmc-6330671-1
|
A 63-year-old female patient presented with reduced vision in her right eye. She reported experiencing sudden-onset pain, loss of vision, and redness in her right eye 7 years earlier, but did not seek medical treatment at that time. She had no history of ocular trauma or surgery. Best corrected visual acuity (BCVA) in her right eye was light perception and intraocular pressure was 18 mmHg. Anterior segment examination revealed hypermature cataract. The iris stroma showed diffuse atrophy and appeared hypochromic. Ultrasonography demonstrated retinal attachment. Cataract surgery was recommended, but the patient refused.
At 1-year follow-up examination, the patient stated that her vision had improved. BCVA was 20/25 in the right eye (with +12 D correction) and 20/20 in the left eye. Although her right eye appeared aphakic on anterior segment examination, no surgical scar or signs of trauma were detected. The cornea was clear and the conjunctiva appeared normal. Despite the hyperchromic appearance and stroma atrophy of the iris, there were no findings suggestive of inflammation (keratic precipitates in the corneal endothelium, posterior synechia, or anterior chamber inflammatory cells). The left eye appeared normal (). Intraocular pressure was 18 mmHg in the right eye and 16 mmHg in the left eye. The areas that could be visualized in fundus examination were normal. A peripheral retinal scan was done to see the crystalline lens. An ideal evaluation could not be performed because the patient had sunken eyes and incomplete pupil dilation. However, no crystalline lens material was observed in the visualized areas. The absence of crystalline lens material in peripheral retinal examination raised the suspicion of crystalline lens subluxation behind the iris. Ultrasound biomicroscopy (UBM) was performed, but UBM images did not show any lens material behind the iris (). B-scan ultrasound revealed a hyperechoic appearance in the inferior peripheral retina suggesting luxation (). Based on these findings, the patient was scheduled for 23-gauge pars plana vitrectomy. Despite intraoperative investigation using 360° scleral depression, there were no signs of the crystalline lens (). During the procedure, atrophic holes formed in the peripheral retina. Prophylactic 360° laser was applied to the peripheral retina at the end of the procedure. An intraocular lens was implanted in the posterior chamber by scleral fixation (). Postoperatively, the possible etiologies of SLA were investigated. Toxoplasma and leptospirosis tests were negative, while cytomegalovirus, rubella, and herpes simplex virus IgG antibodies were positive. Sedimentation rate, complete blood count, urinalysis, and biochemical tests were within normal limits. The patient was followed for 1 year with no complications.
|
pmc-6330672-1
|
A 20-year-old male patient presented to our clinic with a complaint of visual impairment in his left eye since his childhood. The patient had no ocular or systemic disease, history of trauma, ophthalmic surgery, or chronic medication. In detailed ophthalmic examination, best corrected visual acuity (BCVA) in the right eye was 10/10 with Snellen chart and anterior and posterior segment evaluation was normal. BCVA in the left eye was limited to hand motions. His eyes were orthophoric in primary position, and there was no restriction of eye movements. Pupillary light reactions were normal. Intraocular pressure measured by applanation tonometry was 13 mmHg in the right eye and 12 mmHg in the left eye.
Slit-lamp examination of the left eye revealed pigment precipitation and focal lens opacities extending from the temporal quadrant through the posterior lens capsule and blocking the central optical axis ().
On UBM examination, there was a hyperechoic reflection belonging to the rudimentary ciliary body structures between 2-5 o’clock in the temporal quadrant. The zonules could not be visualized in the same location (). In all other quadrants of the anterior chamber angle, the ciliary body and zonules were normal. Media opacities prevented a full fundoscopic examination.
|
pmc-6330755-1
|
A 69-year-old Japanese man (height, 158 cm; weight, 72 kg; body mass index, 28.8 kg/m2) was referred to our hospital because a right parotid gland tumor had rapidly enlarged and developed spontaneous pain 1 month previously. He had noticed the swelling on the buccal region 1 year previously. He had a medical history of hypertension and type 2 diabetes mellitus; he had also undergone surgical resection for gastric lipoma (15 years ago) and urothelial carcinoma (7 years ago). He was receiving oral medication for hypertension and type 2 diabetes mellitus. Medical follow-up revealed no recurrence of urothelial carcinoma. He was living with his wife and had been smoking cigarettes for 30 years, but quit 9 years ago. He had consumed one beer per week for over 40 years. His family and environmental history were unremarkable, and his employment history was not available. At admission, his blood pressure was 164/86 mmHg, but his other vital signs were normal: temperature, 36.4 °C; pulse, 80/minute; respiratory rate, 12/minute with O2 saturation of 100% at room air. The physical and neurological examinations were unremarkable except for tenderness in the region of his right parotid gland. The results of complete blood count, serological test, and dipstick urine test were within normal limits.
A computed tomographic examination showed a mass of 5-cm diameter located in the superficial lobe of his right parotid gland (Fig. a–b), and the mass had solid and cystic components based on contrast imaging (Fig. c). Serum levels of squamous cell carcinoma antigen and soluble interleukin-2 receptor were within reference limits. WT was clinically suspected based on the location in the tail of the right parotid gland, cystic morphology, gender, and age; however, a malignant salivary gland tumor could not be excluded. Superficial parotidectomy was performed for diagnosis and treatment. On gross examination, the formalin-fixed mass was solid, and the cut surface of the tumor had a grayish appearance (Fig. a). No fluid content was observed. A whole-mount preparation of the mass was performed. On histological examination, the mass showed typical focal features of WT, that is tubulocystic growth of bilayered, columnar, and oncocytic epithelium associated with abundant lymphoid stroma (Fig. b). In the other portion of the tumor, approximately 60% of it, there were eosinophilic materials suggesting coagulation necrosis of the tumor; the materials were surrounded by a non-oncocytic epithelium comprising non-keratinizing squamous cells and mucinous cells (Fig. c–h). The non-oncocytic epithelium was associated with a fibrous stroma or granulation tissue, but not with abundant lymphoid stroma (Fig. e). Granulomatous inflammation involving foreign body-type giant cells was also seen. The non-oncocytic epithelium showed neither distinct cellular atypia nor apparent invasive growth, but the fibrosis adjacent to the non-oncocytic epithelium showed a desmoplastic reaction. Thus, low-grade MEC could not be excluded. On immunohistochemical examination, the squamoid cells in the MEC-like lesions were positive for cytokeratin 5 (CK5) and p63, and mucinous cells were negative for these markers (Fig. h). The necrotic materials were diffusely positive for epithelial markers (AE1/AE3 and cytokeratin 7) and negative for CK5 and p63. The Ki-67 positive ratios in the WT and MEC-like components were similar; both components’ ratios were less than 5%. No diffuse immunoreactivity of p53 was observed. Results of FISH showed MAML2 gene rearrangements were not present in the typical portions of WT and the MEC-like lesion (Fig. i). Therefore, we diagnosed this tumor as a metaplastic or infarcted WT. Our patient was discharged without sequelae and was disease-free 8 months after the surgery.
|
pmc-6330774-1
|
A 40-year-old white man, severely addicted to nicotine and caffeine, without alcohol misuse history, was admitted to our psychiatry department in December 2017 due to positive psychotic symptoms and was prescribed haloperidol (30 mg/d), promazine (300 mg/d), and diazepam (30 mg/d). He and his family members denied the history of medical conditions, and no medical data on his earlier treatment were found in our hospital’s archives. Three weeks later, because of treatment resistance, haloperidol and promazine were discontinued, and clozapine was augmented to a final dose of 350 mg a day. On the sixth day of clozapine therapy, the patient developed tachycardia and was given propranolol (40 mg/d) for cardioprotection. As psychosis did not improve by the end of the week 8, ECT was indicated.
Informed consent and ethical approval for ECT application were obtained from the University Hospital Centre Zagreb. The patient also signed informed consent for medical data publication. Somatic and psychiatric pre-evaluation revealed no contraindications for ECT. The blood pressure was 110/70 mm Hg, heart rate 92/min, axillary temperature 36.0°C, and electrocardiogram (ECG) showed a sinus rhythm with intermediate axis without any abnormalities. ECT was first applied at week 10. Diazepam was discontinued. Atropine, propofol, and succinylcholine were administered as standard premedication. The electrical dose was titrated to the patient’s seizure threshold at 0.5-millisecond pulse width, 20-Hz frequency, 5.6-second stimulus duration, and 900-mA current using Thymatron® System IV (Somatics LLC, Chatham, IL, USA), and bifrontotemporal stimulation was applied. Two hours after ECT, the patient complained of gastric pain. He was pale and tachypnoic, without a palpable radial pulse. Initial laboratory tests showed the troponin T level of 1956 ng/L (reference range <14 ng/L) and N-terminal pro-b-type natriuretic peptide (NT-pro BNP) of 12 409ng/L (reference range <300 ng/L). ECG showed marked ST-elevation, with Q waves and deep symmetrical T wave inversion in anterior leads, along with QTc interval prolongation (525 ms), indicating possible acute anterior wall myocardial infarction. However, the patient denied chest pain and complained of shortness of breath. The echocardiographic exam revealed severely reduced left ventricle ejection fraction (15%), with only lateral wall contracting and a consequent apical thrombus. The patient was immediately transferred to the Coronary Care Unit, where he was treated with continuous intravenous infusion of dobutamine (4 µg/min/kg) and furosemide (250 mg/d). Beside these, loading doses of aspirin (300 mg) and clopidogrel (600 mg), and low molecular weight heparin in full dose, were administered as standard therapy for suspicious acute myocardial infarction before planned coronarography. Clozapine was discontinued, and haloperidol (30 mg/d) and diazepam (30 mg/d) were induced intramuscularly. The patient refused the recommended coronary angiography and was distrustful to all other proposed diagnostic procedures. After 24 hours, he was hemodynamically stable, and inotropic support was gradually stopped. Heart failure therapy, consisting of eplerenone (25 mg/d) and ivabradine (2 × 5 mg/d), was initiated. Serial echocardiographic examinations over the next 4 days revealed that the left ventricular systolic function completely normalized, and troponin T and NT-proBNP level considerably decreased (228 ng/L and 1190 ng/L, respectively). ECG showing sinus rhythm, rate 82/min with a vertical axis, did not indicate myocardial ischemia. Based on troponin T and NT-proBNP levels, echocardiographic findings, ECG, and clinical restitution, the patient was diagnosed with takotsubo cardiomyopathy. He was then transferred back to the psychiatric department. At that time, clopidogrel was discontinued as the diagnosis of myocardial infarction seemed unlikely. During the next two weeks, echocardiographic exams were unremarkable, and troponin T and NT-proBNP levels were within the reference range (6 ng/L and 69 ng/L, respectively). By the end of week 12, the patient was referred to a chronic psychiatric institution.
|
pmc-6331344-1
|
A 66-year-old Japanese male was admitted to the authors’ hospital for fever and abdominal pain. He had a past history of multiple renal cysts, chronic renal failure on chronic hemodialysis for 2 years, and multiple liver cysts due to autosomal dominant polycystic kidney disease (ADPKD). He showed the relapse of infection of liver cysts and received longtime antibiotics therapies.
On admission, his vital signs were as follows: body temperature, 39.4 °C; heart rate, 101 beats per minutes (bpm); and respiratory rate, 20 bpm. Laboratory examination revealed a white blood cell (WBC) count of 7480 cells/mm3 with a high neutrophil count of 90.7%, and a C reactive protein of 18.08 mg/dl. He was diagnosed as systemic inflammatory response syndrome (SIRS). Diffusion-weighted magnetic resonance imaging (DW-MRI) showed an abnormal high intensity at the multiple liver cysts, indicating that polycystic infection was strongly suspected. Although antibiotic therapy with intravenous meropenem at a dose of 0.5 g/day was started, fever and inflammatory reactions were unable to improve. Therefore, percutaneous echo-guided drainage was introduced for the most accumulated liver cyst. Because of the improvements of clinical symptoms and laboratory findings, the drainage tube was removed at 19 days after drainage. However, the low-grade fever and inflammatory reactions recurred, and the discontinuation of antibiotic therapy was difficult. Because the most of the liver showed multilocular cystic changes, the control of infection was considered to be difficult by conservative treatments such as a local drainage or a partial liver resection, and the severe infection was expected to be repeated in the future.
As a fundamental treatment, a surgical approach was considered to be necessary, and a liver transplantation surgery was considered to be an indication for the disease. Therefore, he was planned to undergo living-donor liver transplantation with a right lobe graft from his wife. The graft was selected with considering a graft-to-recipient weight ratio of 0.88%, which is larger than the minimal recommended ratio of 0.8%.
Before the liver transplantation, he was 168.0 cm tall and weighed 68 kg. Physical examination revealed hepatomegaly extending below the level of the umbilicus. Laboratory data showed anemia (Hb 10.4 g/dL), and the elevation of C-reactive protein (2.61 mg/dL). Liver and renal profiles were as follows: total bilirubin, 0.8 mg/dL; albumin, 3.3 g/dL; aspartate aminotransferase (AST), 17 U/L; alanine aminotransferase (ALT), 10 U/L; international normalized ratio (INR), 1.3; creatinine, 5.09 mg/dL. His Child-Pugh score was 7 (grade B), and Model for End-Stage Liver Disease (MELD) score was 22. Arterial blood gas analysis showed that blood pH was 7.44, PaCO2 32.9 mmHg, PaO2, 82.1 mmHg in room air, and alveolar-arterial oxygen tension gradient (A-aDO2) was increased to 26.8 mmHg. Chest X-ray revealed an elevation of right diaphragm. Computed tomography (CT) showed hepatomegaly with multiple liver cysts, multiple renal cysts, mild ascites, and no abnormal findings in the lung (Fig. ). Respiratory function test showed the forced vital capacity (FVC) was mildly reduced down to 72% of predicted value, and the adjusted diffusing capacity of the lungs for carbon monoxide (DLco) by Cotes’ method was moderately reduced down to 57.8% of predicted value. Venous ultrasonography revealed lower extremity venous thrombosis, and the day before the operation, an inferior vena cava filter was inserted by a right internal-jugular-vein approach without any complications. At 114 days after admission, a living related liver transplantation was performed. After endotracheal intubation, two central venous catheters were inserted from left and right internal jugular veins before surgery without any complications.
General anesthesia was induced with propofol and remifentanil, and maintained with sevoflurane and remifentanil. The artificial ventilation was uneventful, and the airway pressure was kept below 30 cmH2O during the intraoperative period.
The abdominal cavity was reached through the upper abdominal reverse-T incision. The liver was found to swell markedly and to push the right diaphragm upward. Although the liver was firmly adhered to the right diaphragm, the adhesion was sharply dissected by electrocautery under appropriate traction. After the extraction of the liver, the right diaphragm was found to swell markedly and occupy the abdominal cavity. Although there was no significant change in the vital signs, the right pneumothorax was suspected, a thoracic drain was immediately inserted through the right tenth intercostal space, and continuous drainage was initiated. However, the right diaphragm distended by a massive air leak and prevented the operators from anastomosing the liver vessels and the bile duct. Therefore, a small relaxing incision was made in the right diaphragm for depressurizing the right thoracic cavity and making an adequate operative field to anastomose. Thoracoscopic observation was performed through the diaphragm incision. There was no adhesion in the right thoracic cavity, and the visceral pleura of the bottom of the right lung was widely expanded like a giant cyst due to dissection from the lung parenchyma, and a marked air leak was recognized from a pin hole in the dissected pleura. Since controlling the air leakage in the patient was considered difficult only by drainage, a leakage closure operation was decided to be performed after the completion of the liver transplantation. Following the transplantation procedure, the thoracoscopic leakage closure operation was performed for the patient in the supine position.
During operation, a thoracoscope was inserted through the right tenth intercostal space, and endoscopic surgical instruments were inserted through the small diaphragm incision (Fig. ). The expanded visceral pleura was incised by electrocautery to drain air and pooled blood in the cyst, and bleeding sites in the lung parenchyma were identified and controlled by electric coagulation. Because the lung parenchyma and the visceral pleura of the bottom of the lung was widely dissected and the base of the cyst was large, cystectomy was found to be difficult to be performed by a stapler or sutures. For controlling the air leakage, absorbable fibrin sealant patches (TachoSil®, Baxtor Healthcare, Deerfield, Illinois, USA) were patched on the lung parenchyma under dissected visceral pleura, and fibrin glue (Beriplast P®, CSL Behring, Tokyo, Japan) was injected into the dissected space. After no air pooling was confirmed under the visceral pleura with positive pressure ventilation, polyglycolic acid (PGA) sheets (Neoveil®, Gunze, Kyoto) were applied, and fibrin glue was sprayed on the visceral pleura surface (Fig. ). Finally, a 21Fr silicone thoracic tube was inserted through the right 10th intercostal space and placed on the apex of right thoracic cavity, and the diaphragm and abdominal incision was closed. Although a postoperative minor air leakage was observed, chest X-ray showed the complete expansion of the right lung. The patient was treated with water seal drainage. After the air leakage disappeared, the drainage tube was removed at 27 days after surgery. The course after liver transplantation was also smooth, and he was discharged at 67 days after surgery. The cyst on the bottom of the right lung was confirmed to disappear on chest CT after discharge (Fig. ).
|
pmc-6331345-1
|
A 74-year-old man was admitted for right lower lobectomy with lower mediastinal and hilar lymph node dissection for squamous cell carcinoma. He had pulmonary emphysema secondary to smoking more than 50 pack-years. He had no diabetes mellitus, no history of steroid intake, and had not received chemotherapy or radiotherapy.
On postoperative day (POD) 10, the patient had pyrexia (38.4 °C), and C-reactive protein (CRP) was increased to 16.22 mg/dL. On POD 12, he developed subcutaneous emphysema. A BPF was suspected because of increasing air leakage through the chest tube and the broken appearance of the bronchial stump on chest computed tomography (Fig. ).
On POD 13, reoperation was performed under general anesthesia. First, thoracoscopy in the lateral decubitus position confirmed the presence of the BPF, which was about 6–7 mm in diameter; the adhesions could be removed easily. Next, with the patient in the supine position, laparotomy was performed through a 7-cm skin incision; the right side of the omentum with a preserved right gastroepiploic artery was detached from the stomach for the omental flap. Lastly, with the patient back in the lateral position, the omental flap was led through the anterior mediastinum below the sternum and sutured above and below the bronchial fistula using two nonabsorbable mattress sutures. It was then fixed using three sutures to the parietal pleura without using fibrin sealant. A water test was not done, because the middle lobe held to the omental flap naturally and was expected to adhere soon. The fistula was covered with omentum and was not sutured directly for closure. Because the thoracic cavity had been narrowed due to inflammatory adhesions, and the working space was limited, the suturing technique was not straightforward. Finally, the BPF was covered with an omental flap. All procedures were done by VATS (Fig. ). The thoracic space was washed using 2 L of saline, and the wound was closed with placement of an indwelling chest tube. The total surgical time was 4 h and 41 min, and blood loss was 100 mL.
After the reoperation, no air leakage was observed, and the chest drainage tube was removed on POD 4. The clinical decision was made based on the small quantity of drainage and the patient’s afebrile status, while still considering re-drainage if needed. Ceftazidime was administered intravenously for 2 weeks to treat the P. aeruginosa infection that was detected by cultures of the pleural effusion. The increased CRP level of 16.22 mg/dL before reoperation decreased to 7.19 mg/dL on POD 7 and to 1.64 mg/dL on POD 14. Although the patient complained of anorexia and pain for several days after the reoperation, his general condition was relatively better, and he was discharged 19 days after the reoperation (Fig. ). At 2 years, he remained free from recurrence of cancer and infection.
|
pmc-6331349-1
|
A 61-year-old man with lower thoracic esophageal cancer was referred to our clinic to undergo treatment. His medical history included diabetes mellitus and cataracts. Upper gastrointestinal endoscopy showed a type 3 tumor in the lower thoracic esophagus, and endoscopic biopsy specimen revealed an adenocarcinoma. CT imaging revealed wall thickening in the lower esophagus and swelling of multiple lymph nodes in the mediastinum and abdomen (Fig. ). His clinical diagnosis based on TNM staging (TNM classification, eighth edition) was cT3 N2 M0 stage IIIB; thus, we selected neoadjuvant chemoradiotherapy (NACRT) as preoperative treatment. Two cycles of 5-fluorouracil (1000 mg/m2 from days 1 to 4, and from 29 to 32) and cisplatin (100 mg/m2 on days 1 and 29) were administrated intravenously. A total dose of 41.4 Gy was administered in 23 fractions of 1.8 Gy, 5 fractions per week, starting on the first day of the first cycle of chemotherapy. The irradiation field included the primary tumor and the regional lymph nodes, including the subclavian, paraesophageal, subcarinal, and celiac axis lymph nodes. Surgery was performed 5 weeks after the end of the irradiation. During the preoperative examination, contrast-enhanced CT imaging revealed that the anomalous V2 drained into the RSPV, which ran behind the intermediate bronchus (Fig. a–d). We reconstructed the CT image using virtual thoracoscopic imaging, and the anomalous V2 was visualized clearly as in the operative view (Fig. ) using the Ziostation2 workstation (Ziosoft, Inc., Tokyo, Japan). General anesthesia was administered with single-lumen endotracheal intubation for bilateral lung ventilation. Thoracoscopic esophagectomy with lymph node dissection via the right thoracic approach was performed in the prone position under 6–10 mmHg of artificial pneumothorax. Thoracic esophagectomy and mediastinal lymph node dissection were performed using five ports. Subcarinal lymph node dissection started from dissection of the pericardial membrane. Then, the right bronchus was rolled by pulling the right vagus nerve toward the right side and dissecting the subcarinal lymph node from the right bronchus. The anomalous V2 was identified during the lymph node dissection and was preserved without injury (Fig. a, b). No visible effects of the radiation, such as fibrosis or edema around the bifurcation, were observed. After the thoracoscopic procedure, we performed hernioplasty for the right inguinal hernia and reconstructed the gastric tube via the posterior mediastinal route in the supine position. The total operation time was 815 min, and the total amount of intraoperative bleeding was 52 g. No severe postoperative complications occurred, except for paralysis of the left recurrent laryngeal nerve. The patient started oral intake on postoperative day (POD) 7 and was discharged on POD 17. The pathological diagnosis on TNM staging was pT3 pN3 cM0 pStage IVA. There were no subcarinal lymph node metastases.
|
pmc-6332536-1
|
A 59-year-old male was admitted to Chongqing Shapingba District Chenjiaqiao hospital, Chongqing, China. He suffered the fractures of left femoral neck after falling to the ground (Fig. a). On July 16, 2017, the left total hip replacement was conducted and prosthetic hip in position was shown under X-ray (Fig. b). Cefazolin sodium (1 g IV q8h) was started for prophylactic administration. His indwelling urinary catheter was removed after 24 h. On the 8th day after surgery, however, the patient presented with left hip pain and clinical signs of infection, including fever (38.5 °C), redness and swelling around the surgical site (Fig. c), and he also reported local tenderness. His blood examination demonstrated the white blood cell (WBC), C-reactive protein (CRP), and erythrocyte sedimentation rate (ESR) significantly increased during postoperative period, as shown in Fig. . Furthermore, the screening tests for human immunodeficiency virus, hepatitis B virus and hepatitis C virus infections were non-reactive, and no abnormality in liver or renal function tests was observed. His T-lymphocyte subsets and gamma-globulin analysis were within normal range.
On July 25, 2017, approximately 400-ml light-yellow, odorless subcutaneous fluid was punctured at surgical site, and forwarded to the microbiological laboratory for bacterial smear and culture. A large amount of polymorphonuclear leucocytes (PMNs) were detected but no microorganism on gram-staining smear. Moreover, there was a negative growth on the blood and chocolate agar plates. The repeated blood cultures using the BacT/ALERT 3D blood culture microbial detection system (bioMérieux SA, Marcy l’Étoile, France) were negative. The post-surgical infection was still under suspicion, and the wound was cleaned with iodophor and drainage gauze was placed. Cefepime (2 g IV q12h) was administrated. However, empiric therapy was still ineffective, the prosthetic hip infection deteriorated, fever persisted, and on July 26, the debridement of left prosthetic hip was performed and the seroma, superficial fascia, deep fascia, deep tissue, as well as subcutaneous fluid collected during the surgery were sent for culture on blood and chocolate agar plates. Unexpectedly, tiny colonies grew after 48 h, and they grew to approximately 0.5 mm colonies in diameter after 7-day incubation (Fig. e), and were identified as M. hominis by the bioMérieux® SA Mycoplasma IST2 kit (bioMérieux, France). The identification was also confirmed with 16S rRNA sequencing.
In vitro antimicrobial susceptibility testing (AST) revealed that the organism was susceptible to doxycycline, clindamycin and levofloxacin, but resistant to azithromycin by the bioMérieux® SA Mycoplasma IST2 kit (Biomerieux, France). Combination therapy with clindamycin hydrochloride (0.6 g IV q12h) and moxifloxacin (400 mg IV QD) was initiated, as shown in Fig. . The patient defervesced within 3 days. His infection site recovered gradually (Fig. d). Repeated X-ray scans before discharge showed marked improvement of his prosthetic hip. The patient was discharged on August 23, without further complications. No recurrence of symptoms and signs was reported during three-month outpatient follow-up.
After 48 h of incubation on blood agar at 37 °C in a 5% CO2 atmosphere, pinpoint-sized, non-hemolytic, and transparent colonies were found on Columbia blood agar plate. The colonies were difficult to emulsify in saline water during the preparation of suspension solution for identification and AST. Both Gram stain and Wright-Giemsa mixed stain of the isolates demonstrated no bacterial morphology under × 1000 magnification, and only granular aggregates were detected. Fried-egg-type colonies of M. hominis growed on solid media (Zhongqisheng Hebei Bio-tech Co., Ltd.) 5 days after subculture (Fig. f).
|
pmc-6332555-1
|
A 13-year-old boy had suffered from severe allergic asthma since preschool age. He had house dust mite (HDM) and olive pollen allergy detected by SPT (Dermatophagoides pteronyssinus [DP] 9 mm, Dermatophagoides farinae [DF] 7 mm and Olive pollen 5 mm) and specific IgE levels (100, 82 and 68 IU/mL, respectively), with high total IgE (1003 IU/mL) levels and normal eosinophil count (110/mmc) (Table ). The pulmonary function tests (PFTs) were constantly abnormal, with a forced expiratory volume in 1 s (FEV1) < 80% of the predicted value before bronchodilation. He had poor disease control, despite daily high-dose ICS plus inhaled LABA and leukotriene receptor antagonist (LTRA), previous sublingual specific immunotherapy (SLIT) with dust mite extract (continuously for 3 years from the age of 5), during which he experienced many exacerbations (Table ).
He also suffered from the age of 8 years from mild persistent allergic rhinitis treated with intranasal corticosteroids and eosinophilic esophagitis (EoE) confirmed by endoscopic and histological findings.
In this context, SPT was performed and revealed a sensitization to milk and soy (milk extract 8 mm; Bos d 4 = 10 mm; Bos d 5 = 7 mm; Bos d 8 = 6 mm; Prick by prick [PBP] with fresh milk 10 mm and soy [5 mm]). The first approach to EoE included a semi-elemental diet and a strict soy/milk avoidance which lead to symptomatic and histological relief. Due to the poor palatability, he suspended the diet after three months.
When he was 11 years old, he experienced worsening asthmatic symptoms, requiring emergency room access and hospitalizations. Therefore, he started therapy with omalizumab (375 mg subcutaneously) every 2 weeks, according to the reference nomogram for body weight and total IgE level []. Overall the patient received omalizumab for 18 months with clinical and spirometric improvement. After three months of therapy, the long-term treatment with high-dose ICS plus inhaled LABA and LTRA was gradually reduced until its suspension, at the 12th month of therapy with omalizumab (Table ). According to Global Initiative for Asthma (GINA)-guided assessment [], he continued to have good asthma control over time with normal spirometric parameters (FEV1 99%, forced expiratory flow at 25–75% of the pulmonary volume [FEF25–75] 70%). Furthermore, he showed a reduction of the average wheal diameter for mites and olive tree (DP 6 mm, DF 5 mm, olive 3 mm) serum IgE (sIgE) (DP 59.3 KU/L, DF 36.3 KU/L, olive tree 1.41 KU/Ll) with lower total IgE (490 IU /mL) (Table ).
The treatment response in EoE was assessed by evaluating the change in clinical symptoms score (Pediatric Eosinophilic Esophagitis Symptom Score [PEESS® v2.0]) and by endoscopy with biopsy findings [, ]. There was a non-significant histological change during omalizumab therapy despite a mild decrease in symptom score. Therefore, he started oral viscous budesonide (BUD) with clinical and histological relief but recurrence of symptoms when steroids were discontinued.
|
pmc-6332555-2
|
A 15-year-old boy presented with severe allergic asthma, moderate persistent allergic rhinitis, and chronic rhinosinusitis. The rhinosinusitis symptoms were quite troublesome (visual analog scale [VAS] = 5) despite long-term therapy with nasal saline irrigation, oral antibiotic ≥12 weeks and intranasal corticosteroids. During the work-up and according to the EPOS guidelines, cystic fibrosis, primary ciliary dyskinesia, immunodeficiencies, anatomical abnormalities and nasal polyposis were excluded [].
Asthma appeared in preschool age but worsened in the recent years; it was not controlled by daily high-dose ICS, inhaled LABA and LTRA. He had HDM and pellitory allergy detected by SPT (DP 5 mm, DF 6 mm and pellitory 5 mm) with sIgE levels (100, 100 and 12 IU/mL, respectively) and high total IgE (372 IU/mL). Spirometry showed a persistent reversible airflow obstruction pattern (FEV1 70%, FEF25–75 < 50%). A SLIT with HDM was attempted when he was 7 years old but discontinued because of asthma exacerbations (Table ).
Therefore, he started omalizumab (450 mg subcutaneously) every 4 weeks, according to the reference nomogram [4]. After nine months of therapy, he achieved better asthma control with FEV1 > 80% and started the ICS + LABA treatment step-down until its suspension. He underwent omalizumab therapy for a total of 24 months, at the end of which he showed asthma remission and normal spirometric values (FEV1 98%, FEF25–75 73%). At the end of the treatment, total IgE were 760 IU/mL and sIgE DP 100 KU/L, DF 100 KU/L, pellitory 3.85 KU/L (Tables and ). Under omalizumab he also experienced an improvement in symptoms (VAS = 2) and clinical signs of chronic rhinosinusitis, suggesting the role of IgE in the pathogenesis of the mucosal inflammation as suggested by other studies [].
|
pmc-6332555-3
|
A 10-year-old boy with severe cow’s milk allergy (CMA) and moderate-severe allergic asthma was followed at our allergy outpatient clinic.
Asthmatic symptoms, which started at the age of 4 years, were controlled at first by ICS at medium dosage and LTRA, and then from high-dose ICS (fluticasone up to 500 mcg/day) + LABA, with an FEV1 of 76%. He had HDM, pellitory and cat allergy confirmed by SPT (DP 5 mm, DF 4 mm, pellitory 5 mm, cat dander 4 mm) with sIgE levels (DP 23.4, DF 17.1, pellitory 20.7, cat dander 9.51 KU/L) and high total IgE (668 IU/mL) (Table ).
The diagnosis of CMA was made at the age of 2 months and confirmed at further stages through SPT (milk 16 mm, Bos d 4 = 13 mm, Bos d 5 = 11 mm, Bos d 8 = 12 mm), sIgE (milk > 100 KU/L, Bos d 8 > 100 KU/L, Bos d 4 = 15.8 KU/L, Bos d 5 = 9.26 KU/L) and oral food challenge (OFC) (Table ).
Spontaneous remission of CMA did not occur over time, and the child experienced four anaphylactic adverse reactions from accidental ingestion of foods containing hidden milk proteins and bronchospasm after inhalation of powder containing cow’s milk proteins. At the age of 10, after achieving better asthma control, he started oral immunotherapy (OIT) to milk after a protocol already tested at our Centre [] failed because of anaphylaxis after 0.5 mL of milk.
Therefore, on the basis of recent evidence, he received omalizumab in combination with oral milk desensitization []. The protocol consisted of three steps:Nine weeks of pre-treatment with omalizumab (300 mg subcutaneously every two weeks according to the reference nomogram). A second phase (from 9th to 16th week) characterized by the association of omalizumab and OIT. Oral cow’s milk desensitization was performed in 2 phases: a rush phase on the first day (starting with 5 drops of milk, with increasing doses every 30 min to a maximum of 30 mL corresponding to 1000 mg of cow’s milk proteins) and a slow phase with weekly increases in the dose of milk which, if tolerated, was taken at home. A “consolidation” phase (from 17th to 24th week) in which omalizumab was discontinued and the patient carried out only OIT with a weekly visit to the Day-Hospital.
He presented an excellent response, achieving 140 mL of milk during the third phase.
Unfortunately, two weeks after a viral, milk consumption in the same amounts previously tolerated triggered life-threatening anaphylaxis requiring hospitalization. This adverse reaction was probably worsened by infection, as reported in the literature []. The patient’s parents decided to discontinue OIT and resume a cow’s milk protein-free diet. Evaluations performed after 6 months showed total IgE = 309 IU/mL with milk sIgE > 100 KU/L, Bos d 8 > 100 KU/L, Bos d 4 = 20.3 KU/L, Bos d 5 = 8.4 KU/L (Table ).
Regarding allergic asthma, omalizumab therapy allowed the step-down of ICS + LABA (starting from the 12th week of anti-IgE treatment) until achieving its suspension. He presented normal lung function parameters with sIgE DP and DF > 100 KU/L (Table ).
|
pmc-6332555-4
|
A 9-year-old girl was admitted to the intensive care unit with acute respiratory failure (ARF), pneumothorax (PNX) and pneumomediastinum after a serious asthma attack. Asthma severity was underestimated and the symptoms undertreated, despite being diagnosed with allergic asthma at the age of 5 (SPT DP 5 mm, DF 3 mm, sIgE DP 62.8, DF 31.3 KU/L and total IgE 280 IU/mL) (Table ). At admission, chest radiography and computed tomography (CT) scan documented bilateral apical PNX, pneumomediastinum, and subcutaneous emphysema extended to the soft tissues of the thorax and neck.
After resolution of the ARF, the main causes of spontaneous secondary PNX and pneumomediastinum (such as congenital malformations, foreign body inhalation and/or toxic substances, cystic fibrosis, trauma, pneumonia, interstitiopathies) were reviewed, confirming the relationship with severe uncontrolled chronic asthma (FEV1 61% of predicted).
The patient started high-dose ICS (fluticasone 500 mcg/die) plus LABA (100 mcg/die) and LTRA (10 mg/die), achieving partial control as shown by ACT and spirometry at 4, 8 and 12 weeks (Table ). Therefore, she started omalizumab (150 mg subcutaneously every 4 weeks), according to the reference nomogram [4] for 24 months. During follow-up, there was a gradual improvement in respiratory performances and inflammation conditions, shown by spirometry (3rd month: FEV1 67%, 6th month: FEV1 73%, 6th month: FEV1 79%, 12th month: FEV1 85%) and reduction in exhaled nitric oxide (eNO) before and after treatment (35 vs 8 ppb). A reduction of total IgE (126 IU/mL) was also observed with sIgE almost unchanged (DP 70, DF 30.9 KU/mL) (Table ). At the same time, it was possible to proceed with the gradual step down of inhalation therapy (from high-dose ICS + LABA + LTRA to low-dose ICS) (Table ).
|
pmc-6332555-5
|
A 7-year-old girl was referred to the allergy outpatient Clinic for severe CMA, dating from the first year of life. Food allergy was confirmed by SPT (milk 7 mm, Bos d 4 = 6 mm, Bos d 5 = 5 mm, Bos d 8 = 7 mm), sIgE (milk 20.9 KU/L, Bos d 8 = 18.1 KU/L, Bos d 4 = 5.73 KU/L, Bos d 5 = 3.49 KU/L) and a positive OFC (resulting in anaphylaxis after 4 mL of fresh milk) (Table ). At the age of 6, she started OIT to milk following a protocol already tested at our Centre [], achieving the dose of 35 mL after 12 months of therapy. However, she presented with anaphylaxis after 40 mL of milk, resulting in interruption of OIT. A year later, following the pioneering work of Nadeau et al. [] she started desensitization to milk in combination with omalizumab therapy (75 mg every 4 weeks according to the reference nomogram [4]) following the protocol already described for patient number 3. The girl was able to tolerate ordinary daily milk amounts, but after 4 weeks of food avoidance due to personal considerations, she presented an adverse reaction characterized by urticaria and angioedema after the introduction of 30 mL of milk. She restarted rush OIT lasting 2 days, after which she reintroduced milk into her diet without any adverse reaction. Two months after stopping OIT and 4 months from the last omalizumab injection, she is introducing milk and dairy products into her diet at least several days per week.
Alongside milk desensitization, there was a decline in total IgE, sIgE (milk 8.93 KU/L, Bos d 8 = 5.18 KU/L, Bos d 4 = 4.09 KU/L, Bos d 5 = 1.6 KU/L, total IgE 35 IU /mL) and SPT mean wheal diameter (milk 4 mm, Bos d 8 = 4 mm, Bos d 4 = 3 mm, Bos d 5 = 2 mm) (Table ).
|
pmc-6332555-6
|
A 14-year-old boy with severe CMA and moderate-severe allergic asthma was followed at our allergy outpatient clinic.
His respiratory symptoms started in preschool, then he developed allergy to HDM, cat and dog (SPT mean wheal diameter DP 4 mm, DF 3 mm, cat 4 mm, dog 5 mm, sIgE DP 1.18 KU/L, DF 1.12 KU/L, cat 1 KU/L, dog 5.36 KU/L, with total IgE 597 IU/mL). Asthma was controlled by high dose ICS plus LABA (Table ).
CMA was diagnosed at the age of 10 months, confirmed by SPT (milk 8 mm, Bos d 4 = 13.5 mm, Bos d 5 = 8 mm, Bos d 8 = 11 mm, PBP 11 mm), sIgE (milk 90 KU/L, Bos d 8 62.3 KU/L, Bos d 4 62.5 KU/L, Bos d 5 = 36.6 KU/L), and OFC performed at pre-established intervals (Table ). He followed a milk and dairy free diet but presented two anaphylaxis episodes from accidental exposure to milk at the age of six and eight years.
OIT was attempted at the age of 13 but was unsuccessful due to adverse reactions and poor compliance. A year later he underwent OIT plus omalizumab (450 mg every 4 weeks according to the reference nomogram) [].
The experimental protocol was modified a little from the one given above, and characterized by:First step: (0–8 weeks) pre-treatment with omalizumab. Second step: (8–48 weeks) combined therapy (omalizumab plus OIT) with a rush desensitization phase lasting 2 days and a slow phase with a monthly dose increase (25% at a time) in the outpatient clinic and continuing daily home intake of the maximum tolerated milk amount. Third step: (48–60 weeks) only OIT and subsequently free diet with monthly follow-up.
Although anti-IgE therapy was prolonged for a total of 48 weeks, milk desensitization failed. From the second month of combined therapy, the patient experienced a mild-to-moderate adverse reaction slowing escalation of the milk dose. At the 52nd week of therapy, he presented with anaphylaxis after 10 mL of milk and the study protocol was interrupted. This lack of success was also probably due to the poor family adherence; in fact, the patient did not regularly take milk at home, and sometimes the outpatient appointments were postponed. A year after stopping the study protocol, an increase both in total IgE (930 IU/mL) and sIgE (milk> 100 KU/L, Bos d 8 > 100 KU/L, Bos d 4 > 100 KU/L, Bos d 5 = 69.3 KU/L) was observed. However, during therapy with omalizumab, he showed clinical improvement of asthma symptoms and respiratory function parameters (FEV1 80%) with the chance to start the step-down of inhalation therapy (from the third month of treatment) (Table ). Currently, the boy has mild allergic asthma well controlled by low-dose ICS and continues a milk- and dairy-free diet.
|
pmc-6332555-7
|
Severe CMA affected an eight-year-old boy from the age of nine months. A last positive OFC was performed at the age of two years, and then he continued a cow’s milk proteins-free diet. He suffered from anaphylaxis at the age of 5 because of accidental exposure to milk. During his first outpatient visit, CMA was confirmed by SPT (milk 7 mm, Bos d 4 = 12 mm, Bos d 5 = 6 mm, Bos d 8 = 11 mm, PBP 15 mm), sIgE (milk 25.1 KU/L, Bos d 8 = 16 KU/L, Bos d 4 = 5.99 KU/L, Bos d 5 = 4.24 KU/L, with total IgE 79.9 IU/mL), and a positive OFC (anaphylaxis after 3 mL of milk) (Table ).
Milk OIT was proposed and started without success because anaphylaxis occurred at 1.5 mL of milk.
Therefore, on the basis of scientific evidence [] in a patient at high risk of serious food adverse reactions and refractory to traditional OIT [], omalizumab-assisted desensitization to milk was proposed and started.
The oral desensitization protocol to milk was similar to the one already described for subject number 3 and included pre-treatment with omalizumab (75 mg subcutaneously every 4 weeks for 9 weeks according to reference nomogram [4]), a second phase of combined therapy (omalizumab plus OIT) lasting 7 weeks and finally a third step during which the subject only underwent milk OIT. The results of the study protocol were exceptional, and the boy was able to include milk and dairy products into the diet at least several days per week without any adverse event.
Moreover, a reduction of total and specific IgE levels was observed (total IgE 71 IU/mL, milk 9 KU/L, Bos d 8 = 4.06 KU/L, Bos d 4 = 2.93 KU/L, Bos d 5 = 1.61 KU/L) (Table ).
|
pmc-6332555-8
|
An 11-year-old boy with allergic moderate-severe asthma, mild-moderate persistent rhinitis, and severe CMA was followed at our allergy outpatient clinic.
He had HDM, pellitory pollen and cat dander allergy confirmed by SPT (DP 4 mm, DF 5 mm, Parietaria judaica 5 mm, cat dander 5 mm) and sIgE (17,1 KU/L, 23.4 KU/L, 20.7 KU/L, and 9.51 KU/L respectively), with high total IgE (972 IU/mL) levels. Asthma was not well controlled by ICS (fluticasone 500 mcg/die) plus LABA, while rhinitis was treated with nasal corticosteroids and oral antihistamines.
CMA was diagnosed at the age of 3 months and persisted over the years. The patient experienced 4 episodes of anaphylaxis, after accidental exposure to traces of cow’s milk proteins, needing hospitalization. When he was 8-years old, he started conventional OIT at another Allergy Clinic, following a different protocol []. During the rush phase, he presented with anaphylaxis after 3 mL of milk diluted in 20 mL of water and OIT was discontinued.
At the age of 10, after reviewing SPT (milk 16 mm, Bos d 8 = 6 mm, Bos d 4 = 16 mm, Bos d 5 = 21 mm) we tried to restart conventional OIT [] with bad results (anaphylaxis after 4 drops of milk).
After a year, we reassessed allergy tests (SPT: Milk = 16 mm, Bos d 4 = 11 mm, Bos d 5 = 12 mm, Bos d 8 = 18 mm, PBP 17 mm; sIgE: milk > 100 KU/L, Bos d 8 > 100 KU/L, Bos d 4 = 15.8 KU/L, Bos d 5 = 9.26 KU/L) and started omalizumab-assisted desensitization to milk.
He received omalizumab (300 mg every 4 weeks according to the reference nomogram [4]) and OIT following the same protocol as patient number 6. He was able to drink 180 mL of milk after stopping omalizumab but experienced anaphylaxis again during a viral pharyngitis, and the protocol was interrupted.
Asthma exacerbations reduced and spirometry improved (pre-FEV1 76% vs. post 89%) during anti-IgE therapy. Therefore he started step-down of inhalation therapy (currently he is on low-dose ICS).
|
pmc-6332561-1
|
This patient is a 29-year-old white woman from the USA with a medical history significant for severe IBS-D (diagnosed at age 12) and anxiety disorder. In July 2015, she presented with severe bleeding hemorrhoids secondary to IBS, which required hemorrhoidectomy and anal sphincterotomy in August 2015. The week before the surgery she developed pharyngitis and was treated with azithromycin, which resulted in mucousy diarrhea and abdominal discomfort. She tested negative for C. difficile antigen and toxins at that time.
A week after surgery, she developed a perirectal abscess that had formed at the site of the sphincterotomy and was prescribed orally administered ciprofloxacin. Despite moderate symptom improvement, in September 2015 she required an abscess incision and drainage procedure and Penrose drain insertion. Prior to the surgery she was given a single dose of clindamycin. An additional 2-week course of ciprofloxacin and metronidazole was then prescribed. In late September 2015 she was admitted to the hospital for two nights due to further complications related to the abscess and was then diagnosed as having a perianal fistula.
In November 2015, she was prescribed clindamycin for an episode of group C streptococcal-positive pharyngitis. In late November 2015, she was also diagnosed as having Ehlers–Danlos syndrome, which according to her medical record may partially explain the poor wound healing from the perirectal abscess. In December 2015, her fistula required an anus seton placement. She was treated with multiple courses of ciprofloxacin and metronidazole off and on from December 2015 to January 2016.
In January 2016, following up on her recurrent pharyngitis, she was diagnosed as having chronic tonsillitis which led to tonsillectomy. In February 2016, 2 weeks after the surgery she was prescribed clindamycin. At the beginning of March 2016, she was diagnosed as having bacterial vaginosis and was prescribed orally administered metronidazole. A week later she was diagnosed as having vaginal candidiasis and was prescribed orally administered fluconazole. In April 2016, she complained of dysuria and was prescribed ciprofloxacin. After 2 days, when urine analysis results came back negative, she was asked by her physician to stop the treatment.
In June 2016, she presented for follow-up with ongoing diarrhea and abdominal pain. She was diagnosed as having C. difficile diarrhea, her antigen and toxins laboratory results were indeterminate, and a toxigenic strain was confirmed by polymerase chain reaction (PCR). She was prescribed a 6-week course of orally administered vancomycin. After a week of treatment her symptoms worsened, and following discussion with her gastroenterologist her treatment was switched to a 2-week course of metronidazole. Hours later, she was admitted to the hospital for a 4-day period for colitis. Her C. difficile antigen and toxin test returned negative during her admission. She received intravenously administered metronidazole treatment during her hospitalization. Her symptoms improved during her hospital stay, with 1–2 soft bowel movements a day. At discharge her metronidazole course was stopped and she was again prescribed vancomycin, which she took for over a month. She continued to experience GI irregularity (3–5 bowel movements a day) beyond what she had experienced secondary to her IBS prior to her surgeries. In March 2017, she was prescribed rifaximin for 2 weeks to treat chronic diarrhea.
In November 2017, she was prescribed a series of clinical intestinal tests (SmartGut™, uBiome Inc., San Francisco, USA) with the instructions to administer the test at home whenever she was experiencing a noticeable change of GI symptoms, then follow-up with her health care provider to discuss the results. This sequencing-based test requires that patients use a sterile swab to transfer a small amount of fecal material from toilet paper into a vial containing a lysis and stabilization buffer that preserves the microbial DNA for transport by mail back to the laboratory for processing, which involves DNA extraction, 16S ribosomal RNA (rRNA) gene amplification, and sequencing []. She first used this test in November 2017, about a month after completing a 2-week course of rifaximin. The results revealed a number of microbial organisms that were outside the healthy reference ranges, but she was negative for all pathogenic organisms included in the test, including C. difficile (Fig. ).
Between November and December 2017, her GI symptoms worsened considerably; her daily bowel movements increased from 3–4 to 6–10, stool consistency became more mucous-like and gelatinous, and she was experiencing more pain with defecation. She re-tested with SmartGut™ test again in January 2018. Her results continued to reveal a number of microbial organisms outside the healthy range and, this time, her sample also indicated the presence of C. difficile (Fig. ). She immediately contacted her primary care provider, who re-tested her for C. difficile and confirmed indeterminate CDI by antigen and toxins A and B. Additional PCR testing at a regional laboratory confirmed the sample was positive for a toxigenic C. difficile strain. As a result of testing, her clinician started her on fidaxomicin; her symptoms improved rapidly. By April 2018, she had returned to her baseline in regard to her IBS-related GI symptoms with no blood in her stools.
In addition, the second SmartGut™ sample was tested for toxins A and B by sequencing at uBiome Inc. laboratory in San Francisco, USA, which resulted positive for both and confirmed the toxigenic nature of the C. difficile strain.
|
pmc-6332564-1
|
An 8-year-old boy presented with left periorbital pain for a week. His parents reported that he had mild headache intermittently when he contracted upper respiratory infections but was otherwise healthy. His uncorrected visual acuity was 20/20 in both eyes with mild hyperopia. Ductions and versions were normal, although there were 10 prism diopters of intermittent exotropia as determined by prism and alternate cover testing. There was no pain on eye movement. However, the patient presented intense tenderness on palpitation over the left trochlear region without swelling or redness around the left periorbital area. Orbital magnetic resonance imaging (MRI) showed focal enhancement on the left trochlea (Fig. ). Left frontal, ethmoidal, and maxillary sinusitis was also detected. The patient, however, had not been previously diagnosed with sinusitis. We referred the patient to an otorhinolaryngologist. On rhinoscopic examination, the patient presented mild rhinorrhea with posterior nasal drip, and the mucosa was swollen in the left middle meatus. He underwent treatment with oral empirical antibiotics (amoxicillin/clavulanate syrup for 9 days and then cefpodoxime syrup for 4 days), leukotriene receptor antagonist, and steroid nasal sprays to control the sinusitis and rhinitis. The symptoms and signs were completely resolved after a course of treatment without the need for local steroid injection in the trochlear area. There was no recurrence during the 8-month follow-up period.
|
pmc-6332565-1
|
A 26-year-old man was admitted to our hospital due to atypical chest pain persisted for many years. He was diagnosed as HCM in another hospital two years ago, and had received medical therapy (angiotensin-converting enzyme inhibitors and Beta blockers) for 18 months. Physical examinations did not show abnormality. A 12-lead electrocardiogram (ECG) showed sinus bradycardia, left anterior fascicular block, T-wave anomaly, and abnormal Q wave on the leads of left ventricular anterolateral wall (Fig. ).
2-dimensional(2D) transthoracic echocardiography(TTE)indicated hypertrophy (21 mm in diastolic phase) in the interventricular septum (Fig. ; Additional file 1: Movie 1). There were no detectable gradients with Doppler echocardiography in the left ventricular outflow tract at rest. However, a small defect with echo enhancement of the broken end was observed within the hypertrophic interventricular septum (Fig. ). Doppler echocardiography showed systolic blood flow in a specific direction from left ventricle into the interventricular myocardium (Fig. , Additional file 2: Movie 2) with a peak flow speed of 1.1 to 1.3 m/s during the systolic phase (Fig. ). In turn, the blood flow in the opposite direction had a similar flow speed (Fig. , Additional file 2: Movie 2). Contrast-enhanced echocardiography further indicated that the small defect was interlinked with the left ventricular cavity, but not with the right ventricular cavity (Fig. ; Additional file 3: Movie 3).
In addition, the anomalous RCA originating from left sinus of Valsalva was observed using 2D TTE (Fig. , Additional file 4: Movie 4). CTA further confirmed that RCA arised from left sinus of Valsalva with an interarterial course between the aorta and pulmonary artery (Fig. ).
Syncope or family history of sudden cardiac death was not identified. But the patient’s mother, a 53-year-old woman, had been diagnosed with ventricular septal hypertrophy (17 mm in diastolic phase) in our department. Considering the expensive cost, the patient and his mother declined the genetic testing. The young patient was advised to have regular ultrasound examination and avoid intensive physical exercise.
|
pmc-6332586-1
|
A 61-year-old female was being actively monitored in the hemodialysis unit for intradialytic hypertension (IDH). She was born in Ethiopia and had been diagnosed with autosomal dominant polycystic kidney disease (ADPKD) at the age of 35 and immigrated to Canada at the age of 53. Her mother died in Ethiopia and with no access to medical facilities. Our patient was certain that her mother died of complications of hypertension, but couldn’t remember any specifics. Her brother had successfully received a kidney transplant for ADPKD. Her medical history was also significant for vertically transmitted hepatitis B, rheumatoid arthritis (high titre rheumatoid factor, 515 IU/ml and high titre anti-cyclic citrullinated peptide, 34 U/ml) and latent tuberculosis infection treated with 6 months of isoniazid and rifampin.
Ten years prior, she was initiated on a single agent for blood pressure (angiotensin receptor blocker) and 3 years after arrival to Canada progressed to ESRD. She was initiated on hemodialysis (HD) with a left arterio-venous (AV) fistula requiring three antihypertensives. Over the next 4 years, her blood pressure continued to worsen and more so intradialytically and required six agents for control. She weighed 55 kgs and was 172 cm tall with a body mass index (BMI) of 18.4. Her interdialytic weight gain was four kgs at a frequency of 3/week. She was not taking anti-inflammatories for pain relief as her rheumatoid arthritis was quiescent and was on 75 units/kg body weight of erythropoietin, which maintained the hemoglobin between 100 and 110 g/L. Her dialysate (mmol/L) consisted of sodium 135, potassium 2, bicarbonate 35 and calcium 1.25. The average interdialytic 24-h ambulatory blood pressure was 158/78 mmHg. We attempted to treat her with increasing the frequency of dialysis to 4/week, decreasing the dialysate sodium to 130 mmol, increasing the duration to 4.5 h, (led to inter dialytic weight gains of 2.5 kgs instead of 4 kgs) but made no impact on her blood pressure. Our attempts to decrease her goal weight further were limited by severe cramps. Aldosterone blockade with spironolactone had no noticeable improvement and she was unable to tolerate the sympatholytic agent clonidine. Due to insufficient control of her blood pressure on six medications the patient was referred to interventional radiology for evaluation of renovascular causes of hypertension. Prior to intervention, she was on hydralazine (100 mg qid), amlodipine (10 mg od), telmisartan (80 mg od), labetalol (200 mg tid), furosemide (80 mg od) and amiloride (5 mg od).
Under local anesthesia, percutaneous femoral access was used to introduce the catheter, and selective tight renal artery catheterization was performed. Selective angiogram of both renal arteries revealed right sided atherosclerotic renal artery stenosis (RAS), treated with insertion of a balloon mounted 6 mm stent and left sided fibromuscular dysplasia (FMD), treated with 5 mm balloon angioplasty (Figs. , , , and ). The average (of three sessions) intradialytic blood pressure prior to the procedure was 161/81 mmHg. The patient’s average intradialytic blood pressure (six sessions) post intervention was reduced to 135/85 mmHg. There were no further episodes of intradialytic elevation in blood pressure. The reduction in blood pressure has been sustained over 18 months and has improved to the point that labetalol, furosemide and amiloride, have been eliminated from the patient’s antihypertensive regimen. There has been no change in the patient’s goal weight (54–55 kgs) over the last year.
|
pmc-6332618-1
|
A 35-year-old white woman was found on routine evaluation to have a solitary, circumscribed, nodular, and heavily pigmented retinal lesion in her left eye (OS). Visual acuity was 20/20 in the right eye (OD) and 20/25 in OS. The anterior segment and intraocular pressure were normal in both eyes, as was fundus examination of the OD. Fundus examination OS (Fig. a) showed a juxtafoveolar pigmented, circumscribed lesion measuring 0.6 mm in horizontal basal diameter and 0.5 mm in vertical basal diameter. There was a minimally dilated feeding retinal arteriole across the lesion splitting the mass into a bi-lobulated “butterfly” appearance (Fig. b). There was no macular edema, exudation, hemorrhage, traction or subretinal fluid. The superior-peripheral portion of the lesion was less pigmented, and characterized by yellowish border. These findings were consistent with CSHRPE.
Near-infrared reflectance imaging (Fig. c) demonstrated intrinsic hyperreflectivity, whereas short-wavelength autofluorescence (Fig. b) and red-free filter photography (Fig. d) revealed blocked signal by the lesion. Fluorescein angiography (FA) revealed mild ring-shaped fluorescence (Fig. g, red arrow) of the lesion in the arteriovenous phase that persisted without leakage into the late phase. Also, the FA showed early fluorescence (Fig. c) and late stained fluorescence (Fig. e) in the superior border lesion corresponding to the yellowish lesion. There was an outer retinal defect (Fig. g) on vertical section of EDI-SBOCT and of SBOCT (Figs. h, f on asterisk). Indocyanine green not revealed intralesional cyanescence, but only weak cyanescence on superior boundary (Fig. d–f). The mass appeared as a highly reflective lesion with deep shadowing by SBOCT (Fig. g, h). Interestingly rounded reflective vessels on SBOCT imaging (Fig. h, red arrow) was correlated to the Fig. g (red arrow). The feeder vessel was cross-sectioned by SBOCT scans on Fig. g1, g2 (red dashed line) in the inner retina layer.
The images were captured with the standard macula protocol with a resolution of 2 mm × 2 mm from the Avanti (Optovue) system []. Hereby, the upper border of the superficial vascular layer was defined as 3 μm below the internal limiting membrane (ILM) and the lower border as 15 μm below the inner plexiform layer (IPL). Subsequently, the OCT-A depicted superficial (Fig. a) and deep (Fig. b) capillary layer which were zoomed (Fig. e, f) and manually correlated to fluorescein angiography (Fig. g). Remarkably capillary path was easily detected on OCT-A in comparison to arteriovenous transit on FA. Besides, the feeder vessel (Fig. e, f, red arrowhead) was evident a venule-drainage capillary (Fig. e, f, blue arrowhead) mainly at superficial capillary level (Fig. a, e). A barely visible venule drainage capillary was solely detectable on early vascular FA-transit (Fig. c). In addition, the foveal avascular zone (FAZ) was more easily estimated on OCT-A, and was found to be increased FAZ inferiorly to the pigmented lesion (Fig. e, f, white arrows). The outer nuclear layer (Fig. c) and choriocapillaris (Fig. d) layer segmentation showed an artefact dark image from the pigmented lesion, blocking the under visualization. Vertical and horizontal SBOCT sections (Fig. e, f) and en face imaging (Fig. a–d) were correlated. The ILM en face image showed bright signal on the pigmented lesion (Fig. a) that correlated to the hyperreflective SBOCT within retinal inner layer (Fig. e, white arrow). In the IPL level (Fig. b) the en face image showed deeper bright signal temporally. Additionally, in the interior of the SBOCT shadowing region there was less reflectivity in the outer retina with external limiting membrane (ELM) layer and ellipsoid band absence and that could be related to the deep capillary shunt (Fig. e, yellow arrow). The RPE (Fig. c) and choriocapillaris (Fig. d) en face image demonstrating dark artefact, blocking the optical transmission.
Microperimetry showed an abnormal macular integrity index of 72.9 OS and normal macular integrity index of 9.5 OD, (0–40 indicates normal; 41–60, suspicious; and 61–100, abnormal) []. The mean threshold was 27.3 and 28.2 dB, respectively (> 25 to 36 dB indicates normal; 24–25 dB, suspicious; and < 24 dB, abnormal) []. A sensitivity map of OS (Fig. a, c) suggested reduced retinal function near the hamartoma area, conversely to the regular retinal function from sensitivity map of OD (Fig. b). Corresponding hyposensitivity areas (yellow and red asterisks) on yellowish color fundus (Fig. d1), hyperfluorescent on FA (Fig. d2), cell density absence (Fig. e) and SBOCT (Fig. f, black asterisk) were related.
The en face AO imaging inward to the macular 2-center degree (2°) demonstrated an irregular reflective cell mosaic that became discontinuous with enlarged hyperreflective and hyporeflective polygonal shapes at the site of the lesion (Fig. D, red dashed square). High cone cell density was detected despite the tumor presence (Fig. D, orange dashed square). The unaffected matched superior nasal retina in both eyes within 2° on juxtafoveolar area revealed cone photoreceptors as continuous bright hyperreflective dots (Fig. C, green dashed square and D, blue dashed square). Representative 300 × 300 µm sampling windows from uninvolved (Fig. C, green dashed square and D, blue dashed area) and hamartoma (Fig. D, orange dashed square) areas were matched to spatial distribution inside 2° centered area and analyzed for standardized RTX 1 measurements which included intercellular spacing (normal range 15–20 µm), local cell density (normal range 20,000–30,000 cones/mm2), and number of neighboring cells (standardized value: approximately 6) using the AO software images to create color scale graphic representation []. Measurements obtained in unaffected superior-nasal area of OD, OS and hamartoma area (OS, inferiorly) revealed mean cone densities of 7355 (Fig. E1), 7175 (Fig. F1), and 16,375 (Fig. G1) cones/mm2, respectively. Intercellular spacing was 11.98 (Fig. E2), 12.46 (Fig. F2) and 8.52 (Fig. G2) µm in the uninvolved superior-nasal area of OD, OS and hamartoma area respectively. Proportions of 6-sided Voronoi polygons were 33.8% (Fig. E3), 33.5% (Fig. F3) and 38.6% (Fig. G3) in the uninvolved superior-nasal area of OD, OS and hamartoma area respectively.
|
pmc-6332628-1
|
A 78-year-old man with a history of hypertension, atrial fibrillation and previous left lung tuberculosis presented with shortness of breath (NYHA II) and chest pain (CCS II-III). An echocardiogram showed calcified bicuspid aortic valve with mild regurgitation and a dilated ascending aorta with preserved biventricular function. Cardiac CT scan confirmed maximal ascending aorta dilatation of 5.2 cm (Fig. ). The coronary angiogram showed no coronary artery disease. The Logistic EuroSCORE was 14.74%. Therefore, he underwent aortic valve and aortic root replacement with left atrial appendage excision using a 25 mm Hancock II bioprosthesis and a 28 mm Hemashield graft. The patient was weaned from cardiopulmonary bypass ventricularly paced with Noradrenaline. The bypass time was 116 min with a cross clam time of 100 min using a retrograde cardioplegia technique. Protamine was used to reverse the heparin effect. The intraoperative transoesophageal echocardiogram was satisfactory and the patient was transferred to the Intensive Care Unit (ICU) in stable condition. The day after surgery he was brought back to theatre for bleeding. Despite several bronchoscopies with removal of large amounts of clots, the patient remained hypoxic (Table ). ARDS following aspiration pneumonia with pulmonary hemorrhage was diagnosed based on the Berlin definition. Therefore, he was supported with VV-ECMO, according to NICE and Extracorporeal Life Support Organization (ELSO) Guidelines [], on day 4 after surgery together with continuous veno-venous hemofiltration (CVVH) for refractory metabolic acidosis. Single VV-ECMO cannulation with bi-caval dual-lumen cannula (Avalon ELITE™, Avalon Laboratories, USA) was performed percutaneously through the right internal jugular vein and a 4-l flow was established (Fig. a). In the following days, he became hemodynamically more stable and the gas exchange and CXR improved consistently (Fig. b). VV-ECMO and CVVH were weaned off in 6 days. A CT head, thorax, abdomen and pelvis done as per ECMO protocol ruled out intracranial pathologies, features of colitis and gut ischaemia and chest pathologies. The total patient stay in ICU was 22 days. He made a good recovery and he was discharged to a secondary facility for further rehabilitation. At two-year follow up, the patient made excellent progress, being one if the oldest person to survive VV-ECMO following cardiac surgery in the world. His ECG shows sinus rhythm and the chest X-ray is unremarkable (Fig. c).
|
pmc-6332631-1
|
Case 1: The patient was a 69-year-old man who was diagnosed with IPF 5 years prior to the current episode. He complained of respiratory distress during exertion and dry cough without any treatment. Physical examination revealed bilateral fine crackles in the lung. The patient was admitted to our hospital because of a sudden worsening of his respiratory distress and was diagnosed with AE-IPF based on a poor blood oxygen concentration and the observation of new ground-glass opacity findings over a broad range of bilateral lung fields during computed tomography (CT) scanning (Fig. ). A high level of pertussis toxin (PT) antibodies (147 EU/mL) was noted in samples taken on day 1 of admission. After successful life-saving treatment, the PT level decreased to 52 EU/mL, as measured 30 days after admission. The patient began long-term oxygen therapy (LTOT) and was then discharged to his home.
|
pmc-6332631-2
|
Case 2: The patient was a 57-year-old man who was diagnosed with IPF 5 years earlier and who was currently undergoing oral nintedanib therapy with LTOT. The patient presented at our hospital with the chief complaints of respiratory distress and worsening of cough. Physical examination showed bilateral fine crackles in the lung. Moreover, he exhibited a comparatively poor blood oxygen concentration; new ground-glass opacity was observed over a broad range of bilateral lung fields during CT scanning. He was diagnosed with AE-IPF (Fig. ). The patient also exhibited a high PT antibody titer (104 EU/mL), according to a measurement taken on day 13 of admission. The patient was able to be discharged to his home with an increased dose of LTOT, following successful clinical treatment.
Neither patient had received any pertussis vaccination since adolescence. As both exhibited a typical usual interstitial pneumonia pattern on high-resolution CT, they were both clinically diagnosed with IPF. No blood test exams or physical findings showed any sign of autoimmune disease. Both patients reported a chronic cough associated with the IPF, but they had been aware of uncontrolled cough deterioration and continuous cough beginning approximately 3 weeks before hospitalization. Neither patient had Bordetella pertussis detected from sputum; moreover, PCR analysis was not performed, so the patients did not directly show presence of pathogen. Although the typical symptoms of pertussis (e.g., inspiratory whoop) were not observed in either patient, no infectious diseases other than pertussis were detected through sputum culture tests or serum markers. No other causative bacteria were detected in urine antigen tests or sputum culture tests. Moreover, heart failure was not observed in either patient. Both patients were treated with macrolides and broad-spectrum β-lactam antibiotics, accompanied by high-dose corticosteroid therapy. Case 1 involved an initial acute exacerbation and Case 2 involved a recurrent acute exacerbation.
|
pmc-6332634-1
|
A 37-year-old white man with a past medical history of mitral valve prolapse and gastritis presented with abdominal pain. A computed tomography (CT) scan revealed an 18 cm × 17 cm × 11 cm colonic flexure mass. The patient underwent a resection of the intraabdominal mass with partial small bowel resection, resection of distal transverse and descending colon with enteroenterostomy, as well as colocolostomy, appendectomy and gastrostomy (Fig. ). Pathology was thought to be consistent with leiomyosarcoma, grade 3/3.
The gastric wall tumor showed a high-grade spindle cell neoplasm with focal epithelioid features (Fig. B). Numerous atypical mitotic figures were noted. The background showed moderate amounts of chronic inflammatory infiltrate. The tumor was originally thought to represent a gastrointestinal leiomyosarcoma. Subsequent studies performed 20 years later (Fig. ) included immunohistochemical stains showing patchy reactivity for vimentin, cytokeratin AE1/AE3 and cytokeratin 7, while other markers tested, including gastrointestinal stromal tumor and smooth muscle markers were negative. Notably, calretinin was also negative. This histology and immunoprofile were thought to represent an undifferentiated pleomorphic sarcoma (UPS).
Two months after resection of the intra-abdominal mass, the tumor recurred (Fig. ). He underwent resection of multiple masses in the falciform ligament, left pelvic side wall, small bowel, mesentery, and retroperitoneum. Multiple lymph nodes were also resected. Pathological examination was again thought to be consistent with leiomyosarcoma.
After recovery from surgery the patient received three courses of adjuvant chemotherapy with cisplatin, ifosfamide, dacarbazine, and doxorubicin. This involved 50 mg/m2 of cisplatin on day 1; doxorubicin 65 mg/m2 on day 1; dacarbazine 300 mg/m2 on days 1, 2 and 3; and ifosfamide 2.5 grams/m2 a day by continuous infusion for 3 days. This treatment was well tolerated, aside from neutropenic fevers requiring hospitalization.
Three months later, however, a CT scan revealed a 4-cm metastatic lesion in the left lobe of the liver. The patient underwent a partial left hepatectomy and cholecystectomy.
Three months later, a CT revealed multiple 2–3 cm lesions along the margin of the previous partial left hepatectomy. At the time, the patient noted night sweats and low-grade fevers of 99–100 °F, but good appetite and no significant weight loss. The tumor doubled in size during the next 5 weeks and imaging revealed multiple lesions throughout the remaining left lobe. He subsequently underwent a complete left hepatectomy and excision of perigastric lymph nodes. Pathological examination was thought to confirm metastatic grade 3 leiomyosarcoma of the liver. No extrahepatic involvement or lesions in the right lobe were noted by intraoperative ultrasound.
Five weeks later, the patient noted right upper abdominal fullness and pain, left shoulder pain, and presented to our clinic. Pathology review of the earlier resections at our institution and at another large sarcoma center in the US agreed with the diagnosis of leiomyosarcoma. A CT scan showed multiple metastases in the right lobe of the liver and splenic metastases. Immediately before starting PLD, CT imaging revealed multiple metastases in the remaining left lobe of the liver, the largest being 4 × 4 cm, and one spleen nodule. The left ventricular ejection fraction (EF) was 58% by multi-gated acquisition (MUGA). The patient began treatment with PLD at 55 mg/m2 monthly. After 2 cycles of PLD a CT scan showed regression of tumor nodules. Because of mucositis and hand-foot syndrome the dose was reduced 10% for cycles 2–4 and 50% for cycle 5; thereafter, the dose was increased to 30.8 mg/m2 monthly starting with cycle 6 and the treatment interval lengthened to every 6 weeks starting with cycle 7. The left ventricular EF was 61% by MUGA before cycle 12. After 14 cycles the EF was 62% by MUGA and a CT scan showed a persistent lesion in the spleen. At this point, after 14 cycles of PLD, CT imaging revealed no visible disease in the liver and the spleen nodule that was unchanged in size but had a lower density. Thus, while a complete response by RECIST criteria was evident in the liver, the stable size of the spleen nodule indicated a partial response to PLD by RECIST. A splenectomy was performed revealing some viable tumor cells in a necrotic nodule. The patient received 3 more cycles of PLD for a total PLD dose of 595 mg/m2 and a total dose of free doxorubicin of 196 mg/m2. CT imaging revealed no tumor and MUGA showed an EF of 70%. The patient was followed with interval imaging with no recurrence.
Twenty-two years later, the patient experienced several months of scrotal pain radiating to his urethra and localized to his right testicle. An ultrasound showed a 2.8 cm × 1.6 cm × 0.8 cm mass on the outer surface of the bladder. Fine needle aspiration of the mass showed poorly differentiated carcinoma that was CK7+/CD20+ and histologically compatible with urothelial origin. A PET-CT revealed an intense hypermetabolic pelvic mass contiguous with the right side of the bladder. An exploratory laparotomy, intraabdominal mass resection, and partial cystectomy were performed.
Pathologic examination of the bladder wall tumor showed a 5.5 cm high-grade malignancy with epithelioid and sarcomatoid features (Fig. A). Margins were negative on the perivesical soft tissue mass, and 16 of 16 lymph nodes were negative for malignancy. Mitotic activity was high, and the background showed moderate chronic inflammation. It appeared predominantly located in the outer half of the bladder wall, involving the muscularis propria and perivesical fat. No mucosal involvement or in situ urothelial carcinoma was identified. The tumor was diffusely and strongly positive for calretinin, vimentin and cytokeratin. It was negative for all other markers tested, including gastrointestinal stromal tumor and smooth muscle markers. Given the presence in the bladder and co-expression of keratin and vimentin, it was possible that this represented a urothelial or a urachal remnant-based carcinoma with sarcomatoid differentiation. However, the location of the tumor (posterior dome, per imaging), lack of associated mucosal lesion, positive calretinin stain, and lack of reactivity for urothelial markers such as GATA3, p63, and CK5/6 were unusual for the above diagnosis. The diffuse calretinin reactivity, in conjunction with co-expression of keratin and vimentin, raised the possibility of mesothelial differentiation/origin. While the morphology was not incompatible with a poorly differentiated biphasic mesothelioma, the overall clinical presentation, lack of serosal continuity and non-reactivity for ancillary mesothelial markers (WT1, D2-40 and CK 5/6) precluded a definitive diagnosis of the same.
The morphology and immunohistochemical staining patterns of the remote gastric lesion were compared to that of the bladder neoplasm. Both were poorly differentiated neoplasms, but the high magnification cytology and calretinin reactivity were dissimilar; there was no clear evidence that the tumor on the bladder wall represented a recurrence of the remote malignancy. His hospital course was complicated by Citrobacter urinary tract infections and intraabdominal abscesses requiring three intraabdominal drains and intravenous antibiotics. EF by ultrasound was normal at 55–60%. He subsequently underwent neoadjuvant gemcitabine and cisplatin followed by total cystectomy; the cystectomy specimen showed no evidence of residual tumor. He continues to do well 4 months after surgery, with no evidence of tumor recurrence.
|
pmc-6332642-1
|
A 14-year-old boy (height = 140 cm, weight = 18 kg) from Fars province, southern Iran, who was born to first-cousin parents without family history of any genetic disorders, was referred to our center with failure to thrive, fatigue, muscular dystrophy, generalized muscular atrophy, kyphoscoliosis, and flexion contracture of the knees and elbows (Fig. ). His motor symptoms started at the age of four years with frequent episodes of falling down that had progressed in subsequent years. There were no other family members with similar signs or symptoms. He walked at the age of 11 months and had no motor milestone delay. He had two previous admissions to the pediatric intensive care unit due to pneumonia and respiratory distress. The patient had nasal speech and sleep apnea and was under treatment with BiPAP breathing machine. By the age of 12, he was noted to have scoliosis requiring bracing.
On physical examination, the patient was cachectic with generalized muscular atrophy. Decreased muscle power in the shoulder-girdle muscles, foot extensors and limb muscles (4/5 MRC muscle scale) was noted. He also had pes cavus and contracture of both knees and elbows. He was also found to have severe spine rigidity with a chin-sternum distance of 15 cm.
Transthoracic echocardiography was only notable for mild pulmonary hypertension and mild tricuspid regurgitation. Pulmonary function testing revealed a FEV1 of 35% and FVC of 32% of the predicted values.
Serum calcium and phosphorus levels were 8.2 and 3.1 mg/dL, respectively. The patient had abnormally high levels of creatine phosphokinase (CPK) (340 U/L) and lactate dehydrogenase (LDH) (1200 U/L).
Nerve conduction study was normal. However, needle electromyography (EMG) examination revealed myopathic changes in deltoid, biceps, tibialis anterior, and rectus femoris muscles, in favor of Emery-Dreifuss muscular dystrophy.
To identify the mutated gene involved, whole-exome sequencing (WES) was used on genomic DNA extracted from EDTA blood of the patient. Next generation sequencing (NGS) was carried out on an Illumina NextSeq 500 platform to investigate all coding regions and their boundaries. WES details of coverage and number of reads are provided in Table . NGS data were analyzed using different bioinformatics tools and databases []. NGS data identified a novel, homozygous missense mutation in SEPN1 gene (chr1:25812784, NM_020451.2: exon:10, c. 1379 C > T, p.Ser460Phe). This mutation has not been reported before in different public variant databases and also our database (BayanGene), so it is classified as a variation of unknown significance (VUS). To confirm the novel mutation identified in our patient, Sanger sequencing was performed using primers covering the mutated exon as follows:
F-SELE: 5’-GCACACACTACAGACTCAGC-3′ and.
R-SELE: 5’-GGAAGACACTTGGTCAAGGTTAC-3′ (443 bp).
Sanger sequencing confirmed the identified mutation in SEPN1 in proband as homozygous (T/T). His mother, father and brother were confirmed to be heterozygous (C/T), and his sister homozygous for the wildtype allele (C/C) (Fig. ).
In order to predict the conservation of the mutated residue, we used different bioinformatics tools, including the Basic Local Alignment Search Tool (BLAST BLASTP ver 2.2.31+) on ExPASy (available from: ) and WebLogo ().
Bioinformatics analysis predicted that this mutation is damaging and can affect the proper function of the protein (Table ). In addition, multiple protein sequence alignment revealed conservation of the most residues of SEPN1 across different species (Fig. a and b). Serine residue is conserved among studied species (Fig. a). The frequency of serine in this position is more than that for glycine and proline—only these two amino acids replace serine in other species. Since phenylalanine residue is not among these frequent amino acids, the replacement of serine with phenylalanine is predicted to be deleterious.
|
pmc-6332729-1
|
Our patient is a 41-year-old white male with no known past medical history of renal cell carcinoma presented with skin lesions on his scalp, chest and back for about one month. He was treated for cyst with Bactrim by his primary care physician without having any response. Upon examination, the lesions at scalp and back were found as round, raised, and firm mass measuring 2.0 × 2.0 × 1.5 cm. The chest lesion was flat (2.0 × 1.5 cm) with a palpable nodule underneath it (Figure A,B). All three lesions were violaceous and non-tender. He also reported an intermittent sharp right-sided abdominal pain for last one month. He denied any hematuria and weight loss. Lab works revealed normal CBC with increased creatinine (1.4 mg/dL). CT abdomen, chest and bone scan demonstrated a large heterogeneous exophytic mass of the upper right kidney measuring 11.0 × 11.0 × 10.0 cm (Figure C,D). He had mild ascites with multiple nodules in the posterior peritoneal wall, in lung and liver. Lymphadenopathy and lytic bone lesions were also noted. The cytopathology team was consulted for the rapid interpretation of FNA from the skin lesion of the chest wall. The patient was consented for the procedure and for the publication.
Diff Quick preparation of FNA smear was hypercellular, with a mixture of discohesive and cluster of cells (Figure A,B). The tumor cells had low nuclear to cytoplasmic (N/C) ratio, eccentrically placed round nucleus with prominent nucleoli. Some cells were large in size with abundant finely granular and less vacuolated cytoplasm. Others were smaller with abundant vacuolated, wispy cytoplasm. About 60% of smear was composed of naked nuclei with prominent nucleoli. Our rapid interpretation was reported as “malignant cells present, favor renal cell carcinoma”. Tumor cells in the cell block were positive for Pax8 and AE1/AE3 (Figure C,D) by immunohistochemistry.
Two core biopsies were collected concurrently with the FNA from the same skin lesion. Core biopsy demonstrated sheets of tumor cells infiltrating the underlying tissue. The tumor cells had similar cytomorphology to those observed in the FNA smear (Figure A). Tumor cells were positive for Pax8, RCC, vimentin, CD10 and negative for Ck7 (Figure ). Based on the histomorphology and the immunohistochemistry findings, a diagnosis of metastatic clear cell renal cell carcinoma was made.
|
pmc-6332754-1
|
A 55-year-old man presented with nodule on the nose since 7 months ago. The patient has a history of constant sun exposure due to his work as a farmer. History of bleeding when the patient rubs the lesion is mentioned. One year ago, he was diagnosed with keratoacanthoma and treated for the same lesion on the same area with electrocauterization.
On physical examination, there was a solitary nodule with 0.5 cm in diameter with solitary ulcer on top of it. (Figure ) Dermoscopic examination shows keratin mass with pink background and ulcer on the central area. Vascular features such as dots and globular were also seen. The dermoscopic features were suitable for a keratoacanthoma (Figure ).
From the histopathological examination shows a multiple mass with proliferation of capillary vessels, lymphoid cells and eosinophils infiltration which consistent with the diagnosis of angiolymphoid hyperplasia with eosinophilia (Figure A-H) The patient was done an L-plasty, and there is no sign of recurrence up to this day.
|
pmc-6332770-1
|
A 36-year-old woman was admitted to the hospital for laparoscopic robotic hysterectomy and bilateral salpingectomy for high-grade squamous intraepithelial lesion found on screening pap smear and proven to be cervical intraepithelial neoplasia 2-3 on colposcopy. The patient was stable throughout surgery and was discharged home with no complications.
The patient presented to emergency department 3 days after surgery with abdominal pain, nausea, vomiting, and fever of 101°F. Upon presentation to ED, temperature was 37.5°C, heart rate 93 per minute, blood pressure 124/62, SpO2 of 95% on room air, respiratory rate of 20. Physical exam was consistent with mild tenderness on palpation throughout the lower abdomen without peritoneal signs.
Laboratory data revealed WBC of 3.8 (lowest 1.6), platelet of 86 (lowest 66), AST of 2310 (max), and ALT of 686 (max).
Computerized tomography of abdomen and pelvis revealed small amount of ascites around the liver and spleen extending into the pericolic gutters bilaterally with fat stranding within the omentum (Figure ).
The patient was started on piperacillin/tazobactam with a presumptive diagnosis of postoperative peritonitis. Interestingly, the patient's pathology from the cervical tissue was positive for herpes simplex virus (HSV) (Figures and ). The patient continued to be febrile which prompted a paracentesis. This fluid was sent for viral PCR and demonstrated positive result for HSV. The test was not able to differentiate between HSV type 1 vs 2.
Acyclovir was started at the 10 mg/kg for every 8 hours. After initiation of acyclovir, patient's liver function tests and symptoms improved. Graphs , , show improvement of AST, ALT, WBC, and PLT after initiation of acyclovir on day 5.
Her fever subsided thereafter and the thrombocytopenia and leukopenia resolved. The patient was discharged home in stable condition with total of 3 weeks of acyclovir infusion treatment and outpatient follow up. To date, the patient is doing well and is free of symptoms.
|
pmc-6332778-1
|
A female 86-year-old patient presented at our clinic for a second opinion regarding her ocular symptoms. She was already diagnosed with late-stage macular degeneration in both eyes, progressed cataract formation and pseudoexfoliation syndrome about 6 years ago (Figure ). She complained about her significantly decreased visual acuity at near and far distance. The measurement of best visual acuity using a semiquantitative scale resulted in “counting fingers” (right eye) and “hand motion” (left eye) at 30 cm distance. The slit lamp examination showed the typical pseudoexfoliation (PXF) disk over the anterior capsule in both eyes. The abnormal white, grayish granular flakes were visible on the anterior capsule and in the trabecular meshwork. The pupils reacted very little to dilating eye drops, caused by posterior synechiae. Any kind of previous intraocular inflammation (uveitis) was assumed but not confirmed. The analysis of the lens showed nuclear and cortical cataracts (NC6) according to the lens opacity classification system (LOCS III). Intraocular pressure was fluctuating between 18-26 mm Hg without any therapy during the last months. Fundoscopy revealed a late-stage macular degeneration with large geographic atrophy in the right eye. A subretinal hemorrhage with cystic edema was found in the left eye. Multiple intravitreal injections in both eyes had been performed at another clinic about 4-5 years ago. Clinical reports of that time were not available. The intravitreal therapy of the patient was interrupted about 2 years ago. Since then, there have not been any control examinations and further therapies.
Intravitreal injection therapy in the left eye was reinitiated and we suggested to perform cataract surgery to improve visual acuity. About 4 months later, after two Bevacizumab injections in an interval of 4 weeks, the anti-VEGF therapy was stopped by another clinic due to lack of effectivity and the patient was discouraged regarding cataract surgery.
When the patient presented again at our clinic, we reassessed all clinical findings, repeated OCT examinations of the macula and performed a slit lamp examination of the lens. We found a massive cystic edema with subretinal hemorrhage and retinal pigment atrophy in the left eye and small cystoid spaces (edema) without any new hemorrhage but geographic atrophy in the right eye. Cataracts had advanced in both eyes during the last months, positively correlated to the subjective increase of foggy, gray vision in the periphery, resulting in a significant impairment of the patient's quality of life and ability to perform daily tasks.
In 2015, we decided to perform phacoemulsification with implantation of a new high-add intraocular lens (LENTIS® MAX, LS-313 MF80; Oculentis, Berlin, Germany) in the right eye (Figure A,B) and implantation of a monofocal, hydrophobic, acrylic, aspheric IOL (Tecnis PCB00; Johnson & Johnson Vision, Jacksonville, FL, USA), targeting emmetropia in the left eye. The magnifying IOL enables a 3× magnification at 15 cm distance. Cataract surgery using a Malyugin ring (6.25) was done without any complications. Due to the pseudoexfoliation syndrome with small pupils and the advanced cataract formation, the surgery was challenging. Phaco energy was applied as low as possible using a chop technique. The eye was refilled several times during phacoemulsification with cohesive and dispersive ophthalmic viscoelastic devices (softshell technique) to avoid any damage of the macula and the lens capsule/zonular. At the end of each surgery, a standard intravitreal injection (IVOM) with Aflibercept (Eylea, 40 mg/mL; Bayer, Leverkusen, Germany) was performed.
The postoperative course was uneventful. The postoperative local therapy scheme included cortisone and nonsteroidal anti-inflammatory drugs. In addition, a carbonic-anhydrase inhibitor (Diamox 250 mg 1 x 1) was prescribed for 3 days. The intraocular pressure (IOP) decreased postoperatively in both eyes after 1 month to 16-19 mm Hg. Best corrected distance visual acuity (CDVA) increased to 0.5 (logMAR) right eye, and 0.7 (logMAR) left eye with a binocular CDVA of 0.4 (logMAR). Best corrected near visual acuity (CNVA) increased too, but needed 3 months, most probably due to the neuroadaptation.
Four weeks postoperatively, fundoscopy and OCT examinations showed nearly unchanged conditions of the macula with subretinal hemorrhage and edema in the left eye. The cystic edema of the left macula disappeared. Therefore, another intravitreal injection of Aflibercept in the left eye was performed 6 weeks after surgery. Twelve months after surgery, the slit lamp examination showed two clear intraocular lenses in loco, an intraocular pressure of 17/16 mm Hg without any medication, stable dry ARMD conditions in the right eye and a slightly better OCT in the wet ARMD left eye. Binocular CDVA for distance was 0.5 (logMAR), binocular CNVA reached 0.92 (logMAR). Quality of life of the patient had improved significantly, she could again perform daily tasks. On a scale 0-10, with 10 indicative of best autonomy and 0 indicative of the worst, the patient achieved a score of 3 prior to surgery and a score of 6 postoperatively. Control examinations, including OCT, were performed every 6 weeks without further IVOM injections, and no worsening of the macula was observed during the following 8 months.
|
pmc-6332780-1
|
A 65-year-old male presented to our emergency department with extreme breathlessness and profuse diaphoresis within the last 2 hours. Physical examination revealed increased blood pressure and low oxygen saturation. Auscultation of the chest revealed bilateral basal pulmonary end-inspiratory rales.
The electrocardiography (ECG) did not demonstrate an acute myocardial injury pattern (Figure A). Chest radiography showed bilateral diffuse infiltrations, Kerley B lines, and flow inversion. Cardiac serum markers (Architect STAT assay, high-sensitivity troponin I; Abbott Diagnostics, Chicago, IL, USA) and D-dimer test were negative. Echocardiographic assessment disclosed mild concentric hypertrophy, mildly impaired left ventricular systolic function without regional wall motion abnormalities and moderate diastolic dysfunction with elevated filling pressure.
A diagnosis of acute pulmonary edema was established, and the patient was hospitalized under closed monitoring in the intensive care unit. The acute heart failure symptoms were successfully subsided after administration of furosemide and glyceryl trinitrate intravenously, as well as angiotensin-converting-enzyme inhibitor orally in combination with oxygen support. Complete respiratory recovery occurred in approximately 12 hours.
During the second day of hospitalization, the ECG showed a diffuse T-wave inversion in all precordial leads (Figure B). The patient underwent coronary angiography, and significant coronary artery disease was ruled out (Figure ). ECG T-wave inversion gradually resolved within one week (Figure C).
To the best of our knowledge, only a few cases of late large T-wave inversion after the occurrence of non-ischemic pulmonary edema have been described., Apart from myocardial ischemia, several well-described causes may be associated with T-wave inversion, including subarachnoid hemorrhage and hemorrhagic stroke, massive pulmonary embolism, pheochromocytoma, cocaine abuse, status epilepticus, gastrointestinal emergencies (perforated ulcer, acute pancreatitis, and acute cholecystitis), cardiac sarcoidosis, electroconvulsive therapy, and cardiac memory T-wave pattern., All the events above were excluded with regard to the patient's history and clinical manifestation.
|
pmc-6332814-1
|
A 70-year-old man with history of hypertension and diabetes mellitus (DM) presented with chest pain due to anterolateral STEMI for which he underwent percutaneous coronary intervention (PCI) of the left circumflex (LCX) with a drug-eluting stent. There was a chronic total occlusion of the left anterior descending (LAD) as well. A transthoracic echocardiogram (TTE) revealed an ejection fraction (EF) of 10%-15% with akinetic septum, mid to apical anterior and lateral walls; dyskinetic apex and an echodensity measuring 38 × 18 mm at its greatest dimension suggestive of a thrombus (Figure A). HAS BLED score was 1. He was discharged on Aspirin, Clopidogrel, and Rivaroxaban (15 mg daily for 3 weeks then 20 mg daily). A TTE 3 months later revealed resolution of the previously seen LVT and improvement in EF to 35% (Figure B).
|
pmc-6332814-2
|
A 63-year-old male with history of gout presented with shortness of breath and chest pain. He was found to have new-onset heart failure due to a completed anterior myocardial infarction for which he underwent PCI to LAD and first diagonal with drug-eluting stents preceded by rotational atherectomy. TTE showed an EF of 10% with severe akinesia of the apex; anterior, anterolateral, and mid to distal anteroseptal walls with a 12 × 9 mm thin layered mural thrombus. He received intravenous heparin for 7 days while inpatient. HAS BLED score was 1. He was started on Aspirin and Clopidogrel. Due to concerns of compliance with Warfarin, he was discharged on Rivaroxaban 20 mg daily instead. A TTE 4 months later showed resolution of the LVT.
|
pmc-6332814-3
|
A 58-year-old man with history of DM, presented with shortness of breath due to new-onset heart failure secondary to a completed anterior infarction. He underwent PCI to the right coronary artery (RCA) with drug-eluting stents in the proximal and mid portions. A TTE showed an EF of 10% and a large 18 × 8 mm nonmobile apical thrombus. HAS BLED score was 2 He was discharged on 20 mg of Rivaroxaban in addition to Aspirin and Clopidogrel. A TTE, 3 months later, showed complete resolution of the previously reported thrombus.
|
pmc-6332814-4
|
A 69-year-old man with history of ischemic cardiomyopathy presented with acute dyspnea. TTE showed a left ventricular (LV) ejection fraction of 10% with global hypokinesis and a 11 × 13 mm apical LVT. HAS BLED score was 3. He was discharged on Aspirin, Clopidogrel, and Rivaroxaban 20 mg daily which he stopped 40 days later for gastrointestinal bleeding secondary to vascular malformations; however, a follow-up TTE performed 6 months later showed complete resolution of the LVT.
|
pmc-6332814-5
|
A 60-year-old male with no past medical history presented with shortness of breath and lower extremity edema due to decompensated heart failure following a completed anterior myocardial infarction. TTE showed an EF of 10%-15%, global hypokinesis and a 19 × 12 mm left ventricular apical thrombus (Figure A). HAS BLED score was 0. Due to compliance concerns, he was started on Apixaban 5 mg twice daily following 2 days of intravenous heparin. In addition, he was also discharged on Aspirin and Clopidogrel. He discontinued the medication one month later; however, a follow-up TTE 4 months from the diagnosis showed complete resolution of the thrombus (Figure B).
|
pmc-6332814-6
|
A 28-year-old female with history of hypertension presented with worsening shortness of breath, orthopnea, paroxysmal nocturnal dyspnea, and bilateral leg swelling of 1-week duration. TTE showed global hypokinesia, bilateral ventricular enlargement with an EF of 10%-15% and a large echodensity in the apical inferolateral aspect of the left ventricle measuring 36 mm × 15 mm consistent with a thrombus. HAS BLED score was 1. Due to compliance concerns, Apixaban 5 mg twice daily was started instead of Warfarin. In addition, he continued to take Aspirin. Complete resolution of the LV thrombus was noted on TTE 10 months later.
|
pmc-6332814-7
|
A 68-year-old male with history of nonischemic cardiomyopathy (NICM) and stroke presented with shortness of breath due to decompensated heart failure. TTE revealed an EF of 25%, and an 8 mm pedunculated apical echodensity consistent with a thrombus. HAS BLED score was 3. Due to patient's reluctance to comply with Warfarin, Apixaban 2.5 mg twice daily was started. He also continued Aspirin and Clopidogrel for his previous stroke. Two months later, follow-up TTE revealed resolution of the thrombus.
|
pmc-6332814-8
|
A 62-year-old male with past history of alcohol abuse presented with sub-sternal chest pain due to an anetroseptal STEMI for which he had PCI to mid-LAD with a drug-eluting stent. TTE showed an EF of 15%-20%, akinesis of the mid-anterior wall, anteroseptal wall and apex in addition to two echogenic masses attached to the LV apex consistent with LV thrombi with the larger measuring 20 mm × 12 mm. HAS BLED score was 1. Apixaban 5 mg twice daily was started, in addition to Aspirin and Ticagrelor. Seven months later, a follow-up TTE showed resolution of the thrombi.
|
pmc-6332821-1
|
An 8-year-old boy presented to us with a 2-day history of fever, vomiting, and severe headache. His past medical history included two episodes of concussion and a recent upper respiratory infection. His initial examination was unremarkable. Given the history of head trauma, a head CT scan was obtained and it revealed asymmetrical white matter hypodensity and edema in the right frontal and temporal lobes without evidence of hemorrhage or midline shift, of concern in cases of meningoencephalitis. Cerebrospinal fluid (CSF) was collected and showed marked leukocytosis (1660 cells/L) and increased protein levels (250 mg/dL). The patient was started on ceftriaxone and vancomycin. Within a few hours after admission, the patient's condition deteriorated with left-sided hemiparesis and altered mental status. His airway was secured with successful intubation. A brain MRI was obtained and showed patchy areas of enhancement throughout the right cerebral white matter, midbrain, and pons with significant fluid-attenuated inversion recovery (FLAIR) changes—highly suggestive of ADEM. There was minimal right to left midline shift (Figure A). Aggressive management of high ICP was initiated due to a concern for cerebral herniation. It included head elevation, hyperosmolar therapy, therapy to maintain euthermia and carbon dioxide level in normal physiological range, sedatives and anti-epileptic medications to limit brain hyperactivity. The neurosurgical team was consulted for invasive ICP monitoring and for a possible brain biopsy to confirm the diagnosis of ADEM or AHLE. The patient was started on a pulse dose of intravenous methylprednisolone of 30 mg/kg/d for 5 days. On the second day of admission, the patient started posturing with further deterioration. A repeat MRI showed worsening of the midline shift with early tonsillar herniation secondary to massive edema, now involving both hemispheres (Figure B). The MRI further showed a new hemorrhage in the right cerebral hemisphere. Based on the rapid deterioration of his clinical status and new findings of hemorrhage with widespread white matter cerebral edema on the MRI, the diagnosis of AHLE was clinically made. An external ventricular drain (EVD) was put in place and the patient started on plasmapheresis (volume 1.0). Plasmapheresis was continued for 5 days without notable clinical improvement. Subsequently, the patient was given a dose of intravenous immunoglobulin (IVIG) 2 g/kg for two days. A dramatic improvement in his mentation, neurological deficits, and ICP followed over the next few days. The EVD and endotracheal tube were removed, and the patient weaned off sedative medications and hyperosmolar therapy. A repeat MRI on day 15 post-admission showed marked improvement in the cerebral edema with a complete resolution of the midline shift and tonsillar herniation (Figure C). He had an extensive infectious disease workup that was entirely negative (Table ). On hospital day 20, the patient was transferred to a rehabilitation facility with levetiracetam and a tapering dose of prednisolone.
|
pmc-6332822-1
|
Our patient, a 47-year-old woman with a medical history of hypertension, type II diabetes mellitus, and end-stage renal disease, presented with her family to the emergency department (ED) with worsening episodes of confusion, unsteady gait, and fatigue, after an episode of syncope and ground level fall 1 week prior. Glasgow coma scale (GCS) was determined to be 13 on her arrival, and work-up for stroke was initiated. CT scan of the head, as well as ECHO of the carotids, and ECG were all unremarkable. Of note, the patient's blood pressure on admission was 180/99 mm Hg. Additionally, demonstrating how poor the patient's kidney function was at that time, she was noted to have a creatinine of 3.8, a BUN of 52, and glomerular filtration rate of 13. The patient's family were insistent that patient had been adherent with her blood pressure medications at home but had been having issues controlling her it for years with medical management alone. Her home regimen consisted of Furosemide 40 mg BID, Hydralazine 100 mg TID, and Nifedipine 60 mg extended release daily.
On examination, the patient was somnolent and confused. Orientated only to herself, but able to follow simple commands such as “squeeze my hand” and “raise your right arm”. Pupils were equal and reactive to light. Patient showed no focal neurological deficits either on the face or any of her extremities. No asterixis was observed, reflexes were 2 + throughout, and plantar reflexes were down turning on both sides. Heart and breath sounds were normal. Patient's family admitted she was having trouble keeping her balance while ambulating around the time of the fall, and even more so thereafter. Due to the patient's somnolence during the time of the encounter, gait examination was deferred.
MRI of the brain showed a much more serious picture of the patient's condition in comparison with the benign results the CT scan had yielded in the ED (Figure ). The entirety of the pons demonstrated hyperintense signaling on FLAIR MRI imaging indicative of edematous change, which was also found in partial areas of the midbrain, cerebellum, and deep white matter. Diffusion weighted imaging did not show increased signaling, ruling out an acute infarct. Lumbar puncture returned no leukocytes, a glucose of 30, a slightly higher than normal protein of 46, albumin of 22, PCR negative for common viruses (HSV, West Nile, or Hepatitis Viruses), and did not gram stain. Differentials initially included uremic encephalopathy, pontine myelinolysis, and PRES.
During the first two days of hospital admission, the patient's blood pressure fluctuated greatly from a systolic pressure between 106 and 187 mm Hg, and a diastolic between 58 and 96 mm Hg. Medications such as valsartan, carvedilol, and metoprolol were added to the patient's regimen, all in an attempt to take control of her blood pressure. Once it became clear that medicine alone would be unable to control her blood pressure, the decision was made to begin hemodialysis on hospital day 2 in order to curb it more aggressively, as the patient's clinical presentation was not improving. Furthermore, the patient's creatinine and BUN had continued to climb (4.7 and 55, respectively), which was an additional factor in favor of hemodialysis.
On hospital day 4, as her blood pressure slowly lowered to an acceptable level (<140/90), the patient's family noted a marked improvement in her alertness, GCS rose from 13 to 15, and the patient regained the ability to converse appropriately. FLAIR MRI of the brain on hospital day 4 showed improvement of affected hyperintense areas compared to images taken on hospital day 1, and even more so on hospital day 9 (Figure ). The decision to repeat the MRI on hospital day 9 was both for confirmation of PRES, as well as for academic purposes. The patient was discharged with a blood pressure of 127/66 mmHg, a creatinine of 2.6, and a BUN of 18. Outpatient hemodialysis was arranged for both blood pressure control, as well as for kidney failure.
|
pmc-6332828-1
|
A 37-year-old nulliparous woman was referred for detailed fetal sonographic evaluation for heart anomalies and growth restriction at 20 and 5/7 weeks of gestation. She denied using teratogenic medications, recent viral infection, diabetes mellitus, and hypertension. She and her husband were nonconsanguineous and appeared healthy. There was no family history of congenital malformation.
The results of the stepwise sequential screening test [pregnancy-associated plasma protein (PAPP)-A 0.056 multiples of the median (MoM), free beta human chorionic gonadotropin (hCG) 0.074 MoM, nuchal translucency (NT) 0.874 MoM, α-fetoprotein (AFP) 0.616 MoM, hCG 0.052 MoM, unconjugated estriol (uE3) 0.107 MoM, and inhibin-A 0.303 MoM] indicated that the fetus of the 37-year-old mother was at high risk of Edwards syndrome (1:5). The mother was offered amniocentesis, but declined the invasive diagnostic test in favor of a noninvasive option, Faest© NIPT (Macrogen, Seoul, Korea), at 17 and 6/7 weeks of gestation. Faest© is a NIPT protocol based on massively parallel shotgun whole genome sequencing. The quantity of the fragments from each chromosome is assessed and compared with that of controls, and this comparison is then used to screen for trisomy 21, 18, and 13. When the results were reported as “low risk of trisomy 21, 18, and 13,” the parents and physician concluded that these results were reassuring news that the fetus was negative for any chromosomal anomaly, instead of just the trisomies that are currently screened for by this test (trisomies 21, 18, and 13).
A fetal ultrasound performed at our hospital indicated micrognathia, a complete atrioventricular canal defect, and small-for-gestational-age; biometric data on the head and abdomen were discordant with the age of gestation by 2 and 4 weeks, respectively (Figure ). The amniotic fluid remained normal.
After extensive parental counseling, the parents agreed to undergo amniocentesis to confirm the chromosomal anomaly.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.