_id
stringlengths 7
16
| description
stringlengths 55
95.2k
|
|---|---|
pmc-6370643-5
|
Patient 5 was a 9-year-old girl with a 7-year history of ES. MRI revealed pachygyria in the cortex. Scalp EEG revealed spike and wave complexes mainly over the bilateral central–parietal–posterior temporal regions . Two types of seizure were captured by ictal video-EEG: (a) 15 episodes of ES, which presented as nodding and flexion of the trunk, with typical ictal EEG patterns for ES; (b) four episodes of atypical absence seizures, which presented as loss of awareness, with EEG showing generalized high-amplitude (1.5 Hz) sharp and slow wave complexes .
Mean seizure frequency for ES at baseline was 15.00 ± 5.00 times per day. She was taking sodium valproate, clonazepam, and lamotrigine. The patient underwent three blocks of tDCS treatment at 2 mA. Mean seizure frequency for ES during the first, second, and third months of follow-up was 15.76 ± 35.91, 38.39 ± 59.57, and 21.02 ± 49.78 times per day, respectively Mean seizure frequency for atypical absence seizures at baseline was 0.10 ± 0.32 times per day. Mean seizure frequency for atypical absence seizures during the first, second, and third months of follow-up was 0.16 ± 0.40, 0.08 ± 0.27, 0.05 ± 0.22 times per day, respectively . As Patient 5 underwent three tDCS blocks without achieving a 50% reduction in seizure frequency, she was not identified as a positive responder.
|
pmc-6370643-6
|
At the time of enrollment, Patient 6 was a 15-year-old boy who had been experiencing ES and focal motor seizures since the age of 1 year. He underwent left frontal lobectomy at the age of 14, although no significant changes in seizure frequency were observed following surgery. MRI revealed post-operative changes in the left frontal lobe and abnormal signals in the posterior horn of the bilateral ventricles. Scalp EEG revealed sharp waves over the right frontal and left temporal regions (). Two types of seizure were captured by ictal video-EEG: (a) 71 episodes of ES, which presented as nodding toward the left or right side accompanied by blinking, with typical ictal EEG patterns for ES; (b) one episode of focal motor seizures, which presented as dystonia and clonus of the left upper limb followed by trunk stiffness, with simultaneous EEG showing low-amplitude fast activity over the right frontal–temporal region ().
Mean seizure frequency for ES at baseline was 39.60 ± 19.06 times per day. He was taking sodium valproate, zonisamide, and lamotrigine. The patient underwent two blocks of tDCS treatment at 2 mA. Mean ES frequency was 29.19 ± 20.39 and 69.23 ± 38.83 times per day during the first and second follow-up, respectively . No focal motor seizures were observed during the 14-day baseline period. Mean focal motor seizure frequency was 2.00 times per 28-days during both the first and second follow-up . As Patient 6 underwent two tDCS blocks without achieving a 50% reduction in seizure frequency, he was not identified as a positive responder.
|
pmc-6370643-7
|
Patient 7 was a 25-year-old woman with an 8-year history of ES. MRI revealed no evidence of lesions at the time of enrollment. She had a history of IS at the age of 5 months, at which time MRI revealed subdural effusion. Following drill drainage, she remained seizure-free until the age of 17 years. Scalp EEG revealed sharp waves and complexes mainly over the bilateral frontal–temporal regions . Two types of seizure were captured by ictal video-EEG: (a) seven episodes of ES, which presented as slight nodding, with typical ictal EEG patterns for ES; (b) one episode of ES followed by a tonic seizure, which presented as sudden, slight nodding and stiffness of the neck for several seconds, with EEG showing spike rhythms following a typical ES pattern .
Mean seizure frequency at baseline was 18.10 ± 7.05 times per day. She was taking sodium valproate, clonazepam, zonisamide, and lamotrigine. The patient underwent two blocks of tDCS treatment at 2 mA. Mean seizure frequency was 14.81 ± 4.20 and 12.15 ± 4.00 times per day during the first and second follow-up, respectively . As Patient 7 underwent two tDCS blocks without achieving a 50% reduction in seizure frequency, she was not identified as a positive responder.
|
pmc-6371137-1
|
A 78-year-old male with a past medical history of hypertension, coronary artery disease status post myocardial infarction requiring stent placement, asthma, gastroesophageal reflux disease, and bulbar poliomyelitis presented to our Primary Care clinic for evaluation of worsening fatigue, exertional shortness of breath, dysphagia, chest tightness and generalized weakness.
The patient reported a diagnosis of poliomyelitis in 1956 after noticing flu-like symptoms and weakness. His course was complicated by dysphagia requiring tracheostomy placement, but no iron lung therapy was required. He reported appropriate recovery from his condition with few noticeable sequelae.
Vitals signs were within normal limits. Physical exam revealed an elderly male, alert, oriented, in no acute distress and with non-labored respirations. Neurological exam revealed mild bilateral upper extremity weakness. Sensation and reflexes were intact; positional and balance testing were normal and there were no cranial nerve abnormalities. Remaining cardiopulmonary, abdominal, musculoskeletal and skin exams were within normal limits. Routine blood testing revealed no abnormalities.
More extensive outpatient workup was initiated to elucidate possible etiologies of the patient’s symptoms. High Resolution CT Scan showed eventration and elevation of the right hemidiaphragm but no evidence of honeycombing, ground-glass opacification, suspicious lung nodules, bronchiectasis or bronchial wall thickening. Pulmonary Function testing was performed and results showed very mild restriction with a total lung capacity of 79%. A sleep study was also ordered and revealed mild obstructive sleep apnea.
Electrocardiogram revealed sinus rhythm and no ST-T wave abnormalities. Stress Echocardiogram showed an ejection fraction of 70%, no signs of ischemia and a non-reversible infarction in the basal inferolateral region that appeared unchanged from prior stress testing. Esophagogastroduodenoscopy (EGD) was also performed to further investigate the patient’s complaints of dysphagia. EGD showed a hiatal hernia in the esophagus as well as an esophageal schatzki’s ring requiring balloon dilation.
A diagnosis of post-polio syndrome was made given the patient’s distant history of poliomyelitis, mostly negative multi-system workup and presenting signs. Auto-pap was issued to the patient for the treatment of sleep apnea. Physical therapy was recommended with an emphasis on the avoidance of overexertion.
|
pmc-6371155-1
|
Case 1 was a 60-year-old woman. She was raised in a coastal area in a small town, in what is described as a well-functioning family, and has been trained as a healthcare assistant. Prior to moving into the nursing home, she had been married and had two adult children, with whom she had no contact. She had gradually increased her consumption of alcohol over the years, and in spite of several contacts with outpatient services for alcohol dependence, her drinking had steadily increased. After losing her job, she became increasingly socially isolated. Prior to moving into the nursing home, her home nurses visited several times per day, and they often found her in severe withdrawal, occasionally convulsing. She was underweight and incontinent. Her apartment was untidy and rarely cleaned, smelled of urine and feces and evinced her lack of personal hygiene. She was depressed and talked about suicide.
After moving into the home, she gradually became stable, and was able to manage her personal hygiene with minimal assistance. She ate at meals and began to look better. She was still drinking, but at a level that did not cause problems with other residents. Occasionally, she drank heavily for 1–2 weeks. Her contact with other residents and staff stabilized, and she participated in simple practical activities. She seemed less anxious, and did not go through serious withdrawal.
During the 18-month period before moving into the nursing home, she had been hospitalized nine times for periods ranging from 1 to 19 days; in total, she spent 43 days in hospital, had one outpatient visit and several ER visits. The total cost of her hospital-based care was estimated to be 154,649 DKK (20,798.74 Euros).
After moving into the nursing home, she was admitted to inpatient treatment on two occasions for a total of 4 days. The total cost was 25,226 DKK (3392.64 Euros). She also had two visits at an emergency room (ER) and four outpatient visits.
|
pmc-6371155-2
|
Case 2 was a 62-year-old man. He had been raised in what is described as a well-functioning family. He had no formal training, but had been working for most of his life as an unskilled worker. He had been married three times, and had three adult children, with whom he had no contact. After his last divorce, his consumption of alcohol increased rapidly, causing him to lose his job. Because of alcohol problems and depression, he was repeatedly hospitalized. After an acute cerebral infarction at age 60, he was left with brain damage that rendered him unable to take care of himself. Apart from alcoholic drinks, he started drinking chlorine, denatured alcohol and toilet cleaner. He was described as depressed, lonely and completely without initiative.
After moving into the nursing home, he started to eat, consumed alcohol in an acceptable manner, and his health condition improved considerably. He also made contact with the other residents and staff, reducing his loneliness.
During the 18-month period prior to moving into the nursing home, he was admitted to inpatient wards eleven times, and spent a total of 237 days in hospital. The total cost of these hospitalizations is 1,023,830 DKK (137,694.90 Euros). Due to aggressive/psychotic behavior during intensive care, he also had to be closely supervised by extra staff, but the costs associated with this extra staff could not be estimated by the unit. Further, he had four emergency room visits, one psychiatric emergency and eight outpatient visits.
During his first 18 months in the nursing home, he was hospitalized once for three days. The total healthcare cost was 21,564 DKK (2900.57 Euros). In that period, he had two outpatient visits and no ER visits.
|
pmc-6371155-3
|
Case 3 was a 70-year-old man, who had a diverse history of employment, including military service, working as a plumber, and running his own business. He had been married four times and had two daughters. After his fourth divorce, he stated that he intended to drink himself to death. By age 50, he obtained a disability pension due to rheumatism, and developed a serious prescription opioid dependence. He would increasingly leave his home and walk around drinking until he would pass out on a bench or in a park. He was unable to cook meals for himself, and repeatedly forgot to turn off his stove. He had a number of somatic complaints, and asked doctors and nurses for painkillers. Additionally, he had serious financial problems, and was often aggressive and dissatisfied.
After moving into the wet nursing home, he became able to manage his personal hygiene, and made and maintained contact with his sister. His response to pain medication improved, and he appeared to be satisfied with living in the home. He continued to drink, but was almost never seen intoxicated.
In the 18 months prior to moving into the home, he had been hospitalized nine times for a total of 77 days, had one ER visit and 5 outpatient visits. The total cost was 328,579 DKK (44,190.59 Euros). After moving into the home, he was hospitalized once for two days, and had three visits to general ER and four outpatient visits. The total cost of inpatient care during this period was 9458 DKK (1273 Euros).
|
pmc-6371167-1
|
In June 2016, a 97-year-old man presented to the cardiology clinic with a feeling of impending doom and symptoms of heart failure New York Heart Association class III (dyspnea with minimal exertion, peripheral edema, and fatigue) after recently being treated in the emergency department for similar symptoms with intravenous diuretics. The patient had a long-standing history of asymptomatic severe aortic stenosis and had been highly functional until that day. Three years prior, he was denied SAVR due to being considered a high surgical risk. A 2D echocardiogram revealed a trileaflet aortic valve with a valve area of 0.5 cm2 (normal is 3–4 cm2) and a mean transvalvular gradient of 48 mmHg (normal is <5 mm Hg), which indicated severe aortic valve stenosis. Additional co-morbidities consisted of moderate tricuspid regurgitation, hypertension, chronic obstructive pulmonary disease (COPD), chronic renal disease stage III, gastrointestinal hemorrhage in 2013, and adenocarcinoma of the prostate that was treated in 1991 with radiation and adjuvant hormone therapy. On assessment, his blood pressure was 143/70 mm Hg, heart rate was 50 beats per minute, respiration rate was 14 breaths per minute, and he was afebrile. Auscultation of the heart revealed the class murmur of aortic valve stenosis, which was a loud ejection murmur over the aortic area, radiating to the carotid arteries. He had bilateral lower extremity edema, +2, and non-pitting.
The patient was admitted to the hospital emergently. His pre-operative risk assessment for 30-day mortality—the Society of Thoracic Surgeons (STS) score—was elevated at 14.4% [], and he was thus evaluated for TAVI. Multiple tests were performed to assess the feasibility of the procedure. CT angiograms of the thorax, abdomen, and pelvis were implemented to investigate for abnormalities of the vasculature that would prohibit a transfemoral approach for TAVI. Considering that stroke is a common complication of this procedure [], a carotid ultrasound was performed to evaluate for carotid atherosclerosis. Two cardiothoracic surgeons examined the patient and declared that he would be at high mortality risk to have SAVR, and thus they recommended TAVI. Cardiac catheterization was performed to evaluate for coronary artery disease and to obtain hemodynamic measurements.
Under general anesthesia, the right and left femoral arteries were each accessed with 6-french sheaths. A temporary pacemaker was placed in the right ventricle through an 8-french sheath in the right femoral vein. Balloon valvuloplasty was performed by advancing a balloon via the right femoral artery sheath, and during rapid ventricular pacing at 160 beats per minute, inflating it across the aortic valve to clear the stenosis and to deploy the 26-mm SAPIEN S3 bioprosthetic aortic valve (), which expanded within the native aortic valve (). The purpose of rapid ventricular pacing during TAVI is to reduce cardiac output, which facilitates balloon inflation across the valve and placement of the bioprosthetic aortic valve. The mean valvular gradient after TAVI decreased to 1.9 mm Hg (normal is <5 mm Hg). There were no intraoperative complications. The patient was extubated and transferred to the coronary care unit with the temporary transvenous pacemaker, which was removed two days later.
A 2D echocardiogram performed on the first postoperative day showed that the prosthetic aortic valve was well seated without any regurgitation. A 12-lead electrocardiogram revealed new onset paroxysmal atrial fibrillation with slow ventricular response (his heart rate was in the range of 50 beats per minute). Anticoagulation treatment for the prevention of thromboembolic events was initiated with Apixaban 2.5 mg BID. The lower dose of Apixaban was selected because he was older than 80 years and his serum Creatinine level was above 1.5 mg/dL []. In addition, Clopidogrel 75 mg daily was started to prevent stenosis of the bioprosthetic valve. The patient was discharged home three days post procedure.
One month later, during a follow-up appointment with the primary care provider, the patient was found to be severely bradycardic and became unresponsive for a few minutes. He regained consciousness without any resuscitative efforts and was taken emergently to the hospital. An inpatient limited 2D echocardiogram showed normal systolic function with ejection fraction of 55–60%. Unfortunately, nothing was reported on the function of the bioprosthetic aortic valve. The patient remained asymptomatic during the hospitalization and was discharged home the next day. A review of patient’s home medications revealed that he was taking the negative chronotropic medication metoprolol succinate, which may have precipitated his syncopal episode. He was instructed to stop this medication.
During the six-month follow-up visit, the patient reported continued symptomatic improvement. He had mild peripheral edema. Dyspnea occurred with more significant exertion; thus, NYHA functional class II. He remained off metoprolol as instructed, and despite being bradycardic with a heart rate of 55 beats per minute, he did not experience any further episodes of dizziness. A limited 2D echocardiogram revealed that the bioprosthetic valve was well seated without any paravalvular leak. The ejection fraction was 65% and he had mild diastolic dysfunction. The patient was told to stop clopidogrel (as he had completed the standard six-month treatment), and to continue antiplatelet therapy with Aspirin 81 mg daily indefinitely.
|
pmc-6371184-1
|
Mrs. L., 75-year-old female patient, consulted our Memory Clinic in 2015 and underwent usual diagnostics in order to objectify or rule out cognitive deficits pointing toward possible dementia. Mrs. L. underwent neurological and psychiatric as same as neuropsychological examination, brain imaging and lumbar puncture, spread out across several appointments as is common in this outpatient setting. Mrs. L. was informed about the results, including advice regarding possible driving limitations.
Note that results of the work-up are routinely discussed in a multiprofessional team during a consensus meeting including physicians, social workers and a clinical neuropsychologist.
Mrs. L. reported a history of forgetfulness, starting approximately three months previous to the appointment.
She stated that she needed “to write down everything” in order not to forget things. Previously, she had only used notes when shopping. Being among her family and friends, she often forgot the content of the conversation. She complained about forgetting what she wanted to fetch when going to the cellar. She said that she was able to keep house with a little help from her partner, whom she first met only four months ago. Her husband had died two years previously. She did not report difficulties with spatial orientation, sleep, appetite or motivation.
She had noticed an increasing inner restlessness combined with a fear of having dementia (i.e., subjective cognitive impairment). This was the reason for a prescription of 20 mg of Citalopram as antidepressant medication by her GP—the medication was continued up to consultation with us. Further questioning in our Memory Clinic did not reveal signs of depression, nor for, e.g., delirium or any other acute psychiatric illness.
Mrs. L. added that she still liked to go out with friends for ninepins, although less frequently in the last months. She underlined that she liked driving very much and never had difficulties as a driver.
Mrs. L. completed secondary education and worked as a seamstress. She has one daughter and was widowed two years ago. Meanwhile, she lives in a house together with her new partner.
There is an unclear history of drinking alcohol: Mrs. L. reported stopping “relevant” drinking four months ago, recently consuming one glass of beer per week, without providing further details.
He noticed that Mrs. L. repeatedly asked for the newspaper on Sundays, obviously unable to remember that there never was a newspaper on Sundays. She had expressed her feeling of loneliness since the death of her husband and that she suffered from this. The question of having dementia had become more prominent in the preceding weeks. He never noticed increased alcohol consumption.
The daughter of Mrs. L. suggests regular alcohol consumption (unclear amounts) and expresses her fears of seeing her mother driving, not knowing whether she had drunk recently. She confirms the history given by her mother and the partner (see below for the patient’s history on substance abuse.)
No “known” psychiatric illness. Thyroid disease is present, and the patient is on medication. She is also being medically treated for hypertension. No other illnesses were reported.
She obtained her driving license 40 years ago. No relevant accidents are reported. Her fellow passengers have felt safe when accompanying her. Starting approximately two years ago, she avoids driving at night-time. Whenever she has felt upset or nervous, she has preferred to be driven by others. She enjoys driving, and underlines that she is a confident and safe driver. Regarding the risk factors as introduced in the consensus paper from the Swiss memory clinics as mentioned above [], we only detected the following limitations: The only problem with driving that showed up was that Mrs. L. preferred driving only shorter distances for about one year. Recent medication did not imply any danger for safe driving. There was neither an intake of sedatives nor a newly started administering of ataractics.
The first part of the SAFE, mainly focusing on driving history within the last two years and past medical history as same as recent medication, did not disclose any risk factors for driving.
Mrs. L. and the psychiatrist concluded that there was no obvious hint at reduced driving skills at this stage of diagnostic process. Nevertheless, it was explained that this conclusion could only be preliminary as detailed diagnostic workup was about to come. Final judgement was announced for future consultations after diagnostic workup. The second part of the SAFE that can only be filled in after neuropsychological examination might point toward possibly reduced driving abilities though.
The neurological examination including rough visual testing was unremarkable. No movement limitation was found in the cervical vertebral column.
Mental state examination including questions about orientation, concentration, signs of delusions, fears, obsessive-compulsive thinking or acting, psychomotor disturbances and affective symptoms including suicidality revealed no pathological findings except for her feeling prolonged loneliness after her husband died two years ago. Two months ago, Mrs. L. noticed restlessness and a change in mood, fearing that she may develop dementia. A slight improvement of the restlessness was reported under Citalopram medication. Formal criteria for depression were not fulfilled. There were no signs of day sleepiness. No impulsive behavioral disturbances were present. During consultation, Mrs. L. was irritable and reflected herself on that problem. She reported a thoroughly reduced ability to concentrate once she felt irritated. She described stronger irritability if she was distressed for whatever reason.
Standard lab work-up was performed by her GP, showing slightly elevated potassium and cholesterol levels without other significant findings.
The above history was taken during the first consultation in our Memory Clinic. In summary, we saw an individual with evident short-term memory deficits and slight subjective orientation difficulties (however, objective orientation screening during the consultation showed no abnormalities), that had begun (or were first realized) approximately three months previously; the patient also reported restlessness. There was an unclear history of alcohol consumption that could be potentially relevant. The patient seemed quite irritable during consultation. The patient is an ardent driver, negating difficulties. There were no previous accidents. We did not see any obvious indication that she might pose an immediate threat to herself or others with respect to unsafe driving. We advised the patient to undergo more thorough work-up, including extended neuropsychological testing and brain imaging.
The working diagnosis at this stage of the diagnostic process was “Mild cognitive impairment”.
We brought up the topic of driving safety at this stage of consultation, but it naturally was subject to preliminary evidence. Although the stated “Mild cognitive impairment” and the history did not include hints at driving problems, but irritability was present. Its significance remained unclear.
Moreover, the unclear history of (potentially relevant) alcohol consumption added to uncertainty. Third-party history was somewhat contradictory, the relationship with the patient’s partner being relatively new. Her daughter’s anxiousness in this respect—the fear that her mother may have driven while drunk, ongoing discussions with her mother on the topic, etc.—was taken seriously, albeit the fact that the daughter could not objectively recall the amounts and frequency of consummation. Substantiation remained elusive.
The process of consultation is often not linear, information not always open to clarification. Would it then be indicated to contact the patient and consult her in respect to (new) third-party information to verify on any alcoholic consumption and self-reported short term memory deficits, or, is it more sensible to wait until all tests and examinations have been completed before addressing the subject of driving safety? In the case of Mrs. L., we opted to wait.
After explorative neuropsychological examination during the first appointment, an extensive neuropsychological examination was conducted. Neuropsychological assessment included well-established neuropsychological examination for global cognitive functioning, episodic memory (verbal learning, verbal memory retrieval, nonverbal memory retrieval, and verbal recognition), semantic memory (naming and semantic fluency), attention (processing speed, attention capacity), executive functions (code shifting and cognitive flexibility), and spatial abilities. In addition, depressive symptoms were evaluated using the Beck Depression Inventory (BDI-II) [,] and the Geriatric Depression Scale (GDS) [].
Verbal learning, verbal memory retrieval, and verbal recognition were evaluated with the German version of the Rey auditory verbal learning test (RAVLT) [], whereas nonverbal memory retrieval was assessed using a subtest (Constructional Praxis II) of the Consortium to Establish A Registry for Alzheimer's Disease (CERAD) [,]. Semantic memory was assessed using a 15-item version of the Boston naming test (BNT) [] and a category fluency task (animal fluency) []. Attention was assessed with part A of the trail making test [,] and with digit span tasks []. Executive functioning was assessed with a number transcoding task from the Dementia Detection Test (DemTect) [] and with part B of the TMT-B [,]. The TMT-B assesses cognitive flexibility, whereas the number transcoding task requires code shifting []. Spatial abilities were evaluated using the clock drawing test [] and a CERAD subtest (constructional praxis I), which requires the duplication of geometric figures. For all of these tests, a higher score reflected better performance, except for the TMT, RAVLT false positives, the number transcoding task and the clock drawing test—here, higher scores reflect lower performance (greater time and number of errors, respectively). The neuropsychological test results are displayed in .
Neuropsychological test results revealed impaired global cognitive abilities (MMSE = 23), poor episodic memory skills, slow processing speed, and impaired cognitive flexibility. In contrast, semantic memory and spatial abilities were unimpaired. Depression screening pointed toward slight depressive symptoms.
The neuropsychologist advised Mrs. L. to refrain from driving until the next consultation with the physician.
Regarding possible consequences for Mrs. L.’s driving abilities, the observed cognitive deficits were now deemed to be significant. Especially, Mrs. L.’s very poor performances on the TMT indicated significantly impaired processing speed and cognitive flexibility. Recent studies have shown that a significant association exists between poor TMT-B performances and impaired driving skills []. In addition, Mrs. L. showed a reduced MMSE performance, a reduced driving range and reported increased irritability. Consequently, we concluded that the findings might indicate an increased risk for driving.
The second planned consultation with the Memory Clinic physician was now intentionally scheduled earlier (before further work-up could be carried out) because of the results of the neuropsychological examination. We asked both the patient and her daughter to be present. Due to medical confidentiality, we did not inform about any results in advance.
At the time of the appointment, the patient did not show up. Her daughter was present. She was unaware of the whereabouts of her mother. In the waiting period that followed, the patient’s daughter received a phone call. The caller reported that the patient had taken her own car to drive to the Memory Clinic for the appointment—and had driven down a one-way street in the wrong direction, stopping the car abruptly in the process and leaving it unattended. The patient—clearly upset—had asked a bystander to call the daughter.
The situation created a dilemma: on the one hand, there was a now documented risk to the patient and others if she continued driving; on the other hand, confidentiality issues prevented us from immediately communicating the results of the neuropsychological examination to the daughter—indicating dementia as the cause for her driving disability (although the latter would have “delegated” the process of informing the patient to a third party, it would have also allowed the daughter to act to directly hinder further road activity.) In addition, directly informing official parties was not an option, albeit the risk: it was deemed not sufficient enough when weighed against the legal interest of confidentiality.
The missed appointment was rescheduled. With the patient and her daughter then being present, next to the attending physician and the Memory Clinic’s social worker, we advised against further driving. We highlight that in a worst-case-scenario, the driver will not be covered by insurance in the case of an accident, if it is shown that they had been previously informed of the risk incurred by the cognitive disabilities. To help drivers accept our advice to stop driving, we also provided information to seek second opinion on their driving performance by taking part in professional testing at driving schools, but more commonly by official road safety agencies (e.g., the “TÜV” or “DEKRA” organizations in Germany). Unfortunately, when our social worker visited the patient at home three weeks later—to check on the psycho-social situation—Mrs. L. reported that she had continued to drive, although “only for short distances”. Again, it was urgently emphasized that driving, given the cognitive disabilities, was a risk.
The formal working differential-diagnosis at this stage was “mild Alzheimer’s dementia”.
We routinely recommend an MRI. Furthermore, it is common practice to perform CSF-diagnostics in our setting.
MRI sequences included T1- and T2-weighted imaging, Fluid-attenuated inversion recovery technique (FLAIR) and Suscepibility weighted imaging technique (SWI) —in axial, sagittal and coronal orientations.
The major pathology was patchy bi-hemispheric microangiopathic and lacunar lesions. Some of these lesions showed signal suspicious of microbleeding. There was no sign of more than age-appropriate global or significant mesio-temporal atrophy. We do not routinely perform manual or automated hippocampal volumetry.
Routine work-up was unremarkable: cell count, glucose and lactate level, albumin and albumin blood/CSF-ratio were normal. No signs of intrathecal synthesis of immunglobulines. (Routine) treponema pallidum screening was negative.
The markers for neurodegenerative disease were, however, pathological.
Total tau protein: 1353 pg/mL (pathological cut-off: ≥450 pg/mL), phosphorylated tau protein: 182 pg/mL (pathological cut-off: ≥61 pg/mL);
β-amyloid 1–42was normal (849 pg/mL cut-off: ≤450 pg/mL), β-amyloid 1–40 was elevated to 35,810 pg/mL. Therefore, the β-amyloid ratio ((β-amyloid 1–42/β-amyloid 1–40) × 10) was pathological (0.24; pathological cut-off: <0.5).
Results are commonly discussed in a consensus conference at our Memory Clinic. After all, diagnostic information was available, it was concluded that Mrs. L. should be formally diagnosed with mild Alzheimer’s Dementia.
Note that the cerebral microangiopathy may add to the cognitive deficits; we, however, taking the patient’s history into account, did not judge this pathology to be the leading cause of dementia. High blood pressure is a consistent risk factor for cerebral white matter lesions Leukoaraiosis in turn is a risk factor for dementia, thus treatment of hypertension may also be preventive of future additional cognitive decline.
The patient—together with her partner and her daughter—were informed of the diagnosis in a third, concluding, appointment. They were advised in respect to its probable impact on daily living. Moreover, we proposed initiating treatment with a cholinesterase inhibitor. Though the history of alcohol consumption remained patchy, we advised Mrs. L. to reduce any drinking.
Results of neuropsychological examination as cited above, unclear alcohol consumption, emotional irritability and the discovered driving fault were suggestible of reduced driving abilities. The SAFE assessment helped to provide objective results. The patient’s irritability—though more of subjective value—added to our hesitation to recommend driving competence. We discussed possible alternatives of mobility by public transport. The social worker gave detailed information about bus lines and established a possible schedule for Mrs. L. and her daughter for being fetched by her. Our social worker repeated information on diagnosis and driving several times in future appointments, thus contributing to enhanced psychoeducation. She provided aid in dealing with the support and welfare system, which helped Mrs. L. to cope with the situation. Her practical approach alleviated some emotional distress. Additional consultations with the psychiatrist were offered. In our case, Mrs. L. could profit from sensitive contact both with the social worker and with the psychiatrist. The psychiatrist continued outpatient therapy for several more consultations and discussed coping strategies concerning the loss of independent mobility. For example, we could reframe loss of independence by explaining that more contact could be made possible by her daughter fetching her and neighbors accompanying her on the bus trips.
Fortunately, the patient has now consented to our advice and refrained from further driving. She also acknowledged the diagnosis and was willing to be medicated.
|
pmc-6371447-1
|
The patient was a 70-year-old woman referred to our hospital because of four episodes of hemoptysis within one month. A history of myoma and pulmonary tuberculosis was noted before this admission. After admission, we arranged a series of examinations. No obviously abnormal findings were noted in the patient’s blood tests or sputum culture. Chest radiography revealed opacity of the left upper lung field (Fig. a). Chest multidetector computed tomography angiography (MDCTA) with 3-D volume rendering imaging demonstrated focal bronchiectasis and a 2.4 cm long serpentine hypervascular lesion in the lingula of the left lung abutting the pericardial region (Figs. b and b). Angiography revealed that the main supplying vessels of the hypervascular lesion arose from the inferior phrenic artery (Fig. a). The aberrant arterioles communicated with the inferior branch of the left pulmonary artery. Transcatheter arterial embolization (TAE) was attempted but failed because of the tortuosity of the vessels. Preoperative simulation with 3-D image reconstruction revealed the aberrant vessels and their associated anatomy. The patient underwent single-port video-assisted thoracoscopic surgery with segmentectomy of the lingula. Intraoperatively, the feeding artery of the serpentine hypervascular lesion was ligated and lingual segmentectomy was performed (Fig. ). Histopathology of the resected specimens showed proliferative tortuous arterioles and vessels surrounded by lymphocytic aggregations. The patient was discharged on postoperative day 10 after an uncomplicated course. There was no hemoptysis with 2-year follow-up.
|
pmc-6371454-1
|
A 10-year-old Chinese boy, with a height of 152 cm and weighing 35 kg, was presented with 4-year history of cyanosis and dyspnea on exertion. Physical examination on admission revealed a central cyanosis and digital clubbing with a resting pulse oximetry (SpO2) of 75% on room air. Chest and cardiac examination results were unremarkable. His abdominal examination showed situs solitus and no hepatomegaly. He had mild mental retardation, however, no evidence of encephalopathy. His laboratory test showed an elevated hemoglobin level of 16.5 g/L, a normal liver enzyme enzyme profile with aspartate aminotransferase 16 U/L, alanine aminotransferase 20 U/L. Direct bilirubin was 4 μmol/L (normal range 0 to 6.8 μmol/L) and albumin was 40.8 g/L (normal range 38 to 54 g/L). Chest X-ray, electrocardiogram and echocardiogram results were unremarkable. Chest CT showed diffuse pulmonary hypervascularization. Hence, diffuse PAVF was suspected. A right cardiac catheterization was performed, which showed a normal pulmonary artery pressure. Selective lung angiography showed immediate opacification of the left atrium, and typical diffuse reticular vessel pattern on right lower lung, which suggested PAVF (Fig. ). Transcatheter coil embolization for PAVF of 7 micro coils was performed, however, pulmonary arteriovenous shunt was still existing post occlusion (Fig. ). And, symptoms of cyanosis and dyspnea were not improved.
So, we began to suspect our original diagnosis of PAVF and liver disease was considered. We found the serum ammonia was elevated to 82 μmol/L (normal range from 16 to 60 μmol/L). The elevated serum ammonia was attracted our attention. Furthermore, abdominal contrast enhanced CT showed the main portal vein (MPV) was enlarged, spleen vein (SV) and superior mesenteric vein (SMV) and its branches were circuity expansion. Congenital extrahepatic portosystemic shunt was considered. A selective cathether angiography was subsequently performed, and the results confirmed it was Abernethy malformation IB type. Angiography with direct opacification of the SMV with a catheter coming from the IVC and going to the SMV via the shunt vessel (SHUNT) between the MPV and IVC (Fig. ). Occlusion the IVC with an inflated balloon, injection of contrast medium via a catheter placed in the SMV, MPV was showed and no intrahepatic branches could be opacified (Fig. ). Finally, the investigatory features were consistent with the diagnosis of type IB Abernethy malformation, and the child is now scheduled for Liver transplantation.
|
pmc-6371472-1
|
A 17-year-old female was admitted to the hospital due to severe suicidality. At the time of admission she complained about an irritating feeling in her nose, which made her constantly grimace in the area around the nose. She was excessively worried about having a serious illness of her nose (secondary hypochondriacal delusions) and was suicidal as a consequence. Her belief persisted even after any underlying medical condition of the nose has been ruled out by extensive medical examinations. She also presented with disorganized behavior, stereotypical movements, emotional instability and lability, and a below average level of intelligence during hospitalization. On the PANSS, her symptoms scored 29/23/70 (for the Psychotic, Negative and General Psychopathology Scale, respectively). Brief neurological examination revealed no abnormal neurological signs. As ascertained by the history taken from the patient and her mother, she had a history of school phobia that began at the age of 12 years, emotional disorders, normal cognitive and physical development, and a three-year history of chronic headache. She managed to complete primary and secondary education with the help of school counseling services given to her on account of school phobia. She had not received any psychiatric care before the described admission. A diagnostic evaluation for chronic headache at the University Children’s Hospital was undertaken a year before admission.
Calcium, phosphate and parathyroid hormone blood levels were normal. Vitamin D levels were decreased with decreased calcium levels in the urine. No signs of calcium depositions in organs other than the described brain regions were determined by ultrasound. Ophthalmological, ear-nose-and-throat examination and electroencephalography were also normal.
Detailed neurological examination revealed dysfunction of pursuit eye movement, dystonic positioning of both arms when stretched ahead, discrete ataxia of the arms and legs, and a pathological extensor response of the left big toe.
Bilateral symmetrical calcification in head, body and tail of the caudate nucleus and ventral part of the thalamus were determined by computerized tomography (Figs. and ). MRI was preformed twice over a two-year period using the same protocol. Corresponding MR T1 sequences showed hyperintense calcifications in the same regions as those found on CT examination (Figs. and ). Both MR examinations showed a high signal of calcified areas on T1 weighted sequences due to the surface area of calcium crystals. The same areas had an isointense signal on T2 weighted sequences. No other abnormalities of the brain were detected on the MRI.
During psychometric evaluation, the patient’s cognitive abilities were assessed with RPM, TOL-II, d2, CTMT and Stroop tests. The patient performed significantly worse than her normative age group in terms of general cognitive abilities, coming in below the 10th percentile. She was unable to perform problem-solving operations that require abstract thinking. Assessment of her attention performance showed below-average results in scanning and alternating attention. She also showed below-average performance in her sustained and divided attention, with her concentration performance in the 8th percentile. Her planning abilities were significantly worse in comparison with her normative group, where she was unable to construct a problem-solving strategy. Her approach was a trial-and-error strategy and she failed to solve the problem within the time limit. The patient had no significant difficulties with inhibition of dominant response, reaching a borderline average result. We performed a retest after a year of treatment and the results showed no significant changes, although she was slightly better, but unfortunately without significant improvements, in her planning abilities and in her sustained attention.
A whole blood EDTA sample was used for extraction of genomic DNA according to established laboratory protocols using the FlexiGene DNA isolation kit (Qiagen, Germany). Whole exome sequencing a trio (index patient and her parents) was performed in collaboration with NovoGene Corp. Inc. (Davis, CA, USA) using an Agilent Sure Select Human All Exon V6, 5191–4004 kit for whole exome enrichment preparation together with an Illumina Platform PE150 (Illumina, San Diego, USA) to perform the whole exome sequencing. Genetic variants with coverage >15x were analyzed using Variant Studio 3.0 software (Illumina). Evaluation of variants was firstly restricted to those located in eight genes related to Fahr’s disease (SLC20A2, PDGFRB, PDGFB, XPR1, KRIT1, SLC19A3, TREX1, MYORG). We reached 99.9% with at least 10X coverage for the patient. A search tool for the retrieval of interacting genes/proteins (STRING, ) was used to construct the protein-protein interactions that are involved downstream and upstream in Fahr’s syndrome (GNAS, ERCC8, PDGFB, CYP2U1, GNA11, SLC20A2, IFIH1, PSMB8, PDGFRB, CA2, ERCC6, SAMHD1, TREX1, CASR, TREM2, TYROBP, GJA1, ERCC3, FAM111A, RNASEH2B, SLC46A1, SLC7A7, ATP13A2, PARK7, HMBS, KRIT1). No causative mutations were found in the selected genes in the patient.
Computerized tomography scans of the heads of the patient’s parents were normal.
The patient was treated symptomatically with quetiapine sustained release (initially 200 mg and gradually increasing to 900 mg daily) and sertraline (150 mg daily, gradually increasing to 200 mg daily). We did not observe any side effects with the use of quetiapine, although special attention was given to the possible exacerbation of extrapyramidal symptoms. Psychotic (PANSS scores at discharge were 8/13/27, PANSS scores after two years were 9/16/34 for the Psychotic, Negative and General Psychopathology Scale, respectively), affective and behavioral symptoms were improved; she was no longer suicidal and remained stable on gradually increasing doses of antipsychotic medication within two years of treatment, however, her intellectual abilities were not improved. Even though the patient completed secondary professional education and intense professional rehabilitation efforts were made, she has not been able to start working, mainly due to emotional instability. The patient was transferred to adult psychiatric services at the age of 21.
|
pmc-6371506-1
|
A 58-year-old (gravida 2, para 2) woman presented the nearby hospital complaining of persistent defecation disorder and vomiting. Although her family history was notable for pancreatic cancer in her father, there was no other familial history of cancer, including breast and ovarian cancer. Her past medical history is unremarkable. Her past surgical history includes right ovarian cystectomy for a dermoid cyst at the age of 30. A computed tomography (CT) scan showed a large pelvic tumor adjacent to the rectum. Laboratory findings showed that her serum level of cancer antigen (CA) 125 increased to 315.2 IU/ml. Magnetic resonance imaging (MRI) demonstrated that a 93 × 65 × 62 mm-solid tumor with cystic parts was located immediately dorsal to the rectum (Fig. ). CT and MRI showed no evidence of dissemination, lymph node metastasis, nor distant metastasis. Colonoscopy showed strong extrinsic compression at the rectum with intact mucosa; however, biopsy of the rectum and the tumor site was not performed during colonoscopy. Based on the MRI finding that a perirectal cystic tumor was present without peritoneal dissemination, stage IA ovarian cancer was suspected, and she was referred to our hospital for treatment. At laparotomy, the tumor was located dorsal to the rectum and existed entirely in the retroperitoneal space (Fig. a). There were no apparent lesions in the peritoneal cavity including bilateral adnexa, uterus, and peritoneum. Peritoneal washing cytology was negative. After bilateral salpingo-oophorectomy and total abdominal hysterectomy, en bloc resection of the retroperitoneal tumor together with lower anterior resection of the rectum was performed (Fig. b). Whereas the tumor was adhered to the rectal wall, the tumor itself was relatively well-capsulated and easily separated from surrounding fat tissues. Based on pathological diagnosis of the retroperitoneal tumor: high-grade serous carcinoma, she received 6 cycles of adjuvant chemotherapy with carboplatin, paclitaxel and bevacizumab according to the standard treatment strategy for ovarian cancer. After the combination therapy, bevacizumab was administered for 3 cycles of tri-weekly maintenance therapy but was discontinued because of general fatigue. She has been alive without evidence of recurrence for 20 months since her initial surgery.
Macroscopically, the retroperitoneal tumor measured 80 × 55 × 35 mm in size and was divided into solid and cystic parts. The rectum and the peritoneum separated the tumor from the peritoneal cavity (Fig. c). The cyst part covered with a thick wall included bloody serous fluid. Removed genital organs (e.g. uterus, fallopian tubes, and ovaries) presented no abnormal gross findings except for uterine fibroids. Microscopically, a cyst wall which was composed of fibrous tissue contained hemosiderin-laden macrophages. A solid part of the tumor, characterized by extensive atypical nuclei and lace-like pattern by coalescence of papillae, revealed high-grade serous carcinoma (Fig. a). Although the tumor was invasive into rectal mascularis propria and adjacent fat tissues, the surgical margin, peritoneal invasion, and lymphovascular involvement were negative. In addition, neither cancer metastasis nor endosalpingiosis were identified in the lymph nodes in the adjacent fat tissue. There were no invasive lesions in genital organs but STIC lesion was detected at the right fallopian tube (Fig. d).
The cells of the retroperitoneal tumor and STIC were immunohistochemically positive for p53 (Fig. b & e). Ki-67 was diffusely and partially positive in the tumor and STIC lesions, respectively (Fig. c and f).
The retroperitoneal tumor sample was immediately separated from surgical specimen, embedded in Tissue-Tek O.C.T. compound (Sakura Finetek) in a Tissue-Tek Cryomold (Sakura Finetek), and frozen in liquid nitrogen. Serial 8-μm-thick frozen sections were mounted on MMI Membrane Slides (Molecular Machines & Industries), fixed with 100% methanol, and stained with toluidine blue. We performed laser-microdissection (LMD) using the MMI CellCut system (Molecular Machines & Industries) to isolate tumor cells [], followed by DNA extraction.
Somatic mutations were investigated by target gene sequencing in the retroperitoneal tumor. We selected 120 genes that were frequently mutated in ovarian and endometrial cancers from the TumorPortal website [, ] and involved in the homologous recombination repair pathway. We performed target sequencing of the 120 genes with a pool and capture method described in our previous study [, ]. The DNA libraries from the retroperitoneal tumor and the peripheral blood samples were sequenced via Illumina HiSeq 2500 platform in a rapid run mode with a 2 × 100 bp paired-end module. Referring to sequencing data from peripheral blood as a control, we called somatic mutations using Strelka software [].
Somatic mutations detected in retroperitoneal tumor were listed in Table . Among six non-silent somatic mutations, a mutation of TP53 (c.536A > G, p.179H > R) showed the highest mutant allele frequency (MAF) of 0.94. A nonsense mutation of BRCA2 (c.6385G > T, p.2129E > X) also showed high MAF of 0.84. The MAFs of these two mutations were significantly higher than 0.5 (binomial test, P < 0.0001), suggesting the presence of either loss-of-heterozygosity events or homozygous mutations at these sites. We detected no obviously pathogenic mutations in the patient’s germline data obtained by sequencing for her blood cells.
To explore the genetic relevance between the retroperitoneal tumor and STIC lesion, deep sequencing was performed focusing on the two variant sites (TP53: c.536A and BRCA2: c.6385G) which were the most dominant in the retroperitoneal tumor. To obtain the STIC lesion, LMD was also performed using formalin-fixed paraffin-embedded (FFPE) tissue sections of 10-μm thickness. For LMD experiment, one per ten serial slides (n = 1, n = 11, etc.) was immunostained for P53. DNA samples derived from the retroperitoneal tumor and STIC were amplified by PCR reactions using the following oligonucleotide primers. Forward and reverse primers for TP53 c.536A > G [p.179H > R] were 5’-CTGCTCACCATCGCTATCTG-3′ and 5’-CACATGACGGAGGTTGTGAG-3′, respectively. For BRCA2 c.6385G > T [p.2129E > X], forward and reverse primers were 5′- CTGCTCACCATCGCTATCTG-3′ and 5’-CACATGACGGAGGTTGTGAG-3′, respectively. The PCR products were subjected to a deep sequencing via Illumina MiSeq v2 platform with a 2 × 150 bp paired-end module. The tag counts of paired-end sequences supporting the reference and mutant alleles were measured by using only high confidence base calls (base quality > 20) at the mutation sites.
As a result, the somatic mutations of TP53 and BRCA2 were shared between the retroperitoneal tumor and STIC lesion (Table ). The MAFs of these two mutations were lower in STIC lesion. There is a possibility that STIC lesion was inadequately isolated from surrounding normal tubal epithelium, stroma and infiltrating immune cells through LMD, because the area of STIC lesion was limited.
|
pmc-6371517-1
|
A 63-year-old male with no history of trauma or prior neurological disease presented with 3 days of intermittent dizziness and vomiting. On the second day, the patient was examined by a head computed tomography (CT) scan, and no abnormal changes were found. Five days later, the patient had a sudden onset of weakness in his right limbs, followed by an episode of focal seizure without impaired awareness. The patient had symptomatic deep venous thrombosis (DVT) in the left lower limb 4 years ago, which was treated with warfarin for 3 months. No secondary prophylaxis was subsequently applied, and as a result he experienced multiple recurrences of lower limb DVT. The patient also had a 5-year history of hypertension without antihypertensive therapy. He also had a 2-year history of Raynaud’s phenomenon in his hands, as well as a 30-year history of smoking (10 cigarettes per day) and alcohol intake (50 g per day). The patient’s parents had died of ICH. Additionally, the patient’s three sisters were diagnosed with hypertension, and one brother had a history of occlusion of the distal artery in the right leg at the age of 55 years. The patient’s son had their first symptomatic lower limb DVT at the age of 25 years, for which he underwent inferior vena caval filter placement.
Upon examination after admission, the patient had a blood pressure of 164/92 mmHg. Skin color, temperature, and peripheral pulses were normal. No varicose veins or swelling of the limbs were found, and the lung and heart examinations were normal. The patient was fully alert and oriented, with no signs of cognitive impairment, thus neurocognitive tests were not performed. Results of the cranial nerve and sensory examinations were normal. Motor examination revealed spastic tone and moderate pyramidal weakness in the right arm and leg (4/5), with a total NIHSS score of 2. Repeated head CT plain scans (Fig. a) and brain magnetic resonance imaging (MRI) plain scans (Fig. b) showed acute hematomas in the bilateral parietal lobes, and a cerebral infarction with hemorrhagic transformation in the left frontal lobe. Except for the hemorrhages visible on the head CT, brain susceptibility-weighted imaging (SWI) showed neither venous malformations nor CMBs (Fig. c). Brain diffusion-weighted imaging (DWI; Fig. d, first two images) and contrast-enhanced MRI (Fig. d, last two images) confirmed the cerebral infarction with hemorrhagic transformation in the left frontal lobe. The degree of white matter hyperintensity (WMH) on fluid attenuated inversion recovery (FLAIR) imaging was moderate (Grade II on the Fazekas scale). The results of brain magnetic resonance angiography (MRA) and magnetic resonance venography (MRV) without contrast were normal. On the second day after admission, cerebral digital subtraction angiography (DSA) was performed, with results showing no abnormalities in the arterial phase, venous phase, or venous sinus phase.
Routine laboratory tests showed normal results except for elevated levels of serum creatinine (152.18 μmol/L), homocysteine (52.33 μmol/L), total cholesterol (5.71 mmol/L), low density lipoprotein cholesterol (3.77 mmol/L), and plasma D-Dimer (3.52 μg/ml). Serum tumor markers were negative. The results of hereditary thrombophilia screening revealed an obviously decreased activity of plasma protein S (41.2%). The patient’s son and daughter also underwent tests for plasma protein S activity, and both showed decreased activity (15.2 and 10.0%, respectively). Cardiac workup including color Doppler echocardiography and Holter monitoring revealed no abnormalities. Chest CT plain scans showed no lung abnormalities. The results of cerebrospinal fluid analysis were within normal limits, with no evidence of viral, bacterial, or fungal infections. Doppler ultrasonography revealed residual venous thrombosis in the right popliteal and posterior tibial veins. Affected leptomeningeal and cortical biopsies were further performed after an informed consent form was obtained from the patient. Hematoxylin and eosin staining revealed no inflammatory changes in the blood vessels. When stained with Congo red and viewed under a polarizing microscope, no amyloid deposition in the vessel walls was found.
Finally, the patient was diagnosed with MCVD, hypertension, hereditary protein S deficiency (PSD), hyperhomocysteinemia, and hypercholesterolemia. Following treatment with antihypertensive drugs, folic acid, vitamin B12 and statins, the patient’s blood pressure and levels of serum homocysteine and cholesterol were controlled to within the normal range. Their modified Rankin Scale (mRS) score was 2 at discharge. Warfarin was administered as a secondary prophylaxis for venous thromboembolism 2 months after the onset of stroke; however, the patient did not adhere to the monitoring scheme of blood coagulation function. Therefore, antiplatelet therapy with clopidogrel was given as an alternative, due to the patient’s refusal of other oral anticoagulants. Consequently, he occasionally had symptomatic recurrence of lower limb DVT during the 5-year follow-up period, yet with no recurrence of ICH nor CMBs visible on the follow-up head SWI. The degree of WMH was steady at Grade II on the Fazekas scale, and the mRS score was maintained at 2 during the follow-up, with no clinically apparent cognitive impairment. The patient also suffered hoarseness starting at the age of 66 years; a laryngoscope was performed at that time with no abnormalities found. About 1 year later, the patient had dry cough and received a chest CT exam due to an episode of hemoptysis, and a mass in the upper lobe of the left lung was discovered. He was subsequently diagnosed with lung cancer, and the patient died of the disease at 68 years of age.
|
pmc-6371540-1
|
Ms. C is a 73-year-old woman diagnosed with uveal melanoma in 2014 and initially treated with proton beam radiation therapy. Magnetic resonance imaging (MRI) conducted in November 2015 as part of disease surveillance confirmed liver metastases. The patient’s past medical history included angiomyolipoma of the kidney, uterine leiomyoma, obstructive sleep apnea, and enthesopathy in the hip, Achilles tendinitis, and arthritis, and she had been previously treated with a bone graft. Her medications were notable for estradiol-norethindrone, and trazodone. She had allergies to gabapentin, and had no family history of inflammatory bowel disease or GI malignancy.
Her liver metastases were initially treated with pembrolizumab every 3 weeks beginning in December 2015. Selective internal radiation therapy (SIRT) was performed via the right hepatic artery. In April, 2016, after the 5th cycle of pembrolizumab, positron emission tomography computed tomography (PET-CT) scans found new pulmonary metastases. Pembrolizumab was discontinued for progression, and she began ipilimumab 3 mg/kg as second line immunotherapy on April 29th. One day prior to starting ipilimumab, she was seen in the emergency department with new onset paroxysmal atrial fibrillation for which she was started on metoprolol and apixiban. Following her second dose of ipilimumab, she developed epigastric pain and symptoms of gastric reflux, both of which were unresponsive to high dose proton pump inhibitors (pantoprazole 40 mg twice daily) and Carafate. She also had new onset, mild diarrhea with 3–4 loose stools daily. Esophagogastroduodenoscopy and flexible sigmoidoscopy were performed to inform further treatment. The esophageal, gastric and duodenal mucosa appeared normal on endoscopic examination without evidence of ulceration, or other significant mucosal injury (Fig. a and b). Gastric biopsies demonstrated lymphocytic inflammation surrounding pigmented cells scattered throughout the gastric mucosa (Fig. . c and d). S100 and SOX10 immunostains confirmed multiple microscopic foci of melanoma with tumor associated inflammation resembling gastritis (Fig. . e and f). Flexible sigmoidoscopy and colonic biopsies were normal.
Glucocorticoid treatment was initially deferred as this was considered an appropriate antitumor response, and she received her third dose of ipilimumab. After the 3rd dose, she developed an elevation in her transaminases and bilirubin concerning for checkpoint hepatitis. She was started on glucocorticoids and further immunotherapy was held. Her hepatitis resolved on glucocorticoids. Her gastric symptoms also improved on glucocorticoid therapy consistent with an immune-mediated mechanism. The patient ultimately died from complications of her melanoma six months after starting ipilimumab.
|
pmc-6371586-1
|
A 35-year-old African male refugee from Eritrea arrived in Switzerland in 2015, after several months of a migratory route through Sudan, Libya, and Italy. This former member of the Eritrean military left his country and exiled himself in Switzerland because of the Eritrean political conflict and for personal security. He is married and has three children in good health. One year after his arrival and during a routine appointment with his primary care physician, he complained of a soft and slightly painful tissue swelling in his right buttock, localized on a previous scar. He mentioned that in 2001 in Eritrea he submitted to surgery several times for recurrent abscess on his right buttock. He was otherwise in good health, had no tobacco smoking or drinking habits, and no regular treatment.
On physical examination, he had a visible scar approximately 20 cm on the lateral side of his right buttock. On the medial level, the presence of deep indurated exophytic nodules with some visible openings and spontaneous drainage were noted, which suggested an abscess (Fig. ). He was afebrile and no lymphadenopathy was found.
He was referred to the Department of Dermatology at the University Hospital of Lausanne for further investigation. A punch biopsy was performed and during that procedure a sanguinolent discharge was witnessed with conglomerates of small and rather firm blackish pellets, evoking eumycetoma. Tissue and black grain samples were sent for biological and histological evaluation. These revealed chronic suppurative inflammation in the presence of histologic fungal aspects (Figs. and ). The infectious agent could not be determined exactly at that time, however, the black colored grains indicated a probable Madurella mycetomatis infection. A second biopsy was needed and these samples were negative on bacterial culture and positive for fungal culture of Madurella mycetomatis, which grew in 2 weeks.
To determine the precise depth of the buttock lesions, a magnetic resonance imaging examination of his pelvic area was performed. This examination identified a pseudotumoral infiltration of the cutaneous and subcutaneous tissue into the gluteal muscular plane of the paramedian part of his left buttock compatible with a mycetoma without bone extension (Figs. and ).
We considered several differential diagnoses of mycetoma such as: recurring epidermal cyst of gluteal region, hidradenitis suppurativa (Verneuil’s disease), pilonidal cyst, cutaneous tuberculosis, profound mycosis, leprosy, and cutaneous metastatic lesions.
He was initially treated with orally administered itraconazole at a dosage of 400 mg once daily for 3 months, which was well tolerated. After antifungal therapy, the lesions did not improve substantially and he had surgical debridement of the lesions followed by a double cutaneous-subcutaneous transposition flap (Fig. ).
After surgical removal of the lesions, treatment with itraconazole was continued to achieve a total length of 6 months. An ultrasound of his buttock was performed 3 months after the surgery and two residual mycetomatic nodules were identified: one situated at the surgical scar with a size 0.7 × 0.6 cm; and a second one at the intergluteal region with a size of 0.8 × 0.45 cm. Both remained asymptomatic and he did not develop any further lesions at 12 and 24 months after surgery.
|
pmc-6371588-1
|
A 50-year-old Caucasian female, with no previous smoking history or pancreatic cancer family history, presented to our clinic for surgical evaluation of a biopsy-proven PDA noted at the junction of the body and tail of the pancreas. The patient had previously undergone a classic pancreaticoduodenectomy (Whipple) procedure with concurrent hemicolectomy 6 years prior (in 2011) for a T3N0M0 adenocarcinoma of the pancreatic head that had invaded the mesentery of the proximal transverse colon. After the 2011 surgery, pathology revealed a poorly differentiated PDA along with a PanIN grade 2. The final pathology showed negative surgical margins, positive perineural spread, and 0/33 specimen lymph node involvement. From June 2012 to October 2012, the patient underwent and completed adjuvant chemotherapy with gemcitabine, capecitabine, and radiation at an outside hospital. She was carefully followed by her medical oncology team with serial CA 19-9 monitoring and abdominal MRIs on an ongoing basis. Due to her young age, in 2011, she underwent genetic screening and no germline mutations were identified. Since the time of the primary resection, the patient had been high functioning and healthy, with the exception of some problems of early satiety and recurrent cholangitis. These sequelae were attributed to close proximity of the gastrojejunostomy and hepaticojejunostomy, with possible reflux of intestinal contents up the afferent limb, all partially managed by diet changes.
In 2017, a biannual screening MRI with intravenous contrast showed a new pancreatic lesion measuring 2.3 × 2.2 cm in the tail of the pancreas (). Esophagogastroduodenoscopy and endoscopic ultrasound-guided biopsy identified it as a poorly differentiated adenocarcinoma. From 2011 to 2017, she had had close followup with serial CA 19-9, and a measurement of this marker after identification of the lesion on MRI showed an elevation, which was confirmed on repeat testing (61 and 55 U/mL; normal <37 U/mL). This was the first instance of two consecutive CA 19-9 measurements outside of the normal range since resection of the primary cancer 6 years prior. When the patient presented to our institution a few months later, the CA 19-9 had returned to normal at 32 U/mL (), and there was a moderate increase in CEA (16.9 ng/mL; normal <3 ng/mL). The patient received a second MRI of the abdomen and pelvis with contrast to identify distant disease, which showed the lesion to be confined to the pancreas. Along with the MRI of the abdomen, a CT of the chest was preformed, which showed no gross metastatic lesions. A completion pancreatectomy was scheduled with revision and lengthening of the jejunal limb proximal to the gastrojejunostomy to resect the tumor and treat her episodes of early satiety and recurrent cholangitis.
Intraoperatively, the patient's three Whipple anastomoses were noted to be grossly intact and there was no evidence of metastatic disease. First, the stomach was divided approximately two centimeters proximal to the prior gastrojejunostomy. The jejunostomy was closed, and gastrocolic and gastrosplenic ligaments were divided. The splenic artery was ligated, and the splenocolic ligament was divided. The spleen and pancreas were mobilized out of the retroperitoneum. The jejunum was divided between the pancreaticojejunostomy (PJ) and hepaticojejunostomy. The proximal jejunum, prior PJ, remaining pancreas, and spleen were removed. The tumor was noted to be grossly confined to the pancreas. The distal end of the stomach was delivered through the mesocolon and a retrocolic gastrojejunostomy was undertaken 60 cm downstream from the hepaticojejunostomy. The anatomy before and after this operation is shown in .
The patient tolerated the procedure well and had an uncomplicated hospital course. The patient was closely followed postoperatively and did well. She completed two cycles of adjuvant chemotherapy with gemcitabine and capecitabine from January 2018 to April 2018, but did have some neutropenia at the end of her adjuvant therapy requiring pegfilgrastim. Her intermittent fevers, early satiety, and abdominal pain resolved after the surgery. She became an obligate insulin-dependent diabetic after the completion pancreatectomy procedure and now requires exogenous pancreatic enzymes to support her nutrient absorption.
The specimen was found to be consistent with a poorly differentiated invasive adenocarcinoma. Resection margins were negative, and 2 of 17 lymph nodes were positive for metastatic cancer. We sent representative slides of the patient's 2017 tumor and 2011 tumor to Perthera (McLean, VA) for next-generation sequencing (NGS) and histological analysis, which tested for mutations in a total of 315 genes and stained for various predictive biomarkers (). Both lesions showed the same mutations in KRAS (G12R), CDKN2A (splice site 151-1 G to A), and TP53 (Y220C). In addition, her 2011 tumor had a mutation in ACVR1B (S4) that was not present in the 2017 tumor, and the 2017 tumor had amplifications of MYC and mutant KRAS that were not present in the 2011 tumor (). Upon histological analysis, staining for MLH1, MSH2, MSH6, PMS2, pAKT, and HER2 was similar in both samples, but in the 2017 tumor, there was 60% increased staining for RRM1 and 20% increased staining for ERCC1, which changed the classification from low to high staining for ERCC1.
|
pmc-6371595-1
|
A 72-year-old retired male engineer was diagnosed with two pancreatic lesions, one measuring 2 cm at the head of the pancreas and the other measuring 1.5 cm at the tail of the pancreas. Endoscopic ultrasonography with biopsies confirmed pancreatic adenocarcinoma in both lesions.
The patient underwent seven cycles of neoadjuvant chemotherapy with FOLFIRINOX followed by total pancreatectomy (). The specimen pathology revealed two foci of moderately differentiated pancreatic adenocarcinoma with perineural invasion, but no lymphovascular invasions. Largest dimension was 1.4 cm in the tail of the pancreas and 1.3 cm in the head of the pancreas. Margins were negative and 25 lymph nodes were benign. The patient was initially started with exogenous pancreatic enzyme supplements and long-acting insulin in the hospital and was transitioned to an insulin pump postoperatively. The patient was followed by endocrinology pre- and postoperatively where insulin pump education was given before pancreatectomy. The patient's preoperative HbA1c was 5.9%, 3-month postoperative HbA1c was 7.9%., and 3-year postoperative HbA1c was 7.0%. He remains disease free at 3 years and 3 months with a normal CA-19-9. The patient has been able to easily manage his insulin pump to control his blood glucose levels.
|
pmc-6371611-1
|
A 60-year-old man was admitted for a 1-month history of paroxysmal left periorbital pain accompanied by various symptoms, including left ptosis, blurred vision in the left eye, and diplopia during each episode. Episode duration ranged from minutes to hours. The patient suffered from one to three attacks per day, and his condition continued to worsen. He had visited an oculist, and his visual acuity, visual field and intraocular pressure were normal. The patient had been diagnosed with hypertension 2 years prior and subsequently began taking extended-release nifedipine tablets. He denied any history of chronic headache, trauma or preliminary infection.
At admission, neurologic examination produced unremarkable findings during symptom remission. By 7 days after admission, the patient had suffered 6 episodes, which are summarized in Fig. . The patient’s symptoms were due to impairment of different combinations of multiple cranial nerves (CNs), including the oculomotor nerve (CN3), the first division of the trigeminal nerve (CN 5–1) and the optic nerve (CN2), restricting the location of the lesion to the regions from the posterior cavernous sinus to the orbital apex.
Results for routine blood tests, erythrocyte sedimentation rate (ESR), rheumatoid factor and C-reactive protein were normal. Negative results were obtained for all tests for autoimmune antibodies and ultrasound assessments of temporal arteries. Lumbar puncture was performed with a pressure of 210 mmH2O, and tests revealed normal findings for cell counts, protein, and glucose as well as negative PCR results for herpes simplex virus type 1 and 2, cytomegalovirus, and EB virus. Computed tomography (CT) and contrast magnetic resonance imaging (MRI) revealed that brain structures, the orbital cavity, the cavernous sinus, and optic nerves were normal.
Because the patient’s symptoms could disappear rapidly, even within minutes, angiopathy was considered. Computed tomography angiography (CTA) showed normal imaging of cervical and cerebral vessels and no tortuous vessels in the cavernous sinus. Transcranial Doppler ultrasonography (TCD) demonstrated an abnormal spectrum for the bilateral ophthalmic arteries (OA) with decreased PI and high flow velocity in the left OA. Ultimately, DSA confirmed bilateral CCF and shunts to the cavernous sinus from bilateral branches of the ICA and ECA (Fig. ).
A microcatheter was passed through the left inferior petrosal sinus into the cavernous sinus, and Onyx, an embolic agent, was placed in the cavernous sinus for occlusion. Simultaneously, DSA was performed to ensure complete closure of the CCF without residual arteriovenous shunting (Fig. ). The patient’s symptoms disappeared completely during more than 1 year of follow-up.
|
pmc-6371830-1
|
A 59-year-old asymptomatic female patient, with a diagnosis of a large bilateral
coronary-pulmonary artery fistula made in 2007 was investigated after a cardiac
murmur was identified on a routine examination. At the time, conservative treatment
was chosen. Cardiac auscultation showed a more audible systolic-diastolic murmur in
the upper left sternal border, with a more audible component in systole. There were
no other findings in the cardiological physical examination or even the overall
segmental examination. The patient had no comorbidities at the time, except for a
prior history of smoking (10-pack-years). During the evolution, at the annual
outpatient follow-up, she had diagnoses of dyslipidemia, glucose intolerance and
depression. At the last consultation, in 2017, the patient was asymptomatic. She
used atenolol 25 mg/ day, metformin 850 mg/day, atorvastatin 20 mg/day and
sertraline 50 mg/day.
The examinations performed after 10 years of follow-up were compared with those at
the time of diagnosis. The current echocardiogram showed right coronary (RC) with 4
mm of diameter at the origin and 7 mm in the middle third; the left main coronary
artery (LMCA) with 8 mm. The patient had a fistulous trajectory with tortuous flow
communicating both coronaries with the pulmonary trunk, without the presence of
pulmonary hyperflow. Additionally, the evolution of mitral regurgitation showed to
be of an important degree. shows the
echocardiographic parameters during follow-up.
Myocardial scintigraphy with dipyridamole and 99m-technetium-sestamibi showed no
changes in perfusion, as well as the previous examinations performed in 2007 and
2011. The ergospirometry treadmill test (modified Balke protocol, 3.4 mph), lasting
7 minutes and 38 seconds, was maximal (109% of maximal HR), with VO2 peak
of 22.4 mL/kg/min (87% of predicted VO2).
The angiotomography of the coronary arteries was performed in 2017 and the comparison
with the 2007 examination can be seen in . The finding of a systemic-pulmonary fistula persists, in the RC + ADA
with the LMCA, described as the presence of a high-caliber branch emerging from the
right coronary artery origin, with a tortuous trajectory, surrounding the pulmonary
trunk anteriorly and communicating with the proximal third of the anterior
descending artery. It shows communication with the pulmonary trunk, associated with
two aneurysms along its trajectory, measuring 19x16 mm and 14x13 mm. There is no
pulmonary dilation or other signs suggesting hemodynamic repercussion. Total
coronary calcium score of 246 (Agatston), corresponding to the 99th
percentile for the age group and gender, and absence of significant coronary luminal
reduction were also observed.
|
pmc-6372249-1
|
We describe a 39-year-old male with a diagnosis of pulmonary tuberculosis who presented with progressive asymmetric weakness, pain, tingling and numbness in the lower extremities over the past year. The patient was diagnosed with pulmonary tuberculosis five years ago and was treated for a total duration of 26 months for multidrug resistant (MDR) TB. His past medical history was significant for vitamin B12 deficiency and a deep vein thrombosis of the left femoral vein extending down to the popliteal vein.
On examination, lower extremity reflexes were absent. Significant atrophy and severe weakness of the lower extremities was evident. The sensory examination was significant for marked hyperesthesia and loss of pinprick and proprioception sensation of the lower extremities. The patient had a positive QuantiFERON-TB Gold test (QIAGEN Inc., MD, USA). His sputum was positive for acid fast bacilli (AFB) on presentation. Chronic inflammation markers including erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) were elevated. Nerve conduction studies showed evidence of severe axonal sensorimotor polyneuropathy. Electromyography (EMG) suggested acute and chronic denervation of all the lower extremity muscle groups with normal findings in the upper extremities. A biopsy of the sural nerve demonstrated small vessel leukocytoclastic (allergic) vasculitis with intrusion of the epineural and perineurial vessel walls by leukocytes and eosinophils, vascular luminal obstruction, and resulting considerable active Wallerian/axonal degeneration. There was no granuloma formation as seen in Figures -. A gastrocnemius muscle biopsy showed significant angular fiber atrophy with target fiber changes, consistent with acute/sub-acute denervation.
Workup for other etiologies resulting in vasculitis such as Wegener's disease, autoimmune/connective tissue disorders, cryoglobulinemia and HIV-related vasculitis were all negative. The patient was then treated with anti-tuberculosis medications and immune modulating agents (steroid and Rituxan). There was modest improvement of the weakness in his lower extremities.
|
pmc-6372251-1
|
A 55-year-old intoxicated homeless man presented to the hospital with a cough and chest pain. His past medical history was notable for chronic alcoholism and untreated latent tuberculosis, based on a positive interferon-gamma release assay three years prior to presentation. He had worked as a car mechanic. He smoked half a pack of cigarettes daily and drank a few beers every day. He denied illicit drug use. He reported concern of a cough productive of a moderate amount of yellow sputum that is occasionally streaked with blood. He had the cough for about four weeks with no improvement. His cough was associated with dyspnea on exertion, pleuritic chest pain, chills, night sweats, and a 10-pound weight loss over the past few months.
The patient’s vital signs revealed a temperature of 98.2°F, a heart rate of 92 beats per minute, a respiratory rate of 18 breaths per minute, and a blood pressure level of 96/55 mmHg. His oxygen saturation was 98% breathing ambient air. The patient’s lung examination revealed normal work of breathing and decreased breath sounds on the left lung fields without wheezing, crackles, or rhonchi. The results of his cardiac, abdominal, and neurological exams were all within the reference range. No lymph nodes were palpated. Results from the laboratory workup included a complete blood count and comprehensive metabolic panel, both of which were within the reference ranges. The findings of his chest radiography were unremarkable. Figure represents the initial presentation of the patient three months ago and Figure represents the computed tomography scan of his chest that revealed bilateral ground-glass opacities involving all lung lobes; the largest measured 5.7 cm in diameter.
The patient was placed in respiratory isolation, and an empiric antibiotic therapy was started to cover community-acquired and aspiration pneumonia. Sputum stain tests for acid-fast bacilli were negative on three consecutive days, and respiratory isolation was discontinued. A Gram stain showed normal respiratory flora. Urine legionella and histoplasma antigen test results remained negative. The results of Streptococcal antigen, Aspergillus antigen, and Fungitell® assays were negative. Human immunodeficiency virus (HIV) serology, anti-nuclear antibody, rheumatoid factor, and antineutrophilic cytoplasmic antibody workup results were negative. The erythrocyte sedimentation rate and complement levels were within reference range. His immunoglobulin panel showed an elevated immunoglobulin E (IgE) level at 3309 IU/mL, a low immunoglobulin G (IgG) level at 601 mg/dL, and a low immunoglobulin M (IgM) level at 25 mg/dL. Immunoglobulin A (IgA) levels were within reference range, and the levels were checked again during follow-up and they were completely normal. Initial decrement in levels might be due to the patient's ongoing illness. The patient underwent a surgical lung biopsy. Pathology testing revealed pulmonary fibrosis, reactive alveolar changes, granulomatous inflammation with focal calcifications, positive fungal stains, a mucicarmine rich capsule, and morphology consistent with cryptococcal infection. There was no evidence of malignancy or vasculitis. On the sixth hospital day, empiric antibiotic therapy with ceftriaxone, azithromycin, and metronidazole was discontinued in favor of treatment specific for cryptococcal pneumonia—14 days of intravenous amphotericin B and oral flucytosine. Following induction, the patient was discharged on oral fluconazole, to continue for six to 12 months. Outpatient follow-up was scheduled with the infectious diseases and immunology clinics. The patient was lost to follow-up after a one-time show-up in the medical clinic.
|
pmc-6372255-1
|
A 47-year-old-female with shortness of breath had an incidental anterior mediastinal mass that was discovered on chest CT (Figure ).
It was decided that the mass should be biopsied for identification of cell type. However, several surrounding structures, including the sternum anteriorly, left internal mammary artery laterally, main pulmonary artery and aorta posteriorly, and right lung laterally, made it difficult to access the mass (Figure ).
A BioPince® (Argon Medical Devices, Frisco, Texas) biopsy device was used to sample the mass (Figure ).
A parasternal approach was used to access the mass just lateral to the sternum on the left (Figure ).
Three 18 gauge 2.3 cm core biopsy specimens were passed off to cytopathology for immediate analysis. The patient then reported to have acute shortness of breath, chest tightness, diaphoresis, along with decreased blood pressure associated with cardiac tamponade. A repeat CT image of the chest revealed copious amounts of blood within the pericardium (Figure ).
The interventional operator quickly decided to place a six French pig tail catheter within the pericardium to drain the blood in the pericardium (Figure ) and 180 ml of unclotted pericardial blood was rapidly removed.
The patient’s vitals were stabilized and the patient further reported relief of her symptoms. The pigtail catheter was connected to a low suction drainage bulb, which demonstrated slow continuous drainage. Drainage ceased after 24 hours with a total output of 300 mls. Forty-eight hours later, a CT angiogram showed no significant pericardial effusion remaining (Figure ).
The pigtail catheter was removed and the patient was discharged home at 72 hours.
|
pmc-6372518-1
|
A 37-years-old male caught our attention due to the onset of progressive gait difficulties caused by a rigidity and weakness affecting both legs from the age of 35. At the time, he complained of urinary urgency with incontinence and erectile dysfunction. His family history was negative for neurological or endocrinological diseases. He had normal psychomotor development without learning disabilities and did not report cognitive symptoms. The neurological examination (NE) showed mild dysarthria, spastic paraparesis with a wide-based spastic gait. Deep tendon reflexes were diffusely brisk with a bilateral Achilles clonus and Babinski sign. A brain magnetic resonance imaging (MRI) scan showed multiple congenital brain development defects (): posterior commissure agenesis, right fornix, and ipsilateral mammillary body hypoplasia, colpocephaly, right frontal parasagittal cortical thickening, two periventricular nodular heterotopic foci in the right parietal areas, and two venous drainage abnormalities in the left cerebellar hemisphere and right frontal lobe, respectively. A neuropsychological evaluation revealed no abnormalities. Electroencephalography (EEG) did not show any epileptiform discharges. A spinal MRI showed spinal cord atrophy. Electromyography (EMG) did not reveal any abnormal finding. Somatosensory evoked potentials (SEPs) showed increased central conduction time from the right arm and the left leg. No response was recorded from the right leg. Motor evoked potentials (MEPs) were absent in both legs. Visual evoked potentials (VEPs), and optic coherence tomography (OCT) were unremarkable. We used a multi-gene panel for hereditary spastic paraplegia and other motor neuron diseases (). Genetic analysis revealed the presence of the hemizygous mutation c.1394-2A > G in the ABCD1 gene, leading to the diagnosis of x-ALD. Hematochemical examination disclosed normal cortisol levels with an increased adrenocorticotrophic hormone (ACTH; 352 pg/mL, n.v. 5–60 pg/mL), consistent with subclinical adrenocortical insufficiency. VLCFA plasma levels were increased. A multi-gene panel testing for cortical development defects excluded other possible genetic causes ().
|
pmc-6372518-2
|
A 63-years-old male with a 6-years-long history of progressive gait impairment, received a diagnosis of Addison's disease at the age of 13, and had been chronically treated with cortone acetate from the age of 53. From the age of 57, he noticed a progressive tendency to drag both his feet, which is associated with orthostatic imbalance. His family history was negative for neurological or endocrinological diseases. Psychomotor development was normal and the patient did not report cognitive symptoms. On admission, NE showed diffuse skin pigmentation, and spastic paraparesis (right > left). The deep tendon reflexes were brisk with bilateral Achilles clonus, Babinski, and a right-hand Hoffman sign. Hematochemical investigations, including liver and renal functions, vitamin B12, folic acid, creatinine phosphokinase (CPK), thyroid hormone levels, and a complete screening for autoimmune disease, were all unremarkable. EMG excluded a peripheral neuropathy. SEP showed an increased latency in the central responses from the upper and lower limbs. No motor responses were recorded from the lower limbs. A brain MRI showed T2-hyperintensity of the corticospinal tracts (left > right) with a bilateral hypointensity of the pre-central gyrus in susceptibility weighted imaging (SWI) sequences. A spinal MRI showed atrophy of the spinal cord. Neuropsychological evaluation uncovered no abnormalities. Plasma levels of VLCFA were increased. Genetic analysis of the ABCD1 gene, disclosed the presence of the hemizygous base change c.761C > T, leading to the amino acid substitution p.(Thr254Met). This change is known in ClinVar, as likely pathogenic and classified pathogenic, according to the ACMG guidelines for variant classification, confirming the diagnosis of x-ALD. From the age of 65, the patient started to complain of a severe burning pain and painful dysesthesia affecting the lower limbs and feet. Within a few months, the pain rapidly became his main complaint impairing his quality of life. The patient was treated with common analgesics, gabapentin, amitriptyline, duloxetine, and cannabis without substantial improvement or side effects. High doses of pregabalin mildly attenuated the symptoms. EMG was repeated with negative results. Therefore, the patient underwent a skin biopsy. The immunofluorescence (IF) analysis () revealed a prevalently somatic SFN (). We repeated blood tests including hepatic and renal function, thyroid hormones levels, serological screening for infectious diseases, and a glucose challenge test. All tests turned out to be in range, excluding the presence of risk factors potentially associated with SFN (). His family history was negative for symptoms possibly related with SNF. We performed whole exome sequencing to search for the possible presence of concomitant mutations/variants in other genes that could explain the complex clinical phenotype. Among genes causing hereditary neuropathies, whole exome analysis identified only two heterozygous variants in SBF1 (c.3044G>A, p.Arg1015Gln-rs372268920) and WNK1 (c.2228C > T, p.Pro743Leu -rs528772088), genes with a very low allele frequency in the ExAC database (0.0003 and 0.0008, respectively). In both cases bioinformatics analysis predict likely deleterious effects on protein function. None of them are known in the ClinVar database. However, both genes are associated with recessive diseases: SBF1 with Charcot Marie Tooth disease type 4B3, () and WNK1 with a hereditary sensory and autonomic neuropathy, type 2 (). Therefore, the sole presence of these variants may somewhat contribute to the SFN phenotype, but cannot be considered pathogenic mutations. Furthermore, given the known relationship between WNK1 mutations and pseudohypoaldosteronism type 2 (), the endocrinological history was deepened, by searching for specific features (hypertension, hyperkalemia, or hyperchloremic metabolic acidosis). The patient had no antecedents of suggestive symptoms and repeated blood, and urine analyses never showed electrolytes or pH alterations.
The clinical and demographic characteristics of case 1 and 2 are summarized in , along with the results of the principal diagnostic investigations.
|
pmc-6372570-1
|
A boy, aged 4 months and 7 days (Subject 16, ) and suffering from recurrent diarrhea (7–8 times per day) of unknown etiology, was referred to our hospital. The boy was born in Central China (Hunan Province, Han Chinese) and was the first child of non-consanguineous parents. His birth weight was 3050 g after full-term gestation without any medical problem. When the boy was admitted to our hospital, his rectal temperature was 36.5°C, blood pressure was 130/90 mmHg, pulse rate was 163 beats/min, and breathing rate was 8 breaths/min. He had severe hyponatremia, metabolic acidosis, and anemia (). His urine analysis results showed proteinuria (), and his renal ultrasonography revealed that both his kidneys were small and exhibited mildly increased echogenicity. The patient progressed rapidly to end-stage renal disease (ESRD) at the age of 4 months and 12 days. The patient died at 4 months and 17 days.
|
pmc-6372699-1
|
A 46-year-old male presented to our institution complaining of hematochezia 1 month in duration. His past medical history included coronary vasospastic angina and diabetes mellitus that was treated with insulin. He drank socially and had a 50-pack-year smoking history, but had quit smoking 4 months prior. Abdominal examination including palpation was normal. The levels of carcinoembryonic antigen (4.2 ng/mL) and carbohydrate antigen 19–9 (13.2 U/mL) (commonly measured blood tumor markers) were normal. Colonoscopy revealed a polypoid lesion approximately 30 mm in diameter in the sigmoid colon 30 cm from the anal verge (Fig. a). Histopathological examination of a biopsy specimen revealed spindle-shaped cells exhibiting significant nuclear atypia and a trabecular proliferation pattern on hematoxylin-eosin staining. Immunohistochemically, the tissue was positive for SMA and desmin and negative for c-kit, DOG-1, CD34, and S-100. Furthermore, the Ki-67 index was > 50% (Fig. ). Contrast-enhanced computed tomography from the chest to the pelvis revealed a tumor 28 mm in diameter in the sigmoid colon and the absence of involved lymph nodes and any distant metastasis (Fig. b).
We diagnosed an LMS of the sigmoid colon without metastasis. We performed laparoscopic sigmoid colectomy and regional lymphadenectomy, following the concept of complete mesocolic excision and high-level central vascular ligation with curative intent for colon cancer patients. Laparoscopic surgery was performed with the aid of five trocars. The first trocar (12 mm in length) was placed in the umbilicus using an open method. Another 12-mm trocar was placed in the right lower abdomen, and three 5-mm trocars were placed in the left lower and either side of the abdomen (Fig. a). We identified the tattoo injected near the tumor before surgery (Fig. b). We dissected and mobilized the sigmoid colon by the medial-to-lateral approach in Toldt’s space and performed high-level central vascular (inferior mesenteric artery) ligation (Fig. c). The sigmoid colon was transected to remove a 10-cm tract margin from the tumor. After complete curative resection, a colorectal end-to-end anastomosis was created using the double-stapling technique (Fig. d). The tumor dimensions were 42 × 37 × 28 mm, and the surface was elastic and hard (Fig. a). The cross-section was white with a 5 mm peduncle (Fig. b). The epithelium was widely exfoliated, and the tumor per se featured trabecular proliferation of spindle cells with prominent anisonucleosis and nuclear atypia. The tumor involved the base of the muscularis propria, but was not continuous with the base. Therefore, the tumor was considered to have originated in the muscularis mucosa. All surgical margins, and lymph node vascular invasion status, were negative. Forty-four lymph nodes were harvested; no lymph node metastasis was detected. The tumor was of histological grade 2 by reference to the French Federation Nationale des Centers de Lutte Contre le Cancer (FNCLCC) system []; of stage IIA of the TNM classification of the 7th Edition of the American Joint Committee on Cancer (AJCC) system [], the 7th Edition of the Union for International Cancer Control (UICC) system, and a previously published surgical staging system [].
The postoperative course was uneventful, and the patient was discharged 9 days after the operation. He was followed-up every 6 months by contrast-enhanced computed tomography and every 12 months by colonoscopy; he did not receive adjuvant chemotherapy. There was no evidence of recurrence to 1.5 years after surgery. The clinical course of this patient is shown in Fig. .
LMS of the colon is often diagnosed later than LMS of the rectum. Therefore, only a few such patients can undergo laparoscopic surgery. We here report the first case of curative laparoscopic surgery to treat LMS of the colon.
LMSs originate from smooth muscle, which is widespread in the body; LMSs are most common in the retroperitoneum (including the pelvis), large blood vessels (principally the inferior vena cava), and the lower extremities []. Gastrointestinal LMSs of the colon are very uncommon, accounting for < 0.1% of all colorectal malignancies. Theoretically, LMSs can develop from both the muscularis propria and the muscularis mucosae; however, few reports on LMS origins have appeared. Although the muscularis propria contains more smooth muscle than the muscularis mucosae, a macroscopic polypoid LMS protruding inside the colon has often been reported []. Therefore, development of LMS from the muscularis mucosae (as in our case) may not be uncommon.
We searched the PubMed database using the MeSH terms “leiomyosarcoma” and “colon.” English-language reports published after 1998 investigating cases that were clearly immunohistochemically diagnosed as LMSs were selected. All cited references were also reviewed. The search yielded 197 publications, of which 26 were ultimately evaluated [–]. Table summarizes these data and our case. The patients included 16 males and 11 females of median age 57.5 years [interquartile range (IQR), 53–65.5 years]. Tumors were in the right colon in 14 cases, and the left colon in 13, most frequently in the sigmoid colon (9 cases). The median tumor diameter was 7 cm (IQR, 3.7–10.5 cm).
Surgery is the standard treatment for localized soft tissue and visceral sarcomas []. In all cases, surgery was performed, but no standard therapeutic strategy for gastrointestinal LMSs has yet been established. Lymph node metastasis of gastrointestinal LMSs is rather uncommon; however, lymph node dissection is advisable if this is not excessively invasive, because lymph node metastasis has been reported even in those with small poorly proliferating tumors [one such tumor was 1 cm in diameter and exhibited 18 mitoses/50 high-power fields (HPFs)] []. The standard chemotherapies for advanced soft tissue and visceral sarcomas are first-line anthracyclines, with doxorubicin-plus-dacarbazine as an alternative []. Presently, chemotherapy plays a limited role in LMS treatment. Factors prognostic of LMS are unclear because LMSs are rare, but tumor diameter ≥ 5 cm has been reported to be poorly prognostic []. Therefore, minimally invasive laparoscopic surgery should be performed only when LMSs are < 5 cm in diameter, as in our case.
|
pmc-6373029-1
|
The pedigree was shown in Fig. a. The proband (II-1) was a 28-year-old woman, who suffered a profound HL without any syndromic phenotype. She demonstrated a bilateral hearing loss at all frequencies and predominantly at middle to high frequencies, based on pure tone audiometry (PTA) test. The pure tone averages of 500 Hz, 1000 Hz and 2000 Hz were 97 dB HL in her both ears (see Fig. b). Impedance audiometry exhibited a typical A-type tympanogram for each ear. Temporal bone computerized tomography (TBCT) scans and magnetic resonance imaging-inner ear hydrography (MRI-IEH) did not find any obvious abnormality of middle or inner ear. Other associated symptoms were also not observed in the proband (II-1), including vestibular disorders (dizziness, vertigo, etc.), optic problems (blurred or distorted vision, eye pain, etc.), mal-development and intellectual disability. According to information provided by the family, II-1 had congenital HL but did not find obvious progression these years. No hearing or associated symptoms were found in the proband’s parents (I-1 and I-2) or brother (II-2). Her parents had consanguineous marriage. No deafness history was found in the last three generations of their family.
To identify the genetic cause of NSHL in this proband, we routinely applied a Sanger sequencing of four common HL-associated genes, including gap junction protein beta-2 (GJB2), gap junction protein beta-3 (GJB3), solute carrier family 26 member 4 (SLC26A4) and mitochondrially encoded 12S RNA (MT-RNR1). DNA preparation, PCR conditions and Sanger sequencing process were described previously []. The coding regions of GJB2 and GJB3, hotspot region (exon7–8 and exon19) of SLC26A4, and the full-length region of MT-RNR1 were carefully screened, only a homozygous variant, m.827A > G within MT-RNR1, was identified. However, previous studies reported conflicting interpretations of pathogenicity for this variant [–], which was insufficient to result in hearing impairment.
Therefore, we further performed a WES analysis for the trio (I-1, I-2 and II-1) by using the Illumina HiSeq platforms. Details of the process of WES analysis are shown in Additional file : Supplementary materials. The target mean depths in the trio were all greater than 128X and > 97.8% of the target regions were covered by at least 20X. More than 77 thousands of variants were annotated for each person, and we summarize these results in Additional file : Table S1. Two analyses were applied in the trio data. One was de novo variants analysis, but we found no deleterious HL-associated variant. The other was shared variants analysis. A promising variant within LOXHD1 (c. c.5948C > T; p.S1983F) was identified after rigorous filters (see Additional file : Tables S1 and S2). It was co-segregated and validated in this family by Sanger sequencing (see Fig. c). The primer sequences (5′ → 3′) were: forward-p, ATCGTGGTGCTTTTAACCTGC; reverse-p, GGGTGCTTGCACAGGATTG. Although homogeneous MT-RNR1: m.827A > G was identified in the proband, but her asymptomatic brother and mother also carrier this variant, implying that MT-RNR1: m.827A > G contributed little to the pathogenesis of the proband (Additional file : Table S3). LOXHD1: c.5948C > T was a missense variant, which was not found in all public databases (dbSNP, 1000 Genomes, ExAC and gnomAD), and predicted as damaging by multiple bioinformatics tools (SIFT, Polyphen2, and Mutation Taster, etc.). Evolution analysis also indicated that this variant was located at the well conserved region (Additional file : Table S2). Nowadays there have been 47 variants within LOXHD1 associated with hearing impairment according to HGMD database, but c.5948C > T (p.S1983F) was not reported previously.
|
pmc-6373033-1
|
The patient was a 62-year-old female suffering since adolescence from mite-induced asthma, as assessed by positive in vitro testing to Dermatophagoides pteronyssinus and Dermatophagoides farinae, with development in latest years of severe asthma not controlled by standard drug treatment. The patient fulfilled the admission criteria to mepolizumab treatment, as defined by severe asthma from ≥ 12 months despite high-dose inhaled corticosteroids (ICS) plus additional controller(s) treatment, ≥ 2 exacerbations (requiring systemic corticosteroid and/or ED visit and/or hospitalization in prior 12 months) and blood eosinophil ≥ 150 cells/µl at visit 1 or historically ≥ 300 cells/µl []. Lung function measurement by plethysmography showed a forced expiratory volume in 1 s (FEV1) of 64% and significant reversibility to 80% following inhalation of salbutamol 400 µg. From 1998, the patient also suffered concomitant CRSwNP. The disease state was investigated by computed tomography (CT), which showed a picture of pansinusitis with almost complete obliteration of all the paranasal cavities, with erosive reabsorption phenomena associated to the presence of numerous polypoid formations in the ethmoidal cells, extending to the nasopharynx. The patient was previously treated with many drugs, including oral and injective corticosteroids, with some benefit on nasal discharge, stuffiness, facial pressure, and cough but no effect on the loss of the sense of smell. Starting from March 2018, mepolizumab treatment by 100 mg at monthly intervals was performed, that resulted in good clinical control of both asthma and CRSwNP, a complete recovery of the smell loss occurring in the latter after 4 months of treatment and persisting. Figures and show the results of paranasal sinuses CT before (T0) and after (T1) mepolizumab treatment in axial and coronal projection, with evident improvement after treatment.
|
pmc-6373044-1
|
A 38-year-old Japanese woman came to our institute with a complaint of epigastric pain after meals. She had no medical history and no exposures to plants or animals prior to her hospital stay or invasive procedures. She never smoked tobacco and was not an alcohol consumer. She was diagnosed as having acute cholangitis induced by stone based on symptoms and laboratory findings (Table ), and was admitted (Fig. ). Her body temperature was 37.1 °C, blood pressure 97/57 mmHg, and heart rate 85/minute. She did not exhibit any jaundice. An abdominal examination revealed tenderness on the epigastric portion. No rebound tenderness was confirmed. Her cardiac, respiratory, and neurological examinations were normal. Abdominal computed tomography (CT) findings showed gallstones with gallbladder wall thickening (Fig. ). Antibiotic therapy of sulbactam (SBT)/cefoperazone (CPZ) was started empirically at the same time. When undergoing endoscopic nasobiliary drainage, she had a high fever and two sets of blood cultures were obtained on day 6. Growth of Gram-negative rods was reported in both aerobic and anaerobic blood cultures within 24 hours on BACTEC™ (BD, Tokyo, Japan). Antibiotic therapy of meropenem (MEPM) was started empirically. Our patient’s clinical condition and laboratory data improved rapidly. After 3 days of intravenously administered MEPM, the antibiotic therapy was switched to orally administered levofloxacin (LVFX) 500 mg daily for another 7 days according to microbiological sensitivity. The infection did not recur and she was discharged on day 28. During 1 year, recurrence of the infection was not observed.
First, the pathogen by positive blood culture was identified as Klebsiella ozaenae by means of a MALDI Biotyper® (Bruker Daltonics). Subsequently, genetic investigation by 16S ribosomal RNA (rRNA) analysis was performed in order to identify this organism. Finally, the pathogen was identified as P. dispersa with 100% homology (1343 of 1343 bases) on the EZ taxonomy database (). We also conducted additional biochemical tests using API® 50 CH kit, according to previous reports to confirm the isolate as P. dispersa. The organism had no activities of esculin and salicin, and had activities of lactose, melibiose, and gentiobiose, which were consistent with P. dispersa [].
Antimicrobial susceptibility testing was performed according to Clinical and Laboratory Standards Institute (CLSI) criteria for Enterobacteriaceae [] using the newly developed, fully automated microbiology system, RAISUS (Nissui Pharmaceuticals Co., Ltd., Tokyo). The organism was susceptible to all antimicrobial agents tested, including ampicillin, cefazolin, gentamicin, LVFX, and trimethoprim-sulfamethoxazole (Table ).
|
pmc-6373098-1
|
A 42-year-old Sri Lankan man presented to the Colombo North Teaching Hospital, Ragama, Sri Lanka (CNTH) with a febrile illness of 6 days, accompanied by headache and constitutional symptoms. He was a grocer from Minuwangoda, a suburban area in the Western Province situated 44 km from Colombo. He was initially investigated and treated at a regional hospital for 4 days, and was transferred to the CNTH for specialized care. He gave a history of type 2 diabetes mellitus for 5 years without microvascular or macrovascular complications, and was a nonsmoker and a teetotaler. There were no specific symptoms suggesting a source of infection such as cough, abdominal pain, urinary symptoms, etc. He was febrile with a temperature of 39.10 C, and examination of the heart, lungs and abdomen was unremarkable. There was no papilloedema, focal neurological signs, pyramidal signs or neck stiffness. Initial laboratory work up revealed features of a bacterial infection, with neutrophil leukocytosis and elevated inflammatory markers (erythrocyte sedimentation rate – 101 mm/1st hour, C-reactive protein - 220 mg/dl). Initial blood cultures done at the regional hospital had yielded an isolate, which was reported as a Pseudomonas species; this was sensitive to ceftazidime, imipenem and meropenem and resistant to gentamicin and ceftriaxone. Other basic laboratory investigations including renal and liver function tests, electrolyte panel and urinalysis were normal. Chest x-ray and ultrasound scan of the abdomen were normal, and the trans-thoracic 2-D echo did not show any vegetations. As the unusual antibiotic sensitivity pattern suggested the possibility of melioidosis, blood was sent for serological testing to a specialized Melioidosis Research Laboratory at the Faculty of Medicine, University of Colombo.
He had been initially treated with intravenous ceftriaxone, and later with ceftazidime according to the antibiotic sensitivity pattern. Although the frequency and intensity of fever spikes reduced with treatment, he continued to have low grade fever and complain of anorexia, malaise and lethargy. On the 4th day after admission to the CNTH (day 10 of the illness), he developed simple partial seizures involving the left lower limb, progressing to persistent numbness of the left side of the body. An urgent CT scan of the head revealed a subdural collection over the right fronto-parietal region with gas locules and obliteration of sulci and gyri, without definite evidence of abscess formation (Fig. ). Contrast enhanced MRI scan of the brain demonstrated a subdural collection in the right fronto-temporo-parietal region with possible abscess formation in the right parietal region (Fig. ). Seizures were treated with oral sodium valproate and phenytoin sodium. He was referred for neurosurgical opinion, and the subdural collection was managed conservatively. Results of the indirect hemagglutination assay (IHA) for melioidosis antibodies were received on the following day; an antibody titre of more than 1/10,240 was strongly suggestive of an acute infection with Burkhoderia pseudomallei and a diagnosis of cerebral melioidosis was made.
Antibiotics were changed to intravenous meropenem and oral trimethoprim/sulfamethoxazole (Co-trimoxazole/TMP-SMX). Initial intensive therapy with these antibiotics was continued for 8 weeks, until clinical improvement was evident with resolution of inflammatory markers and radiological improvement confirmed by repeat MRI scan of the brain. (Fig. ) Repeat blood cultures were sterile after 2 weeks of treatment with antibiotics. There were no further seizures, and the fever and the neurological symptoms resolved completely. He was discharged home with oral TMP-SMX and doxycycline, which were continued for 6 months, and the antiepileptics were gradually tailed off. At 6 months follow up he was asymptomatic. (Fig. ).
|
pmc-6373146-1
|
We report on a 64-year-old man suffering from hemoptysis, cough, mild fever and dyspnea. His computed tomography (CT) scan showed solid tumor of 40 mm in diameter in left lower bronchus (Fig. -a), which obstructed the lower bronchus and caused obstructive pneumonia of left lower lobe and expanded to second carina and pulmonary artery (Fig. -b). The CT scan also revealed severe pulmonary emphysema and his pulmonary function test showed obstructive function pattern (Table ). His bronchoscopy showed that tumor was exposed in the bronchial lumen and infiltrated to left main bronchus and upper bronchus even though the scope could pass through the exposed tumor of upper bronchus (Fig. -a, b). Transbronchial lung biopsy showed squamous cell carcinoma. He had undergone left sleeve lingular segmentectomy and left lower lobectomy. The details of the procedure were as follows: a posterolateral thoracotomy at the fourth intercostal space was performed. The left lower lobe and lingular division were dissected. The resection point of bronchus was determined with almost 1 cm of the distance from tumor. Intraoperative pathological findings showed free surgical margin of the bronchus. Reconstruction was performed with bronchial wall flap using 4–0 PDS stitches (Johnson and Johnson K. K., NJ, US) (Fig. and Fig. ). The anastomotic site was wrapped using a fourth intercostal muscle flap. Although he had been suffered from prolonged air leakage due to alveolopleural fistula, he could discharge from our hospital one month after surgery. Pathological findings revealed moderately differentiated squamous cell carcinoma of pT3N0M0 stage IIB according to UICC 8th edition. Postoperative bronchoscopic findings showed no troubles at the anastomotic site including stenosis or kinking (Fig. -c, d). He had received no adjuvant chemotherapy after surgery because of his low pulmonary function. He has been well for eighteen months without any recurrences after surgery.
|
pmc-6373151-1
|
A 16-year-old male was admitted to the Department of Infectious Diseases at the Children’s Hospital of Chongqing Medical University, Chongqing, P. R. China, on June 30, 2014 with a history of fever, skin rash over hand and feet, headache, and weakness in lower limbs over the past 4 days. The patient also had intraoral and throat pain, and non-projectile vomiting 3 days prior to admission. Two days prior to admission, the patient developed drowsiness, startle, hand tremor, urinary incontinence, and progressive deterioration in consciousness. He reported recent contact with a HFMD. Medications were limited to recent use of over-the-counter analgesics. The patient’s body temperature was 36.8 °C, respiratory rate was 25/min, pulse rate 98 beats/min, and blood pressure was 124/76 mmHg. Vesicular lesions and ulcers were present in the oral mucosa, and macular and vesicular lesions were present on palms and soles.
The patient was drowsy and non-verbal, but was responding to painful stimuli. He showed left-sided facial paralysis. The left nasolabial fold was flat and there was drooping of the mouth to the left side. The pupils were equal in size (diameter: 4 mm) and the pupillary light reflex was bilaterally symmetrical. Neck resistance was normal. The left upper and lower limbs showed reduced muscle strength (grade III–IV). The muscle strength in right limb was normal. Abdominal reflex and cremasteric reflex were normal. Pathological reflexes (e.g., Babinski, Chaddock, Oppenheim, Gordon) were negative. The rest of the physical findings were unremarkable.
Results of blood test were as follows: White blood cell count, 10.82 × 109; neutrophils, 92%; C-reactive protein, 80 mg/L, and blood glucose, 7 mmol/L. Findings of cerebrospinal fluid (CSF) examination were as follows: Total number of cells, 188 × 106/L; nucleated cells, 44 × 106/L; monocytes 37 × 106/L; multinucleated cells 7 × 106/L; protein, 0.65 g/L; glucose, 5.74 mmol/L, and chlorides, 120.4 mmol/L.
IgM levels were quantified using ELISA kit (Cat No. 20143400198, Wantai Biopharm Inc., China). The CSF and serum tested positive for IgM antibody to EV71, but negative for IgM antibodies against Enterovirus, Herpes simplex virus, Cossack virus, and measles virus. EV71 RNA, but not CVA16, was detected in the patient’s faeces by reverse-transcriptase-polymerase chain reaction (RT-PCR) (Cat No. 20133400621, SANSURE Biotech Inc., China). All tests were performed in the clinical laboratory at the Children’s Hospital of Chongqing Medical University, Chongqing, P. R. China. Eight hours after admission, the patient showed progressive loss of consciousness and was transferred to the paediatric intensive care unit (PICU). He was in a coma and exhibited shallow breathing (30–40 breaths per minute). Pupils were sluggishly responsive to light with mild anisocoria (OD = 3 mm and OS = 4 mm). The patient showed no response to painful stimuli, and thus the muscle strength was not detected. The status of abdominal, cremasteric, and pathological reflexes was identical to that at the time of hospital admission. Based on the above clinical symptoms, a diagnosis of severe HFMD with brain stem encephalitis was established by specialists in the Department of Neurology and the Department of Infectious diseases.
The patient was administered mannitol (5 mL/kg/dose, q4h) to reduce the intracranial pressure, ganglioside for neurological recovery, creatine phosphate sodium for providing heart muscle energy, methyl prednisolone for reducing inflammation and cerebral edema, and potassium sodium dehydroandroan drographolide succinate as antiviral therapy. The patient was also administered midazolam (5 mg) twice daily on days 1 and 2 after admission to prevent agitation. From day 2, the patient received gamma immunoglobulin therapy (25 g/day) for 2 days.
Head CT performed on day 3 following admission showed signs of pineal calcification; no other obvious abnormality was observed in other parts. The patient was unconscious and comatose during EEG examination performed on day 3. The results were indicative of diffuse encephalopathy with mixed delta and theta wave activity in the range of 1–4 Hz, which indicated abnormal brain function.
The patient showed improvement and was transferred back to the Department of Infectious Diseases on day 4 following admission, and the same treatment was continued, except for gamma immunoglobulin therapy. On day 5, the patient regained consciousness, but showed paroxysmal increase in muscle tension in the limbs (mainly on the right side).
Head MRI performed on day 9 was normal. The patient showed progressive improvement and was able to walk with an unsteady gait; he was discharged from the hospital on day 10 following admission.
Two weeks after discharge, the patient still walked with an unsteady gait, but showed full recovery 1 month after discharge (normal limb muscle strength and tone, movement, and intelligence).
|
pmc-6373162-1
|
A 68-year-old Caucasian man (73 kg) was treated for an early postoperative hip prosthesis infection with Staphylococcus epidermidis in October 2017. His past medical history included type 2 diabetes, peripheral artery disease, previous coronary artery bypass surgery, a stroke and two episodes of pulmonary tuberculosis, treated in 1994 and 2008.
After surgical debridement of the prosthesis the patient was started on antibiotic therapy with daptomycin. Rifampicin 450 mg twice daily per os (p.o.) was added 12 days postoperatively when the wound was dry, according to treatment concepts of prosthetic joint infections []. However, the wound began to discharge again and C-reactive protein (CRP) rose from 90 mg/l to 439 mg/l, and rifampicin was stopped after 3 days of treatment. Common sources of hospital-acquired infections were excluded. Ultrasound examination and joint aspiration did not indicate the presence of an uncontrolled infection. Rifampicin was therefore recommenced a week later.
Two hours after the first rifampicin dose, the patient presented with dyspnea which proved to be rapidly progressive. On clinical examination the patient was hypertensive with a normal heart rate, subfebrile (temperature 37.5 °C), tachypnoeic with an oxygen saturation of 78% on room air, and showed ubiquitous pulmonary crackles. He furthermore developed anuria. A computed tomography (CT) scan of the chest showed ubiquitous ground-glass pattern infiltrations (Fig. a). Rifampicin and daptomycin were stopped. The patient was started on hemofiltration for anuric renal failure with marked metabolic acidosis (base excess 18.2, bicarbonate 8.4 mmol/l). His respiratory failure was managed with supplemental oxygen.
Laboratory results during the next few days indicated severe acute liver injury as manifest by massively elevated liver function tests with peak values 2 days after re-exposure to rifampicin (AST 11′115 U/l or 330 times upper limit of normal (ULN), ALT 1′803 U/l or 30 times ULN, LDH 11′883 U/l, total bilirubin 98 μmol/l, spontaneous INR 2.4; previous values all within normal range). Further laboratory abnormalities were eosinophilia (maximum 0.91 G/l), a fall in hemoglobin from 100 g/l to 60 g/l, a positive direct Coombs test, a moderate number of fragmentocytes on the blood film, a urinary sediment with non- glomerular microhematuria without casts, and nephrotic-range proteinuria. The haptoglobin concentration was within the normal range.
Follow-up CT scan of the chest on day 7 after exposure showed progressive ground-glass infiltrations in a “crazy paving” pattern and changes of early fibrosis with new traction bronchiectasis (Fig. b), consistent with hypersensitivity pneumonitis. A broncho-alveolar lavage performed on the same day yielded a negative culture, and a cytology specimen showing a moderate cellular infiltration (full cell count 169/ul; ULN 300/ul) of predominantly macrophages (53%) and neutrophil granulocytes (37%). Eosinophilic pneumonia triggered by daptomycin could therefore be excluded.
The patient was started on intravenous steroids (initially methylprednisolone 125 mg once daily (od)) due to the progressive pulmonary changes and daptomycin was re-introduced. Transaminases returned to normal within 1 week. Apart from the temporarily elevated INR, there was no evidence of impaired liver synthetic function. Renal function recovered sufficiently so that hemofiltration could be stopped after 2 weeks, but serum creatinine took 2 months to return to normal range. Pulmonary oxygenation also improved significantly after 2 weeks and a follow up chest CT scan 2 months later no longer showed ground glass infiltrations. Prednisolone was tapered over 2 months as allowed by the clinical course (methylprednisolone 125 mg od for 4 days followed by oral prednisolone 60 mg od for 2 weeks, 40 mg od for 3 weeks, 20 mg od for 3 weeks).
A review of the patient’s tuberculosis treatment records from 9 years previously revealed that management was modified at that time to a rifampicin-free regimen within 8 days of starting treatment due to a suspected rifampicin-hypersensitivity reaction that included kidney failure and hemolytic anemia (Table ).
A multi-organ hypersensitivity reaction in a patient previously sensitized to rifampicin was therefore diagnosed. Biopsy-confirmation was not performed on account of the suggestive clinical picture, coagulopathy and limited sensitivity after the introduction of steroids. A Rifampicin-specific lymphocyte transformation test (LTT; performed by ADR-AC GmbH, Berne, Switzerland) 3 weeks after exposure was positive even under steroid treatment.
In summary, our patient showed severe acute kidney failure, hypersensitivity pneumonia, acute liver injury and moderate haemolytic anemia after re-exposure to rifampicin.
|
pmc-6373168-1
|
A 44-year-old female patient was admitted with fatigue for 10 days, especially increased with shortness of breath after activities for the last 2 days. She announced that she had got cough, sore throat, with low-grade fever (without measuring) and pale face. About 2 months ago, she accepted the root canal therapy.
Upon physical examination, her heart rate was 96 beats/minute and regular. Body temperature was normal (36.7 °C). Laboratory examination showed the hemoglobin was 36 g/L, with a mean corpuscular volume of 78.9 fL, and the red blood cell was 1.42 × 1012/L, the reticulocyte was 2.52%. The color of the urine showed brown. Urinalysis showed that urobilinogen appeared positive (4+), with urine red blood cells 3cells/μL. The blood chemistry tests were shown as follows: lactic dehydrogenase (LDH) 594 U/L, serum total bilirubin (TBIL) 27.3 μmol/L, serum indirect bilirubin (IBIL) 20.45 μmol/L. According to the patient’s report, similar physical situation occurred 15 years ago, without further treatment. It was suspected that she was suffering autoimmune hemolytic anemia. Further examination of serum autoantibodies showed antinuclear antibodies (ANA) 188.35 IU/ml, anti-double-stranded DNA antibody (dsDNA) 186.42 IU/ml, anti-nucleosome antibodies (AnuA) 27.01 IU/ml, anti-SSA antibody (+), anticardiolipin antibodies (aCL) IgG (+), aCL-IgM (+), anti-β2-glycoprotein-I antibodies (a-β2-GPI) (+), Coombs test (4+). According to American College of Rheumatology (ACR) criteria, she was diagnosed as systemic lupus erythematosus (SLE). After red blood transfusion and hormonotherapy treatment with dexamethasone (10 mg qd), her clinical symptoms have improved.
On the third day after admission, the transthoracic echocardiography (TTE) was performed as a routine examination. TTE results showed that the posterior leaflet of the mitral valve was thickened and incompetent. A small light band was observed on the mitral valve, which was fluttering along with the leaflet. A low echo mass was attached to the posterior leaf margin, which indicated vegetation existed. Its size was 3 mm × 3 mm. Acute severe mitral valve systole regurgitation was observed by Color Doppler Flow Imaging (CDFI), which indicated severe valvular inadequacy (Fig. ).
Blood cultures were obtained then and empiric antibiotic treatment with vancomycin (1.0 g every 12 h) and piperacillin-tazobactam (4.5 g, iv drip q8h) were started. All the 6 sets of blood cultures were positive after 2 days and detected as Gram-negative coccobacilli (Fig. ) The organism was subcultured and incubated on blood agar at 35 °C with 5% CO2. In the meantime, the empiric antibiotic treatment for the patient was switched to piperacillin-tazobactam (4.5 g, ivdrip q8h) and levofloxacin (0.5 g, ivdrip qd). The organism appeared slightly pink, mucoid colonies after 48 h incubation. It was identified as R.mucosa by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) (bioMerieux, Durham, NC). However, the organism was identified as R.gilardii by the Vitek2 system (bioMerieux, Durham, NC, USA). To confirm the identity of the isolate, a fragment of the 16S rRNA gene was amplified by PCR using primer sets 16S-forward (5′AGAGTTTGATCCTGGCTCAG 3′) and 16S-reverse (5′GGTTACCTTGTTACGACTT 3′), and the resultant polymerase chain reaction product was sequenced. The best match returned was the R.mucosa, ATCC BAA-692 type strain, with 99.6% identity.
Antimicrobial susceptibility testing of the R.mucosa strain was determined by the Kirby-Bauer disk diffusion method, using the breakpoints recommended by Clinical and Laboratory Standards Institute (CLSI-M100) for nonfermentative Gram-negative bacteria. The isolate exhibited large inhibition zone (millimeter) for most of antimicrobials tested: amikacin 42 mm, ciprofloxacin 42 mm, levofloxacin 27 mm, imipenem 38 mm, meropenem 42 mm, and piperacillin-tazobactam 6 mm. Therefore, according to the antibiotics susceptibility test result, the treatment was switched to meropenem (1 g, ivdrip q12h) and amikacin (400 mg, ivdrip qd). After antibiotic treatment, the control echocardiography showed that moderate mitral valve systole regurgitation was observed by CDFI, which was much better than before (Fig. ). The following blood cultures, the sputum culture and urine culture were all negative and the C-reactive protein (CRP), the procalcitonin (PCT), the white blood cell counts and the neutrophil counts were all normal. After treatment, the hemoglobin has raised to 81 g/L. The results of serum autoantibodies, including ANA 130.04 IU/ml, dsDNA121.18 IU/ml, AnuA 19.45 IU/ml, anti-SSA antibody (±), were improved. The patient discharged and kept on accepting the treatment with meropenem and amikacin in community hospital for another 6 weeks until the clinical symptoms of the SLE were controlled. The patient is still preparing for a cardiac surgery which has been advised by the doctor.
|
pmc-6373170-1
|
A 62-year-old female presented with a 10-day history of productive cough, myalgia and fever since returning home from a trip to Sri Lanka. She was febrile (41.1°C), tachypnoeic and hypoxic but haemodynamically stable. Her inflammatory markers were raised (peripheral leucocyte count 19.3 × 109/L and C-reactive protein (CRP) 420 mg/L). Baseline blood tests revealed deranged liver function (alanine aminotransferase = 379 U/L (normal <35 U/L) and gamma-glutamyl transferase = 78 U/L (normal <40 U/L)). She was coagulopathic (activated partial thromboplastin time (APTT) of 44.4 s and international normalized ratio (INR) of 1.8). Chest X-ray (CXR) and computed tomography (CT) of the chest demonstrated left-sided consolidation complicated by a small loculated pleural effusion (Fig. A).
Her past medical history was significant for psoriatic arthritis, which had been managed with methotrexate and sulfasalazine up until six months prior and carcinoma of the breast managed with wide local excision and radiotherapy. She also had a left video-assisted thoracotomy nine years prior for an undiagnosed effusion which spontaneously resolved after. Pleural biopsies showed benign organizing fibrinous pleuritis only.
She was initially managed with intravenous (i.v.) ceftriaxone 2 g plus azithromycin 500 mg daily. This regime was then changed to i.v. benzylpenicillin 1.8 g 4-hourly plus clindamycin 600 mg 8-hourly on day 2 upon identification of Streptococcus pyogenes (Group A) in blood cultures. There was initial improvement in symptoms, fever, oxygen saturations, and inflammatory markers (CRP decreased to 36 mg/L by day 5). She was also a subject of a double-blinded randomized trial and received either i.v. dexamethasone or placebo for 48 h on days 2 and 3. The pleural effusion was not drained because of good clinical response, its small size and the coagulopathy, which persisted despite administration of two doses of i.v. vitamin K 10 mg.
However, she deteriorated and became febrile again at day 6 and her CRP rose to 130 mg/L. Repeat imaging showed a worsening loculated pleural effusion, particularly at the lung apex (Fig B–D). Antibiotics were changed to i.v. piperacillin with tazobactam 4.5 g 8-hourly. An ultrasound-guided intercostal catheter (ICC) was inserted. Microbial culture of the fluid did not yield any organism.
Over the next 72 h she had minimal improvement. She remained febrile and her CRP remained elevated. Thoracic ultrasound (TUS) and CXR (Fig. E) confirmed a persistent septated pleural effusion. Intrapleural instillations with tPA and DNase were commenced. The patient was considered at high risk of iatrogenic haemothorax due to persistent sepsis-associated coagulopathy (APTT of 53.7 s and INR of 1.4). Hence, a conservative approach using a starting dose of 1 mg tPA was administered initially with a view to dose escalation based on response. The dose of DNase was 5 mg. Intrapleural treatment was given twice daily for 2.5 days (five doses in total).
The patient had significant clinical, radiological, and serological response to the 1 mg tPA/5 mg DNase regime. The volume of pleural fluid drained in the 72 h preceding fibrinolytic treatment was 175 mL and increased to 675 mL in the first 24 h of tPA/DNase treatment and 1450 mL after five doses of tPA/DNase. She was afebrile and her CRP decreased to 49 mg/L. TUS and CXR showed radiological resolution of the pleural effusion and her ICC was subsequently removed (Fig. F). Importantly, during the course of treatment she had no bleeding or other complications. At clinical follow-up two months post-discharge she remained well with no evident complications.
|
pmc-6373275-1
|
A 6-year-old boy without relevant medical history presented at the emergency department of the Maastricht University Medical Centre (MUMC+), after referral from a local hospital. Several hours before, the boy fell off a 1-m-high windowsill in his house and landed with his back on a protrusion of the central heating. In the local hospital emergency room, he complained of a painful and continuously leaking wound on his back. At that moment, the boy showed no signs of impaired consciousness or any neurological deficit. After transfer, at presentation in the MUMC+, he was drowsy with a varying decreased Glasgow Coma Score of 10 (E2M6V2) to 13. Furthermore, he presented with episodes of bradycardia and a preferential head position towards the left. Motor and sensory functions were undisturbed, and deep tendon reflexes were symmetrical and normal, with no Babinski signs.
Physical examination showed a horizontally oriented, deep, and sharp confined wound of about 4 cm in length, located paravertebrally at the lower lumbar region (Fig. ). Due to penetration of the subcutis, fascia, and paravertebral muscles, the spinous process was visible and the wound was continuously leaking bloody fluid.
|
pmc-6373287-1
|
A 62-year-old male patient with acromegaly sought treatment at our hospital for intermittent headaches. MRI and CT showed a 1.5 × 1.0 × 1.3 cm space-occupying lesion at the sella turcica (Fig. A, B), which was diagnosed as a pituitary macroadenoma. Preoperative endocrine examinations showed elevated growth hormone levels, and the patient was advised to undergo endoscopic transsphenoidal surgery. We employed 3D-printing technology to reconstruct a model of the patient’s tumor (Fig. C, D). This model has been used as demonstration object to actively communicate the patient’s condition with his relatives, which led to good communication results. On the model, we also planned the surgical approach and practiced the surgical manipulation, which provided important guidance for the surgery, leading to full tumor resection. Pathological examination showed that the patient’s tumor was a growth hormone-secreting PA. No complications occurred after the surgery, and the patient was successfully discharged.
|
pmc-6373287-2
|
A 28-year-old female patient with acromegaly sought treatment at our hospital for poor glucose control. MRI and CT showed a 3.9 × 2.4 × 3.3 cm space-occupying lesion in the sella turcica region (Fig. A, B). The patient was diagnosed with pituitary macroadenoma, and preoperative endocrine examinations showed elevated growth hormone levels. We employed 3D-printing technology to reconstruct a model of the patient’s tumor (Fig. C, D) and used the model as a demonstration object to actively communicate the patient’s condition with his relatives. We recommended to the patient to undergo first a transsphenoidal surgery to remove the intrasellar tumor and then a craniotomy to remove the suprasellar tumor. We obtained good condition communication results. At the same time, we planned the surgical approach on the model and practiced the surgical manipulation, which provided important guidance for the surgery. Pathological examination showed that the patient’s tumor was a growth hormone-secreting PA. No complications occurred after the surgery, and the patient was successfully discharged. Three months later, the patient went for craniotomy at our hospital, and the tumor was fully resected.
|
pmc-6373502-1
|
A 2-month-old male baby was admitted with complaints of fever, cough, diarrhea, and respiratory distress. The parents were first-degree cousins. The constellation of clinical features such as prolonged fever and splenomegaly and laboratory findings (cytopenia in peripheral blood, elevated ferritin, triglyceride and liver enzymes, and hemophagocytosis in the bone marrow) suggested the diagnosis of hemophagocytic lymphohistiocytosis (HLH). Cytomegalovirus (CMV) PCR was found to be positive and he was given ganciclovir therapy. Intravenous immunoglobulin was added to the therapy due to the presence of hypogammaglobulinemia. Percentages of lymphocyte subsets were in the normal ranges. A second bone marrow aspiration demonstrated megaloblastic changes in the erythroid series. The patient’s serum vitamin B12 level was normal; however, the serum homocysteine level (23 µmol/L) was significantly higher than normal. A genetic deficiency of TC was suspected and a homozygous TCN2 gene mutation was detected in molecular analysis. This 5304-bp deletion began 1516 bp into intron 7 and ended 1231 bp into intron 8. The deletion included all of exon 8 and caused a frameshift to produce a premature stop four codons into the new reading frame. The patient was treated with intramuscular vitamin B12, which was followed by improvement in both clinical and laboratory findings. This case was published as a case report in the literature [].
|
pmc-6373502-2
|
A 6-month-old girl presented with complaints of failure to thrive, vomiting, and diarrhea. A diagnosis of sepsis or metabolic disease was suspected and antibiotic therapy was started empirically. She had anemia, neutropenia, and thrombocytopenia. Serum vitamin B12 level was found to be normal; however, serum homocysteine was 53 µmol/L. Megaloblastic changes and vacuolization were prominent in the myeloid lineage in the bone marrow aspiration. Immunological evaluation revealed hypogammaglobulinemia. Percentages of lymphocyte subsets were in the normal range. A genetic deficiency of TC was suspected. The molecular analysis revealed c.1106+1516_1222+1231del mutation. This mutation is not listed in the Human Gene Mutation Database (Cardiff). It is a 5304-bp deletion that begins 1516 bp into intron 7 and ends 1231 bp into intron 8. The deletion includes all of exon 8 and causes a frameshift to produce a premature stop four codons into the new reading frame. The patient was treated with intramuscular vitamin B12 and oral folic acid, which was followed by improvement in hematological response, but a speech deficit was detected at 2 years of age in follow-up.
|
pmc-6373502-3
|
A 7-month-old boy presented with complaints of poor feeding, diarrhea, and petechiae. He was the child of first-degree cousins. He had pancytopenia. Serum vitamin B12 level was found to be normal and serum homocysteine level was high at the borderline (16 µmol/L). Bone marrow was hypocellular and megaloblastic changes were prominent in the myeloid lineage. A genetic deficiency of TC was suspected. The molecular analysis revealed c.1106+1516_1222+1231del mutation. This mutation is not listed in the Human Gene Mutation Database (Cardiff). It is a 5304-bp deletion that begins 1516 bp into intron 7 and ends 1231 bp into intron 8. The deletion includes all of exon 8 and causes a frameshift to produce a premature stop four codons into the new reading frame. The patient was treated with intramuscular vitamin B12, which was followed by improvement in hematological response, but a delay in walking was detected at 2 years of age in follow-up.
|
pmc-6373502-4
|
A 5-month-old girl was admitted with failure to thrive, poor feeding, vomiting, and diarrhea. She was the child of first-degree cousins and had a history of sibling death. Laboratory evaluation showed pancytopenia, which required transfusions, and lymphopenia and hypogammaglobulinemia. Percentages of lymphocyte subsets were in the normal range. Serum vitamin B12 level was low (136 pg/mL) and serum homocysteine level could not be measured. CMV PCR was found to be positive. Severe combined immunodeficiency was suspected. Intravenous immunoglobulin, ganciclovir treatment, and antibacterial and antifungal prophylaxis were given. However, bone marrow aspiration showed prominent vacuolization in the myeloid lineage, which suggested Pearson syndrome, and prominent megaloblastic changes in the myeloid lineage. However, molecular analysis did not support the diagnosis of Pearson syndrome. A genetic deficiency of TC was suspected. The patient was treated with intramuscular vitamin B12 and oral folic acid with clinical and hematological improvement. After her family discontinued vitamin B12 therapy, she showed relapse with severe pancytopenia. Vitamin B12 treatment was restarted. The molecular analysis revealed a homozygous TCN2 gene mutation.
|
pmc-6373502-5
|
A 1-month-old male baby presented with irritability, fever, and poor feeding. He had a cleft palate and lip. He was the child of first-degree cousins. A diagnosis of sepsis was suspected and antibiotic therapy was started empirically. Complete blood count revealed macrocytic anemia, which required transfusions in follow-up. Serum vitamin B12 and folic acid levels were found to be normal. Bone marrow aspiration showed megaloblastic changes in the myeloid lineage. Serum homocysteine level was 45 µmol/L. A genetic deficiency of TC was suspected. Homozygous deletion of the TCN2 gene was detected in exon 8. The patient was treated with intramuscular vitamin B12, which was followed by clinical and hematological response.
|
pmc-6373502-6
|
A 2-month-old male baby presented with complaints of irritability, fever, oral aphthous ulcers, and diarrhea. Patent ductus arteriosus was found in echocardiography. Laboratory evaluation revealed pancytopenia. Serum vitamin B12 and folic acid levels were found to be normal. Serum homocysteine level could not be measured. Bone marrow aspiration was remarkable for megaloblastic changes in erythroid and myeloid cell precursors. A genetic deficiency of TC was suspected. The molecular analysis revealed a homozygous TCN2 gene mutation: c.106C>T (p.Q36*) (p.Gln36*). The patient was treated with intramuscular vitamin B12 and oral folic acid. He has been asymptomatic in follow-up.
|
pmc-6373508-1
|
The proband is a 21-year-old male who was referred to our hematology clinic for evaluation of bleeding diathesis prior to a left mastoidectomy operation due to chronic suppurative mastoiditis. He had wrinkled skin, hyperpigmentation, microcephaly, dysmorphic facial features, cleft lip and palate, and ectopia lentis. Bleeding diathesis, delayed wound healing, and easy bruising was noticeable in early childhood. He had been operated on for cleft lip and palate at age 6 months and for undescended testis and inguinal hernia at age 10 years. He had a history of chronic suppurative otitis media attacks that eventually caused sensorineural hearing loss. After a mild trauma to the left tibial region at age 20 years, a deep wound developed and progressed to acute compartment syndrome. He was hospitalized, and a fasciotomy was performed. During this period, excessive bleeding requiring blood transfusion attracted attention. Complete blood count showed white blood cells of 4.87x103/µL (N: 4-10x103/µL), hemoglobin of 10.9 g/dL (N: 12-16 g/dL) with mean corpuscular volume of 72 fL (N: 80-94 fL), and platelet count of 205x103/µL (N: 150-400x103/µL) with mean platelet volume of 13.6 fL (N: 9-11 fL). Hypochromic and microcytic red blood cells and large platelets were seen on peripheral blood smear. Ferritin level was low (14 ng/mL, N: 20-150), and hemoglobin electrophoresis was normal. Iron deficiency anemia was treated with oral therapy. Prothrombin time, activated partial thromboplastin time, D-dimer, fibrin degradation products, and fibrinogen activity were found to be normal. Skin bleeding time (Ivy method) was 16 min (N: 4-9 min), and PFA-100 revealed prolonged closure times; both collagen/EPI (N: 85-157 s) and collagen/ADP (N: 65-125 s) results were >300 s. Light transmission aggregometry studies showed slightly decreased aggregation with ADP, collagen, and epinephrine. Aggregation with ristocetin was normal. Flow cytometric analysis of the peripheral blood platelets revealed normal expression with CD41 (for glycoprotein IIb), CD61 (for glycoprotein IIIa), CD42a (for glycoprotein IX), and CD42b (for glycoprotein Ib) cell surface markers. von Willebrand factor (vWF) activity to antigen ratio was low (0.35, N: >0.7), and factor VIII activity was 74% (N: 50%-150%).
|
pmc-6373508-2
|
The elder patient is 35 years old. She had wrinkled skin, hyperpigmentation, microcephaly, dysmorphic facial features, cleft lip and palate, ectopia lentis, hearing loss due to chronic suppurative otitis media, bleeding diathesis (menometrorrhagia requiring oral and parenteral iron treatment), easy bruising, and defective wound healing. She had been operated on for cleft lip and palate, and has had eye operations for ectopia lentis and bilateral corneal transplantations for corneal clouding. Papillomatous lesions were noticed on her tongue. Complete blood count revealed hypochromic and microcytic anemia consistent with iron deficiency, normal white blood cell count, and differential and normal platelet count with slightly elevated mean platelet volume. Basic coagulation tests (prothrombin time, activated partial thromboplastin time, D-dimer, fibrin degradation products, and fibrinogen activity) were normal. Skin bleeding time (Ivy method) was 15 min (N: 4-9 min). Light transmission aggregometry studies showed normal aggregation with ADP, collagen, ristocetin, and epinephrine. vWF activity to antigen ratio was low (0.3, N: >0.7), and factor VIII activity was 70% (N: 50%-150%).
Neurological examination and cranial magnetic resonance imaging (MRI) of both patients were normal, excluding structural defects besides microcephaly (). We concluded that the disease was atypical cutis laxa.
|
pmc-6373879-1
|
A 49-year-old African-American male with a past medical history of sickle cell trait was transferred to our tertiary care hospital from a local community hospital. He initially presented to the outside hospital with one week of fatigue, arthralgias, and myalgias. Given anemia (hemoglobin 11 g/dL), thrombocytopenia (platelet count 46,000 per microliter), acute renal failure (creatinine 1.33 mg/dL, elevated from a normal baseline), elevated lactate dehydrogenase (LDH; 968 IU/L), decreased haptoglobin (15 mg/dL), and a peripheral blood smear showing one to two schistocytes per high power field (HPF), he was presumed to have TTP. An "a disintegrin and metalloproteinase with a thrombospondin type one motif, member 13" (ADAMTS13) was appropriately sent and pending at time of transfer. Additionally, his white blood cell count was 4.1 per microliter, potassium 4.1 mmol/L, phosphate 6.6 mg/dL, calcium 9.8 mg/dL, and liver function tests showed elevated bilirubin of 2 mg/dL. He was empirically started on 1 mg/kg prednisone and daily plasma exchange (one plasma volume per day). Given lack of improvement with these interventions and three days of plasma exchange (PLEX), he was referred to our hospital.
Upon presentation to the initial hospital, his review of systems was positive for intermittent rigors, constipation, and low back pain. He denied unintentional weight loss, fever, bleeding or bruising, dyspnea, or urinary symptoms. He used occasional ethanol, but denied any smoking or drug use history. He denied recent travel or risk factors for human immunodeficiency virus (HIV). His family history was non-contributory.
On examination, he was an ill-appearing thin tall male with abdominal tenderness and diffuse pain on palpation of the lower back, shoulders, and hips. His pertinent laboratory data at our hospital after four days of prednisone and three days of daily PLEX included hemoglobin of 7.6 g/dL, mean corpuscular volume (MCV) 86 fL, white blood cell count 3.3 per microliter, platelet count 25,000 per microliter, and inappropriately low reticulocyte percentage of 0.9% (absolute reticulocyte count of 22 per microliter). His renal function was rapidly deteriorating (creatinine 5.4 mg/dL). Haptoglobin improved to 60 mg/dL while his LDH rose to 4445 IU/L. Ferritin was significantly elevated (31,863 ng/mL) with elevated uric acid (11.7 mg/dL). Urinalysis was notable for proteinuria and hematuria without casts. Peripheral smear at our institution revealed occasional schistocytes (one to two per HPF) with few nucleated red cells and teardrops (Figure ). Given hypoproliferative anemia and peripheral smear with teardrops and nucleated red blood cells, a bone marrow biopsy was performed to rule out infiltrative disease.
While results of the bone marrow biopsy were pending, the patient’s renal function, anemia, and thrombocytopenia continued to worsen in the setting of daily PLEX and steroids. He became anuric and required initiation of hemodialysis. At that time, it was decided to stop PLEX and administer a trial of eculizumab as complement-mediated hemolytic uremic syndrome (HUS) was rising on the differential. ADAMTS13 results became available showing appropriate activity of 151%, supporting the decision to stop PLEX. The patient also underwent imaging of the chest, abdomen, and pelvis to evaluate for occult malignancy. This was notable for abnormal diffuse mottled and moth-eaten attenuation of the spine suggestive of a diffuse marrow process, but no evidence of malignancy.
Final pathology of the bone marrow biopsy revealed metastatic prostate adenocarcinoma with neuroendocrine differentiation with nearly absent trilineage hematopoiesis and greater than 90% necrosis of the marrow space. The etiology of the patient’s renal failure, cytopenias, elevated uric acid, and elevated LDH was thus favored to be tumor lysis syndrome from metastatic prostate adenocarcinoma which may have been precipitated spontaneously or with the administration of high dose steroids. Of note, the prostate specific antigen (PSA) was elevated at 24.9 ng/ml.
At this point, he was initiated on allopurinol and supported with transfusions and hemodialysis. Steroids were tapered. He started palliative chemotherapy with carboplatin and etoposide on day 12 of hospitalization.
|
pmc-6373881-1
|
In our initial case report [], we described the case of a 57-year-old man diagnosed with stage IIA cutaneous melanoma in November 2007 following biopsy of a melanocytic lesion on the left posterior arm that revealed ulcerated primary melanoma with Breslow thickness 1.75 mm and a mitotic index of 1/mm2.
He underwent wide excision of the primary lesion followed by completion lymph node dissection (LND) of the left axillary basin following what was initially deemed a positive sentinel lymph node biopsy, although histology from the LND favored a diagnosis of capsular nevi within several regional lymph nodes (LNs) (ie, pathologic stage IIA, T2b melanoma). The patient remained disease-free for three years, when an in-transit metastasis was detected near the primary site. Following excision of the lymphatic metastasis, he was treated with adjuvant radiotherapy of 50 Gy in 20 fractions to the left posterior arm, followed by one month of adjuvant systemic therapy with high-dose interferon (IFN). One year later, he experienced a second local in-transit recurrence, with positron emission tomography–computed tomography (PET-CT) imaging and tissue confirmation of two to three metastatic melanoma lesions in the liver. BRAF testing on the hepatic metastasis was negative for the V600 mutation.
To induce an anti-tumor immune response that could mediate systemic tumor regression (abscopal effect), planned treatment for the patient included four doses of ipilimumab (anti-CTLA-4) at 3 mg per kilogram of body weight every three weeks, with radiation to begin after two doses. After two cycles of ipilimumab alone, a PET-CT scan showed progression of liver metastases with enlargement of the two previous liver lesions and development of five new hypermetabolic foci in the liver, the largest measuring 2.3 x 2.5 cm (Figure ). He then was treated with stereotactic body radiotherapy (SBRT) to two of the liver metastases with a total dose of 54 Gy in three fractions (Figure ). During cycle 3 of ipilimumab, he developed another in-transit melanoma recurrence in his left upper arm, which later completely resolved following initial enlargement consistent with “pseudoprogression.” He also developed hypophysitis that was treated with prednisone. Our previous report concluded at one-year follow-up, in August 2012, with complete resolution of the hypermetabolic lesion in the left arm and all seven hypermetabolic lesions in the liver and no evidence of local or distant disease progression.
Follow-up
Six and a half years after completing treatment, the patient remains disease-free. He continues to be followed every six months, and as of June 2018, he has no clinical or radiologic evidence of disease recurrence. His most recent PET-CT and maximum intensity projection (MIP) scans were performed in 2016 and showed no evidence of disease (Figure ). His dual-energy X-ray absorptiometry (DEXA) scan T-score was -2.0, which is consistent with osteopenia, a secondary effect of prolonged prednisone use for chronic hypophysitis that he developed from ipilimumab. Symptoms of hypophysitis recurred when he attempted to wean off the prednisone. He therefore remains on a regimen of 3 mg per day. Bisphoshosphonate therapy was recommended, which the patient declined, though he continues to take calcium and vitamin D supplements to manage the osteopenia.
|
pmc-6373882-1
|
A 79-year-old Peruvian woman presented with 10 months of vaginal bleeding and a vaginal tumor that was exophytic involving the cervix and extending to the right vaginal wall. There was a right tumoral mass that involved the sub-epithelium of the labia to the pelvic bone. The right parametrium was invaded until the pelvic bone. Computerized tomography (CT) scans showed a large solid tumor mass (10 x 10 x 9 cm) in the pelvic cavity with irregular edges that infiltrated the pelvic floor, parametrium, and the perineal soft tissues (Figure ).
Hematoxylin-eosin showed a proliferation of the hyperchromatic cells with nuclear pleomorphism associated with an apparently red cell neoplasm. Immunohistochemistry was negative for Pankeratin, Melan-A, S100, and CD3. CD20, BCL2, BCL6, CD10, MU-1, and C-MYC were positive. Ki-67 was positive and over-expressed in 70% of the cells. Chest CT showed an interstitial reticular pattern and no signs of nodules and lung masses. Bone marrow and bone biopsy were negative. The final diagnosis was vaginal NHL of large B cells, with the primary central germinal phenomenon, stage IE with a bulky mass.
The initial treatment was CHOP-R (cyclophosphamide, doxorubicin, vincristine, and prednisone, plus rituximab). The patient completed six courses of CHOP-R chemotherapy. The last clinical evaluation showed a complete clinical response (Figure ). The patient was under control.
|
pmc-6373885-1
|
The patient is a 61-year-old lady who presented to the emergency department (ED) with a one-day history of severe lower abdominal pain and nausea. She had previously undergone pelvic exenteration with a permanent end colostomy for stage IIIb cervical cancer. Approximately two years later, she developed a parastomal hernia and had been managing it conservatively. On this admission, she was diagnosed with an incarcerated parastomal hernia.
Emergency laparotomy was performed with the resection of more than one-and-a-half meters of gangrenous bowel and the stoma was re-fashioned more superiorly to its original location. An UltraPro (Ethicon, Inc Somerville, NJ, US) surgical mesh was applied with primary closure. The surgery was completed successfully and the patient was then transferred to the ICU for further monitoring.
Approximately one week later, the patient was pyrexial and had not responded to treatment sufficiently. On CT imaging, there was a five-centimeter collection identified over the mesh. The wound was then opened, re-explored in the ICU, and debridement was completed. Initially, the wound dimensions were 20 cm x 23 cm x 5 cm, with exposure down to the rectus sheath. To ensure healing, the VeraFlo™ Vacuum (KCI Technology, San Antonio, TX, US) with instillation dressing was commenced at -125 mmHg with a sterile saline solution being cycled for three hours prior to vacuum application. The dressing was changed three times weekly and prior to replacement, the dressing was soaked in saline solution for 20 minutes. After seven weeks, the wound had reduced to 9 cm x 5 cm x 1.6 cm. There was also a dramatic decrease in the amount of exudate and debris over the seven weeks, which resulted in a decreased instillation volume. During this time, the patient also reported improved pain control relative to the post-operative period.
The dressing was then switched to the ActiVAC™ therapy (KCI Technology, San Antonio, TX, US), a more compact, portable version of NPWT, which allowed the patient more freedom to mobilize. This helped to facilitate the discharge planning process. Within the following two weeks, the wound had completely healed (Figure ) without the necessity of a skin graft or tertiary closure. One year later, the patient had not experienced any late complications on outpatient follow-up.
The authors would like to disclose that KCI Technology provided financial support for ASRB to attend and present at a conference previously.
|
pmc-6373887-1
|
A 14-year-old adolescent male was brought to Chigateri Government Hospital Davangere, Karnataka, with an alleged history of self-falling on to a rock from a height of seven feet while playing and sustaining an injury to his right knee. Pain was sudden in onset, localized to the right knee, excruciating in nature, aggravated on movement, and relieved on immobilization. The patient was unable to walk. On local examination, swelling and an abrasion, measuring 1 cm in length, 2 cms in breadth, were present on the anterior aspect of the right knee. The skin over the swelling was stretched and shiny. The superior pole of the right patella was not palpable while the inferior pole was most prominent. The patellar tendon was taut and intact. The patient was comfortable in 85 degrees of flexion in the right knee (Figures -). A further five to 10 degrees passive flexion was possible but was painful. Further tests were not performed due to the discomfort of the patient. The normal range of movements was present at the ipsilateral hip and ankle joint. There were no distal neurovascular deficits.
Investigations
a. Blood investigations: Within normal limits.
b. X-ray of right knee: anteroposterior and lateral views (Figures -) show intra-articular, intercondylar dislocation of the patella.
c. Emergency ultrasound report: Partial tear of the quadriceps tendon with minimal joint effusion.
d. MRI of the right knee joint was done (Figure ), which reported intercondylar dislocation of the right patella oriented in the horizontal axis, buckling of the quadriceps tendon with a partial tear near the attachment of the patella, intra-substance edema in the anterior cruciate ligament, and supra-patellar bursa effusion with fluid level, denoting hemarthrosis.
The patient was immobilized with an above-knee slab until he was taken to the operation theater for further management.
Course of patella dislocation reduction
Under general anesthesia with muscle relaxation, closed reduction was attempted and was successful at the first attempt. The right knee was completely flexed. The patella was pulled downwards and pushed upwards by placing both the thumbs over the inferior pole of the patella. Once the patella was relocated, the full range of movements of the right knee was normal without any patellar instability with intact patellar tendon. The reduction was cross-checked in the image intensifier, both in the anteroposterior and lateral views (Figures -).
Quadriceps tendon repair
A para-medial incision was given longitudinally over the superior pole of the patella, extending proximally along the quadriceps (Figure ). Bruising of the quadriceps muscle was noted, with an existing 40% tear in the superolateral aspect of the quadriceps tendon (Figure ).
A non-absorbable polyethylene terephthalate suture (Ethibond, Ethicon Inc., New Jersey, United States) was used to repair the tendon tear. An above-knee cylindrical slab was applied in the complete extension of the right knee joint. The postoperative period was uneventful. The patient was allowed partial weight bearing on immediate post-op Day 1. Check X-rays of the right knee in the anteroposterior (AP) and lateral views were taken (Figures -). Skin sutures were removed on the tenth postoperative day; the cylindrical slab was continued for three weeks. Follow-up was done in the first, second, and third months. Active quadriceps exercises of the right knee were started from the first follow-up. On every visit, the range of movements was satisfactory, with no visible deformity.
|
pmc-6373888-1
|
A 23-year-old male with no prior medical history was found unconscious in a construction building. Minutes prior to the incident the patient was noticed to be walking and behaving erratically, drinking excessive amounts of fluids. A friend who accompanied the patient specified that the patient was not engaged in overly exertional work and that he was wearing light clothing. Further questioning revealed no history of substance abuse and no previous history of heat-related illnesses. On arrival to the emergency department (ED) the patient was in obvious distress, normotensive (BP 102/64 mmHg), tachycardic (HR 159 bpm), tachypneic at 42 breaths per minute and febrile on rectal temperature (43.3°C/109.9°F). Initial electrocardiogram (EKG) showed sinus tachycardia. Initial labs showed electrolyte disturbances, abnormal transaminase and acute kidney injury. In addition, elevated troponin and creatine kinase were observed. Laboratory values have been shown in Table . Urinalysis was negative for infection. Cooling protocol was initiated with use of ice packs when the patient suddenly became unresponsive. The patient was intubated to secure the airway and a few minutes thereafter he suffered cardiac arrest. Advanced cardiovascular life support was initiated and the code was run for nine minutes. The patient received three doses of epinephrine, three doses of bicarbonate and two doses of calcium gluconate. Initially the rhythm was reported as pulseless electrical activity (PEA) followed by ventricular fibrillation; after which the patient was defibrillated achieving return of spontaneous circulation (ROSC). Broad spectrum antibiotics including coverage for meningitis and aspiration pneumonia (vancomycin, ampicillin, ceftriaxone and metronidazole) were initiated. Lumbar puncture was unremarkable. Chest radiograph after the cardiac arrest showed left side infiltrates (Figure ). Hypothermia protocol was started and the patient was transferred to medical intensive care unit (MICU).
Due to worsening infiltrates on Chest X-ray and PO2/FiO2 < 300, acute respiratory distress syndrome (ARDS) protocol was initiated. Ceftriaxone and metronidazole were continued, along with transcutaneous pacing due to sinus bradycardia. After rewarming, 48 hours later, physical examination showed a Glasgow Coma Scale score of seven with preserved brain stem function. Subsequently, the patient was witnessed to have several episodes of clonic seizures. Magnetic resonance imaging (MRI) of the brain showed patchy areas of restricted diffusion of both cerebral hemispheres, more extensive in the right in a watershed distribution (Figure ). Subsequent electroencephalogram revealed severe diffuse metabolic encephalopathy. Urine toxicology screen was positive for benzodiazepines that were administered during the admission. Seven days after admission the patient started showing signs of neurological improvement. He demonstrated left side upper and lower extremity hemiparesis and full range of activity on the right evidenced by following simple commands. The patient was extubated with no complications and nasogastric tube feeding was continued but due to patient agitation, percutaneous endoscopic gastrostomy (PEG) tube was placed to provide adequate nutrition. The patient showed progressive neurological improvement, following more commands with the right-side extremities, receptive language skills with hands and improved swallowing movements. Before discharge the right side of the body was completely functional. Physical therapy was continued as outpatient.
|
pmc-6373889-1
|
This is the case of a 46-year-old African American woman with a history of hypertension, who presented with upper back pain that began a week prior to presentation. The pain was intermittent, sharp, 8/10, radiated to the lower back, aggravated by movement, especially on leaning forward; and not relieved by nonsteroidal anti-inflammatory drugs (NSAIDs). The patient denied any weakness, numbness, bowel, or urinary incontinence. The morning of the presentation, the patient was awoken from her sleep by 10/10 mid-sternal chest pain. Pain was pressure-like in character with no associated symptoms. Initial emergency room (ER) vitals revealed a difference in blood pressure of approximately 20 mmHg between the lower and upper extremities (right arm, 170/115; left arm 179/112; right leg 202/115; left leg 197/126) and the chest pain disappeared with narcotics; however, the intermittent upper back pain continued. The physical examination was significant for reproducible midsternal chest pain. Initial labs were significant for very high acute phase reactants, marginally elevated D-dimer at 1.96, and negative troponins. Computed tomography (CT) angiogram ruled out pulmonary embolism (PE) but revealed circumferential thickening of the descending aorta and a mildly ectatic ascending aorta. Subsequently, aortic magnetic resonance imaging (MRI) with contrast showed an enhancement of adventitia with non-enhancing media (Figures -). This was thought to be either due to aortitis or aortic dissection. Subsequent trans-esophageal echocardiography was not consistent with aortic dissection, making aortitis the most probable diagnosis. Infectious tests with blood culture were unremarkable. Additionally, tests for HIV, viral hepatitis, and syphilis were also negative. Vasculitis tests, such as antinuclear antibody (ANA), antineutrophil cytoplasmic antibody (ANCA), and anti-cyclic citrullinated peptide (anti-CCP), were also normal. The patient was diagnosed with single organ (aorta) vasculitis and was started on high-dose corticosteroid. Due to the persistence of severe chest pain, a decision was made to proceed with thoracic endovascular aortic repair (TEVAR; Figure ). Immediately post-procedure, the patient experienced a dramatic improvement in pain and was discharged on a slow, tapering course of corticosteroid.
|
pmc-6373891-1
|
An otherwise healthy, 43-year-old Caucasian man was diagnosed with clinical/radiologic T3c N2b M0 low rectal adenocarcinoma with a threatened circumferential resection margin. His complete blood count, renal, and liver function tests were within normal limits. The patient underwent dihydropyrimidine dehydrogenase (DPYD) genotype testing as part of a personalized medicine program, which suggested normal DPYD enzymatic activity. He started neoadjuvant chemoradiation therapy consisting of standard-dose capecitabine (825 mg/m2 oral twice daily, seven days a week) and 5040 cGy in 28 fractions with a concurrent boost to 5760 cGy in 28 fractions to the primary tumor and involved lymph nodes delivered by tomotherapy. After 23 fractions, the patient presented with pain and erythema involving his hands and feet as well as his penis and scrotum. The patient also reported narrowing and deviation in the direction of his urinary stream due to a white exudate, which had developed at the urethral opening. The patient had self-limiting, sharp cramping pains in the mid-abdomen. He was instructed to discontinue capecitabine. Radiotherapy was placed on hold.
Five days after discontinuing capecitabine, the pain and redness in his hands and feet had improved, but the findings at the tip of his penis had not improved. On physical examination, there was circumferential erythema to the glans penis (Figure ). There was a thin, white exudate affecting the corona and tip of the glans (Figure ). The groin and lateral aspects of the scrotum had mild erythema in the skin folds. In the perineum and perianal areas, there was more extensive erythema with non-confluent moist desquamation with exudate consistent with radiation dermatitis. The patient was instructed to apply petroleum jelly and non-stick gauze pads to the affected area and increase water intake. The exudate demonstrated probable contamination with Pseudomonas aeruginosa. No antibiotics were started. Seven days after discontinuing capecitabine, the penile erythema and exudate, as well as the perianal moist desquamation, had begun to resolve. Eleven days after discontinuing capecitabine, improvement in pain, erythema, and urinary symptoms were noted. The patient underwent the remaining fractions of radiotherapy without capecitabine. One-month post-treatment magnetic resonance (MRI) showed a decrease in tumor volume with a plan to undergo a low anterior resection of his rectal cancer.
|
pmc-6374296-1
|
A 63-years-old Chinese female presented with asymptomatic palpable abdominal mass, increased carbohydrate antigen 19-9 (CA-199) level and pelvic mass on CT scan. An opening surgery observed an appendiceal mass involving the entire layer of the appendix, rupture, invasion of bilateral ovaries, wide-spreading nodular implantations with pseudomyxoma in peritoneal cavity, greater omentum, small intestine mesentery and hepatic and splenic regions. Debulking surgery with peritoneal nodule ablation and mucus reduction was performed in Beijing 301 Hospital. Postoperative pathology confirmed mucinous adenocarcinoma of the appendix T4NxM1, stage IV with peritoneal carcinomatosis (). After surgery, the patient received one time standard perioperative hyperthermic intraperitoneal chemotherapy (HIPEC) with mitomycin C. Because of the excessive peritoneal carcinomatosis, the patient was given three cycles of postoperative intraperitoneal chemotherapy (EPIC) with 5-FU plus mitomycin C. The patient remained symptom free for 1 year until she developed progressive abdominal distension, loss of appetite and worsening nourishment. The patient failed to response to further systemic chemotherapy, and a large number of PPM (). Then a second surgery was performed, intestinal obstruction by mucous cavities was observed, and a colostomy was given. Shortly after operation, cetuximab, a monoclonal antibody binding to and inhibiting EGFR, was given to the patient for 20 days (yet without gene testing) at a local hospital, but failed to show any improvement. By then the patient had tried all available approved options and became refractory to the treatments.
At the time when the patient visited us, she was severely wasted, with progressive abdominal distension and elevated CA-199 level at 5436.7 U/ml. Considering her weak constitution and failure of previous interventions, alternative treatment strategies, especially a rationally designed targeted therapy, emerged to be the last-ditch option to the patient. Targeted therapy is usually based on a patient's genomic profile by genetic testing. In order to find the accurate target, we decided to use the paraffin-embedded surgical tumor tissue from the patient, and detect gene mutations using the TruSeq Rapid Capture Exome Kit for whole exome sequencing (WES) on the Illumina NextSeq500 sequencing platform. The WES data was then analyzed using OncoDecoder™ (Genomic Future, Inc. USA). Several key gene mutations were identified including a missense mutation p.Gln472His (exon 11) in KDR/VEGFR-2, a missense mutation p.Arg281Gln (exon 8) in FGFR1, a missense mutation p.Lys296Arg (exon 7) in FGFR2, a missense mutation p.Thr654Ser (exon 14) in FGFR3 and a missense mutation p.Gly12Asp (exon 2) in KRAS. Additional 38 gene mutations including TP53, ERBB2, KIT, GNA11, and JAK3 were also detected ().
Although no NCCN-guided targeted therapy regime for appendiceal mucinous adenocarcinoma is documented as of to-date, there are two approved drugs for colorectal cancer may be considered as potential candidates: bevacizumab and cetuximab. Bevacizumab is a monoclonal antibody blocking the VEGF ligand, and bevacizumab in combination with standard chemotherapy has been approved by FDA as first line treatment for metastatic colorectal cancer (, ). We predicted that bevacizumab may be a suitable targeted drug candidate for our case based on the following three reasons: Firstly, the gene testing results showed several mutations involving KDR/VEGFR-2, FGFR1, FGFR2, and FGFR3. Although these mutations are currently classified as variation of uncertain significance (VUS), hyperactive VEGF pathway is a common event in colorectal cancer and contributes to tumor metastatic activity (). A recent study from the MD Anderson cancer center showed improved average overall survival and progression-free survival by providing anti-VEGF treatment to patients diagnosed with unresectable appendiceal epithelial neoplasm (yet no gene testing was performed) (). This finding suggests that VEGF hyperactivity could be a common event in appendiceal cancer, and bevacizumab could be a promising targeted drug. Next, it has been known that the efficacy of certain EGFR monoclonal antibody drugs, including cetuximab and panitumumab, could be affected by KRAS mutation (). Indeed, in the present case, we identified KRAS p.Gly12Asp missense mutation, which could cause inefficient response to cetuximab (). However, the efficacy of bevacizumab for colorectal cancer treatment has been testified to be independent from KRAS mutation (). Thirdly, there was no contraindication of bevacizumab usage to the patient. The common risk factors include low WBC count, high blood pressure, impaired heart function and poor renal function.
Under our advice, the patient received treatment of bevacizumab (7.5 mg/Kg, in total 450 mg, IV-GTT) plus oxaliplatin (130 mg/m2, in total 200 mg IV-GTT) on day 1 every 3 weeks for 6 cycles since August, 2016. Follow-up examination after treatment showed significant improvement of the patient's condition, and CT scan imaging results showed dramatic reduction of her peritoneal mucus (as shown in ). In addition, the patient's CA-199 level decreased from 5,436.7 U/ml (before treatment) to 1121.4 U/ml (after treatment). Afterwards, the patient received continuous maintenance treatment using bevacizumab (7.5 mg/Kg, in total 450 mg, IV-GTT on day 1 each 3 weeks) plus capecitabine (1,500 mg, oral, twice a day) for days 1 to 14 until now. The patient has been followed up routinely to evaluate the treatment efficacy and to monitor the adverse effects. The main adverse effects were numbness in the hands and feet, dry nose and epistaxis, dry throat, fatigue, loss of appetite. The patient has been progression-free as of recent follow-up on September 26th, 2018 with the most recent CA-199 being 401.26 U/ml on August 15th, 2018.
|
pmc-6374324-1
|
A 19-month-old boy who had born in March 2015 with multiple brown-black skin pigmentation on the face, trunk, and right leg, with multiple satellite lesions (). He was referred to hospital because of repeated vomiting for 4 days. He had a round face, full cheeks, prominent forehead, hypertelorism, periorbital fullness, short nose, and everted lower lip. The largest nevus was on the leg, of about 13 cm in diameter [(13 × 10), (8 × 6), (4 × 2) cm]. Enhanced MRI showed hydrocephalus (). A shunt surgery was done, to relieve the symptoms of intracranial hypertension, followed by MRI and/or computed tomography (CT) assessment every 3 months. The result of 6 months post-shunt MRI revealed the presence of supratentorial ventricular dilatation, brain stem volume reduction, in addition to leptomeningeal enhancement, however, no macroscopic mass was evident. Three months later, MRI showed a mass of 3 cm diameter, in the right frontal lobe. Although the tumor was completely resected, the patient died 4 months after surgery.
Pathological evaluation of CNS lesion, revealed that the mass was grossly dark-red to brown with the size of (4 × 4 × 2) cm. The tumor was firmly attached to the meninges. Microscopically, the tumor cells had atypical nuclei, obvious nucleoli, an increased karyoplasmic ratio, some mitoses, and remarkable necrosis, which infiltrated the brain parenchyma, accompanied with melanin deposition.
Immunohistopathological evaluation as shown in disclosed that the tumor cells were positively expressing the antibodies of HMB45, Melan-A, and S100. Ki-67 was positively expressed in 30% of the cells, while P53 was negative.
Cytogenetic study using fluorescence in situ hybridization (FISH) revealed a lack of allelic deletion of P53. ARMS-PCR disclosed NRAS mutation in the third exon (codon 61), with a wild-type BRAFV600E ().
|
pmc-6374324-2
|
A 4-year-and-9-months-old girl who had a brown-black skin pigmentation over her neck since birth, presented with headache and vomiting of 10 days duration. The largest diameter of the nevus was 12 cm (12 × 9.5 cm). Clinical examination revealed disturbed walking, balance, and coordination. CT and MRI disclosed a mass occupying most of the left cerebellar hemisphere, reaching the dura (. She underwent complete surgical resection, however, she died 3 months after surgery, due to progressive disease.
Pathological evaluation of CNS lesion, revealed that the mass was grossly grayish-red to brown, of soft consistency, and the size of (4 × 3 × 2) cm. Microscopically, the tumor cells exhibited atypical nuclei, obvious nucleoli, and large number of mitoses, accompanied with outstanding necrosis and melanin deposition.
Immunohistopathological study showed that the tumor cells were positively expressing the antibodies of HMB45, Melan-A, and S100. Moreover, Ki-67 was positively expressed in 50% of cells ().
|
pmc-6374494-1
|
A 71-year-old man with a history of atrial fibrillation, acute appendicitis, and early esophageal cancer treated with endoscopic submucosal dissection underwent distal pancreatectomy with splenectomy for treatment of pancreatic body cancer (Fig. a). Pathological examination showed well-differentiated tubular adenocarcinoma (pT3, pN0, pM0). The Union for International Cancer Control (UICC) stage was established as IIa (Fig. b). After surgery, the patient received adjuvant chemotherapy of S-1 for 6 months. Multi-detector row computed tomography (MDCT) showed a 30-mm nodule at the lesser curvature of the stomach 17 months after pancreatectomy during postoperative surveillance (Fig. a). Positron emission tomography (PET)/CT showed fluorodeoxyglucose (FDG) uptake in the nodule; maximum standardized uptake value uptake (SUVmax) was 3.5 (Fig. b). Upper gastrointestinal endoscopy revealed mucosal irregularity in the posterior wall of the lesser curvature of the gastric body (Fig. c) and submucosal tumor in the anterior wall of the stomach antrum (Fig. d). Endoscopic ultrasound (EUS) showed the hypoechoic submucosal tumor, which was diagnosed as adenocarcinoma by fine-needle aspiration (FNA) cytology.
Based on these findings, we diagnosed lymph node metastasis of PDAC invading the gastric wall, and the patient was treated with gemcitabine and S-1 combination (GS) therapy for 6 months. Considering the patient’s age and prior pancreatic resection, we selected GS therapy due to its relatively high response rate and manageable complication rate found in a previous phase III study for unresectable pancreatic cancer (GEST study) []. Because the tumor size did not change over 6 months and CA 19-9 decreased from 54 to 28 U/mL, we decided to perform total gastrectomy and prophylactic cholecystectomy for tumor resection.
Macroscopically, two nodules were located in the stomach, with one in the wall of the lesser curvature and the other in the antrum anterior wall (Fig. a). Pathological examination showed that these were well-differentiated tubular adenocarcinomas in the subserosa and muscularis propria of the stomach. The tumor was not exposed to the mucosa and serosa, and there was no lymph node involvement (Fig. b).
Surprisingly, there was a tumor in the neck of gallbladder; pathological examination revealed this was a well-differentiated tubular adenocarcinoma in the subserosa (Fig. c, d).
As the pathological findings of these tumors were similar to the lesion initially resected by distal pancreatectomy, we diagnosed metachronous gastric and gallbladder metastases from PDAC.
The patient’s postoperative course was uneventful, and the patient was discharged on postoperative day 16. Because of prior S-1 adjuvant therapy after pancreatectomy and GS therapy before gastrectomy/cholecystectomy, we elected to defer further chemotherapy. A liver metastasis was discovered 7 months after the second operation. He was then treated with GS therapy followed by gemcitabine and albumin-bound paclitaxel combination therapy and modified FOLFIRINOX therapy. At 41 months after the second surgery, the patient remained alive.
|
pmc-6374786-1
|
A 68-year-old woman with no previous medical history presented to the Emergency Room for weakness, dizziness, and nausea of a few days duration. At presentation, blood pressure was 133/64, heart rate 51, temperature 36.8, and respiratory rate 16. An EKG showed sinus bradycardia, a prolonged QT interval, and prominent U waves (). Blood tests revealed a creatinine of 338 μmol/L. Potassium was 1,7 meq/L, sodium 120 meq/L, chloride 61 meq/L, pH 7.57, and bicarbonates 43 meq/L. Urinalysis was as follows: sodium, 6 meq/L; potassium, 28 meq/L; chloride, <10 meq/L. Serum renin and aldosterone were ordered upon admission; after a few days delay, the values came back elevated at 152 ng/L and 3000 pmol/L, respectively. An abdominal ultrasound showed normal kidneys and bladder and a moderate quantity of fluid in the rectum. A renal scintigraphy revealed bilateral moderately severe renal dysfunction, which was suggestive of acute kidney injury. Diuresis was overall preserved (682 cc over the first 24 hours) and improved after fluid resuscitation (1800 cc on day 2). The hemodynamic and electrolyte status were normalized following the administration of approximately 3.5 liters of normal saline intravenously (IV), 180 mEq of oral and 180 mEq of IV potassium chloride over the first two days. Awaiting some laboratory results, a working diagnosis of renal tubulopathy was later disproved. The patient was discharged one week later with spironolactone and potassium chloride tablets and was referred to a nephrologist to plan further investigations.
She presented two days later with a recurrence of symptoms, new-onset atrial fibrillation, and severe hyponatremia at 113 meq/L. Although the patient denied having diarrhea, a thorough questionnaire revealed a three-month history of soft stools and mucoid discharge per rectum. At digital rectal examination, a soft mass was palpated. Sigmoidoscopy revealed the presence of a large secretory villous adenoma extending from anal margin to 10 cm. This confirmed the diagnosis of the McKittrick-Wheelock syndrome (MWS). Multiple biopsies showed a tubulovillous adenoma with focal high-grade dysplasia.
The patient underwent transanal endoscopic microsurgery (TEMS) successfully (). However, atrial fibrillation recurred postoperatively and consequently she was started on low-molecular weight heparin and warfarin. Creatinine and electrolytes all normalized after surgery. shows the evolution of laboratory values from initial admission to postoperative day 4. She was discharged on postoperative day 6. Final pathology confirmed clear resection margins and the absence of invasive adenocarcinoma.
|
pmc-6374787-1
|
The patient is a 74-year-old male with comorbidities of coronary artery disease, congestive heart failure, hypertension, and renal insufficiency who presented to an outside hospital with back pain and left upper extremity weakness associated with high fevers and urinary incontinence. Outside spinal imaging showed a large spinal abscess; therefore, he was transferred to our institution for a higher level of care. On presentation, the patient was in septic shock requiring fluid boluses and inotropic agents to stabilize him. Further history was obtained from the family as follows:On November 2016, he underwent an elective right TKA complicated by an early MRSA PJI associated with bacteremia On May 0f 2017, he underwent resection of the hardware in the knee, incision and drainage, followed by 12 weeks of daptomycin therapy Five months later, on October of 2017, due to relapse, he had a second debridement of the right knee for source control as well as left ankle incision and debridement followed by another 8 weeks of daptomycin for this relapse of infection A daptomycin-susceptible, vancomycin-susceptible MRSA was isolated from blood and both surgical sites, knee and ankle, on both occasions He had ongoing thoracic back pain since 2016 which was monitored radiographically by his local providers, until the development of spinal epidural abscess with upper extremity weakness, which prompted his current hospitalization in January of 2018
Review of systems on presenting to our institution was significant for general weakness and malaise, right shoulder and thoracic back pain, and constipation from narcotics. He was hemodynamically unstable requiring inotropic support. He was awake and oriented, following commands with intact speech. There were no cranial nerve deficits. On motor testing, he had normal muscle bulk with generalized hypotonia. There was no movement of his left upper extremity. He had 2/5 strength on his right upper extremity and 2/5 strength on his bilateral lower extremity. There was decreased sensation to light touch on his left side. Reflexes were globally decreased with negative Hoffman and Babinski signs. The white blood cell count was 30,000/L, and procalcitonin was 4.88 ng/ml. Blood cultures grew MRSA rapidly. Repeat imaging of the brain and spine at our institution showed extensive epidural phlegmon throughout the cervical, thoracic, and lumbar spine with intracranial expansion into the posterior fossa beneath the cerebellum with pockets of possible early organizing abscess within the phlegmon (). Brain imaging identified no discrete abscess or leptomeningeal enhancement.
Neurosurgery immediately evaluated the patient and promptly performed a cervical spine decompression of C1–C7 and thoracic spine decompression of T5–T7. Operatively, a large epidural abscess was found, drained, and washed out. He was started on vancomycin every 12 hours with trough vancomycin levels being therapeutic. The patient subsequently underwent irrigation and debridement of the right knee, left ankle, and left great toe as well at our institution; all surgical sites grew MRSA with vancomycin MIC of 1 mcg/ml. Despite attempts at source control and optimal pharmacokinetic dosing of vancomycin with a trough level of 20.5 mcg/ml on day 5, he had refractory MRSA bacteremia. Infectious disease deemed he had failed daptomycin therapy; therefore, ceftaroline 600 mg every 8 hours (MIC of 0.38 mcg/ml) was added to vancomycin. Repeat blood cultures showed clearance of bacteremia after 48 hours of initiation of the combination therapy. His left ankle and right knee continued to yield MRSA. Due to his multiple comorbidities and need for more aggressive source control of his infection, i.e., amputation of the leg, palliative care was sought by the family, and he died a few days later.
|
pmc-6374790-1
|
An 11-year-old Saudi female, presented with fever, pain, and swelling in the left foot for a 6-month duration. Magnetic resonant imaging (MRI) of the left lower limb confirmed the diagnosis of multifocal, chronic osteomyelitis involving the distal left fibula, lower part of both tibiae, and metatarsal bones of both feet (). Surgical incision and drainage in the affected lower limb was done, and the aspirated fluid and bony tissue biopsy excluded fungal and bacterial causes of chronic osteomyelitis, including mycobacterial tuberculosis. Initial management by intravenous antibiotic therapy was provided; however, it was stopped following negative bacterial culture.
Subsequently, she was referred to our service because of stunted growth, past history of chronic bloody diarrhea, abdominal pain, and multiple blood transfusions following recurrent, and severe hemoglobin drop. Family history was remarkable for Crohn's disease in a paternal aunt.
Physical examination revealed pallor and stunted growth.
Initial laboratory workup showed features of iron deficiency anemia, high erythrocyte sedimentation rate (ESR), and high C-reactive protein (CRP). Upper digestive endoscopy was unremarkable, with normal duodenal, stomach, and esophageal histology. The diagnosis of UC was established following clinical, colonoscopic, histological, and radiological findings. Hence, colonoscopy showed features of pancolitis with pseudopolyps in the entire colon; histology showed features of chronic active colitis, crypt architectural distortion, and absence of granuloma (); terminal ileum (TI) was normal macroscopically and histologically; and magnetic resonance enterography (MRE) excluded small bowel disease. The final diagnosis of ulcerative colitis UC in association with chronic multifocal osteomyelitis was made. A remarkable remission for intestinal and bony symptoms as well was achieved following IBD therapy prednisolone, mesalamine, and azathioprine.
|
pmc-6374802-1
|
A 22-year-old female presented to the emergency department in a wheelchair with left lower extremity weakness and numbness, left low back pain, and left hip pain radiating to the left foot. She apparently had been found lying on the sidewalk. She stated that the pain felt similar to a “spasm”. There were no aggravating or alleviating factors. She had no similar prior episodes. She admitted to drinking alcohol and using illicit drugs the previous night. She reported that she awoke with the pain but could not remember if she had experienced a loss of consciousness. There was a large ecchymotic area on her left forehead, so she assumed that she had fallen. She could not remember any additional details. She noted that her leg pain has gotten progressively worse throughout the day.
Review of systems revealed ecchymosis to the left frontal area, pain in left lower extremity and hip with light palpation, decreased range of motion in left hip and knee, numbness of the left lower extremity, and weakness of the left lower extremity. Review of systems was negative for fever, chills, headache, chest pain, shortness of breath, nausea, vomiting, or change in urination or bowel movements. She had no known medical problems other than anxiety. She had no known drug allergies or previous surgeries. She endorsed illicit substance use and alcohol use.
Physical exam revealed a heart rate of 112 bpm, blood pressure of 145/95 mm Hg, respiratory rate of 18/ min, oral temperature of 98.1 degrees Fahrenheit, and oxygen saturation of 98% on room air. Her height was recorded as 5 feet 4 inches (162.6 cm), weight 143 pounds (64.9 kg), and body mass index (BMI) 24.5. The patient was in moderate distress, very uncomfortable, and restless. Her pupils were equal and reactive bilaterally. Extraocular muscles were intact. There were no signs of a basilar skull fracture. Nares were patent bilaterally. Hearing was normal. Tympanic membranes were clear. There was moderate sized ecchymosis to the left frontal region without any appreciable step-off or deformity. There was no bony midline cervical tenderness to palpation. Trachea was midline. Chest was nontender without deformity or crepitus. Heart was regular rate and rhythm. Lungs were clear to auscultation bilaterally with good excursion. Abdomen was nontender, nondistended, with normal bowel sounds in all four quadrants. Normal perfusion was exhibited in all extremities with brisk capillary refill of less than two seconds. She had 2+ pulses bilaterally (radial, femoral, and dorsalis pedis). Her left lower thoracic and lumbar regions were tender to palpation with associated decreased range of motion in all directions. Muscle strength was 5/5 in the upper extremities bilaterally. Muscle strength was 5/5 in the right lower extremity and 3/5 in the left lower extremity. Deep tendon reflexes were 1+ left Achilles, 1+ left patellar, 2+ right Achilles, 2+ right patellar, 2+ bilateral biceps, and 2+ bilateral triceps. Patient was extremely tender on palpation of her entire left lower extremity extending from the hip distally to her left foot. Left lower extremity range of motion was severely limited due to pain. Cranial nerves II-XII were intact bilaterally. She had an antalgic gait. Cerebellum testing was within normal limits. She had diminished sensation to light touch in her left lower extremity. Romberg testing was normal.
Test results revealed a serum alcohol level <10, a negative urine pregnancy test, and a serum creatine kinase (CK) level within normal limits. Basic laboratory evaluation including complete blood count, chemistry panel, and liver function testing was unremarkable. CT brain, CT cervical spine, X-rays of the thoracic spine, X-rays of the lumbar spine, and X-rays of the left hip were all negative.
The patient complained of persistent, severe pain despite multiple attempts at controlling her pain using different modalities. The on-call neurologist was consulted and recommended an emergent MRI of her lumbar spine. Patient was transferred from the ED to a tertiary care center where she underwent this study. MRI results ultimately revealed high intensity signal at the left quadratus femoris, gluteus maximus/medius/minimus, and piriformis with significant overlying subcutaneous edema and inflammation consistent with gluteal compartment syndrome. Patient subsequently underwent a fasciotomy with resultant improvement in her abnormal sensation and deep tendon reflexes.
|
pmc-6374803-1
|
A 69-year-old Caucasian female was brought to the emergency room by her family for worsening confusion that began 3 days prior to admission. Her son reported that she had not been acting like herself, had been confused, and had been sending him some gibberish text messages. They also noticed that the patient was very quiet, which was unusual for her. She had trouble finding words and her speech did not make sense. She seemed to be indifferent and inattentive at times and had urinary incontinence. There was no history of fever, chills, headache, nausea, vomiting, photophobia, diplopia, or seizure activity. She denied any skin rash or ulcers. She liked to garden in her free time.
Her general physical examination was unremarkable, and she was well-nourished. Vital signs were within normal limits. Ophthalmological examination revealed bilateral 3 mm reactive pupils with full conjugate extraocular movements and no nystagmus or ptosis. Visual acuity was 20/50 in the right eye and 20/100 in the left eye. Funduscopic examination revealed slightly blurred disk margins on the left, with sharp disk margins on the right; the retinal vascularity was normal. She was alert and cooperative and was oriented to self and time but not to place. She could add simple numbers but had difficulty with serial seven subtractions. She was slow to spell “world” backward. She spoke in short phrases and occasionally sentences. Her speech was fluent, but there was intermittent misuse of words and expressive dysphasia. Cranial nerves 2 through 12 were intact, except for a right eyelid droop. Motor examination revealed a slight pronator drift of the right arm. She had 5/5 muscle power in the upper and lower extremities, and her deep tendon reflexes were symmetric. Cerebellar examination showed slowing of the finger-nose testing and rapid alternating movements on the left but without tremor or dysmetria.
The complete blood count, metabolic panel, and inflammatory markers (ESR and CRP) were normal. She was HIV-negative, but the absolute CD4 count was 250/mm3 (reference range 500–1500/mm3). Neuroimaging showed centrally cavitary, peripherally enhancing intra-axial brain lesions, involving the right frontal lobe, the left basal ganglia, and the lateral aspect of the left cerebellar hemisphere (). She was started on IV dexamethasone (10 mg bolus) followed by 4 mg every 6 hours for cerebral edema. She underwent right frontal craniotomy the next day with removal of tan, creamy, partially liquefied necrotic material, which was sent for histopathology and cultures. The final histopathology was consistent with granulomatous amebic encephalitis (). Bacterial cultures were negative. Immunohistochemical and real-time PCR tests performed at the Centers for Disease Control and Prevention, Atlanta, GA, documented positive results for Balamuthia mandrillaris amoeba and negative immunohistochemical and real-time PCR results for Naegleria fowleri amoeba and Acanthamoeba species amoeba. DNA sequencing data were unavailable. As per the CDC recommendations, she was started empirically on a six-drug regimen of pentamidine (which has amoebastatic activity in vitro), sulfadiazine, azithromycin, fluconazole, flucytosine, and miltefosine (which has amebicidal activity in vitro). These treatment recommendations were mostly based on a few Balamuthia survivor case reports in the literature. Her hospital course was complicated by an ischemic stroke on postoperative day 3, and she clinically deteriorated with worsening mental status. Given the poor prognosis, her family decided to pursue hospice care, and she died a few weeks later.
|
pmc-6374805-1
|
A 30-year-old woman with no previous history of systemic inflammatory disease or neoplastic diseases developed loss of vision in the left eye and two days later in the right eye due to acute ON, followed by tetraparesis two weeks later. Spinal cord MRI obtained prior to treatment revealed LME, intraparenchymal contrast enhancement corresponding to the site of LME, and longitudinal extensive transverse myelitis (LETM) extending from C2 to Th3 ().
Cerebral MRI was normal. Cerebrospinal fluid contained 122 leukocytes/mm3 with polymorphonuclear predominance; oligoclonal bands were not determined. Aquaporin-4 (AQP4)-IgG was negative. Accordingly, seronegative neuromyelitis optica was suspected by that time. Follow-up MRI demonstrated resolution of LME four months later.
Retrospective testing by means of two cell-based assays employing fixed and live HEK293 cells, respectively, transfected with full-length human MOG revealed the presence of MOG-IgG antibodies in a serum sample taken at onset [, ]. MOG-IgG seropositivity was confirmed in a second sample taken four years later.
|
pmc-6374808-1
|
A 33-year-old male patient was referred from a private practitioner to the Department of Conservative Dentistry and Endodontics of Sathyabama Dental College and Hospital, Chennai, with the chief complaint of sensitivity and occasional pain in the left region of upper front teeth. On clinical examination, the patient had a crown-bridge prosthesis spanning from the left upper canine to the right upper canine. Since the crown-bridge prosthesis had a compromised stability, it was removed and an intraoral radiograph in relation to the #12 and #13 region was taken (). The radiograph revealed distoproximal dental caries involving enamel, dentin, and pulp of tooth #13. An electric pulp test suggested symptomatic irreversible pulpitis.
In the first visit, under local anesthesia (Lignox 2%; Indoco Remedies Ltd., Mumbai) and rubber dam (Hygienic, Coltene Whaledent) isolation, root canal treatment was initiated in #13. With the help of an endo-access bur (bur type FG-1; Dentsply, USA), an access cavity was made and a single root canal orifice was located. The tentative working length was found to be 26 mm with an apex locator (Root ZX mini; J Morita, Japan). Hand instrumentation (K-files, Mani Inc., Japan) was done till size #50. A copious saline and sodium hypochlorite (3%) irrigation was done during each instrumentation change. Calcium hydroxide (RC-Cal; Prime Dental Ltd., India) was placed as an intracanal medicament. The access cavity was temporized with Cavit (3M ESPE, Germany), and a second visit was scheduled for further management.
Before the scheduled second visit, the patient reported to the department with severe pain in relation to #13. On reentering into the access cavity, fresh bleeding was noted. Hence, multiple angulated radiographs with two #20-size hand K-files inside the root canal were taken to rule out the presence of any extra root canal. These radiographs were inconclusive of missed canals. According to the AAE and AAOMR Joint Position Statement (2016 update), cone beam computed tomography scanning with a low-field volume, following ALARA principles, was done. On analysing CBCT multiple axial images (Figures –), a second root canal (palatal canal) was seen branching out from the main root canal (buccal canal) at the middle third of the root. The palatal root canal joins the buccal root canal at the apical third, just before the exit suggesting Vertucci type III canal configuration (Figures and ). The palatal canal was negotiated with #10 hand K-files under a dental operating microscope (Seiler Alpha Air 3; St. Louis, USA) at 10x magnification. A working length radiograph was taken to confirm the presence of the palatal canal (). After orifice enlargement with a #1 Gates Glidden drill (Mani Inc., Japan), instrumentation was done till #20 hand K-file (Mani Inc., Japan) followed by preparation of the remaining canal using the Self-Adjusting File (SAF; ReDent, Ra'anana, Israel) and the VATEA irrigation pump for chemical debridement with 3.5% sodium hypochlorite during canal preparation.
In the scheduled third visit, the patient was asymptomatic. In view of complicacy of the root canal, the obturation of both root canals () was carried out using thermoplasticized gutta percha (Elements; Sybron Endo, Germany). The follow-up review radiograph () after 6 months revealed no periapical changes, and the patient was found to be asymptomatic.
|
pmc-6374811-1
|
The patient was a 41-year-old female with past medical history of appendectomy and dysmenorrhea. She presented to the emergency department with nausea, severe vomiting, and acute pain in the lower abdomen. She reported having experienced asthenia and weight loss for one month. On clinical examination, abdominal distension and tenderness were discovered. Blood tests revealed leukocytosis with neutrophilia, and a contrast-enhanced abdominal computed tomography (CT) showed a 7 × 7 × 4 cm hyperenhanced mass in the cecum that caused complete bowel obstruction (). Also, a 5 × 3 × 3 cm right adnexal mass that compromised the ovary with intimate contact with the uterus was found (). Furthermore, the CT showed dilated loops in the small bowel (>4 cm), some of which had an enlarged wall thickness and presence of intraluminal fluid stasis ().
With these findings, particularly the observation of a mass through the CT scan, and due to the evident weight loss that the patient had undergone, neoplasia could not be ruled out. Surgery was decided, and at laparotomy, a volume of 200 ml of inflammatory fluid was found in the cavity. Most of the loops of the distal ileum were dilated, and a 7 × 7 × 3 cm cecum mass was discovered, which compromised the ileocecal valve and caused complete bowel obstruction. Surgical decision was straightforward, the cecum mass was completely resected, and a right hemicolectomy was executed. An ileocolic anastomosis was also performed during the procedure. Furthermore, the right adnexal mass that was previously identified through the CT scan (measuring 4 × 3 × 2 cm) was observed to be firmly attached to the ovary and the fimbriae and displayed a pale external capsule surrounded by a cystic component. Gynecology consultation was required, and due to the size of the mass and its characteristics, surgical removal of the right adnexal mass was performed. After completion, closure of the abdominal wall was performed, and the remainder of the procedure continued without any complications.
Pathology revealed a 4 × 3 × 2.5 cm blueish heterogenic mass that occluded 90% of the lumen of the cecum and the ileocecal valve. Microscopy revealed that the colon wall was invaded by glands and endometrial stroma. The colonic epithelium showed inflammatory changes and was negative for malignancy (Figures and ). In the ovarian parenchyma, an endometrial cyst was discovered, covered with siderophages. Glands and endometrial stroma were observed in the fallopian tube as well ().
The postoperative course of the patient was uneventful. She initiated clear liquids a day after surgery and was discharged once full diet was resumed. On follow-up controls, the patient was completely asymptomatic, without any pain or complications.
|
pmc-6374812-1
|
A 61-year-old Chinese man was admitted to hospital with a gingival squamous cell carcinoma of the left mandible. He was treated with a combination of radical neck dissection with gingivectomy, mandibulectomy, and strengthening of the mandible with a reconstructive plate (). K. ascorbata was identified from the drainage specimen taken on postoperative day five and confirmed with the Hefei Star HX-21 blood culture analyzer (Hefei Star Technology Development Co., Ltd., Anhui, China). Antimicrobial susceptibility testing showed resistance to cefazolin and piperacillin but susceptibility to levofloxacin and gentamicin (). K. ascorbata's ability to produce ESBLs was also detected by the same system. The patient's blood culture was sterile. Intravenous administration of levofloxacin (200 mg, q24 h) and gentamicin (240 mg, q24 h) based on the susceptibility test of this microorganism was continued for 14 days. The wounds were continuously dressed twice a day for 2 weeks and daily for 1 week. The patient was discharged home with an iodoform sponge which was changed weekly for 1 month, and the wound gradually healed after 2 months.
|
pmc-6374815-1
|
A 70-year-old woman presented with a 10-month history of left midfoot pain without any trauma. She was diagnosed as having osteonecrosis of the tarsal navicular based on the findings of plain radiographs from the previous hospital. She was initially treated with an insole. However, the conservative treatment was ineffective for her symptoms. Therefore, surgery was performed.
At the time of presentation, her left foot was swollen and had point tenderness at the dorsal side of the talonavicular joint. The preoperative Japanese Society for Surgery of the Foot (JSSF) midfoot scale score [] was 79 points. Radiographs showed increased radiodensity and dorsal protrusion of the tarsal navicular. Sclerotic collapse was also noted at the lateral aspect of the tarsal navicular (). Computed tomography (CT) scans showed diffuse sclerosis and marginal irregularities of the tarsal navicular (). Magnetic resonance imaging (MRI) showed low signal-intensity areas on both T1-weighted images and T2-weighted images in the marrow of the tarsal navicular. Gd-based MRI showed increased uptake in the peripheral tarsal navicular, which was representative of hypervascular areas (). She was diagnosed with spontaneous osteonecrosis with a Maceira classification of Stage 3 [].
Arthrodeses of the talonavicular and naviculocuneiform joints were selected as the treatment because both joints had cartilage damage on imaging. The articular surfaces of the talus and medial cuneiform that were adjacent to the tarsal navicular and necrotic areas of the tarsal navicular were excised. The blood supply was visible from the marrow of the residual tarsal navicular. The bone defect (5 cm × 1 cm) was reconstructed with a tricortical bone graft harvested from the iliac crest. Arthrodesis was performed using an LCP Distal Radius Plate (SYNTHES) with 6 2.4 mm locking screws from the medial aspect of the foot (). Histopathologic findings showed diffuse empty lacunae without any infection, consistent with avascular necrosis (). The ankle was immobilized in a cast for 4 weeks after surgery. Partial weight bearing with a patellar tendon-bearing (PTB) orthosis was permitted after the removal of her cast.
A radiograph taken 1 year after surgery showed union of the naviculocuneiform joint, but she did not have satisfactory union of the talonavicular joint. The patient had referred pain with the backing out of the most proximal screw. Therefore, the most proximal screw was removed. A radiograph taken 5 years after surgery showed nonunion with mild osteoarthrosis of the talonavicular joint (). However, she just had tenderness of the talonavicular joint and had no pain in her usual daily life. The final follow-up JSSF midfoot scale score was 97 points.
|
pmc-6374815-2
|
A 68-year-old woman had right midfoot pain during walking for about 1 year without any trauma. Conservative treatment with an insole was ineffective, so she came to our hospital for surgery. Physical examination showed tenderness and slight swelling at the talonavicular joint. The preoperative JSSF midfoot scale score was 76 points. Radiographs showed increased radiodensity, dorsal protrusion, and fragmentation of the tarsal navicular (). CT scans showed a segmented tarsal navicular and cystic lesions with sclerotic changes in the neck of the talus (). MRI showed low signal-intensity areas on T1-weighted images and T2-weighted images in the marrow of the tarsal navicular, which suggested osteonecrosis (). She was diagnosed with spontaneous osteonecrosis with a Maceira classification of Stage 3 [].
Arthrodeses of the talonavicular and naviculocuneiform joints were planned, as in case 1. A skin incision was made on the medial aspect from the talus to the medial cuneiform. Cartilage delamination of the navicular articular surface was seen. The articular surfaces of the talus and medial cuneiform that were adjacent to the tarsal navicular and the necrotic areas of the tarsal navicular were excised until the blood supply from the marrow of the residual tarsal navicular was visible. The bone defect (4 cm × 1 cm) was reconstructed with a tricortical bone graft harvested from the iliac crest. Primary fixation was performed using CSLP-VA (SYNTHES) with 4 4.0 mm locking screws from the medial aspect of the foot ().
Histopathological examination showed normal osteocytes and empty lacunae ().
The same postoperative immobilization and rehabilitation as in case 1 were used. A radiograph taken 6 months after surgery showed sufficient bone union ().
Four years after surgery, her radiograph showed complete fusion at the talonavicular and naviculocuneiform joints (). The patient was pain-free and could ambulate independently. The final follow-up JSSF midfoot scale score was 100 points.
|
pmc-6374822-1
|
A 23-year-old male was feeding his horse, and while stroking the horse's hair, the animal chewed the fourth finger of his left hand causing violent pain and total functional impotence of the finger. Both the patient and the horse were up to date on their required vaccinations at the time of the incident. The patient was transferred to an emergency department and was admitted six hours after the incident. He was conscious, in good general condition, and apyretic. An examination revealed a crush injury of the fourth finger with tendons and bone exposed ().
Copious irrigation with normal saline (2 liters) at the injury site was performed along with injection of 0.5 ml tetanus toxoid and 500 IU of human tetanus immunoglobulin. Postexposure rabies prophylaxis (rabies immune globulin human 20 IU/kg) with the first-dose rabies vaccine was injected into the depth of the wound as well as around the wound. The remaining rabies immune globulin was injected into the deltoid muscle. The patient was also treated with prophylactic antibiotic therapy with intravenous amoxicillin-clavulanate, gentamicin, and metronidazole.
After this initial treatment, radiography revealed a fracture dislocation of the proximal interphalangeal joint of the fourth finger with a third fragment (), prompting the patient to undergo surgery. Surgical exploration under locoregional anesthesia found that the ulnar digital pedicle was sectioned and thrombosed, the radial digital pedicle was intact, the flexor and extensor tendons were sectioned and shredded, and the skin was irreparably shredded ().
Surgical procedures included removal of foreign bodies and excisional debridement of devitalized tissue, collection of bacteriological samples, copious irrigation with saline serum (3 liters), tendon striping, and finger amputation with coverage of the bone by the radial digital flap using separate stitches (). The surgery was followed by careful clinical and biological monitoring.
A clinical assessment of the patient 1 day postoperatively showed that he was apyretic with no necrosis of the flap and no purulent discharge. A neurovascular examination was normal. Biological findings at this time showed a C-reactive protein level of 30 mg/dL and a white blood cell count of 11000/μL.
Three days postoperatively, bacteriological samples found an evidence of Pasteurella species and Staphylococcus sensitive to amoxicillin + clavulanic acid with C-reactive protein levels of less than 10 mg/dL and a white blood cell count of 7000/μL. At this time, the patient received the second dose of rabies vaccine.
One week postoperatively, the patient was discharged with a prescription for a course of 10 days amoxicillin-clavulanic acid treatment to be reviewed weekly. At a three-month follow-up (Figures and ), the patient showed no sign of infection; he returned to his usual activities and was discharged from care.
|
pmc-6374827-1
|
EK, an 8-month-old female, was born at 35 weeks by C-section due to preeclampsia with intrauterine growth restriction (Birth weight: 1.25 Kg). She stayed in the intensive care unit for 25 days for nutritional support and was discharged home in a good condition.
She was doing well until the age of 8 months when she presented to our Emergency Department with 1 day duration of high-grade fever; irritability; nonbilious, nonprojectile vomiting; multiple episodes of watery, nonbloody diarrhea; and PO intolerance. Upon physical examination, the patient was irritable and ill-looking with mottled skin and moderate dehydration. The anterior fontanel was soft nonbulging with bilateral erythematous tympanic membrane and pharynx. Her abdomen was soft, nondistended, and nontender, with no hepatomegaly. The rest of the physical examination was unremarkable. Lumbar puncture was done and was negative. The urine and CSF cultures were negative, and subsequently, the antibiotics were discontinued. Complete blood count showed hemoglobin: 12.2 g/dl, hematocrit: 38.2, WBC: 9300, bands: 10, neutrophils: 59, lymphocytes: 14, platelets: 364000, and C-reactive protein: 1.06 mg/dl. The liver function test was as follow: SGPT: 526 U/L (Nl < 40 IU/L), SGOT: 340 U/L (Nl < 40 IU/L), bilirubin (T/D): 2.56/2.24 mg/dl, alkaline phosphatase (ALP): 443 U/L (Nl: 150–420 U/L), gamma-glutamyl transferase (GGT): 662 U/L (Nl < 32 U/L), and albumin 4.38 g/dl (Nl: 3.5–5 g/dl). Serology for hepatitis A, B, and C and HIV was negative. Stools analysis was negative for rotavirus and adenovirus. Stools culture did not grow any pathologic bacteria. The anti-EBV viral capsid antibodies IgM was positive (IgM > 1.64 (Nl < 1.1)). Ultrasound of abdomen was normal.
Liver function test was repeated after 3 days showing SGPT: 170 U/L, SGPT: 38 U/L, bilirubin (T/D): 0.7/0.55 mg/dl, ALP: 371 U/L, and GGT: 466 U/L. The patient was discharged home to be followed up by liver function test. Two weeks later during regular visit, the patient was found to be jaundiced and started to develop itching with 1 episode of clay-colored stools. So she was readmitted to the hospital. Repeat liver function tests showed a dramatic increase in bilirubin (T/D): 9.13/8.46 mg/dl, ALP: 1373 U/L, and GGT: 1062 U/L. The SGPT and SGOT were 232 and 233 U/L, respectively. The lipase level was 3036 U/L (4–23 U/L), and the amylase level was 226 U/L (3–50 U/L). Repeat ultrasound of the abdomen revealed a normal-sized liver of homogenous structure with dilatation of the intrahepatic and extrahepatic biliary duct with no signs of cholecystitis. The common bile duct (CBD) measured 10 mm with calcified sediment measuring 16 × 8 mm in his distal part, near the head of the pancreas.
Magnetic resonance cholangiopancreatography (MRCP) showed extrahepatic dilatation with CBD reaching 1.1 cm, with dilatation of the both right and left intrahepatic ducts which confirmed the diagnosis of choledochal cyst (CC) type IVa complicated by biliary stones (). The patient was kept NPO and started on IV hydration. Surprisingly, the jaundice improved the day after with normal-colored stools. Repeat LFTs after 48 hours showed marked improvement: SGPT: 129 U/L, bilirubin (T/D): 3.2/2.76 mg/dl, ALP: 951 U/L, GGT: 749 U/L, and lipase: 63 U/L.
A complete resection of extrahepatic ducts with Roux-en-Y hepaticoenterostomy was performed uneventfully. Follow-up after 3 months showed complete normalization of liver enzymes (SGPT: 21 U/L, SGOT: 35 U/L, bilirubin (T/D): 0.25/0.09 mg/dl, ALP: 208 U/L, GGT: 7 U/L, and lipase: 74 U/L).
|
pmc-6374832-1
|
A 53-year-old Caucasian man was admitted to the emergency department (ED) with complaints of diarrhea of 3 days' duration, general weakness leading to multiple falls, abdominal pain with lack of appetite, dry cough, and dyspnea on exertion since the last 6 months. His medical past history included chronic alcoholism with 28 units of alcohol per week, active tobacco smoking (22,5 pack-years), sleep apnea syndrome treated with nocturnal continuous positive airway pressure (CPAP) ventilation, high arterial blood pressure controlled by a daily dose of perindopril 5mg and bisoprolol 10 mg, and a morbid obesity with a body mass index (BMI) of 47,3 kg/m2. There was no history of abdominal surgery. Vital signs in the ED were arterial blood pressure 106/64 mmHg, sinus tachycardia with heart rate ranging from 104 to 144 bpm, respiratory rate 37/min, temperature 36.2°C, and oxygen peripheral saturation (SpO2) 92% at room air. Initial examination revealed crackles at the basis of the right lung and abdominal distension with decreased bowel sounds. There were no clinical signs of muscular injury.
The relevant laboratory investigations were the following: CRP 192 mg/L (< 5), platelet count 115.000 /μL, serum creatinine 4.48 mg/dL, BUN 94 mg/dL, sodium 126 mmol/L, and potassium 3mmol/L. A major rhabdomyolysis was early noted: CK 96,012 IU/L (< 397), troponin-I 103.3 ng/L (< 34.2), AST 818 IU/L (< 37), and LDH 2,960 IU/L (< 214). The CK level further increased to 120,059 IU/L 4 hours after hospital admission. Arterial blood gas analysis was consistent with a compensated metabolic acidosis: pH 7.44, pCO2 21.8 mmHg, pO2 79.7 mmHg, bicarbonate 18.6 mmol/L, base excess -7.2 mmol/L, and lactate level 2 mmol/L (< 1.6). Urine analysis revealed moderate proteinuria (++).
The electrocardiogram showed new onset atrial fibrillation (144/min). The diagnosis of left basal pneumonia with a contralateral pleural effusion was made on chest X-ray. Small and large bowel distension was evident from abdomen X-ray with some air fluid levels ().
The patient was transferred to the intensive care unit (ICU) for further management. He remained hypotensive (79/43 mmHg), with atrial fibrillation (166/min) and hypoxemia requiring nasal oxygen administration (5L/min). Initial therapy included fluid replacement, vasopressors, and potassium supplementation for persisting hypokalemia (2.9 mmol/L). Cefuroxime and clarithromycin were initially chosen for empirical antimicrobial therapy. No sputum was available for culture and blood cultures remained sterile. Urine Legionella testing returned positive for L. pneumophila serogroup 1 antigen and clarithromycin was continued alone.
Further clinical course was characterized by a progressive weaning of vasopressors and decrease of arterial lactate. Ileus persisted. Contrast enhanced abdominal computed tomography (CT) showed a diffuse distension of the large intestine and terminal ileum and a diffuse enhancement of the intestinal wall without evidence of bowel ischemia or stenosis (). Renal failure worsened and the patient became anuric on day 2 with serum creatinine 7.18 mg/dl and BUN 146 mg/dl. Intermittent hemodialysis was then started. The peak level of CK (202,000 IU/L) was reached on day 2.
Mechanical ventilation was ultimately required from hospital day 4 to 10 due to the progression of hypoxemia with hypercapnia; there was also a suspicion of inhalation pneumonia secondary to persisting ileus. During the period of mechanical ventilation, the patient did not receive opioid medications that could have resulted in a decreased intestinal motility.
Despite noncontributive abdominal CT findings, an explorative laparotomy was decided on day 12 that failed to demonstrate any mechanical occlusion.
Two weeks after ICU admission, patient was transferred to the nephrology ward with persisting ileus leading to a full month of parenteral nutrition. Antimicrobial therapy was stopped after 21 days. The patient was discharged home after two months. Hemodialysis was definitely stopped after 5 weeks, and renal function returned to normal values after 6 weeks.
|
pmc-6374868-1
|
A 35-year-old obese woman presented to a community clinic in late March with two days of nausea, vomiting, myalgias, and cough and was diagnosed with influenza A virus (). She endorsed refusal of the influenza vaccine offered earlier in the season. She was given oseltamivir for a five-day course. On the final treatment day, she presented to the emergency department with inability to tolerate liquids and solids. Laboratory studies showed leukocytosis (18.4 K/μL), hyponatremia (133 mmol/L), metabolic acidosis (HCO3 9 mmol/L), and elevated creatinine (1.77 mg/d) from her baseline of 0.6 mg/dL. Liver function tests, lipase, and creatinine kinase were normal. Human immunodeficiency virus testing was negative. Rapid influenza A virus polymerase chain reaction was positive, and a computed tomography (CT) of the abdomen showed gallbladder wall thickening and pericholestatic fluid. Oseltamivir was continued. Empiric antibiotics, ceftriaxone, and metronidazole were started for presumed cholecystitis.
On hospital day (HD) 2, she developed refractory hypotension requiring vasopressor support. She progressed to hypoxemic respiratory failure on HD 3 and was mechanically ventilated. Laboratory studies revealed worsening leukocytosis (59.7 K/μL with 3.4% bands), worsening renal function (creatinine 3.01 mg/dL), and elevated lipase (13,740 U/L). Antibiotics were broadened to intravenous vancomycin and piperacillin-tazobactam. Due to profound leukocytosis, she was empirically treated for Clostridium difficile colitis with oral vancomycin and intravenous metronidazole. Stress dose steroids were started for refractory shock. Blood cultures had no growth. Based on CT imaging suggestive of cholecystitis, percutaneous cholecystostomy was performed. Cultures of biliary fluid were negative.
On HD 4, the patient developed hyperkalemia and worsening acidosis with a pH of 7.12 and HCO3 of 8 mmol/L. She was transferred to our institution for emergent renal replacement therapy. Her examination was notable for tight, mottled bilateral lower extremities without pulses and left upper extremity discoloration. To rule out compartment syndrome and myoglobin-associated renal toxicity, creatinine kinase (CK) was sent and this was elevated at 33,000 U/L. On HD 5, CK had progressed to 43,500 U/L. Bilateral lower extremity four compartment fasciotomies were performed at the bedside. Edematous and nonviable muscles were observed without necrosis. Due to nonimprovement, repeat bilateral thigh fasciotomies were performed. Her CK rose to 2196,000 U/L. On HD 6, mottling of upper extremities was noted and bilateral forearm fasciotomies were performed. In light of continued evolving multiorgan failure, her family opted for withdrawal of aggressive interventions, the patient was made comfort measures, and she expired shortly thereafter. Influenza was later genotyped as pdmH1N1. The sample was tested in the Clinical Virology Laboratory at Yale New Haven Hospital, using the seasonal influenza real-time reverse transcriptase (RT) PCR protocol from the Centers for Disease Control and Prevention []. Autopsy confirmed necrotizing myositis, myoglobin cast nephropathy, and acute necrotizing hemorrhagic pancreatitis.
|
pmc-6374870-1
|
A 70-year-old female was brought to the emergency department of our tertiary care referral hospital with an alleged history of accidental “car coolant” consumption followed by unsteadiness of gait about 3 hours later. On examination, the patient was drowsy but following verbal commands. There was no odour of alcohol in the breath. The GCS score was 15/15 (E4V5M6). Her blood pressure was 140/80 mm of Hg and pulse rate 68 per minute. Oxygen saturation was maintained at room air. ECG was normal, and no focal neurological deficit was detected. Gastric lavage was performed as the first line of treatment. Laboratory investigations revealed Na+ 142 mEq/L, K+ 2.4 mEq/L, Cl− 101.1 mEq/L, HCO3− 15.8 mEq/L, Ca+ 5 mg/dl, urea 35 mg/dl, creatinine 0.7 mg/dl, BUN 16.35 mg/dl, random glucose 141 mg/dl, and serum osmolality 323 mOsm/kg. Arterial blood gas analysis showed pH 7.322, pCO2 30.7 mmHg, pO2 93.8 mmHg, cBase(B)c −9.1. Urine examination revealed crystals of calcium oxalate. Anion gap was 25.1 mEq/L, and osmolar gap was 17 mOsm/kg·H2O. Blood and urine levels of ethylene glycol could not be obtained for lack of such analytical facilities in the region.
Crystalluria observed in the case is considered as a major indicator of ethylene glycol consumption []. Anion gap metabolic acidosis and high osmolar gap gave further confirmation to our diagnosis. Oral ethanol therapy was started at 2.5 ml/kg of 40% ethanol [] through the nasogastric tube. In view of high anion gap metabolic acidosis, the patient was given hemodialysis (HD) over four hours with high potassium dialysate. Intravenous calcium gluconate was given over 10 minutes for management of hypocalcaemia. In addition, pyridoxine and thiamine were administered. She was given 100 ml of ethanol before dialysis.
Repeat arterial blood gas analysis was performed after 12 hours, which showed marked improvement in patient's condition. The patient improved clinically, and the investigations were in normal limits with pH 7.416, pCO2 34.7 mmHg, pO2 94.1 mmHg, and cBase(B)c −1.7. Calcium infusion was stopped. Repeat electrolytes were within normal limits with Na+ 141 mEq/L, K+ 5.2 mEq/L, Cl− 101.3 mEq/L, HCO3− 24.9 mEq/L, and Ca+ 9.4 mg/dl. Over the next 24 hours, she received 400 ml of ethanol through the nasogastric tube at timed intervals (approximately 35 ml second hourly).
Urine routine after 48 hours showed no crystalluria. The patient was clinically stable after 72 hours with laboratory parameters within normal range. No residual organ damages were detected upon follow-up.
|
pmc-6374873-1
|
The patient was an 81-year-old woman with metastatic renal cell carcinoma. Due to a clinical suspicion of renal cell carcinoma, patient initially underwent right radical nephrectomy. The histopathological diagnosis was pT2 clear cell carcinoma. After a 10-year disease-free interval, distal pancreatectomy and splenectomy were performed for pancreatic mass lesion recurrence. Two years later, recurrence at the site of the pancreatectomy was diagnosed by an abdominal CT scan, and then further surgical resection of the recurrent tumor was performed. However, a recurrent mass lesion was found at the head of the pancreas a year after surgical resection of the recurrent tumor. As surgical resection was not indication for treatment due to postoperative adhesions, sorafenib (800 mg/day) was initiated. The lesion persisted in a stable disease condition, but 16 months after starting the sorafenib therapy, the metastatic lesion at the head of pancreas became a progressive disease, so the regimen was switched to sunitinib (37.5 mg/day). However, 4 months later, a CT scan showed disease progression with the appearance of liver metastatic lesions, so everolimus (10 mg/day) was initiated. In evaluation prior to everolimus, there were no findings of respiratory dysfunction. Arterial blood gas analysis revealed a pH of 7.333, PaCO2 40.0 mmHg, bicarbonate 20.8 mmol/L, and PaO2 10.5 mmHg on 97.5% FiO2. Laboratory data also showed normal CRP levels. No apparent changes, including interstitial opacities, were observed on the chest CT taken 1 month after starting everolimus administration. At one and a half months after everolimus induction, the patient showed no remarkable respiratory symptom and no remarkable change was seen in the patient's chest X-ray (). Two months after starting everolimus administration, the patient presented to the emergency department after developing a sudden fever and dyspnea. Her peripheral capillary oxygen saturation level was 93% (under inhalation of O2 3 L), and blood gas analysis revealed decompensated alkalosis. The results of the general blood biochemistry tests were normal apart from an elevated C-reactive protein level of 13.93 mg/dl. Her blood serum KL6 level was elevated at 1929 IU/ml, as was her surfactant protein A (SP-A) and surfactant protein D (SP-D) levels, to 103.0 and 513.0 IU/ml, respectively. Her serum βD-glucan level was within the normal range. Linear, reticular shadows were found in both lung fields during chest radiography (), and a chest CT revealed diffuse ground-glass opacities, thickening of the interlobular septa, and consolidation throughout both lung fields. Mild pericardial effusion was found, but there is no findings of suspecting cardiogenic pulmonary edema, which indicate acute respiratory distress syndrome (). The diagnosis was surmised to be everolimus-induced interstitial pneumonitis. The patient was immediately treated with oxygen and steroid pulse therapies (methylprednisolone 1 g/day for 3 days) by a respiratory specialist, and everolimus administration was promptly stopped. The patient's respiratory status continued to rapidly worsen, however. The patient received ventilation on day 3 of hospitalization at the intensive care unit. The possibility of pneumonitis caused by infection, including fungal infection, was ruled out after subsequent culture tests returned negative. Accordingly, a respiratory specialist concluded the diagnosis as everolimus-induced interstitial lung disease. The patient had two more courses of steroid pulse therapy but showed no improvement in her respiratory status. The patient died on day 49 of hospitalization due to rapid respiratory failure.
|
pmc-6374874-1
|
A young patient (female, 16 years old) was referred to the Oral Surgery Unit of the Policlinico Umberto I Hospital–Sapienza University of Rome with the chief complaint of asymptomatic swelling in the left side in the posterior region of the maxilla, gradually increased to the present size of 3.5 cm since approximately 12 months.
Medical history and extraoral examination were noncontributory, and there was no regional lymphadenopathy.
Intraoral examination revealed, in the buccal fold of the left maxillary posterior region, a swelling extending from behind the canine up to the tuberosity, covered by normal oral mucosa (). On palpation, the buccal cortical plate was expanded, and the swelling was smooth, nontender, and nonfluctuant, and its consistency was bony hard.
The involved teeth were sound, positive at cold sensitivity test, and without mobility.
Panoramic radiograph showed in the left maxillary posterior region a well-defined, unilocular radiolucency, root resorption of the first and second molars, and presence of an unerupted third molar ().
Panorex view of the Computed Tomography (CT) revealed a hypodense intrabony, unilocular lesion circumscribed by radiopaque border, extending from the mesial margin of the first premolar to the distal margin of the second molar and apicocoronally from the sinus floor to the alveolar ridge. The resorption of the first molar roots and the second molar mesial root and the unerupted third molar not related to the lesion were also detectable ().
In the axial view of the CT, a limited expansion and thinning of the buccal and palatal cortical plates, limited cortical perforation in the vestibular wall upper the first molar, and small foci of radiopacity near the mesial root of the first molar were observed ().
The resorption of the first molar roots was also evident in the coronal view of the CT ().
Based on the clinical and radiographic findings, different pathologic conditions, such as dentigerous cyst, calcifying odontogenic cyst, odontogenic keratocyst, central giant cell granuloma, unicystic ameloblastoma, calcifying epithelial odontogenic tumor, ameloblastic fibroma, and ameloblastic fibroodontoma, were considered, and the preventive histological diagnosis was needed for treatment planning.
Incisional biopsy was performed under local anesthesia ().
Histological examination showed a nodular proliferation of polyhedral epithelial cells of probable odontogenic origin, organized either in small cystic spaces with intraluminal basophilic PAS-positive material or in syncytial and trabecular nests. The stroma was poorly cellular, either intensely eosinophilic or amorphous like dentin, with some calcifications (). A diagnosis of AOT was made.
Conservative surgical enucleation of the lesion, extraction of the first molar, and apicectomy of the involved teeth, previously endodontically-treated, were planned.
The surgery was performed under general anesthesia. Surgical access was obtained through a full-thickness trapezoidal intrasulcular buccal flap, extending from the mesial aspect of the canine to the distal aspect of the second molar (). The flap was detached, and the cortical bone was exposed ().
After the first molar extraction, ostectomy was performed under sterile saline irrigation with a round tungsten carbide burr mounted on a low-speed handpiece used with a tangential movement not to involve the underlying lesion. The fibrotic capsule surrounding the tumor was dissected from the bony wall, and the mass was completely enucleated (Figures and ).
Before flap repositioning, amputation of the resorbed mesial root of the second molar, and apicectomy of the premolars and the remaining roots of the second molar, thorough debridement of the bony cavity and trimming of the rough bony edges were carried out.
A releasing periosteal incision was made at the bottom of the buccal flap to enhance its elasticity and to achieve tension-free primary closure, the tumor cavity was packed with absorbable gelatin sponge (Gelfoam®, Pfizer, New York, USA), and the interrupted sutures were placed (4-0 Vicryl, Johnson & Johnson Medical, Norderstedt, Germany) ().
The surgical specimen was submitted for histopathological examination, and the diagnosis confirmed the previous incisional biopsy ().
Healing was uneventful without any complications and follow-up was performed at 3, 6, and 12 months.
One year after the surgery, clinical examination and radiographs showed restitutio ad integrum both of the bone and the soft tissues and no local recurrence ().
|
pmc-6374879-1
|
A 10-year-old female with chronic active EBV disease and HLH was evaluated in the emergency department for fever and possible sepsis after recently receiving chemotherapy. In the emergency department, she received a dose of ceftriaxone (50 mg/kg). She had received ceftriaxone on three previous occasions with no history of adverse reaction. Within one hour, she developed back pain, tachycardia, and tachypnea. Over the next three hours, she developed worsening distress and failed continuous positive airway pressure support and required endotracheal intubation with mechanical ventilation. She also experienced hypotension requiring fluid resuscitation and a continuous epinephrine infusion.
Prior to receiving ceftriaxone, she had an erythrocyte hemoglobin concentration of 11.9 g/dL. Four hours later, her hemoglobin had decreased to 6.1 g/dL, followed by a point-of-care hemoglobin of 5.1 g/dL. There were spherocytes on her peripheral blood smear as well as red blood cell aggregation. A DAT report was sent after confirmation of the hemoglobin decrease and was positive for both IgG and C3. Urinalysis demonstrated hemoglobinuria and bilirubinuria. She required four packed red blood cell transfusions (each 10 mL/kg) over 72 hours, after which her hemoglobin stabilized at her initial baseline. High-dose methylprednisolone was begun during the first day of admission. On admission, one day later, and five days later, her total bilirubin levels were 1.5 mg/dL, 10.7 mg/dL, and 23.1 mg/dL, respectively, with 90% being unconjugated. On admission, her LDH was 514 U/L and increased to 42,093 U/L two days later. Her renal function declined 24 hours after ceftriaxone, with her BUN doubling from 12 mg/dL to 25 mg/dL and serum creatinine tripling from 0.3 mg/dL to 0.9 mg/dL. She continued to require inotropic blood pressure support for three days and required mechanical ventilation for sixteen days. Her presentation was highly suggestive of CIIHA and did not include red urine or severe anemia making the suspicion for cold agglutinin syndrome low.
The American Red Cross tested a blood sample from the day after admission and reported “Our testing was not definitive due to unexpected reactivity at the 37°C phase of testing with one set of controls. However, all controls were acceptable at the antihuman globulin phase of testing. The strong reactivity at 37°C and the reactivity at the antihuman globulin phase of testing indicate a strong likelihood that the patient has antibody to ceftriaxone.” In order to evaluate whether this was ceftriaxone-initiated hemolysis, we adapted the complement hemolysis using human erythrocytes (CHUHE) hemolytic assay utilizing the patient's serum and erythrocytes and adding exogenous ceftriaxone. These experiments showed that adding ceftriaxone (10 μg/ml) to her serum increased complement-mediated hemolysis (p=0.02) of her erythrocytes (). We also evaluated whether the hemolysis was occurring via the classical complement pathway by adding peptide inhibitor of complement C1 (PIC1). Adding PIC1 (0.75 mM) in addition to ceftriaxone to her serum and erythrocytes decreased hemolysis compared with adding ceftriaxone alone (p=0.03), returning hemolysis to the level of the no-ceftriaxone control. Together, these tests confirmed that the hemolysis was initiated by ceftriaxone and mediated via the classical complement pathway. These results raise the possibility that a classical pathway complement inhibitor could be employed therapeutically to moderate the disease process by blocking complement opsonization (e.g., C3b, iC3b, and C3d) of erythrocytes and inhibiting hemolysis. A terminal complement pathway inhibitor could also inhibit hemolysis, but would not stop complement opsonization of the erythrocytes.
|
pmc-6374880-1
|
A 34-year-old man, a subsistence farmer, from southwestern Uganda with a history of multiple prior presentations with anemia, jaundice, and dark-colored urine requiring blood transfusions presented to us again in July 2018 with a week history of palpitations, dizziness, and dark-colored urine.
His condition started in 2006 with an episode of palpitations, yellowing of eyes, and dark-colored urine where he was initially seen in different health facilities close to his home village and later admitted to Mbarara Regional Referral Hospital (MRRH). He recalled being transfused with >4 units of blood during that initial admission and was discharged when all his symptoms subsided.
After discharge, he stayed fairly well for about 3 months before he developed another episode with similar symptoms. These symptoms continued to recur at an interval of 2–4 months, and each episode would require admission and blood transfusion.
In 2012, he was referred to Mulago National Referral Hospital for diagnostics and management. Many investigations were done (), and he was ultimately given a diagnosis of vitamin B12 deficiency. He was then treated for 1 year with vitamin B12 injections (no records of the doses available). Despite this treatment, he continued to have episodes of yellowing of eyes, palpitations, and dark-colored urine at approximately similar intervals (2–4 months).
In 2013, investigations were repeated, and in addition, bone marrow aspiration was done. The serum B12 level was found to be high, and the vitamin B12 injections were stopped. However, similar symptoms continued to recur at similar intervals over the following 2 years.
In 2015, he was restarted on B12 injections when found to have high serum levels of homocysteine despite a negative urine methylmalonic acid. The injections were stopped again a year later when found to have a very high serum B12 levels. Symptoms continued to recur at similar intervals till his recent admission in July 2018. Apart from B12 injections, the patient was given oral prednisolone on two occasions in the past but without significant improvement.
On this admission, he presented with predominant symptoms of palpitations, dizziness, generalized body weakness, yellow eyes, and dark-colored urine for about 7 days. This time, he also reported a 5-month history of erectile dysfunction and intermittent mild to moderate abdominal pain without associated vomiting, diarrhea, or dark/bloody stools. Reviews of the other systems were uneventful. He has no other chronic diseases or history of allergies. He has not been on any chronic medications in the past, apart from the tablets of folic acid and ferrous sulfate and vitamin B12 injections. He reported no history of a similar condition in any of his family members or a history of hereditary anemias or hematological malignancies. He reported no history of radiation or toxin exposure and further denied any history of taking traditional remedies.
His physical examination in the latest admission revealed severe pallor and jaundice of the mucous membranes. He had a displaced point of maximum cardiac impulse (6th left intercostal space and anterior axillary line) and grade-3 mitral and tricuspid murmurs of mitral and tricuspid regurgitation, respectively. He has no skin rashes, and the rest of his systemic examination was unremarkable. Many tests done during the course of his illness are displayed in .
Due to the recurrence of the symptoms, DAT-negative hemolytic anemia, and new onset of erectile dysfunction, we did a flow cytometry including fluorescent aerolysin (FLAER) in which a large PNH clone was found. The details of the flow cytometry test are displayed in .
In this admission, we transfused him with 4 units of blood and later discharged when his symptoms subsided.
|
pmc-6374882-1
|
A 66-year-old man arrived at the emergency room after a cardiac arrest with successful prehospital resuscitation.
He had a medical history of hypertension, diabetes, and obstructive sleep apnea. Recently he had also been diagnosed with granulomatosis polyangiitis (GPA) with positive C-ANCA and respiratory tract involvement. Severe tracheobronchial inflammation had led to stenosis and secondary tracheobronchomalacia, with the distal trachea and main bronchi most affected on previous CT scans. At the time of the reported events, he received treatment with azathioprine 100 mg per day and prednisolone 10 mg per day. Noninvasive mask ventilation with positive airway pressure was used at night because of worsened symptoms when recumbent. There was a plan to consult ENT surgeons regarding the possibility of placing airway stents to treat the condition.
Pulmonary function test done the month before showed marked nonreversible expiratory flow limitation with forced expiratory volume in 1 second (0.6 L, 18% of expected) and hyperinflation with a reduced forced vital capacity (2.7L, 58% of expected), an increased residual volume (3.0L, 139% of expected), and functional residual capacity (4.3L, 131% of expected). Total lung capacity and diffusion capacity were normal.
The patient had undergone bronchoscopy under general anesthesia the previous year which was complicated by severe bronchospasm, hypoventilation, and subsequent hypercapnia requiring unplanned delayed extubation and ICU admission.
The cardiac arrest took place during a visit at an out-of-hospital urology clinic. It was preceded by obstructive breathing and coughing leading up to respiratory arrest, and he became pulseless before the arrival of paramedics. Cardiopulmonary resuscitation (CPR) was started. When paramedics arrived, they found pulseless electrical activity, CPR was continued including administration of adrenaline, and after 10 minutes there was return of spontaneous circulation and breathing.
At the hospital emergency room he was unresponsive but with stable pulse and blood pressure. After intubation he was taken to the ICU. Arterial blood gas showed respiratory acidosis with pH at 6.88, PaCO2 16.6 kPa. Ventilating the patient sufficiently to normalize PaCO2 was difficult. Regardless of ventilation mode, high inspiratory and end-expiratory pressures were needed for acceptable tidal volumes and gas exchange. PEEP at 14-16 cmH2O was considered optimal. Remaining air flow at end-expiration indicated auto-PEEP; therefore, the expiratory phase was prolonged with I:E ratio 1:4. Bronchoscopy showed very narrow bronchi and inflammation. CT scan confirmed narrow conditions in the proximal airways, especially in the main bronchi (). No signs of pulmonary embolism were seen.
The second day at the ICU, the situation quickly deteriorated, with increasing respiratory acidosis. The patient seemed stressed and hypertensive and triggered the ventilator. Suddenly the blood pressure dropped to immeasurable. CRP was started, the ventilator was disconnected, and bag ventilation was attempted. Adrenaline was administered and after about 2-3 minutes of CPR circulation returned. During the CPR, muscle relaxant with rocuronium (Esmeron®) was also administered to ease continued ventilation after return of circulation. The assessment at this point was that hyperinflation and auto-PEEP due to the expiratory flow obstruction likely had caused the circulatory collapse. Increasing sedation and muscle paralysis stabilized the situation and the patient was therefore kept deeply sedated.
The ENT surgeons were consulted to discuss urgent stenting of the collapsing airways. Stenting of each main bronchus using two stents was conducted a few hours later in the operating theater. The procedure was done with aid of rigid bronchoscopy with ongoing jet ventilation during general anesthesia. The diameter of the right main bronchus was approximately 2-3 mm wide and in the left main bronchus hardly any lumen was seen.
With the stents in place (), respiratory compliance improved immediately, and peak pressure and PEEP could be reduced with maintained minute volume. The patient was extubated in the operation room. He was neurologically intact and the continued care was uneventful. The following years though, he has needed treatment at hospital several times, due to recurrent respiratory problems with mucus stagnation, infections and granulation tissue in proximity to the stents, well-known complications to long term stent treatment. However, he has experienced no further episode of circulatory collapse.
|
pmc-6374910-1
|
A 56-year-old woman presented to the ophthalmology clinic with a main complaint of acute onset right eye pain with extra-ocular movement. She also reported right eye periorbital swelling, redness, upper right lid drooping, and bilateral tearing. She received her first zoledronic acid infusion for osteoporosis 24 h prior to presentation. Her significant past medical history included chronic inflammatory demyelinating polyneuropathy, Sjogren’s syndrome, and systemic lupus erythematosus. The patient had been on cyclosporine 75 mg (1 mg/kg) daily and monthly belimumab 120 mg/1.5 ml for her rheumatologic conditions for 3 years prior to presentation.
On ophthalmic exam, her best-corrected visual acuity was 20/25–2 in the right eye, and 20/25–3 in the left eye. Intraocular pressure was 14 mmHg in the right eye and 13 mmHg in the left eye. On external exam of the right eye, there was mild upper lid edema, erythema, ptosis, and − 1 adduction defect. The slit lamp exam was remarkable for conjunctival chemosis without anterior chamber cell or flare. The posterior segment exam was remarkable for posterior vitreous detachment (PVD) (Fig. ). The left eye exam was significant for PVD (Fig. ). 24–2 visual field testing attempted but was not reliable due to frequent fixation loss secondary to eye pain. A contrast enhanced MRI was obtained which showed: 1) ill-defined right orbital soft tissue thickening, 2) enhancement in the retro-orbital intraconal space with extension along the retro-orbital scleral contour and surrounding the anterior optic nerve sheath (Figs. and ). Orbital inflammation secondary to SLE was considered as part of the differential based on the patient’s rheumatologic history. However, based on the clinical presentation, MRI findings, and timing of symptoms with regards to the zoledronic acid infusion, orbital inflammation secondary to bisphosphonate therapy was suspected. The patient was started on oral prednisone 50 mg daily with rapid improvement in symptoms. After 1 week, patient reported full resolution of symptoms and was started on a slow weekly taper of prednisone.
|
pmc-6374989-1
|
A 15-year-old Caucasian female was diagnosed with CVID at 3 years of age during work-up for recurrent infections and chronic lung disease. During the first 2 years of life, she had multiple hospitalizations for wheezing, pneumonia, bronchiectasis, severe pseudomonas ear infections, and failure to thrive. First wheezing episode occurred at 3 months of age and required chronic home bronchodilator nebulization therapy. Initial immunology work-up revealed low CD4 count, poor T-cell function by mitogen studies, B cells within normal range, and near-normal serum immunoglobulin levels (IgG, IgM, IgA). No numerical details were available to us. She was found to have “functional antibody deficiency” due to absence of detectable titers to tetanus, despite routine childhood immunizations, and no protective antibody titers to Haemophilus influenzae type b following at least 3 attempts at revaccination. She was maintained on chronic intravenous (IV) or subcutaneous (SQ) immunoglobulin therapy and did well overall until she developed West Nile meningoencephalitis at the age of 12 years, leading to severe residual motor deficits, in the form of quadriparesis requiring a wheelchair, and cognitive changes. Her CVID treatment included 20% SQ immunoglobulin (Cuvitru, Shire Pharmaceuticals, Lexington, MA, USA) every 2 weeks, but there was evidence of nonadherence. Poor adherence was suggested by not picking up the immunoglobulin from the pharmacy and multiple hospitalizations/urgent care visits during that time for flare of wheezing and ear infections. She presented to the ED with progressive fatigue along with rapid weight gain of 4.5 kg in 6 weeks, and decreased urine output with facial and leg swelling. She was found to have hypertensive urgency with manual BP of > 99th percentile for height. Physical examination showed mild generalized anasarca, no hepatosplenomegaly, no lymphadenopathy, no skin rash, and normal chest examination. Labs showed elevated serum creatinine of 486.2 µmol/L (53 – 97 µmol/L) and BUN 21.7 mmol/L (1.8 – 7.1 mmol/L) along with mild hyperkalemia (6 mmol/L, normal 3.5 – 5 mmol/L) and anion gap acidosis. Her prior renal function testing performed 6 weeks prior during an episode of painless gross hematuria (“cola-colored urine”) had shown normal electrolytes with serum creatinine of 17.68 µmol/L. That episode of gross hematuria lasted for ~ 3 weeks and then resolved spontaneously. She did not have fever, loin to groin or abdominal pain, joint pains, skin rash, sore throat, cough, nausea, hematemesis, vomiting, or diarrhea. Blood pressure was not documented. Urinalysis at that time showed 2+ proteinuria, 703 red cells, 36 white cells, negative nitrites and leukocytes. Urine culture was positive for > 100,000 cfu/mL lactobacillus and 10,000 – 50,000 cfu/mL coagulase-negative staphylococcus. She was treated for urinary tract infection with levofloxacin. Serum complements were not checked.
In the ED, other labs showed white blood cell count of 12.5 × 109/L (4.5 – 11.0 × 109/L, hemoglobin 8.7 g/dL (12 – 15 g/dL), and platelet count of 402 × 109/L (150 – 450 × 109/L). EKG showed tall peaked T waves, and her hyperkalemia was treated with kayexalate, calcium gluconate, insulin/glucose, sodium bicarbonate, and nebulized albuterol. Renal sonogram showed slightly enlarged echogenic kidneys with right kidney of 13.6 cm and left kidney of 12.7 cm with poor corticomedullary differentiation but no nephroureterolithiasis. In the past, she had a history of left-sided nephrolithiasis. Urinalysis showed ≥ 500 protein, 52 red cells, 4 white cells, negative nitrites, and leukocytes with a specific gravity of 1.019 and pH of 6. Serum albumin was 30 g/L (35 – 50 g/L). A spot urine protein (mg/dL) to creatinine (mg/dL) ratio was 29.4. Hypertension was managed with IV nicardipine, which was later switched to oral antihypertensive agents, including losartan, amlodipine, clonidine, labetalol, and doxazosin. Serum IgG level was 1,273 mg/dL (658 – 1,534 mg/dL), IgM 91 mg/dL (48 – 186 mg/dL), and IgA 320 mg/dL (57 – 300 mg/dL). Both C- and P-ANCAs were negative. Antinuclear antigen was slight positive at 1 : 40 in a speckled pattern with negative anti-double-stranded DNA, anti-Smith and anti-RNP antibodies. SSA and SSB antibodies were negative. Serum anti-GBM antibody (IgG) was elevated at 194 AU/mL (normal: 0 – 19 AU/mL) by multiplex bead assay (ARUP laboratory, Salt Lake City, UT, USA). Serum complements were normal.
A renal biopsy showed severe glomerular injury characterized by crescentic glomerulonephritis (). Out of 11 glomeruli in the light microscopy, 1 glomerulus showed active cellular crescent with progression to fibrous crescents in 3 and fibrocellular crescents in 2 glomeruli along with global glomerulosclerosis (50%). There was patchy, interstitial fibrosis and tubular atrophy, involving at least 40% of the cortical parenchyma. There was acute tubular injury, characterized by patchy tubular dilatation, epithelial attenuation, and luminal casts. Focal moderate intimal thickening of the small arteries was evident without any vasculitis. Immunofluorescence showed 5 globally-sclerotic glomeruli without any intact glomeruli. The glomeruli were negative for IgM, C1q, and albumin. Deeper tissue level immunofluorescence revealed both smudgy and linear staining for IgG, κ-light chain, and λ-light chain in glomerular capillary walls compressed by crescents (). Electron microscopy revealed no electron-dense deposits in the available 2 glomeruli. CT of the chest did not show any alveolar hemorrhage, and she never had hemoptysis. Pulmonary function test showed evidence of severe intrinsic restrictive ventilatory dysfunction, most likely related to her neuromuscular illness, unchanged from her pre-illness tests. Diffusion capacity showed anemia and decreased alveolar volume with no evidence of pulmonary hemorrhage or pulmonary fibrosis.
She was treated with IV methylprednisolone 10 mg/kg/dose for 3 days, 2 doses of cyclophosphamide 1 week apart (10 mg/kg followed by 600 mg/m2), rituximab 750 mg/m2 q2 weeks × 2 doses and 10 sessions of plasmapheresis every other day. Her anti-GBM antibody titer decreased from 194 to 3 U/mL after the above therapies. She was continued on 60 mg prednisone daily along with azathioprine, following which her anti-GBM level decreased to 0 U/mL (negative). Her prednisone dose was then tapered to 5 mg every other day. She remained without hemoptysis, cough, or respiratory difficulty. However, despite aggressive therapies, she became anuric and progressed to ESRD. Renal replacement therapy in the form of hemodialysis was required early during the course of her illness and was subsequently maintained on nightly chronic peritoneal dialysis. She was discharged home on prednisone, azathioprine, pentamidine IV every 3 – 4 weeks for pneumocystis jirovecii pneumonia prophylaxis, and previously prescribed SQIG (she had been receiving IVIG while an inpatient). Her illness was further complicated by an episode of hypertensive encephalopathy and CMV meningoencephalitis along with CMV viremia requiring IV ganciclovir and then chronic oral valganciclovir therapy. Azathioprine was discontinued as a result. After few months, she developed otitis media, lower respiratory tract infection, candida urinary tract infection, micrococcus septicemia, and status epilepticus, all of which were treated appropriately. A week after her latest hospitalization, her mother informed the office by telephone about her worsening respiratory secretions, despite using vest and cough assist, and postponed the medical care citing extreme weakness of the patient. The following day, she passed away at home, most likely secondary to lower respiratory tract infection.
|
pmc-6374990-1
|
A 39-year-old female presented with complaints of generalized abdominal distension, weight loss, swelling of legs, and muscle weakness extant for several weeks. Her past medical history was significant for a well-controlled HIV infection of 6 years on highly active anti-retroviral therapy, hypertension, ESRD secondary to HIV-associated nephropathy, and secondary hyperparathyroidism. She was a non-smoker and had no history of alcohol or drug abuse. Her initial renal biopsy revealed collapsing focal glomerular sclerosis, microcystic dilation of renal tubules, lymphocytic interstitial infiltrates, and interstitial fibrosis. She received chronic cycler-assisted peritoneal dialysis (PD) for 5 years and was well controlled clinically regarding uremic and volume status with no abnormalities regarding color, viscosity, or volume of exchanges. Subsequently, she was transitioned to intermittent hemodialysis (HD) due to personal preferences. A few weeks after the transition to intermittent HD, ascites of unclear etiology developed, ultimately requiring repeated large-volume paracentesis with ~ 5 – 7 L ascitic fluid removals every other week.
There were no associated symptoms of coughing, palpitations, or shortness of breath. She was chronically anuric. Vital signs showed blood pressure of 160/80 mmHg, heart rate 74 beats/min (regular), respiratory rate 16/min and temperature 36.9 °C. Oxygen saturation was 98% on ambient room air. Her physical examination was remarkable for moderate ascites and edema of the lower extremities. Otherwise neurological, respiratory, and cardiovascular examinations were normal without organomegaly and without clinical stigmata or symptoms of chronic liver disease or heart failure.
Laboratory investigations showed normocytic, normochromic anemia with a hemoglobin of 10 g/dL and uncorrected serum calcium of 8.6 mg/dL. Other labs were as follows: CD4 T-cell count: 600/mm3, HIV viral load: 986 copies/mL (reference: < 40 copies/mL), serum creatinine: 10.3 mg/dL, aspartate aminotransferase: 13 U/L (normal range: 5 – 34 U/L), alanine aminotransferase: 17 U/L (5 – 45 U/L), bilirubin: 0.4 mg/dL, prothrombin time INR: 1.01, serum albumin: 2.3 mg/dL, serum amylase: 105 IU/L (27 – 130 U/L), serum lipase: 40 IU/L (8 – 78 U/L). Her tumor antigens (Ag) were within reference range for cancer antigen (CA) 15-3 and CA19-9. CA 125 levels were repeatedly elevated (197 – 416 U/mL (normal: < 34.9 U/mL)), but no further follow-up was obtained. Analysis of the ascites fluid showed an albumin level of 1.5 g/dL and protein of 3.5 g/dL. The serum-to-ascites albumin gradient was < 1.1 excluding portal hypertension as a cause of ascites. The culture of peritoneal fluid was negative for acid-fast bacilli. There were no fungi seen by calcofluor white stain. Histoplasma Ag and Aspergillus Ag were negative. The pancreas was reported normal on computed tomography. Her β-2 microglobulin was elevated to 47.30 mg/L (normal: 0.80 – 2.3). Serum protein electrophoresis showed hypoalbuminemia and decreased total protein, with minimal monoclonal M-component only (IgG-κ 0.30 g/dL in the γ zone). Immunofixation electrophoresis showed polyclonal immunoglobulins (Ig) with polyclonal light chains. κ and λ light chains were increased to 66.86 mg/dL (normal: 0.33 – 1.94) and 18.55 mg/dL (normal: 0.57 – 2.63), respectively, yielding a ratio of 3.6 (normal: 0.26 – 1.65) (). Ascitic fluid analysis showed a marked increase in plasma cells with an abnormal κ : λ ratio, i.e., > 5 : 1.
Liver biopsy was essentially normal, hence an omental biopsy was performed which on immunohistochemistry showed similar findings as the ascitic fluid with predominant κ and faint λ staining (). Multiple myeloma work-ups with skeletal surveys revealed no focal osseous lesions, apart from the osseous changes of hyperparathyroidism. Accordingly, the diagnosis of omental EMP with malignant ascites was established. Omental resection and radiation were offered to the patient, but she refused further intervention. Two years of follow-up, she remained stable without any further complication, apart from requiring regular paracenteses.
|
pmc-6375066-1
|
A 12-year-old female presented to the local emergency room with persistent intense left flank pain. Dipstick showed large blood and abdominal CT showed 4 mm obstructing calculus in the proximal left ureter, nephrolithiasis with minimal scarring in the upper pole of left kidney, multiple bilateral renal cysts with the dominant on the left kidney at 2.8 mm. Non-calcified 2 mm right lower lobe pulmonary nodules was also identified. Renal function was preserved with the BUN of 11 mg/dl and creatinine of 0.6 mg/dl, electrolytes were within normal range. The patient was treated with pain control medications and hydration with improvement and was referred to a nephrologist. At the nephrology clinic, urine was collected over 24 h for a “stone risk study” and renal ultrasound (RUS) was performed. RUS showed multiple bilateral cysts and renal calculi in the kidneys (). The right kidney measured 10.5 cm × 4.9 cm × 4.8 cm and the left kidney measured 9.8 cm × 4.7 cm × 5.0 cm. Renal cysts were present bilaterally with some displaying thick internal septation (Bosniak type II renal cyst). The largest cyst was present in the left kidney, measuring 3.3 mm. There were no solid masses present. An extrarenal pelvis was present on the left. There was no caliectasis present.
Twenty-four hours urine “stone study” showed elevated levels of calcium oxalate, brushite, and monosodium urate. Because of strong family history, both the father and paternal grandmother had a history of never genetically tested ADPKD, and radiological and clinical finding the patient underwent genetic testing for PKD1, PKD2, GANAB, and HNF1B. Using genomic DNA from the submitted specimens, the exonic regions and flanking splice junctions of the genome were captured and sequenced by next-generation sequencing (NGS) on an Illumina sequencing system and compared to the human genome build of non-mutated genes of interest. The results returned positive mutations for GANAB and PKD1. The GANAB mutation was classified as the pathogenic variant and the PKD1 mutation was classified as a variant of uncertain significance.
GANAB is vital for Polycystin-1 and Polycystin-2 maturation (). The three genes, GANAB, PKD1, and PKD2 are characterized by a high number of exons, 26, 50 and 16 exons, respectively. We identified dual mutations in GANAB and PKD1genes, which are mapped on the reverse strands on long and short arms of chromosomes 11 and 16, respectively (; ). The identified GANAB mutation resulted in generating nonsense codon that terminates transcription (CGA > TGA) of GANAB mRNA. The mutation located in exon 3 of GANAB mRNA NM_198335.3 (). shows the position of the mutated nucleotide C > T in the CGA codon generating nonsense codon TGA at position 308 of GANAB mRNA NM_198335.3. The site of mutation is equivalent to the nucleotide site 181 in the CDS sequence, c.181C > T (). The GANAB-CDS occupies a region of 2900 nucleotides (nts) located at 128–3028 in the GANAB mRNA NM_198335.3. The mutation is predicted to stop transcription of the amino acid arginine (R) coded by CGA at position 61 of the glucosidase II alpha subunit polypeptide, p.Arg(R)61Ter () and causes loss of normal protein function. It is possible to interpret the GANAB variant as a pathogenic variant, which is not reported in large population cohorts ().
Mutations in the PKD1 gene are linked to renal cystic dysplasia and renal tubulogenesis (). The detected PKD1 mutation p.Pro(P)61Leu(L): c.182C > T mapped at nucleotide site 391 in the exon1 of the PKD1-mRNA transcript NM_001009944.2 () equivalent to position 182 of the CDS sequence (). The mutation is of missense type. The CTC codon is generated from base pair substitution of the middle letter of the CCC codon, CCC>CTC. The triplet CCC codes for proline (P), the mutated codon, CTC, codes for leucine (L) and is predicted to replace proline in the polycystin-1 polypeptide sequence ().
Missense mutations are either silent or mild mutations unless they occur at critical sites along the polypeptide chain. Although, the identified PKD1 missense mutation (p.Pro(P)61Leu(L) is likely of uncertain clinical significance. The finding that showed about 15% of human codons are dual-use codons (duons) specify both amino acids and transcription factor (TF) recognition sites (), motivated us to investigate the exon 1 for “duons”. Our analysis showed the PKD1-exon 1 untranslated and translated regions host motifs for eight types of transcription factors ( and ). Intriguingly, the site of the detected missense mutation showed three overlapping TFs motifs. Also, we identified motifs for two types of genomic structural regulators CTCF and YY1.
|
pmc-6375168-1
|
A 19-year-old male was referred to our department after initial physical examination to a military training center as part of his compulsory enlistment for the Greek military service. During the examination, he reported having a solitary right kidney but was otherwise asymptomatic with no further relevant details. Neither a history of trauma nor previous surgeries were reported. Physical examination was unremarkable. He had no scars on the trunk and normal external genitalia. No pain provoked or masses felt during palpation. A digital rectal examination was not performed due to the patient’s preference. No sexual intercourse was reported at the time. Furthermore, no previous notable medical history for hereditary or acquired diseases was mentioned. The whole blood count and urinalysis results were within normal limits.
Abdominopelvic computed tomography (CT) and magnetic resonance imaging (MRI) of the pelvis were performed. CT depicted only a right kidney with absence of left kidney (Fig. ). Additionally, CT demonstrated a large lobulated multicystic lesion of left seminal vesicle without enhancement on contrast-enhanced images (Fig. ). A saccular dilated ectopic ureter opening into the left cystic seminal vesicle and extending centrally up to the level of L3 vertebral body was revealed with a length of approximately 16 cm (Fig. ).
MRI was performed with a Siemens Magnetom Avanto (1.5 Tesla) MRI unit (Siemens Inc., Germany) using a pelvic phased-array coil. The imaging protocol comprised T1-weighted, T2-weighted, T2-weighted with fat saturation (FS) and T1-weighted FS images on axial, sagittal and coronal planes. Finally, images on T1-weighted FS sequence after intravenous administration of contrast medium (gadolinium) were added.
MRI demonstrated a large lobulated multicystic lesion in the anatomic region of left seminal vesicle. The lesion measured approximately 7.2 cm × 6.1 cm with low signal intensity on T2-weighted FS and high signal on T1-weighted images, corresponding to a dilated seminal vesicle cyst (SVC). The high signal intensity on T1-weighted sequences was strongly suggestive of proteinaceous or hematic content. In contrast, the normal right seminal vesicle exhibits high and intermediate signal intensity on T2-weighted FS and T1-weighted images, respectively, corresponding to fluid (Fig. ). An enlargement of the left ejaculatory duct communicating with the dilated SVC was well depicted on sagittal T2-weighted images (Fig. ). A saccular dilated ectopic left ureter with tortuous morphology, which was also filled with proteinaceous or hematic content, was revealed on all T1-weighted images, communicating with the SVC and extending centrally (Fig. ).
Unfortunately, the patient declined additional investigation by means of transrectal ultrasonography (TRUS), which might have assisted in clarifying the ejaculatory duct obstruction.
Semen analysis revealed cryptozoospermia (volume < 1 ml, pH 8.0, total sperm count 126 /ml) of obstructive origin. Nevertheless, fertility was not the patient’s primary concern. He declined further management, although he was made aware of the rarity of the syndrome and the possible future need of surgical management. Despite detailed analysis of the importance of cryopreservation and fertility maintenance, he had no intention to cryopreserve sperm or undergo microsurgical sperm retrieval at the time. Therefore, annual semen analysis was recommended for as long as he presented with altered fertility status. Although SVCs are generally benign and rarely symptomatic, cases of malignant transformation and late diagnosis due to the absence of warning symptoms have been described []. Thus, we adequately informed our patient about the possibility of the carcinomatous evolution of SVCs. Finally, we advised him to undergo ultrasonographic monitoring on an annual basis.
|
pmc-6375173-1
|
A 61-year-old Caucasian man with no past medical history presented to another teaching hospital with a 2-week history of hematuria. He had a transurethral resection of a 3-cm papillary bladder tumor located near the left ureter meatus. The final histologic examination led to the conclusion that it was a urothelial carcinoma pT2 G3.
The patient was referred to our outpatient clinic after 2 months. He still reported hematuria. The result of his physical examination was totally normal. All the biological workup was normal except for a decreased hemoglobin level (10 g/dl). Thoracoabdominopelvic computed tomography (CT) showed a 4-cm heterogenic and enhanced bladder tumor with invasion of the left ureter and another 3-cm mass with the same characteristic located in the left renal pelvis. No other sign of malignant disease was found by CT.
The multidisciplinary team decided to start with upfront surgery. The patient had a midline laparotomy, which revealed that the abdominal cavity was free of ascites and calcinosis. The liver was free of disease. Therefore, the patient had an en bloc radical cystectomy and a left ureteronephrectomy associated with para-aortic and bilateral pelvic lymph node dissection. He also had a cutaneous transileal urinary diversion. The surgery lasted 245 minutes with no need for blood transfusion.
The immediate follow-up was normal. The patient was discharged 1 week after surgery.
The final histologic examination showed a synchronous high-grade urothelial carcinoma of the bladder (pT3) and the left renal pelvis (pT3) with free margin.
All the lymph nodes dissected were free of disease: nine para-aortic lymph nodes, five right pelvic dissection lymph nodes, and seven left pelvic lymph nodes.
The multidisciplinary team decided to add adjuvant chemotherapy. However, the patient was lost to follow-up.
He consulted our outpatient clinic after 1 year for cutaneous masses located in the left hypochondriac (1), the back (2), and the cervical region (1) (Figs. , and ). No other abnormal signs were found in the physical examination.
Thoracoabdominopelvic CT was performed, which showed multiple pulmonary metastases but no sign of local recurrence.
The patient had a biopsy of the left hypochondriac lesion (Fig. ), and the histology confirmed the metastatic origin. The tumor was CK7- and P63-positive (Figs. , and ).
The patient was then referred for chemotherapy. However, he never received treatment because of deteriorating general status.
The patient died 1 month after the biopsy.
|
pmc-6375201-1
|
A 52-year-old woman presented with pain and active function loss in her left shoulder, and was admitted to our hospital in June 2017. Her shoulder problem had started 3 months earlier, and there was no history of trauma or fracture. At first the pain was intermittent and bearable, but then gradually increased. On examination, there were no positive signs except for localized pain. A radiologic examination on 3 April 2017 found no destruction of the shoulder (Fig. ). Pain at the shoulder joint became gradually aggravated, together with the appearance of shoulder joint dysfunction. Two months later, physical examination revealed mild swelling of the shoulder, and markedly restricted shoulder and elbow motion. Mild distal nerve function defects appeared gradually. Radiography on 3 June 2017 showed that the head of the humerus had disappeared within the past 2 months (Fig. ), which was confirmed by magnetic resonance imaging (Fig. a, b).
The patient is a healthy, active individual with no history of weight loss, anorexia, or fever during this period. General and systemic examination findings were within normal limits. Routine laboratory investigations were also normal, including levels of serum calcium, phosphate, alkaline phosphatase, high-sensitivity C-reactive protein, and erythrocyte sedimentation rate. An open biopsy of the lesion revealed that the bony tissue had been replaced by fibrous connective tissue, and small areas of bony trabeculae with occasional osteoclasts were visible (Fig. ). There was no evidence of malignancy or tuberculosis. Because of the lack of any clinical findings or supporting data for other causes, the features were confirmatory of GSD. Computed tomography of the shoulder joint (Fig. ) revealed a bony defect of the glenoid cavity.
We performed surgery involving glenoid cavity amplification with an autologous iliac bone graft and a reverse total shoulder arthroplasty. The grafts were from autologous iliac bone (Fig. , Fig. ). A deltopectoral approach was used on the shoulder, and necrotic and dissolving bone tissue was removed. Reconstruction of the glenoid was carried out with autologous iliac bone and installation of reverse shoulder prosthesis. Postoperatively, the arm was placed in a sling for 3 months. Passive elevation and external rotation were allowed 2 weeks after the operation. Three months later, sling use was discontinued, and active range of movement was initiated. Six months after surgery, the patient is pain-free with more than 90° of active abduction, 100° of forward flexion, and 30° of shoulder posterior extension. She also has good functional use of her shoulder (Fig. , Fig. ).
|
pmc-6375225-1
|
In a 75-year-old man, right upper lobectomy with mediastinal lymph node dissection was performed due to lung cancer. He had yellow sputum expectoration on postoperative day 8, and the level of C-reactive protein (CRP) was elevated in spite of no abnormal findings on chest X-ray. Bronchoscopy was performed immediately to check the presence of postoperative bronchitis or bronchopleural fistula. Although purulent secretions were clearly visible on WLI, there were no signs of ischaemic bronchitis and bronchopleural fistula. The LCI demonstrated the contrast between bronchial mucosa and purulent secretions and detected inflammatory change that was not detectable with the conventional WLI on the tracheal wall (Fig. A, B). His sign improved and the level of CRP was normalized because of the administration of antibiotics.
|
pmc-6375225-2
|
A 61-year old woman who was diagnosed with adenoid cystic carcinoma in her left main bronchus was admitted for surgical treatment. Bronchoscopy was performed to confirm the extent of the tumour. The submucosal vascularity and tumour margin on the bronchial mucosa were more clearly visible on LCI than on WLI (Fig. A, B). According to the findings, we could perform left pneumonectomy by clearly securing the surgical margin with LCI.
|
pmc-6375261-1
|
During routine anatomic dissection of an 83-year-old male cadaver, a variation of the right IJV was observed. The right IJV exhibited a tributary located parallel and medially to the IJV itself. This branch of the IJV emerged between the transverse processes of the third and fourth cervical vertebrae and drained into the junction between the right internal jugular and brachiocephalic veins. The branch was 6.5 cm in length, running from the transverse processes of the cervical vertebrae to the junction between the internal jugular and brachiocephalic veins. It ran down dorsally in relation to the vagus nerve and common carotid artery ( ).
|
pmc-6375262-1
|
A 37-year-old female patient was admitted after presenting at a hospital on April 1, 2017 with facial edema and pain involving the right hemiface, with onset 3 days previously and asthenia and progressive dyspnea in response to moderate force since the previous day. She reported no episodes of fever. Hitherto healthy, she had performed her daily physical activities with no complaints prior to this occurrence. She had a history of bruxism, complicated by a dental trauma to the right lower second molar 3 days previously, requiring extraction, which had been performed immediately.
Her general state of health was normal on physical examination, but she had tachypnea with a respiratory rate of 30 breaths per minute, oxygen saturation of 60% in room air, and she had edema of the right hemiface. On chest auscultation, there was a notable diffuse reduction of vesicular murmur, cardiac sounds were rhythmic and normal sounding, and there were no murmurs. Her calves were free from clubbing, and both Bancroft’s and the Homans signs were negative.
A hypothesis of pulmonary thromboembolism (PET) was considered and so angiotomography of the thorax was ordered on April 1, 2017 and showed that the patient did not have PET. However, it revealed opaque nodules sparsely distributed throughout the pulmonary parenchyma bilaterally, thickened interlobular septa, with ground glass attenuation, and pleural effusion bilaterally, with a cissural component on the left, suggestive of a diagnosis of septic emboli ( ). Laboratory tests of samples taken on April 2, 2017 revealed Leukocytosis at 16,050, with predominance of segmented cells and no bandemia, while C-reactive protein (CRP) was elevated at 26.3 mg/L.
On April 4, 2017, computed tomography (CT) of the face and cervical region showed increased density and enlargement of soft tissues in the right hemiface and thrombophlebitis of right internal jugular vein tributaries ( ). Since clinical and radiological findings correlated, a diagnosis of LS was made.
Throughout her clinical course, the patient remained in a standard ward and she was medicated throughout her stay with analgesics, non-steroidal anti-inflammatories, and antibiotics. Analgesia was with dipyrone and tramadol, given regularly over the first 5 days. The inflammatory process was managed with 100 mg of ketoprofen every 12 hours for 10 days and 10 mg of prednisone every 12 hours for 10 days. Initial empirical antibiotic therapy was a combination of azithromycin, clindamycin, and ceftriaxone, but once the antibiogram results were in on the second day, this was altered to 600 mg of clindamycin every 6 hours, for 10 days, and 2 g of ceftriaxone once a day for 10 days.
Over the course of her hospital stay, the patient’s laboratory parameters improved to the point that, on April 9, 2017, she had 11,330 leukocytes, was free from bandemia, and her CRP had fallen to 1.7 mg/L. Relief from pain was achieved on the first day of admission and after 24 hours the patient no longer exhibited dyspnea and her pulse oximetry reading was 95% in room air. Since she had improved from both clinical and laboratory perspectives, she was discharged from hospital 10 days after admission.
|
pmc-6375263-1
|
A 64-year-old woman presented with large varicose veins, CEAP C2s, in the left lower limb. The patient had never been treated before because she was afraid of surgery. She had no history of migraine headaches or cardiac diseases. She had never smoked cigarettes, never had high blood pressure, and never been overweight. Her only medication was 20 mg sinvastatin once a day, and her last lipid profile, and all blood tests were normal. Except for the large varicose veins in her left lower limb, physical examination was normal, including normal peripheral pulses and absence of bruits. The patient was treated in the Trendelenburg position with a total of 10 ml of 3% polidocanol foam via direct punctures, 5 mL into an 8 mm diameter great saphenous vein and 5 mL into large collaterals in the leg. Foam was prepared with a 1:4 ratio of liquid to room air, using the Tessari technique involving 40 passes of agitation through a three-way stopcock using one 5 mL syringe and one 3 mL syringe. With ultrasound guidance, foam was injected immediately after each of three preparations, 5 mL, 2.5 mL, and 2.5 mL. No air boluses occurred. Ultrasound scanning showed no foam in the deep venous system. The patient remained lying down for 10 minutes after the injections, before being discharged wearing compression stockings. Less than 1 hour after leaving hospital, impairment of speech capacity was observed. She encountered difficulties when she tried to talk, with incomplete and incomprehensible words. No other alterations were noted. She was taken to another hospital, where the clinical presentation was misdiagnosed as an allergic reaction. One gram of hydrocortisone IV was infused and 20 mg prednisone was prescribed per day for 5 days. The next morning she came to the office to report the allergic reaction. After detailed history taking and physical examination, including the Wells DVT clinical model, the only alteration detected was aphasia. This was Broca’s aphasia, identified by loss of speech and writing capabilities, with no impairment of comprehension. A neurological examination found no signs or symptoms of hemiparesis or hemiplegia. Cerebrovascular ischemia was suggested, and the patient’s daughter became fairly angry about the diagnosis of ischemia, which she considered exaggerated. Both mother and daughter left the clinic and refused a neurological consultation. Two days later, the patient came to the office, reporting that she was almost recovered and reaffirming her belief that she had suffered an allergic reaction. After an appropriate explanation, 1 week later, a normal transthoracic echocardiogram was obtained and magnetic resonance showed a recent cerebrovascular ischemia in Broca’s area ( ). A transesophageal bubble study echocardiogram performed a few days later revealed a patent foramen ovale ( ). The patient’s daughter’s became very upset again, and, despite a complete recovery by the patient, the doctor-patient relationship broke down almost completely. It wasn’t possible to continue investigations. More explanation and discussion followed, in which the intention to publish this complication was decisive to achieving greater comprehension about what had occurred. Both the patient and her daughter gave permission for publication in writing.
|
pmc-6375266-1
|
The patient was a 14-year-old female who had a prior history of tracheostomy, performed when in an intensive care unit because of head trauma, at the age of eight. She had been discharged from hospital after a one month stay and, around three months later, developed subglottic tracheal stenosis, which was treated with outpatient endoscopic dilatation sessions over a period of six years.
During the fifth year of these dilatation sessions, she suffered repeated episodes of hemoptysis, without significant hemodynamic consequences, initially managed conservatively. However, bronchoscopy and CT revealed a TIF, which was identified as the source of the bleeding. This lesion was repaired by a surgical procedure to ligate the TIF, reconstruction of the brachiocephalic trunk with an expanded polytetrafluoroethylene (PTFE) prosthesis, preserving the carotid and vertebral arteries.
After this initial surgical treatment, she progressed well for one year, during which the dilatation sessions were continued, but at the end of this period, hemoptysis recurred. This time, bronchoscopy and CT of the thoraco-cervical region did not reveal the source of the bleeding.
Under general anesthesia, selective arteriography of the brachiocephalic trunk revealed a TIF approximately six cm from the carina ( A). At this point, the fistula burst open once more, flooding the lower respiratory tract, with massive bleeding via the oral endotracheal tube, hemomediastinum with compression of the apical segment of the right lung and resultant deterioration of ventilatory function ( B).
As an emergency measure, a compliant occlusion balloon (Coda®, Cook Medical, Bloomington, United States) was placed in the mid-distal segment of the brachiocephalic trunk, achieving total obstruction of flow through the vessel ( 2B). Once the blood had been aspirated through the oral endotracheal tube, the patient’s saturation began to improve and hemodynamic stability was achieved.
Endovascular treatment of the TIF was conducted with placement of a covered stent measuring 7 × 50 mm (Wallgraft®, Boston Scientific, Marlborough, United States) in the brachiocephalic trunk and right subclavian artery, proximal of the origin of the right vertebral artery, excluding the fistula and occluding the origin of the right common carotid artery, which totally controlled the bleeding ( ).
Three days later, an elective surgical operation was conducted via a cervical access to debride devitalized tissues, remove the prostheses and perform carotid-carotid revascularization with preservation of the cervical vessels. One day after the last surgical procedure, the patient was already extubated, breathing spontaneously, hemodynamically stable, and free from signs of neurological deficits. She was put on antibiotics for three weeks and remained free from additional clinical complications over six months of outpatients follow-up.
|
pmc-6375268-1
|
A 49-year-old female patient (Fitzpatrick III phototype) sought medical care in November 2016 complaining of varicose veins in the lower limbs, which at the time were asymptomatic. She stated that she had no comorbidities or allergies. She was taking the following medications: 0.100 mg levonorgestrel and 0.020 mg ethinylestradiol. A physical examination only found a moderate quantity of telangiectasias (CEAP C1), predominantly of the arborizing type. An arterial examination was normal.
The purpose of treatment was essentially esthetic. In March 2017, the first sclerotherapy session was conducted with 75% glucose (at a temperature of 17 °C, achieved in advance) using a 0.40 x 13 mm (27G x ½”) needle and a 3 mL syringe (Total volume = 2 mL). Around 10 minutes after the injection into the lateral region of the right thigh, where the concentration of telangiectasias was greatest ( ), an ochre-colored stain was observed. It progressed with formation of blisters and erythema ( ), which were observed on the seventh day after sclerotherapy.
The patient also exhibited pain, edema (+ / +4), and clubbing (++ / +4) of the ipsilateral calf, all with simultaneous onset. Superficial thrombi were drained (maintaining the blisters intact) and a color Doppler ultrasonography examination was conducted because of a suspicion of deep venous thrombosis, which was ruled out. The patient had been instructed to wear elastic stockings (20-30 mmHg compression) after the initial sclerotherapy, but was then proscribed from wearing them on the seventh day after sclerotherapy, when edema and skin lesions were observed.
On the 14th day after sclerotherapy, the pain, erythema, and edema had improved, but scabs ( ) had appeared where the blisters had been. The patient was instructed to apply dressings daily using oil containing essential fatty acids (EFAs). Formation of necrosis ( ) prompted mechanical debridement, on the 42nd day after sclerotherapy ( ), and the EFAs were withdrawn and daily topical administration of a preparation containing 60% glucose and 40% vaseline was initiated ( ).
A second sclerotherapy session with 75% glucose was conducted on the 49th day after sclerotherapy, when the patient still had an ulcer measuring 2.00 x 1.00 cm, and injections in proximity to this area were avoided. The ulcer had healed by the 88th day after sclerotherapy, but hyperpigmentation remained ( ) and the patient was prescribed hydroquinone, retinoic acid, and hydrocortisone.
After using the depigmentation agent for 6 months, the patient exhibited a discrete reduction in pigmentation. At the same time, another sclerotherapy session was conducted with 75% glucose, with no intercurrent conditions. After 1 year, the pigmentation in the scarred area had lightened moderately ( ). The result with relation to the telangiectasias was relatively satisfactory, provoking disappearance of the majority of them.
|
pmc-6375269-1
|
The first case, which took place in September 1993, involved a 72-year-old female patient with severe heart disease, arterial hypertension, and grade III obesity who had been admitted to an intensive care unit with sepsis of pulmonary origin. An attempt was made to puncture the right subclavian vein, using a supraclavicular technique, but was unsuccessful. One week later, the vascular surgery team was called to investigate a large pulsating mass in the right cervical region. Physical examination found the patient hemodynamically unstable, with a large, right-side, cervical pulsating mass ( ). A duplex scan revealed a PA originating from the second portion of the right subclavian artery (RSA), with diameters of 50 × 42 mm ( ), and the decision was taken to treat the patient with open surgery.
Access was achieved via a median sternotomy with right supraclavicular extension ( ). The proximal RSA was isolated and the neck of the PA was approached progressively. It originated from the proximal segment of the thyrocervical trunk and was treated with simple ligation. The aneurysm sac was drained. The patient recovered satisfactorily, despite the magnitude of the intervention and the severity of her condition.
|
pmc-6375269-2
|
The second case occurred in December 2017 and involved a 66-year-old female patient with severe heart disease and systemic arterial hypertension who had undergone a kidney transplant in 2007 because of polycystic kidney disease. She was admitted to an intensive care unit with sepsis of pulmonary origin. An attempt was made to perform ultrasound-guided puncture of the left internal jugular vein for administration of vasoactive amines, but the attempt was unsuccessful and the procedure was aborted. The patient developed a pulsating mass in the left cervical region and exhibited a progressive drop in hematocrit levels. After 15 days, during which the patient was in pain and the cervical mass expanded, the vascular surgery team was asked to investigate.
During physical examination and history taking, the patient complained of considerable pain in the left cervical region, related to the pulsating mass ( ). A duplex scan suggested a PA originating from the left common carotid artery ( ), and computed tomography angiography (CTA) revealed a PA from segment V1 of the left vertebral artery, with diameters of 30 x 32 mm ( ).
After the team had discussed the case, the decision was taken to employ endovascular techniques to implant a Viabahn® 5 mm × 2.5 cm covered stent (WL Gore, Flagstaff, AZ, United States) in the vertebral artery. The procedure was accomplished with no intercurrent conditions and 18 mL of iodinated contrast were used ( ). The cervical mass receded and the pain resolved during the immediate postoperative period and the patient suffered no neurological deficits. A control duplex scan conducted 6 months after the procedure showed that the left vertebral artery was patent at the level of segment V3.
|
pmc-6375271-1
|
The patient was a 65-year-old male who presented with a swelling of the posterior surface of the proximal third of his left leg. His prior history included a prolonged stay in hospital for treatment of bacterial endocarditis, when two mitral valve replacement operations were performed. He had also previously undergone two abdominal operations to treat an intestinal tumor and one varicose veins surgery.
Physical examination revealed a pulsating mass in the posterior region of the proximal third of the left leg. Femoral, popliteal, and dorsal pedal pulses were palpable and normal in both lower limbs. The posterior tibial artery pulse was absent, whereas the posterior tibial artery pulse was palpable in the right lower limb.
Magnetic resonance angiography showed a saccular dilatation in the tibioperoneal trunk with a 4.4 cm diameter, at the level of the origin of the posterior tibial artery. The posterior tibial artery was also occluded ( ). Investigation was supplemented with laboratory tests (inflammatory activity tests, coagulation tests, and complete blood cell count), which all returned normal results, in addition to blood cultures, which were negative.
Having ruled out other probable etiologies and active infections, in view of the history of bacterial endocarditis, it was decided to perform a less invasive treatment, considering the inflammatory/infectious pathophysiology and the size and site of the pseudoaneurysm. A covered, self-expanding stent (Gore VIABAHN 6.0 × 50 mm) was therefore placed in the tibioperoneal trunk, preserving fibular artery patency and excluding the aneurysm. The transition between the tibioperoneal trunk and the fibular artery was ectatic, because of the pseudoaneurysm, which minimized difficulties caused by reduction of the distal diameter. A control magnetic resonance angiography showed that the aneurysm sac was no longer perfused and the fibular artery was patent ( ).
The patient was followed up for 10 years after treatment and during this period the symptoms did not recur and the patient maintained an ankle-brachial index of 1.0.
|
pmc-6375272-1
|
A male, 57-year-old patient collided with another competitor during a bicycle race and fell off, landing with his right gluteus hitting a stone. He presented at an emergency room with considerable pain and edema in the right gluteal region. According to the Advanced Trauma Life Support (ATLS) protocol, the patient’s airway was clear, breathing was normal, he showed signs of class II shock (heart rate greater than 100 beats per minute), scored 15 on the Glasgow Coma Scale, and was free from signs of pelvic bone instability. During physical examination, a significant expanse of non-pulsating hematoma was noted in the right lumbar and gluteal region, painful on local palpation. The patient also complained of right foot paresthesia, probably caused by compression of the sciatic nerve. Laboratory test results showed reduced hemoglobin (< 7 g/dL), and replacement was initiated with packed red blood cells. An angiotomography of the abdomen and pelvis was performed, showing hematoma of the right gluteus, with contrast leakage, compatible with a pseudoaneurysm at that site ( ). The patient was taken to a hemodynamic suite and underwent angiography, which confirmed a pseudoaneurysm of the inferior gluteal artery ( ).
Superselective embolization was performed to repair the pseudoaneurysm, occluding the branch involved proximal and distal of the lesion using controlled-release coils (Codman & Shurtleff, Inc. brand; by Johnson & Johnson, Raynham, MA, United States) to completely stop the bleeding, during the same procedure as angiography ( 3C). After embolization, the hematoma was drained to reduce the risk of gluteal necrosis, relieve pain, and improve neurological signs and symptoms. The patient was transferred to the intensive care unit, where hemodynamic and laboratory parameters were monitored and volume resuscitation was supplemented. There was immediate improvement of gluteal pain and paresthesia. The patient was later transferred to another hospital, with bleeding controlled.
|
pmc-6375273-1
|
The patient was a 58-year-old man, on treatment for hypertension, who was admitted to a vascular surgery service because of an incidental finding of two aneurysms of the SMA, identified during preoperative imaging exams preparatory to repair of an incisional hernia. The patient had no abdominal symptoms and on physical examination his abdomen was flaccid and painless and with a pulsating mobile mass in the epigastrium. Abdominal ultrasonography indicated a partially thrombosed saccular aneurysm in the retroperitoneal space, with no communication with the aorta. Multislice angiotomography revealed two aneurysms of the SMA, a proximal one measuring 5.9 × 5.2 × 5.0 cm and a distal one measuring 5.3 × 3.5 × 3.2 cm (
). Since multiple collateral branches emerged from both aneurysm bodies, which meant the endovascular treatment would have involved a risk of damaging the intestinal blood supply, the decision was taken to perform open surgical repair. During the operation, by explorative laparotomy, access to the retroperitoneal space was achieved after performing the Cattell-Braasch maneuver, with medial displacement of the ascending colon and part of the transverse colon, exposing the infrarenal aorta and its branches. This revealed two true aneurysms of the SMA, the larger of which was around 3 cm from the arterial ostium and the smaller approximately 2 cm from the end of the first ( ). It was also possible to observe collateral branches (right colic, ileocolic, jejunal artery, and ileal arteries) projecting from the bodies of these aneurysms. A mesenteric-mesenteric, end-to-end bypass was therefore constructed, using a dacron prosthetic graft, excluding both aneurysms but preserving branches distal of the proximal aneurysm. It was decided to ligate and resect the aneurysms – sending specimens for cultures – and their lumens were opened, revealing large quantities of intraluminal thrombi ( ). Inspection of the abdominal cavity found the intestines to be viable and free from any sign of injury. During the postoperative period, the patient suffered gastrointestinal atony, but responded satisfactorily to prolonged conservative measures. Additionally, on the fifth day after the operation, a control computed tomography revealed signs of hematoma in the hepatorenal recess, managed conservatively to resolution. The patient was discharged from hospital to outpatients follow-up in good clinical condition, 18 days after the operation ( ). There was no bacterial growth in the culture of the aneurysm segment.
|
pmc-6375306-1
|
An 11-year-old girl with prehepatic portal hypertension due to portal vein thrombosis was referred to the Children’s Memorial Health Institute, Warsaw, Poland, following two episodes of acute pancreatitis. The age of disease onset was 9.7 years. Abdominal ultrasound revealed chronic pancreatitis with a heterogeneous pancreas and a dilated pancreatic duct. Risk factors of pancreatitis such as injury, anatomical anomalies, toxic-metabolic disorders and biliary disease were excluded. Genetic testing revealed the presence of a heterozygous c.568G>A (p.Glu190Lys) variant in PRSS1. No other pathogenic variants were identified in the susceptibility genes tested in this patient. The parents of the index patient had no history of pancreatitis but were unavailable for genetic testing The p.Glu190Lys variant is not listed in the 1000 genomes, dbSNP, genomic GNomad (version 2.0.2), ClinVar and HGMD databases.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.