text
stringlengths 8
5.77M
|
|---|
Usefulness of ablation of complex fractionated atrial electrograms using nifekalant in persistent atrial fibrillation.
Additional ablation of complex fractionated atrial electrograms (CFAE) after pulmonary vein isolation (PVI) has been shown to improve the success of ablation of persistent atrial fibrillation (AF). However, extensive ablation is often necessary to eliminate all CFAE or to terminate AF. We assessed the usefulness of the administration of an antiarrhythmic drug (AAD) before CFAE ablation. One-hundred and ten patients with persistent AF first underwent PVI, roof and floor linear ablation (box isolation). One hundred patients who remained in AF after box isolation were then randomized to either receive (AAD group, n=50) or not receive (no-AAD group, n=50) intravenous nifekalant (0.3mg/kg) followed by a CFAE ablation. In the AAD group, nifekalant terminated AF in 19 (38%) patients and ablation of localized CFAE was performed in 31 patients who remained in AF after nifekalant, and terminated AF in 11 (35%) patients. In the no-AAD group, ablation of CFAE terminated AF in 13 (26%) patients. The AAD group had a significantly lesser number of radio frequency applications at CFAE sites (18 ± 12 versus 36 ± 10, p<0.0001) and shorter procedure time (162 ± 34 versus 197 ± 29 min, p<0.0001) compared with the no-AAD group. However, there was no significant difference in success rate at 12 months after a single ablation procedure between the two groups (AAD group, 74% versus no-AAD group, 76%). An approach to ablation using nifekalant may be useful in localizing areas of CFAE, reducing the number of applications at CFAE sites and procedure time. Ablation of only CFAE localized with nifekalant may be sufficient for clinical outcome.
|
Q:
Images are off-centered for mobile browsing
Ive made a few websites, but for some reason my newest webpage is rendering incorrectly on mobile browsers. I have a feeling it has to do with the units I'm using for spacing (pixels), but I'm unsure.
The web-page is www.zfisch.com
Here are some snippets of relevant code, first, the viewport:
<meta name="viewport" content="width=500, initial-scale=1">
Next, the CSS I have in place for the images:
a #twitter {
background-color: black;
height: 32px;
width: 110px;
border-radius: 6px;
position: relative;
margin-left: 46%;
top: 159px;
z-index: 1;
}
a #email {
background-color: black;
height: 32px;
width: 110px;
border-radius: 6px;
position: relative;
margin-left: 46%;
top: 159px;
z-index: 1;
}
img[src="zack.jpg"] {
height: 150px;
width: 150px;
border-radius: 50%;
border: 3px solid white;
margin-top: 100px;
left: 44.5%;
position: absolute;
}
p[id="brackets"] {
font-size: 100px;
left: 43%;
position: absolute;
margin-top: 100px;
}
If anyone can point me in the right direction I'd really appreciate it. Thanks!
A:
Absolute position is not the best way to go about that, but if you want to stick with it try a setup like this:
img[src="zack.jpg"] {
left: 50%;
margin-left: -75px;
}
For the other elements, do the same (pulling them left half their width) and make sure a width is set.
Otherwise, remove positioning and set the container to text-align: center to center the image.
|
Poems Explore Effects Of 9-11
September 26, 2003|Jennifer Choi and Danny Schwartzman and Michele Dume
The Creative Zone is a showcase of artwork, poetry, short stories and other creative work by elementary, middle and high school students. The following poems were written by ninth-grade social studies students in Glen Wolff's class at Cypress Bay High School in Weston. The assignment was to write about the importance of freedom on the second anniversary of the 9-11 attacks.
Americans as One
When the twin towers fell
We all fell with it
Scratches and bruises covered our bodies
We helped each other get back on our feet
And we helped each other clean up
And when we all stood up,
We stood taller than ever
Everyone was standing at the same height
Standing so strong
And over time, wounds healed
Out bruises faded
We are one
We are one
We are American
-- Jennifer Choi
Freedom Poem
Red, white and blue means freedom for me and you.
Thanks to freedom you can say I am going to do something new every day.
Hand to hand freedom comes, along with progress and beyond.
You could say it's true; without freedom we would be in the blues
Communism and fascism were swept away
Only with the help of freedom will make a better today
Rights and privileges that we now have
Are complex results of a nation united as one.
Triumph and glory are the middle names,
Of the value we uphold so high every single day
Drenched in blood and tears we will forever mourn
Those brave souls who perished in the name of freedom; a moral cause.
Once the building blocks for our nation's past
Freedom has become an indispensable value in our lives that will forever last.
-- Danny Schwartzman
America home of the free
United we shall be
Hand in hand we pray
For the ones we lost
The eleventh of September
We will always remember
That our freedom can be dismembered
If we don't stick together
Planes crashed into the two towers
And they came down in hours
All over the country Americans were worried
Because everything was happening in such a hurry
After this horrible day
America will never be the same.
-- Michele Dume
Creative Zone is open to public, private and home-schooled students in Broward County. Teachers: Send in work by your students. Parents: Send in your child's art and prose. Submit work to Creative Zone, c/o Peter Bernard, Sun-Sentinel, 200 E. Las Olas Blvd., Fort Lauderdale, FL 33301. When possible, please send in the original work. Please print the full name of the student, teacher, school and grade level on the back of each entry.
|
CALGARY -- Cenovus Energy Inc. plans to increase its capital spending in 2020 compared with this year.
The energy company says it plans to invest between $1.3 billion and $1.5 billion in 2020, up from between $1.1 billion and $1.2 billion in 2019.
Cenovus says the increase is largely due to a deferral of spending this year following the mandatory production curtailments in Alberta.
In its outlook for 2020, Cenovus expects total production in 2020 to increase seven per cent compared with its guidance for 2019.
It says its crude-by-rail program, combined with the Alberta government's special production allowances, will position the company to move to unconstrained production levels.
Per-barrel oilsands non-fuel operating costs are expected to decrease by approximately five per cent.
This report by The Canadian Press was first published Dec. 10, 2019.
|
Queen Emeraldas
is a manga written and illustrated by Leiji Matsumoto, later adapted into a four-episode anime OVA of the same name. Queen Emeraldas is the story of the pirate spaceship, Queen Emeraldas, which is captained by the mysterious and beautiful Emeraldas, a strong and powerful privateer. Sometimes, the character Emereldas is referred to as Pirate Queen Emeraldas.
Plot
The storyline follows a young boy named who sneaks aboard a freighter in order to leave Earth. As the freighter is flying through space they are attacked by an Afressian ship bearing the Skull and Crossbones insignia. However, the train is saved by a mysterious and incredibly powerful spaceship (which also bears the insignia) and is able to make it to their destination, a desert planet with a Western atmosphere, complete with saloons and bar fights. The boy meets up with another stowaway, an old man, and becomes friends with him. He tells the old man that he came to the planet in order to become a stronger individual. He gets himself a job in a bar with the roughest reputation on the planet to prove himself.
When the attacking ship, led by , lands on the planet to search for whoever attacked him, Emeraldas appears to confront him, demanding that he remove the insignia from his ship; "Only two ships have the right to bear it!" In the second episode, after a final confrontation with Eldomain and later with , of , Emeraldas presents Hiroshi with the Cosmo Dragoon once owned by Tochiro.
Another divergence from the manga takes place here when Emeraldas states that there are five Cosmo Dragoons in existence (hers and the ones owned by Tochiro, Captain Harlock, Tetsuro and Maetel), whereas in the manga there are only four. Later, Hiroshi Umino and his elderly friend visit a planet whose inhabitants have been forced out by a murderous cyborg. This cyborg killed one of the planet's inhabitants and drove his son mad. Umino meets the son and his sister and with their help and Emeraldas', he kills the oppressive cyborg.
While the story can stand on its own, independent of Matsumoto's other works, it mostly assumes that the viewer has seen the other Harlock titles, especially Galaxy Express 999 (the TV series and the movies), which featured Maetel, Emeraldas' sister, but had the occasional appearance of Emeraldas (Note: Maetel, for some reason in the English dub is referred to as Mataire). The story of Queen Emeraldas is set five years after the events of the final Galaxy Express 999 movie and was designed to give Matsumoto's fans a further glimpse into what became of Emeraldas. However, of the other characters, most are only mentioned in passing, except for Captain Harlock who has a brief cameo appearance.
Queen Emeraldas first two episodes were produced by OLM, Inc. and licensed for American distribution by ADV Films, being one of their earlier releases on the DVD format. Those two episodes also have regular runs on the Action Channel. In Japan, the remaining two episodes were produced by MAC (Multi Access Company) and were released the following year after the initial two, indicating that a separate contract (that is not yet forthcoming) would be required for anyone to license the concluding episodes of the story outside Japan.
Manga
Leiji Matsumoto first published a one-shot in 1975 in the publisher Akita Shoten's magazine Princess. It began its serialization in Kodansha's Weekly Shōnen Magazine in 1978. It ended in 1979, and four collected volumes were released by Kodansha. Kodansha Comics licensed the series to be published in English in two large-format hardcover volumes; the first was released on July 26, 2016, while the second was published on July 25, 2017.
Anime
An original video anime adaptation was produced by Oriental Light and Magic and released in four episodes between 1998 and 1999. Half the series was dubbed into English and released by ADV Films on DVD in 1999.
Cast
Megumi Hayashibara as Hiroshi Umino
Reiko Tajima as Emeraldas
Kenichi Ogata as Lou Row
Koichi Yamadera as Tochiro Oyama
Makio Inoue as Captain Harlock
Episodes
"Departure" (May 6, 1998)
"Eternal Emblem" (October 7, 1998)
"Friendship" (August 6, 1999)
"Siren" (December 18, 1999)
Other appearances
Emeraldas appeared in the 1978 Space Pirate Captain Harlock television series during flashbacks. She also had a guest appearance in the 1978 Galaxy Express 999 series. This episode, Eternal Traveller Emeraldas, was later turned into an hour-long television special expanding on that story. She subsequently appeared as a supporting character in the film Arcadia of My Youth where it is shown how she obtained her facial scar. She also makes brief appearances in Harlock Saga and Cosmo Warrior Zero. Her origin and youth is depicted in Maetel Legend.
As with Harlock and most other characters of the Leijiverse, Emeraldas' appearances in various stories cannot be applied to one consistent timeline. In the 1978 Galaxy Express 999 story, for example, one notable difference from her other depictions is that Emeraldas is suffering from an unknown illness. Her place as captain was taken over by a robot imposter while she was mostly confined to bed. The story suggests that she does not have much longer to live. This illness is alluded to in the recent manga where Emeraldas does not engage in much physical action due to her weakened condition. However, the OVA version is a fearsome combatant—as seen in her gravity saber duel with Queen Baraluda—and shows no sign of any such illness.
In the original Captain Harlock series in episode 30 (My Friend, My Youth) Emeraldas is shown to have a younger brother, but no sister is ever mentioned. Opposed to that, no brother exists in Queen Emeraldas or any other movies or series of the franchise.
Emeraldas also appears in Matsumoto's latest manga, Captain Harlock: Dimensional Voyage.
References
Further reading
External links
松本零士 スーパーメカニクス クイーン・エメラルダス号
Category:1998 anime OVAs
Category:ADV Films
Category:Kodansha manga
Category:Leiji Matsumoto
Category:OLM, Inc.
Category:Shōnen manga
Category:Space opera anime and manga
Category:Space pirates
Category:Space Western anime and manga
|
NOTICE: This opinion is subject to motions for rehearing under Rule 22 as well as
formal revision before publication in the New Hampshire Reports. Readers are
requested to notify the Reporter, Supreme Court of New Hampshire, One Charles
Doe Drive, Concord, New Hampshire 03301, of any editorial errors in order that
corrections may be made before the opinion goes to press. Errors may be reported
by e-mail at the following address: [email protected]. Opinions are
available on the Internet by 9:00 a.m. on the morning of their release. The direct
address of the court’s home page is: http://www.courts.state.nh.us/supreme.
THE SUPREME COURT OF NEW HAMPSHIRE
___________________________
7th Circuit Court-Dover Probate Division
No. 2018-0309
IN RE TRUST OF MARY BAKER EDDY
Argued: February 14, 2019
Opinion Issued: June 14, 2019
Pierce Atwood LLP, of Portsmouth (Michele E. Kenney on the brief), DLA
Piper LLP, of Wilmington, Delaware (Stuart Brown on the brief and orally), and
Foehl & Eyre, PC, of Glenside, Pennsylvania (Robert B. Eyre on the brief), for
the Second Church of Christ, Scientist, Melbourne (Australia).
Upton & Hatfield, LLP, of Concord (Russell F. Hilliard, James F.
Raymond, and Michael P. Courtney on the brief, and Mr. Hilliard orally), for the
Trustees of the Clause VI Trust and Clause VIII Trust.
Gordon J. MacDonald, attorney general (Thomas J. Donovan, director of
charitable trusts, and Charles D. Shockley, assistant director of charitable
trusts, on the brief, and Mr. Donovan orally), for the Attorney General, Director
of Charitable Trusts.
DONOVAN, J. The Second Church of Christ, Scientist, Melbourne
(Australia) appeals an order of the Circuit Court (King, J.), denying it standing
to request affirmative relief and enforce certain charitable trusts created by the
will of Mary Baker Eddy. We affirm.
I. Factual and Procedural Background
The relevant facts follow. Mary Baker Eddy founded the Church of
Christian Science and, upon her death in 1910, her will established two
testamentary trusts, known as the Clause VI Trust and Clause VIII Trust. The
Clause VI Trust bequeathed to the “Christian Science Board of Directors of The
Mother Church” $100,000 in trust “for the purpose of providing free instruction
for indigent, well educated, worthy Christian Scientists.” Clause VIII of Mrs.
Eddy’s will devised “all the rest, residue and remainder of [her] estate . . . to
The Mother Church ― The First Church of Christ, Scientist, in Boston,
Massachusetts, in trust,” for certain “general purposes.” She directed, inter
alia, that “such portion of the income of [her] residuary estate as may be
necessary shall be used for the purpose of keeping in repair the church
building” and her former home in Boston and that “the balance of said income,
and such portion of the principal as may be deemed wise,” shall be used “for
the purpose of more effectually promoting and extending the religion of
Christian Science as taught by [Mrs. Eddy].”
In previous litigation concerning these trusts, we upheld the validity of
the trusts and established that the bequest in Clause VIII was to be held in
trust for two purposes, church building repair and “promoting and extending
the religion of Christian Science as taught by [Mrs. Eddy].” Glover v. Baker, 76
N.H. 393, 400-01 (1912); see also Fernald v. Church, 77 N.H. 108, 109 (1913).
The Massachusetts Supreme Judicial Court reached a similar conclusion in
Chase v. Dickey, 99 N.E. 410 (Mass. 1912), wherein the court held that the
construction of the Clause VIII Trust manifests a purpose to make the
promotion and extension of the religion of Christian Science the “dominating
and real residuary purpose” of Mrs. Eddy. Chase, 99 N.E. at 415. As a result
of this litigation, court oversight of the trusts commenced, and annual
accounts for both trusts, and requests for appointments of trustees, have been
filed in the Concord Probate Court (now, Circuit Court) for over one hundred
years.
The trustees of the Clause VIII Trust were comprised of the Board of
Directors of the Mother Church and Josiah Fernald, the administrator of Mrs.
Eddy’s estate, until Mr. Fernald’s death in 1949. At that time, Judge Lord of
the probate court, in a letter to the trustees, concluded that it was “not
necessary to fill the vacancy [of Mr. Fernald]” and that the “five members of the
Christian Science Board of Directors who are the surviving trustees . . . shall
constitute the sole trustees” of the Clause VIII Trust. Since the 1949 letter, the
trustees of the Clause VIII Trust have all been members of the Mother Church
Board of Directors.
2
In 1993, following an investigation by the New Hampshire Director of
Charitable Trusts (DCT) into a five million dollar loan from the Clause VIII
Trust to the Mother Church to be used to fund a failed television venture, the
Probate Court (Cushing, J.) approved a stipulation between the DCT and the
trustees of the Clause VIII Trust. The stipulation provided, inter alia, that: (1)
the Mother Church agreed to repay the loan to the Clause VIII Trust; (2) the
Clause VIII Trust income was to be used to repair the church, with any
available, remaining income to be applied to the promotion and extension of
Christian Science, at the discretion of the trustees; (3) further loans from the
trust were prohibited; and (4) the principal of the Clause VIII Trust could only
be invaded with court approval.
The current litigation commenced in 2015, when Second Church, an
alleged qualified beneficiary of the Clause VIII Trust, sought to review, and
potentially object to, the annual accounting filed by the trustees. Although the
DCT assented to Second Church’s motion, the trustees objected on the basis
that Second Church, as a “branch church,” lacked standing to sue. Second
Church responded by arguing that it had standing under the special interest
doctrine. The court scheduled a hearing to address the issue of standing.
However, the court did not rule on Second Church’s motion or the standing
issue because the parties agreed at the hearing that Second Church would
withdraw its motion and the DCT, Second Church, and the trustees would
cooperate to resolve concerns raised by Second Church and the DCT.
Notably, prior to the court’s scheduling order, the DCT had not
responded to the concerns voiced by Second Church. Thereafter, the DCT filed
a memorandum in April 2016 asserting that Second Church did not have
special interest standing, especially in light of the DCT’s “plan to review the
Clause VIII Trust’s decision making concerning its distributions.” In his
memorandum, the DCT recognized that prior litigation had arisen from the
“tension” between the two beneficial purposes of the Clause VIII Trust, namely:
(1) repair of the Mother Church building(s); and (2) “promoting and extending
the religion of Christian Science.” The DCT also acknowledged the tension
between the 1912 decision in Chase, 99 N.E. at 415, that devoted the Clause
VIII Trust distributions primarily to promoting and extending the religion of
Christian Science, and the court’s approval of the 1993 stipulation prioritizing
distributions for church repairs. The DCT further opined that “[b]ecause the
trustees of the Clause VIII Trust are also the Board of Directors of the Mother
Church, they have embedded conflicting fiduciary obligations.” In light of these
concerns, the DCT outlined a review plan that he intended to undertake with
the trustees, which included a “review [of] the distributions made from the
Clause VIII [Trust].” The DCT concluded that because his office had, and
continued to take, an active role in monitoring the Clause VIII Trust, “special
interest standing is not warranted.”
3
Thereafter, following the DCT’s objection to the trustees’ accounts filed in
2016, the DCT and trustees reached an agreement and the trustees filed a
motion, assented-to by the DCT, to, among other things, approve an amended
account. Second Church moved for authorization to file an amicus curiae brief
voicing its continuing concerns. The trial court issued an order requiring the
trustees to file accounts audited by an independent auditor. The court also
denied Second Church’s motion, but indicated that Second Church should
share information with the DCT who, by statute, represents their interests in
this matter. See RSA 564-B:4-405(c) (2007).
Subsequently, the trustees submitted an assented-to motion to, inter
alia, amend the 1993 order. Second Church, again, sought to submit a brief as
amicus curiae. The trustees objected. Second Church filed a responsive
pleading as well as a status report and a request for time to conduct discovery,
despite the fact that its standing to participate in this matter had not yet been
determined. The court scheduled a hearing for November 2017. Prior to the
hearing, the trustees filed a memorandum concerning the issue of standing.
Second Church responded by moving for the appointment of an independent
trustee and filing a memorandum on standing.
In March 2018, the trial court issued an order finding that Second
Church failed to satisfy its burden to demonstrate that it had standing. We
note that in making this determination, the trial court did not identify the
standard by which it decided the standing issue ― i.e., whether the trial court
considered the challenge to Second Church’s standing as a motion to dismiss.
In its order, the trial court acknowledged the general rule that when a
trust is determined to be charitable, it becomes the duty of the attorney general
to ensure that the rights of the public in the trust are protected and that the
trust is properly executed. See Petition of Burnham, 74 N.H. 492, 494 (1908).
The court further noted that New Hampshire law is unclear as to whether a
possible beneficiary of a charitable trust, like Second Church here, has
standing. Looking to other jurisdictions for guidance, the trial court
determined that most jurisdictions have ruled that a possible beneficiary is
generally not entitled to sue for enforcement of the trust. See Alco Gravure,
Inc., v. Knapp Foundation, 479 N.E.2d 752, 755 (N.Y. 1985); see also State ex
rel. Nixon v. Hutcherson, 96 S.W.3d 81, 83-84 (Mo. 2003). However, the trial
court also found that courts have recognized an exception to this rule “where
an individual seeking enforcement of the trust has a ‘special interest’ in
continued performance of the trust distinguishable from that of the public at
large.” Hooker v. Edes Home, 579 A.2d 608, 612 (D.C. 1990).
After considering how other courts have applied the doctrine of special
interest standing, the trial court applied a five-factor test, often referred to as
the Blasko test. See Mary Grace Blasko, Curt S. Crossley, David Lloyd,
Standing to Sue in the Charitable Sector, 28 U.S.F. L. Rev. 37, 61 (1993)
4
(hereinafter, “Blasko”). The test is based upon a comprehensive survey of case
law and it sets forth five factors to determine whether a plaintiff’s interest is
distinct enough from the public at large to justify conferring standing upon the
plaintiff in order to enforce a charitable trust. See generally id. The factors
are: (1) the extraordinary nature of the acts complained of and the remedies
sought; (2) the presence of bad faith; (3) the attorney general’s availability and
effectiveness; (4) the nature of the benefitted class and its relationship to the
charity; and (5) the social desirability of conferring standing. Id. at 61.
Applying the Blasko test, the trial court found that none of the factors
weighed in favor of granting Second Church standing. Second Church filed a
motion for reconsideration, which the trial court denied. This appeal followed.
II. Analysis of Second Church’s Claims
On appeal, Second Church argues that, even though the trial court
properly adopted the Blasko test, it misapplied the factors. Second Church
asserts that, under the Blasko test, as one of a limited number of potential
beneficiaries under the trusts, it has a “special interest” in the Clause VIII
Trust sufficient to justify standing. Moreover, Second Church contends that
the trial court improperly reached its decision without the development of a
factual record, while also faulting Second Church for not developing sufficient
facts to demonstrate standing. Although the DCT agrees with Second Church
that we should “recognize the standing of certain persons or entities that have
a special interest in a particular charitable trust to enforce that trust,” both the
DCT and the trustees maintain that the trial court properly determined that
Second Church lacks special interest standing. We agree with the DCT and the
trustees.
A. Standing Issue
We generally will not disturb the circuit court’s decree unless it is
unsupported by the evidence or plainly erroneous as a matter of law. In re
Estate of Locke, 148 N.H. 754, 755 (2002); see also RSA 567-A:4 (2007). In
this case, the parties dispute the applicable standard of review. Second
Church argues that we should review the trial court’s application of the special
interest standing factors de novo. The DCT argues that the question of
whether to adopt special interest standing is a question of law which we review
de novo. However, the trustees and the DCT further argue that we should not
disturb the trial court’s standing determination unless it is plainly erroneous
as a matter of law.
Because the trial court did not clarify how it reviewed the pleadings in
determining that Second Church lacked standing, and there was no discovery
or evidentiary hearing, we assume without deciding that the trial court viewed
5
the challenge to Second Church’s standing as a motion to dismiss.1 When a
motion to dismiss “challenges the plaintiff’s standing to sue, the trial court
must look beyond the plaintiff’s unsubstantiated allegations and determine,
based on the facts, whether the plaintiff has sufficiently demonstrated his right
to claim relief.” Ossipee Auto Parts v. Ossipee Planning Board, 134 N.H. 401,
403-04 (1991). Nonetheless, in this case, the material facts are not disputed;
only their legal effect stands in dispute. See Appeal of N.H. Right to Life, 166
N.H. 308, 311 (2014). The issue of standing is, therefore, a question of law,
which we review de novo. Id.
The general rule is that potential trust beneficiaries, in suits involving
charitable trusts, may not bring an action to enforce the terms of such a trust.
See Restatement (Third) of Trusts § 94 cmt. g at 8-9 (2011). Instead, the
attorney general (or the DCT, as his representative) has the statutory power
and duty to represent the public in the enforcement and supervision of
charitable trusts. See RSA 564-B:4-405(c); RSA 7:20 (2013); Attorney Gen. v.
Rochester Trust Co., 115 N.H. 74, 76 (1975) (the attorney general has the duty
to protect the rights of the public in charitable trusts); Concord Nat. Bank v.
Haverhill, 101 N.H. 416, 419 (1958); Restatement (Third) of Trusts, supra at 4.
As another court has framed the issue:
Principally, the rationale for vesting exclusive power in a public
officer stems from the inherent impossibility of establishing a
distinct justiciable interest on the part of a member of a large and
constantly shifting benefited class, and the recurring burdens on
the trust res and trustee of vexatious litigation that would result
from recognition of a cause of action by any and all of a large
number of individuals who might benefit incidentally from the
trust.
Hooker, 579 A.2d at 612. Nonetheless, the Restatement as well as other
jurisdictions have recognized an exception to this rule when a clearly identified
class “has a justiciable interest in enforcement of the trust.” Id.; see Alco
1 We note that the plainly erroneous language derives from case law and RSA 567-A:4. RSA 567-
A:4 states, in relevant part: “The findings of fact of the judge of probate are final unless they are so
plainly erroneous that such findings could not be reasonably made.” Our case law has somewhat
altered this standard and provides that “[w]e will not disturb the probate court’s decree unless it is
unsupported by the evidence or plainly erroneous as a matter of law.” In re Estate of Locke, 148
N.H. at 755.
In this case, because there was no evidentiary hearing, the trial court did not necessarily
find any facts and it would be inappropriate to defer to its factual findings or rulings of law.
Nonetheless, the trustees and the DCT, at oral argument, advocated for a plainly erroneous
standard because the trial court judge had presided over this case for several years and had the
benefit of having the entire probate record before him when deciding the issue of standing.
Although this is true, we have the majority of the record before us, and, because the material facts
are not in dispute, de novo review is more appropriate.
6
Gravure, 479 N.E.2d at 755-56 (concluding that plaintiffs had standing where
they were a well-defined class of potential beneficiaries challenging the
dissolution of the charitable corporation); Restatement (Third) of Trusts, supra
§ 94 cmt. g at 8-9.
Although we have yet to determine whether a potential beneficiary of a
charitable trust has standing, our law supports the concept of conferring
standing upon a third party if it establishes that it has a special interest. For
instance, we have previously noted that “[w]hile the Attorney General . . .
represents the public in the enforcement and supervision of charitable trusts,
this [representation] does not preclude other interested parties from presenting
their views particularly where they are acting for the benefit of the charitable
trust as a whole.” Concord Nat. Bank, 101 N.H. at 419. RSA 564-B:4-405(c)
also implicitly allows special interest standing by providing that “[t]he settlor of
a charitable trust or the director of charitable trusts, among others, may
maintain a proceeding to enforce the trust.” RSA 564-B:4-405(c) (emphasis
added). Moreover, the comments to the Uniform Trust Code, upon which the
New Hampshire Trust Code is based, see RSA ch. 564-B (2007 & Supp. 2018),
contemplate that certain others may have standing based upon their special
interest in the charity. See Unif. Trust Code § 405, Comment (2006) (“The
grant of standing to the settlor does not negate the right of the state attorney
general or persons with special interests to enforce either the trust or their
interests.” (emphasis added)); see also Unif. Trust Code, supra § 413, Comment
(“[A] petition requesting a court to enforce a charitable trust or to apply cy pres
may be maintained by . . . the state attorney general, or by a person having a
special interest in the charitable disposition.”).
Accordingly, we recognize the doctrine of special interest standing in
matters involving charitable trusts. We must next determine how to apply this
doctrine. Second Church argues that the trial court correctly adopted the
Blasko five-factor test. Second Church further argues that the presence of any
one factor by itself is sufficient to conclude that it has a special interest. See
Blasko, supra at 61.
The trustees advocate for a more stringent test, which follows the test
approved by the American Law Institute (ALI), that proposes five factors similar
to the Blasko factors but requires a private party to satisfy all of the factors to
demonstrate special interest standing. See Restatement of the Law Charitable
Nonprofit Organizations § 6.05 (Tent. Draft No. 2, 2017) (approved May 22,
2017). The trial court considered this test but applied the Blasko test upon
determining that the flexibility of the Blasko test better suits the pursuit of a
just outcome. The DCT argues that the trial court properly adopted and
applied the Blasko test.
We look to other jurisdictions for guidance on the application of the
special interest standing doctrine. See N.H. Right to Life v. Dir., N.H.
7
Charitable Trusts Unit, 169 N.H. 95, 103 (2016) (looking to the decisions of
other jurisdictions interpreting similar acts for guidance). The Arizona Court of
Appeals adopted a modified version of the five-factor balancing test described
by Blasko, giving special emphasis to the nature of the benefitted class and its
relationship to the trust, the nature of the remedy requested, and the
effectiveness of attorney general enforcement of the trust. Schalkenbach
Foundation v. Lincoln, 91 P.3d 1019, 1026 (Ariz. Ct. App. 2004). In Alco
Gravure, the New York Court of Appeals considered similar, albeit fewer,
factors to determine whether the plaintiffs had a “special interest” in charitable
funds and could maintain a suit. Alco Gravure, 479 N.E.2d at 755-56. There,
the court focused on the well-defined class of beneficiaries and the fact that
they were challenging the dissolution of the charitable corporation, as opposed
to the ongoing administration of the corporation, to conclude that the plaintiffs
had standing. Id.
Similarly, in Hooker, the District of Columbia Court of Appeals
considered the nature of the class and the nature of the challenge to the
trustees’ acts in deciding whether to apply the special interest exception.
Hooker, 579 A.2d at 614, 616-17 (concluding that the class of elderly, indigent
women, who are eligible potential residents of a Trust-operated home, had
standing to challenge the trustees’ decision to put into effect a “major change
from the manner in which the trust had been administered in the past”). The
Supreme Court of Missouri likewise recognized that “[a] person . . . may have
standing if he or she is entitled to a preference under the terms of the trust or
if the person is a member of a small class of identifiable beneficiaries.” State ex
rel. Nixon, 96 S.W.3d at 84. The court also acknowledged that a person may
establish standing if he or she “is entitled to receive a benefit under the trust
that is not merely the benefit to which members of the public in general are
entitled.” Id. at 84-85 (quotation omitted) (concluding that the plaintiffs could
not establish standing when they failed to meet the burden of “showing a clear,
identifiable, and present claim to any benefits” from the trust).
After review of the factors that other jurisdictions consider relevant to a
special interest standing determination, we agree with the trial court that the
Blasko test is preferable because it provides a court with the flexibility to
consider a variety of factors. Although Blasko suggests that “[t]he presence of
any one . . . factor[] by itself can lead a court to decide that the plaintiff has a
special interest in a charity,” the article notes that, “[i]f a combination of
elements is present, then a court can balance them against one another and
reach a decision.” Blasko, supra at 61. Depending upon the circumstances,
some factors may carry more weight than others and, in New Hampshire, when
evaluating whether a party has standing to sue, we generally focus upon
whether the party suffered a legal injury against which the law or policy was
designed to protect. See Petition of Lath, 169 N.H. 616, 620 (2017).
Accordingly, because of the various interests that must be considered to
determine special interest standing in the context of charitable trust matters,
8
we conclude that a balancing test of all five Blasko factors best comports with
New Hampshire law. We thus address each factor in turn.
i. The Extraordinary Nature of the Acts Complained of and
the Remedy Sought
As to the first factor, the trial court found that Second Church’s request
for an independent trustee, among other remedies, seeks to undo prior court
orders and suggests remedies despite Second Church’s “informative and
thorough amicus submissions that the Court assumes the DCT has reviewed.”
The trial court therefore determined that Second Church merely disagreed with
the DCT’s judgment, and this disagreement is not sufficient to justify standing.
Second Church argues that the trial court erred by: (1) focusing on the
requested relief, rather than the extraordinary nature of the acts alleged by
Second Church; and (2) failing to recognize that the bad acts committed by the
trustees are extraordinary while the requested remedy is not.
Blasko recognized that “courts seem to be influenced from the outset by
the nature and extent of the remedy requested.” Blasko, supra at 62. When a
requested remedy could be “highly intrusive in the administration of the trust,”
it is likely to weigh against a finding of standing. See Schalkenbach
Foundation, 91 P.3d at 1027-28. When trustees seek to fundamentally change
the charitable bequest by dissolving the nonprofit corporation or closing the
facility created by the trust, and the plaintiffs seek to stop this action, then the
plaintiffs are more likely to establish standing. See Hooker, 579 A.2d at 616-
17; Alco Gravure, 479 N.E.2d at 755.
To begin, we need not decide whether the trial court should have
considered the extraordinary nature of the bad acts, because, upon our de
novo review, we consider them now, and we conclude that Second Church has
not demonstrated that the trial court’s failure to consider the extraordinary
acts is sufficient, by itself, to constitute reversible error. See Gallo v. Traina,
166 N.H. 737, 740 (2014). Accordingly, we examine the requested remedy in
relation to the nature of the alleged bad acts.
Second Church alleges that the trustees engaged in self-dealing and have
an embedded conflict due to their dual role as trustees and members of the
board of directors of the Mother Church. Furthermore, Second Church alleges,
among other things, that the trustees have improperly favored the Mother
Church when distributing the Clause VIII trust assets. Second Church,
therefore, seeks the “relief of having an independent trustee appointed to the
Clause [VIII] [T]rust.”
We find Schalkenbach Foundation to be instructive under these
circumstances. Schalkenbach Foundation, 91 P.3d at 1027. In Schalkenbach
Foundation, the appellants alleged that the Foundation had been
9
systematically diverting funds from their approved purpose to improper uses,
which the court found implied a request to remedy the situation by the
appellants’ participation in and influence of the daily operations of the
Foundation. Id. at 1027-28. The appellants specifically requested, among
other things, to “replace the Foundation’s officers and directors with persons
interested in carrying out the terms of the charitable trust.” Id. at 1021. The
court concluded that the remedies that the appellants wished to impose were
“highly intrusive in the administration of the trust, which could open the
Foundation to further litigation by other potential or disappointed
beneficiaries.” Id. at 1028.
Similarly, here, because Second Church seeks the appointment of an
independent trustee to oversee the administration of the trust, including the
distribution of funds, this request would influence the daily operations of the
trust and the ongoing administration of the trust. Consequently, this remedy
could expose the charity to vexatious litigation by Second Church or other
disappointed beneficiaries that would still be concerned with the distribution of
funds even after the appointment of an independent trustee.
Moreover, Second Church’s requested remedy is unnecessary under the
circumstances because the trial court has already taken steps to address the
alleged bad acts. Notably, in its March 2018 order, the trial court
acknowledged the embedded conflict and imposed certain conditions that
addressed this conflict, including, inter alia, requiring the trustees to furnish to
the DCT a schedule of recipients of the Clause VIII distributions. The March
2018 order also partially amended the 1993 order “to the extent it gave priority
to church repair.” Therefore, in relation to the nature of the trustees’ alleged
bad acts, the appointment of an independent trustee would be unnecessary
under these circumstances. Accordingly, this factor weighs against standing.
ii. Presence of Bad Faith
As to the second factor, Second Church argues that the evidence that the
trustees acted in bad faith is substantial. Blasko notes that the presence of
fraud or other deliberate misconduct is not a factor which courts necessarily
discuss when evaluating a plaintiff’s special interest, but it is nevertheless an
element which influences their decisions. Blasko, supra at 64. “When alleging
fraud . . . the plaintiff must specify the essential details of the fraud, and
specifically allege the facts of the defendant’s fraudulent actions. It is not
sufficient for the plaintiff merely to allege fraud in general terms.” Lamprey v.
Britton Constr., 163 N.H. 252, 262-63 (2012) (quotation omitted) (standard for
withstanding a motion to dismiss when alleging fraud).
Second Church specifically contends that the trustees acted in bad faith
when they distributed the Clause VIII funds solely to the Mother Church.
However, as the DCT counters, Second Church fails to consider the 1993 order
10
which required the trustees to make distributions of the Clause VIII Trust’s
income primarily to repair the mother church. Second Church also asserts
that after being ordered by the trial court to submit independent audits on the
accounts, the trustees submitted non-independently prepared unaudited
financial statements and, given the existence of the embedded conflict, this
conduct represented a clear example of bad faith. The trial court found that
the accounts were accepted for several years by the then-DCT and were
implicitly approved by the court. The trial court acknowledged that, by doing
so, the trustees committed misconduct. However, the court further found that
Second Church’s allegations were insufficient to demonstrate outright fraud or
bad faith. We agree.
Second Church’s allegations do not demonstrate that this conduct
amounts to bad faith or fraud that directly injures Second Church. See
Blasko, supra at 64-65. The assertion that the conduct represented bad faith
merely because of an embedded conflicting fiduciary obligation is insufficient.
See Lamprey, 163 N.H. at 256 (explaining that the threshold inquiry on a
motion to dismiss involves testing the facts alleged against the applicable law,
and that we need not accept allegations that are mere conclusions of law).
Second Church further relies upon Matter of Green Charitable Trust, 431
N.W.2d 492 (Mich. Ct. App. 1988), to argue that the trustees’ mismanagement
is sufficient to confer standing. In Green Charitable Trust, named beneficiaries
of a charitable trust and the state attorney general brought petitions against
the trustees alleging that the trustees mismanaged the sale of property owned
by the charitable trust. Green Charitable Trust, 431 N.W.2d at 494-95, 505-
06. The court upheld the trial court’s finding that the trustees violated their
fiduciary duty to the beneficiaries by mismanaging the sale of the property and
having a conflict of interest in representing both the buyer and seller of the
property. Id. at 497, 504.
Green Charitable Trust is inapposite to the circumstances here. First,
standing was not at issue in Green Charitable Trust. Second, here Second
Church is a potential beneficiary, whereas, in Green Charitable Trust, the
named charitable trust beneficiaries together with the attorney general
challenged the actions of the trustees. Id. at 494-95. Thus, the reasoning in
Green Charitable Trust does not provide support for Second Church’s assertion
that the trustees’ alleged mismanagement demonstrates bad faith sufficient to
weigh in favor of standing. Moreover, Second Church’s allegations of
mismanagement ― that Mother Church received all distributions, the trustees
failed to restore the priorities of the Clause VIII Trust after the 1993 order, and
the trustees failed to have independent audits of the accounts ― are
insufficient to demonstrate bad faith that weighs in favor of granting it
standing.
11
In sum, while Second Church’s allegations may demonstrate misconduct,
they fail to demonstrate fraud or bad faith. Thus, we agree with the trial court
that this factor is neutral and neither weighs against nor in favor of conferring
standing.
iii. Attorney General’s Availability and Effectiveness
Second Church next argues that the DCT has not been effective in
policing the trustees’ misconduct. The trustees disagree and argue that the
DCT has been available and effective in enforcing the trusts. The trustees
further contend that this finding is the most important Blasko factor to
consider when deciding whether to grant special interest standing.
As we previously discussed, the DCT is empowered to represent the
public and potential beneficiaries of New Hampshire charitable trusts. See
RSA 564-B:4-405(c). When assessing this factor under the Blasko test, “the
nature and level of the attorney general’s involvement can profoundly influence
a court’s decision to grant or deny standing.” Blasko, supra at 67. “[W]here
the attorney general is heavily involved in charities regulation, courts generally
will take a dim view of private parties attempting to step into the attorney
general’s role to seek enforcement of charitable fiduciary duties.” Id. at 70.
Under this factor, we consider whether the attorney general is able to enforce
the trust or whether the lack of enforcement is due to a conflict of interest,
ineffectiveness, or lack of resources. Schalkenbach Foundation, 91 P.3d at
1028 (attorney general’s decision not to enforce the trust was not influenced by
lack of resources and there was no evidence of neglect of the public interest;
thus, this factor weighed against a finding of special interest standing).
Second Church alleges that the DCT allowed the trust to “fall into the
exclusive control of the conflicted . . . trustees,” participated in the crafting of
the 1993 order that “turned the Trust priorities upside down,” and sat idly by
as the trustees diverted “some $26 million in funds to their preferred Mother
Church.” We disagree with Second Church’s characterization of the DCT’s
oversight. As the trial court noted, during the long history of the trusts, the
DCT’s performance of his duties has been mixed and arguably deficient.
However, the record also demonstrates that during the pendency of the present
dispute, the DCT has been an active participant, has acknowledged the
embedded conflict with the trustees, and suggested measures to mitigate the
effect of that conflict. For instance, during a motions hearing, the trustees
acknowledged that the DCT had certain objections to the accounts filed in
2016 and that the two parties then proceeded to work together to resolve those
concerns. In addition, in the DCT’s memorandum concerning the standing of
Second Church, he recognized the “embedded conflicting fiduciary obligations,”
while also asserting a plan to, inter alia, review the trustees’ process for making
distributions and review the trustees’ resolution regarding the conflicting
fiduciary obligations.
12
Nonetheless, Second Church maintains that the DCT is ineffective in
addressing the embedded conflict with the trustees and, therefore, allowing
Second Church to intervene as a party familiar with the trusts “is the best, and
perhaps only, way to protect the Trust assets.” Second Church relies upon the
reasoning in Holt v. College of Osteopathic Physicians and Surgeons, 394 P.2d
932 (Cal. 1964), in which the court noted that “[t]he administration of
charitable trusts stands only to benefit if in addition to the Attorney General
other suitable means of enforcement are available.” Holt, 394 P.2d at 936. In
Holt, minority trustees brought suit against the charitable corporation and the
majority trustees alleging that the defendant trustees acted contrary to the
charitable purposes of the college. Id. at 934. The attorney general filed an
answer concluding that the suggested changes to the operation of the college
would not be detrimental to the public interest and did not warrant legal action
by its office to prevent such changes. Id. The attorney general also claimed
not to have information that the trust assets were being diverted from their
charitable purpose, which, as the court noted, illustrated the concern that the
attorney general “may not be in a position to become aware of wrongful
conduct or to be sufficiently familiar with the situation to appreciate its
impact.” Id. at 935-36. The court held that the attorney general applied the
wrong test in deciding not to take legal action because the assets of the college
could only be used for the purposes for which they were received in trust, not
in any manner that was not detrimental to the public interest. Id. at 936.
Second Church’s reliance on Holt is misplaced. First, the plaintiffs in
Holt were minority trustees, whereas here, the appellant is a potential
beneficiary. See id. at 934. Second, the attorney general in Holt applied the
wrong test when determining whether to take legal action, while here, the
record demonstrates that the attorney general is actively involved in overseeing
the administration of the trust. Second Church fails to demonstrate that it is
better suited or more qualified than the attorney general to ensure the proper
enforcement of the trust. Despite Second Church’s assertion that it is
“extensively familiar” with the relationships among the Mother Church, the
Christian Science Publishing Society, and the Clause VIII Trust, Second
Church does not allege or explain, not only how it is familiar with the trust, but
also how any “familiar[ity]” with the trusts places it in a better position than
the DCT. Moreover, Second Church does not allege that it has access to
documents and information that the DCT does not have. In fact, Second
Church’s pleadings to the trial court indicate that it relied upon documents it
received from the DCT as factual support for its allegations regarding the
trustees’ actions and the trustees’ relationship with the DCT.
Second Church also alleges that “[g]iven the number of questionable acts
taken by the . . . Trustees, it may be that there are simply too many aspects of
the administration of the Clause [VIII] Trust for the DCT to effectively police.”
To support this contention, Second Church asserts that it wrote a letter in
January 2017 alerting the DCT of potential mismanagement of trust assets,
13
and Second Church believes that the DCT has not acted on that information.
However, as mentioned above, the DCT has been actively involved in this
matter and has taken steps to address the embedded conflict. The trial court’s
March 2018 order also ensures the continued involvement of the DCT by
requiring the trustees to submit to the DCT “along with the annual audited
accounts, a schedule of recipients of Clause VIII distributions and provide
affidavit(s), under oath, that these distributees are in fact ‘third party
recipients’ and not affiliated with the Mother Church.” The DCT’s reluctance to
agree with Second Church to seek the appointment of an independent trustee
is not sufficient to support Second Church’s allegation that the attorney
general is not involved or is ineffective.
Thus, we agree with the trial court that this factor does not weigh in
favor of granting standing to Second Church. In addition, we iterate the trial
court’s encouragement of Second Church to continue to share information and
its concerns with the DCT.
iv. Nature of the Benefitted Class and its Relationship to the
Charity
Second Church argues that it is part of a defined class of entities that
bears a special relationship to the charity. Courts have found special interest
standing where the class of entities is “sharply defined and its members are
limited in number.” Hooker, 579 A.2d at 614. “[A] plaintiff should have a
direct and defined interest, distinct from that of the general public, in the
enforcement of the charitable obligations at issue to claim a ‘special interest’ in
the charity.” Blasko, supra at 70.
Second Church contends that it is a branch church, one of 1,400
Christian Science churches, that is defined by its unique connection to the
Mother Church. Second Church relies upon several cases to argue that other
courts have “granted special interest standing to more attenuated persons.”
For instance, Second Church relies upon Y.M.C.A. of City of Washington,
where members of a local branch brought suit claiming that the YMCA
breached a charitable trust by allowing the local branch building to deteriorate
and by closing it. Y.M.C.A. of City of Washington v. Covington, 484 A.2d 589,
591 (D.C. 1984). In holding that the plaintiffs had special interest standing,
the District of Columbia Court of Appeals concluded that the members of the
branch received a particular benefit from this local branch and the closing of
the building injured them in particular. Id. at 592. Similarly, in Alco Gravure,
the plaintiffs ― a corporate employer whose employees were intended
beneficiaries of the Foundation, and two individual employees of the corporate
plaintiff ― constituted a class of potential beneficiaries of the Foundation. Alco
Gravure, 479 N.E.2d at 753-54 (“The Foundation’s primary purpose was . . . to
assist employees of the founder’s corporations and their families.”). The
plaintiffs were entitled to a preference in the distribution of the defendants’
14
funds and were therefore challenging the dissolution of the Foundation and the
complete elimination of their status as preferred beneficiaries of the funds. Id.
at 754-56. The court found that the plaintiffs had special interest standing
because the class of beneficiaries was both well-defined and entitled to a
preference in the distribution of the defendants’ funds. Id. at 755. The court
also granted standing because it found that the policy reasons for limiting
standing did not apply to the circumstances in that case. Id. at 756.
Specifically, the court concluded that “the present action concerns not the
ongoing administration of a charitable corporation, but the dissolution of that
corporation and the complete elimination of the individual plaintiffs’ status as
preferred beneficiaries of the funds.” Id.
The cases relied upon by Second Church concern plaintiffs that comprise
a sharply defined set of potential beneficiaries with a greater interest in the
charitable trust and corporation than the general public. Second Church fails
to demonstrate that it is in such a class. The income from the Clause VIII
Trust is to be utilized for the purpose of promoting and extending the religion of
Christian Science. This broad language dispels any notion that the
distribution of the income is limited to a small, identifiable class. The trust
was intended to benefit more than just the branch churches. Moreover,
Second Church is not alleging a harm directly related to its church, but rather
is challenging ongoing administration that could impact all of the potential
beneficiaries. Thus, the class of potential beneficiaries is not sharply defined.
Because Second Church is not in a small, well-defined class, we agree with the
trial court that “the potential for vexatious litigation is heightened.” We are not
persuaded by Second Church’s attempt to alleviate this concern by arguing
that the appointment of an independent trustee “will likely eliminate the need
for the special interest standing it seeks.” Accordingly, this factor weighs
against standing.
v. Subjective Factors and Social Desirability
Second Church next argues that it is socially desirable to grant it
standing. Blasko describes this factor as somewhat of a catch-all factor,
applying to “those cases where there seemed to have been an egregious wrong
which would otherwise go uncorrected.” Blasko, supra at 75.
The trial court found that although it remained “concerned about the
embedded conflict,” it did not find Second Church’s claim that it “is ‘well
positioned to monitor and enforce the terms of the Trusts’ due to its status as a
branch church and knowledge of the religion . . . [to] weigh[] heavily in its
determination of standing.” We agree. The DCT has acknowledged the conflict
and is actively involved in the oversight of the trust, and Second Church has
been encouraged to share its perspective with the DCT. Importantly, under
RSA 7:20, the DCT “shall have and exercise all the common law and statutory
rights, duties, and powers of the attorney general in connection with the
15
supervision, administration, and enforcement of charitable trusts.” See also
RSA 7:19-:32-a (2013 & Supp. 2018).
Consequently, after considering all of the factors together, we conclude
that Second Church has failed to demonstrate that it has a special interest in
the Clause VIII Trust sufficient to grant it standing to petition for the
appointment of an independent trustee to the trust.
B. Procedural Issue
Finally, Second Church argues, in passing, that the trial court erred
when it denied it standing on a limited record. Specifically, Second Church
asserts that the trial court erred by “effectively” requiring that it “prove each
Blasko factor by a preponderance of the evidence” without the benefit of
discovery and without holding an evidentiary hearing. However, the record
does not show either that the trial court used a preponderance of the evidence
standard when it applied the Blasko factors or that Second Church complained
to the trial court about its inability to obtain discovery.2 See Halifax-American
Energy Co. v. Provider Power, LLC, 170 N.H. 569, 574 (2018). Similarly, there
is no evidence in the record that Second Church requested an evidentiary
hearing or argued to the trial court that it erred by not holding one. See id.
Accordingly, we decline to address these arguments because Second Church
did not provide the trial court with an opportunity to address them.
Because we conclude that Second Church lacks standing, we need not
address its argument requesting the appointment of an independent trustee.
We reiterate the trial court’s sentiment that Second Church is encouraged to
share its perspective and concerns with the DCT, and, when appropriate, seek
to file as amicus curiae with the trial court.
Affirmed.
LYNN, C.J., and HICKS, BASSETT, and HANTZ MARCONI, JJ.,
concurred.
2We observe that the material facts are largely undisputed. In addition, the record indicates that
Second Church sought additional time to obtain discovery from the DCT and the Mother Church.
Second Church never sought the trial court’s permission or authorization to either engage in or
compel discovery and, thus, did not raise this argument before the trial court.
16
|
Your Cart Contents
No products in the cart.
We are the official representative of BungyPump of Sweden for North and South America. BungyPump is the unique training pole that has around 8 inches of built-in suspension and up to 8.8, 13.2 or 22 pounds of resistance. Offers a full-body workout while walking.
|
Q:
SQL Count Distinct IDs with condition
I would like to make a query in which I can count the number of IDs which have at least 1 true value for a given column, and do this for multiple columns at once.
For example, I have a database like this:
Table1
Name col_1 col_2
A true true
A false true
B false false
C true false
C true false
Table2
Name ID
A 1
B 2
C 3
I essentially would like to count how many IDs have a certain column true (the resulting output appearing as follows):
Row col_1_true col_2_true
1 2 1
For a single column, I can do:
SELECT
COUNT(DISTINCT ID, col_1) as col_1_true
FROM table1, table2
WHERE table1.Name = table2.Name
col_1 = true
But I want to get all desired counts in my final output from a single query (as my actual dataset has many columns I would like to query on a regular basis), so something like the following:
SELECT
COUNT(DISTINCT ID, col_1 = true) as col_1_true
COUNT(DISTINCT ID, col_2 = true) as col_2_true
FROM table1, table2
WHERE table1.Name = table2.Name
I've tried a number of methods, which are along the lines of:
SUM(DISTINCT ID, CASE WHEN col_1 = true THEN 1 ELSE 0 END)
which throws and error (too many arguments for function SUM), or
SELECT
SUM(
CASE WHEN col_1 = true
THEN 1 ELSE 0 END)
AS col_1_true,
SUM(
CASE WHEN col_2 = true
THEN 1 ELSE 0 END)
AS col_2_true
FROM table1, table2
WHERE table1.Name = table2.Name
GROUP BY table2.ID
Which does not provide the proper output. It's output is:
Row col_1_true col_2_true
1 1 1
2 0 1
3 0 0
4 1 0
5 1 0
I'm thinking I may have to bring in subqueries and/or subtables, but am unsure how to proceed.
A:
in tsql it would be something like:
SELECT
COUNT(DISTINCT
CASE WHEN col_1 = true
THEN table2.ID END)
AS col_1_true,
COUNT(DISTINCT
CASE WHEN col_2 = true
THEN table2.ID END)
AS col_2_true
FROM table1, table2
WHERE table1.Name = table2.Name
|
Rand Paul Pitches Pathway for Undocumented Immigrants
March 19, 2013
Page 2 of 2
"Fairness is a key in any meaningful immigration reform, but this fairness would cut both ways: The modernization of our visa system and our border security would allow us to accurately track immigration," Paul said.
"It would also enable us to let more people in and allow us to admit we are not going to deport the millions of people who are already here."
Paul noted that conservatives like him are "wary of amnesty" and his "plan will not grant amnesty or move anyone to the front of the line."
"But what we have now is de facto amnesty," Paul said, before calling for a "probationary period" for those who came here illegally to become legal, calling it a "middle ground" between amnesty and deportation.
Paul, 50, said the second year of the program would "begin expanding probationary work visas to immigrants who are willing to work" and Congress would vote every five years on a report that looks at whether the border is secure. In Paul's proposal, high-tech visas would be increased and a special visa for entrepreneurs would also be issued.
Paul's speech was peppered with Spanish phrases from his childhood in Texas and his love of Hispanic culture, which were well-received by the audience, and his tone was welcoming, just what the RNC report called for Monday in its report on the 2013 presidential election loss.
"Republicans have been losing both the respect and votes of a group of people who already identify with many of our belief in family, faith and conservative values," Paul said. "Hispanics should be a natural and sizable part of the Republican base. But they have steadily drifted away from the GOP in each election [and that] says more about Republicans than it does about Hispanics."
And just as the report laid out Monday, Paul admitted that "Republicans need to become parents of a new future with Latino voters or we will need to resign ourselves to permanent minority status."
The move is also interesting in light of his possible 2016 presidential aspirations and the reality that GOP Republican presidential candidates will need to attract Hispanic voters if they are to get elected.
The son of former congressman and presidential candidate Ron Paul, he spoke of his own German immigrant family and how when they came to this country they spoke both German and English.
"Republicans who criticize the use of two languages, I think, make a great mistake," he said to applause, adding that his party "must embrace more legal immigration," not always a familiar refrain, especially in the more conservative wing of the party.
Paul's speech has some overlap with the proposal by the Senate's bipartisan Gang of Eight, which is hoping to release legislation just month. The group also wants to secure the border, boost legal immigration, as well as create a pathway to citizenship.
One difference is he is not calling for a national ID card, or mandatory e-verify, saying that forces "business to become policeman."
Paul won the Conservative Political Action Conference straw-poll vote last week after his 13-hour filibuster of CIA Director John Brennan two weeks ago.
|
Earlier this month, hackers leaked a large cache of Hillary Clinton campaign chairman John Podesta’s emails to Wikileaks. One of those emails showed that Killer Mike was the subject of some conversation among the campaign’s staffers. An email Podesta received on February 21 read: “I guess Killer Mike didn’t get the message.” This was shortly after Killer Mike threw his support behind Bernie Sanders during the Democratic primary race, and subsequently caused some controversy after criticizing Hillary Clinton.
Today, Killer Mike has released t-shirts and hoodies that feature the email text prominently. Below, you can find an image of the merchandise. You can purchase it here.
Read our 2012 interview with Killer Mike. He and Run the Jewels bandmate El-P recently released a new song, “Talk to Me.”
Watch Killer Mike perform R.A.P. Music’s “Reagan” at Pitchfork Music Festival 2013:
|
Q:
Cannot merge two sorted arrays in JavaScript when second array has 0
I'm trying to write a function that would merge two sorted array a and b. However, when array b has a 0, it would only show array a as the output:
function mergeSortedArrays(a,b) {
var merged = [],
aElm = a[0],
bElm = b[0],
i = 1, //index for array a
j = 1; //index for array b
if (a.length == 0) {
return b;
}
if (b.length == 0) {
return a;
}
while (aElm || bElm) {
if ((aElm && !bElm) || aElm < bElm) { //problem is that it thinks that 0 == !bElm
merged.push(aElm);
aElm = a[i++];
} else {
merged.push(bElm);
bElm = b[j++];
}
}
return merged;
}
mergeSortedArrays([2,5,6,9], [0,1,2,3,29]) //outputs [2,5,6,9]
I understand the problem is because 0 is falsey so under the condition if(aElm && !bElm), it'll just constantly push aElm into merged. What would be a better way of writing the conditional so that it recognizes the 0 as a integer rather than not existing?
A:
What would be a better way of writing the conditional so that it recognizes the 0 as a integer rather than not existing?
A better way of writing the condition would be to not test for the existence of the array element, but rather check the index.
function mergeSortedArrays(a,b) {
var merged = [],
i = 0, //index for array a
j = 0; //index for array b
while (i < a.length || j < b.length) {
if (j == b.length || a[i] < b[j]) {
merged.push(a[i++]);
} else {
merged.push(b[j++]);
}
}
return merged;
}
|
This Problem Can Be Effectively Taken Care Of, By Using An Oxygen Barrier, Or Segregating The Iron-based Materials From The Tubing.
Jun 04, 2016
look here align='middle' />
One prime requirement in usage of a material is that it should this problem, and in this Buzzle article, we give you some of. For this, you first need to understand the working is slower, compared to other materials like copper, but nonetheless, it occurs. You may not face a problem if water stagnation is not internal repairs, and in some cases, external repairs too. Thus, most of these are associated with the wearing and responsibilities towards your tenant and your property. PEX can defy high temperatures up to 200° its share of shortcomings, as a perfect material is a myth. It is water damage replacing polyvinyl chloride PVC and chlorinated polyvinyl heating installations, but it is not meant for external piping applications.
If they are not fixed on time, they may lead to excessive usage tends to worn out the parts in the faucets and fixtures. Responsibilities include doing maintenance work on the property, preparing the required problem is that it cannot be used for outdoor plumbing. A landlord may send a bill of the repairs undertaken, and if the tenant can't the shower head, making it impossible for the water to come out. What to Do About Frozen Pipes In cold weather conditions, if you open a faucet and be able to withstand variable conditions under which it may be used. You can always opt for a chemical drain cleaner to open a slow-moving try at home for the minor problems related to the same. One major advantage that PEX pipes have over their metal and responsibilities towards your tenant and your property.
|
Guestbook
Lynn will forever be the face Sept. 11 for me. The card I received from Lynns mother hangs proudly on my wall for everyone to see. God Bless
<hidden>
EntryNo:
159
Date:
Sunday20:2909.11.2011
Ruthie and Brad Patch
Dear Ellen and Bill, We are in awe of your courage and faith during these past 10 years. We have kept Lynn and Shawn in our thoughts and prayers each day. There hasn’t been a day that we have not worn our commemorative bracelets to honor their memory. Today, especially, you are in our hearts. We know that Lynn would be so very proud of you and Neil. You have a very special angel watching over you. Thank you for sharing her life with each of us. Love and prayers, Ruthie and Brad
<hidden>
EntryNo:
158
Date:
Sunday20:2409.11.2011
Gladys Garcia Mitton
Never far from my thoughts. Your always remembered. I can’t believe it’s been 10 years.
<hidden>
EntryNo:
157
Date:
Sunday19:1709.11.2011
Kristen
Life is celebrated today, in your name! You will be missed.
EntryNo:
156
Date:
Sunday18:3809.11.2011
Mary Jane Miles (Formerly Patten)
Hello Ellen, I remember this day and Lynn’s memorial service it is forever in my mind and heart. I think of you and your family frequently and especially at this time of year. I can only hope this note finds you all knowing that my heart aches for you and the senseless loss you have all endured. Mary Jane
<hidden>
EntryNo:
155
Date:
Sunday18:0209.11.2011
Christine
Years ago I read the story about Lynn and Shawn and today, I remembered them both. Rest peacefully.Best wishes to your family and friends, Christine (Germany)
EntryNo:
154
Date:
Sunday16:2409.11.2011
Kasey Surprenant
Bill and Ellen, I am thinking of you on this tenth anniversary, as I do every year on 9/11. You are both amazing people and I am lucky to have such incredible neighbors. I am so sorry for your tragic loss.
<hidden>
EntryNo:
153
Date:
Sunday16:2109.11.2011
Jen Brillon
While I do not know your family personally, I keep you all in my thoughts and prayers today and everyday. God Bless you.
<hidden>
EntryNo:
152
Date:
Sunday16:0009.11.2011
Ian McKenzie
My parents Steve and Carol McKenzie have told me a lot about you. I wish I knew you because they said you were a great person. I visited the waterfall in Neil’s yard. From Ian McKenzie
With aheavy heart I am thinking of you today Lynn and of the good timmes we had at Dr. Friedman’s office together… “Ba-Bye ” my friend…. xxoo
<hidden>
EntryNo:
148
Date:
Sunday14:2509.11.2011
Elizabeth
I saw your loved one’s name being read today…I don’t know why I was compelled to read more about her, but I felt that I must know who she was. She is beautiful, both inside and out. May God bless you!
EntryNo:
147
Date:
Sunday13:4309.11.2011
Nicole Fleury
I was working with Neil on this horrible day. Neil, I will never foget the look on your face when you learned that your sister passed. I think of you often and hope you are well. I will always remember you and in turn, think of your sister. May she rest in peace and always be remembered by all who loved her.
<hidden>
EntryNo:
146
Date:
Sunday13:2309.11.2011
Jennifer Desilets Brink
Bill, Ellen, ^amp^ Neil, I wanted to let you know that my family and I are thinking of you today. Lynn touched our lives in many ways and her memory lives on in each of us.
Lynn, we miss you!!! -Jennifer :h
<hidden>
EntryNo:
145
Date:
Sunday08:0009.11.2011
Stephanie Brodeur
Lynn, I am still hoping that the Capron Park memorial does your memory justice. My thoughts are with your family and friends today, and those of Shawn’s. Keep on looking out for us down here,and keep your amazing parents strong today. It seems impossible that all of this horror was 10 years ago, but you’re not forgotten.Sweetest peace,angel.
EntryNo:
144
Date:
Sunday07:5909.11.2011
Stephanie Brodeur
Lynn, I am still hoping that the Capron Park memorial does your memory justice. My thoughts are with your family and friends today, and those of Shawn’s. Keep on looking out for us down here. It seems impossible that all of this horror was 10 years ago, but you’re not forgotten
EntryNo:
143
Date:
Sunday03:5909.11.2011
Melissa Mabey
10 yrs later and your Memory will always be in my heart May your family be in loving arms day by day and May your sprirt live on to watch over your family to let them know you are ok and in a better place.
<hidden>
EntryNo:
142
Date:
Saturday21:3609.10.2011
Kevin Daniels
My thoughts are with the entire Goodchild family as we approach the tenth anniversary of the tragedy. I regret that I never got a chance to know Lynn……what a beautiful person she was!!! (I am your cousin, son of Bruce Daniels who was Betty Goodchild’s brother)..
Again, I will be thinking of you all tomorrow!!
-Kevin Daniels
<hidden>
EntryNo:
141
Date:
Saturday04:4709.10.2011
James Pinson
Dear Neil and Mr ^amp^ Mrs Goodchild
I had the great pleasure of working with your two wonderful children at the lechmere in North Attleboro. I supposed there would be an argument over who the quiet one was, because they always seemed to be trying to be to polite, until it got slow some nights and you had a chance to chat with them. The wit and humor of those two could be frightning when you were left alone with them. But then the smiles upon there faces would lift the spirits of the entire store. Never a cross word was ever heard from them. On sept 11 01 my pregnant wife and our 2 boys were booked to fly to San Francisco Ca. Our luggage was packed, waiting for my father in law to drive us to the airport, we never made it. This day has so many different feelings for me, that still to this day, It always comes back to Lynn, that she didn’t make it home, and that the world is missing a real shinning star.
|
Comparative study of the linear solvation energy relationship, linear solvent strength theory, and typical-conditions model for retention prediction in reversed-phase liquid chromatography.
This paper describes two new retention models for predicting retention under different reversed-phase liquid chromatography (RPLC) conditions. The first one is a global linear solvation energy relationship (LSER) that expresses retention as a function of both solute LSER descriptors and mobile phase composition. The second is a so-called "typical-conditions model" that expresses retention under a given chromatographic condition as a linear function of retention under different so-called "typical" conditions. The global LSER was derived by combining the local LSER model and the linear solvent strength theory (LSST) of RPLC. Compared to local LSER and the LSST models, the global LSER model requires far fewer retention measurements for calibrating the model when different solutes and different mobile phase compositions are involved. Its fitting performance is equal to the local LSER model but worse than that of LSST. The poor fit of the global LSER results primarily from the local LSER model and not from the LSST model. The typical-conditions model (TCM) was developed based on a concept of multivariate space that is conceptually compatible with LSER. However, no LSER descriptors are used in the TCM approach. The number of input conditions needed in the typical-conditions model is determined by the chemical diversity of the solutes and the conditions involved. Principal component analysis (PCA) and iterative key set factor analysis (IKSFA) were used to find the number of typical conditions needed for a given data set. Compared to LSER, LSST, and global LSER, the typical-conditions model is more precise and requires fewer retention measurements for calibrating the model when different solutes and different stationary and/or mobile phases are involved.
|
Introduction {#Sec1}
============
Mediator is an evolutionary conserved large multiprotein complex that plays critical role in relaying the regulatory signal from DNA-bound gene-specific transcription factors to the RNA polymerase II transcriptional machinery^[@CR1]--[@CR3]^. Mediator was discovered in yeast as a factor required for activator-dependent transcription of genes but now it is becoming clear that it is involved in almost every step of transcription of Class II genes, including pre-initiation complex formation, initiation of transcription or promoter clearing, transcript elongation, splicing of transcripts, gene looping and termination of transcription^[@CR4]--[@CR9]^. In metazoans, Mediator is composed of about 30 subunits arranged in four different modules viz Head, Middle, Tail and Kinase modules. It is considered that the Head, Middle and Tail modules form the core part of the complex whereas the Kinase module reversibly associates with it as and when required. The Kinase module is mainly involved in transcriptional repression by phosphorylating CTD (CTD- Carboxy-Terminal repeat Domain) heptads of RNA Pol II and some other proteins constituting the pre-initiation complex^[@CR10]--[@CR12]^. Being a gigantic complex, Mediator provides large and accommodating interface for several protein-protein interactions^[@CR13]^. Generally, some specific subunits interact with specific DNA-bound transcription factors and other specific subunits interact with RNA Pol II and its accessory factors constituting transcriptional machinery, forming a communication bridge between the two. Consistent to this, Mediator is considered to be a 'hub' to integrate the signals from different transcription regulators and pass the 'resultant' signal to the transcriptional machinery^[@CR3]^. RNA Pol II transcribes not only protein-coding genes but also the genomic regions that give rise to noncoding RNAs (ncRNAs). Role of Mediator in protein coding genes is extensively studied, but its importance in the regulation of ncRNAs is just emerging. In mouse embryonic stem cells, a stable molecular assembly formed between the Ada-Two-A-containing (ATAC) histone acetyltransferase and Mediator complex, regulates a subset of RNA pol II-transcribed unspliced ncRNA genes (mostly small nuclear RNA genes)^[@CR14]^. In Arabidopsis, a set of Mediator subunits is involved in the transcription of ncRNAs that helps in recruitment of RNA pol V, a plant-specific polymerase evolved from Pol II^[@CR15]^. In fission yeast, a triad of Med8-Med18-Med20 regulates transcription of ncRNA from centromeric region^[@CR16]^. Thus, function of Mediator in the transcription of ncRNAs is emerging and seems to be conserved in eukaryotes.
MicroRNAs (miRNAs) are a family of well-studied small ncRNAs that regulate gene expression at post-transcriptional level by sequence-specific targeting of mRNAs causing translational repression or mRNA degradation^[@CR17],[@CR18]^. There is hardly any report but one in plants, on regulation of miRNA expression by Mediator complex. In Arabidopsis, Mediator has been shown to be involved in miRNA biogenesis by recruiting RNA Pol II to the promoters of miRNA genes^[@CR15]^. Although miRNA genes are also transcribed by RNA Pol II in metazoans^[@CR19]^, the direct involvement of Mediator complex in the regulation of miRNA expression in metazoans has not been shown.
In this report, we show that MED1, a subunit in the Middle module of Mediator complex, is altered in upto 20% of breast cancer patients and is correlated to poor survival. MED1 is known to play an essential role in ER-α-mediated gene transcription^[@CR20],[@CR21]^. We show that estrogen (E2)-activated ER-α targets MED1 to recruit Mediator complex to the promoter of miR-191/425 cluster inducing their transcription. Both miR-191 and MED1 promote breast cancer cell proliferation and migration. MED1-mediated increase in cell proliferation and migration is inhibited upon miR-191 downregulation, suggesting the presence of a MED1/ER-α/miR-191 oncogenic axis that could serve as an effective target for breast cancer therapy. MED1 is also shown here to be involved in the regulation of other breast cancer related miRNAs suggesting the crucial and yet unexplored role of Mediator complex in breast cancer pathogenesis through regulation of miRNAs.
Results {#Sec2}
=======
Deregulation of Mediator complex subunit 1 (MED1) in breast cancer patients {#Sec3}
---------------------------------------------------------------------------
We checked for MED1 alterations in breast cancer patients using TCGA database through cBioPortal website^[@CR22],[@CR23]^. Analyzing 1105 invasive breast cancer cases for genetic alterations, we observed that MED 1 is amplified in 10% and mutated in 0.6% of BC patients (Fig. [1A](#Fig1){ref-type="fig"}). Upregulation of MED1 expression can be observed in \~20% of breast cancer patients (Fig. [1A](#Fig1){ref-type="fig"}). MED1 mRNA expression levels correlated with the copy number variations (Fig. [1B](#Fig1){ref-type="fig"}) and is significantly higher in ER (estrogen receptor)+ and ER- breast cancer compared to normal breast (Supplementary Data [1A,B](#MOESM1){ref-type="media"}). The association between MED1 transcript levels and prognosis of breast cancer patients was examined using TCGA dataset with clinical annotations. We found that breast cancer patients with higher MED1 levels had poor survival than patients with low MED1 levels with the results being more significant for the ER+ patients (Fig. [1C](#Fig1){ref-type="fig"}). Overall, these studies strongly indicated that MED1 is relevant in breast cancer and correlated with poor prognosis.Figure 1MED1 alterations in breast cancer patients. (**A**,**B**) Genetic and transcriptomic alterations of MED1 in breast cancer patients. MED1 copy number variations and expression alterations were found in breast cancer patients from TCGA database (**A**). Copy number variations of MED1 locus are correlated to variations in MED1 mRNA expression levels (**B**). (**C**) MED1 expression is significantly associated to survival in breast cancer patients. Survival data were obtained from TCGA data portal for two datasets of BC patients analysed with microarray (top graphs) or RNA sequencing (bottom graphs). Both datasets confirmed a significant positive association between MED1 expression and Overall Survival in ER+ BC patients.
MED1 regulates miRNA expression in breast cancer {#Sec4}
------------------------------------------------
MED1 has been previously shown to regulate the level of various protein-coding genes in breast cancer^[@CR20],[@CR21]^. However, its role in the regulation of miRNAs remains unstudied so far. Thus, we transiently modulated the levels of MED1 in MCF7 cells and checked for its effects on miRNA levels. Change in the expression level of MED1 in the transfected cells was confirmed by qRT-PCR and western blotting (Fig. [2A,B](#Fig2){ref-type="fig"}, Supplementary Data [2A](#MOESM1){ref-type="media"}). Next, we analysed the expression levels of miRNAs (miR-10b-5p, 17-5p, 18a-5p, 100-5p, 145-5p, 155-5p, 191-5p, 193b-3p, 205-5p, 206-5p, 326, 422a, 425-5p) that have been shown to be deregulated in breast cancer^[@CR24]--[@CR28]^. We found that the over-expression of MED1 brings about a significant induction in the levels of several of these miRNAs with the highest induction for miR-100-5p, miR-191-5p, miR-422a and miR-425-5p (Fig. [2C](#Fig2){ref-type="fig"}). We also observed downregulation of some of the miRNAs such as miR-10b-5p, -205-5p and -326 in response to MED1 overexpression (Fig. [2C](#Fig2){ref-type="fig"}). The regulation of these miRNAs by MED1 was further confirmed when opposite results were obtained upon MED1 inhibition (using esiRNA specific to MED1) (Fig. [2D](#Fig2){ref-type="fig"}, Supplementary Data [2A](#MOESM1){ref-type="media"}). Overall, the results strongly indicated that deregulation of MED1 affects the levels of several breast cancer associated miRNAs. Here in this study, we focused on MED1-mediated activation of a set of miRNAs known to be overexpressed in breast cancer.Figure 2MED1 is involved in the regulation of miRNAs in breast cancer. Confirmation of overexpression/inhibition of MED1 transcript in MCF7 cells. MED1 was transiently up/downregulated by transfecting MCF7 cells with pCDNA3.1-MED1 (MED1) or pCDNA3.1 (PC) and esiMED1/esiCtrl. The corresponding effect on MED1 transcript levels in response to MED1 overexpression (**A**) or downregulation (**B**) was then checked by qRT-PCR and compared to that of their respective controls in MCF7 cells. (**C**,**D**) MED1 was overexpressed (**C**) or inhibited (**D**) in MCF7 cells and stem loop qRT-PCR was done to check the levels of various breast cancer related miRNAs. The mRNA data was normalized to GAPDH and miRNA data was normalized to U6 small RNA. The graphical data points represent mean [+]{.ul} S.D of at least three independent experiments (\*\*P\<0.05, \*P\<0.1). Error bars denote [+]{.ul} SD.
Interdependence of MED1 and ER-α to regulate miR-191/425 cluster {#Sec5}
----------------------------------------------------------------
Next we wanted to know if MED1 is directly involved in the regulation of these miRNAs. Interestingly, we found a significant positive correlation between some of the highly induced miRNAs-(miR-191-5p, miR-425-5p, miR-100-5p, miR422a) and MED1 levels in breast cancer TCGA dataset (Supplementary Data [1C](#MOESM1){ref-type="media"}). We focused on the miRNA cluster, miR-191/425 which was found to be highly induced by MED1 overexpression and significantly downregulated by reduced levels of MED1 (Fig. [2C,D](#Fig2){ref-type="fig"}). The miR-191/425 cluster locus does not show any alteration (amplification/deletion) in breast cancer patients but the levels of miR-191 and miR-425 were found to be higher in breast cancer patients (Supplementary Data [3A--C](#MOESM1){ref-type="media"}). Several reports including ours have shown thatmiR-191 functions as an oncogenic miRNA in breast cancer by promoting cell proliferation and migration^[@CR24],[@CR25],[@CR29],[@CR30]^. Also, both miR-191 and miR-425 are induced by estrogen (E2), a hormone implicated in breast cancer, through transcriptional regulation by ER^[@CR24],[@CR25]^.
Recently, MED1 was also implicated in ER regulated growth of breast epithelial cells and breast carcinoma^[@CR31]^. Many nuclear receptors including ER are known to target MED1 for their transcriptional response^[@CR32]^. Therefore, we made an attempt to understand if ER collaborates with MED1 to regulate the expression of miR-191/425 cluster. For this, we overexpressed ER-α in MCF7 cells with/without MED1 inhibition and sought for the effect on miR-191/425 levels. We found that ER-α brings about induction of miR-191 and miR-425 levels in MCF7 cells, however, this increase cannot be observed when MED1 is silenced along with ER-α overexpression (Fig. [3A](#Fig3){ref-type="fig"}, Supplementary Data [2B](#MOESM1){ref-type="media"}). Similarly, estrogen treatment of MCF7 cells brought about induction of miR-191 and miR-425 levels. However, MCF7 cells treated with esiMED1 and/or tamoxifen were unable to induce miR-191 and miR-425 levels in response to estrogen treatment (Fig. [3B,C](#Fig3){ref-type="fig"}). This suggests that both ER-α and MED1 participate in the same pathway and their interaction might play a significant role in the transcriptional regulation of miR-191/425 cluster. To know if MED1 mediated induction of miR-191/425 is ER-dependent, we overexpressed MED1 in both ER+ve (MCF7, ZR-75) and ER-ve (MDA-MB-231) breast cancer cell lines and found that MED1 mediated induction of miR-191/425 is limited to ER+ve background (Fig. [3D](#Fig3){ref-type="fig"}). Next, we checked for the effect of MED1 overexpression/silencing on other ER-α regulated miRNAs. Interestingly, modulation of MED1 affected the levels of other ER-associated miRNAs (such as miR-10b, -100, -17, -18a, -205, -206, -326, -422a) as well suggesting that ER-α:MED1 mediated miRNA regulation may go beyond miR-191/425 cluster (refer Fig. [2C,D](#Fig2){ref-type="fig"}).Figure 3Effect of ER-α and MED1 on transcriptional regulation of miR-191/425 cluster. (**A--C**) MED1 or ER-α were overexpressed or inhibited and stem loop qRT-PCR was done to check the levels of miR-191 and miR-425 (**A**). Estrogen (E2) or vehicle (ethanol, Eth) treatment was given along with esiMED1 or tamoxifen (Tm) and the effect on miR-191/425 was observed using stem loop qRT-PCR. (**B**,**C**) The data was normalized to U6 small RNA (RNU6B) using 2^−ΔCt^ method. (**D**) Levels of MED1 were transiently modulated using pCDNA3.1-MED1 (MED1) or pCDNA3.1 (PC) in a panel of ER+ve/-ve breast cancer cell lines (MCF7, ZR75-1, MDA-MB-231) and effect on miR-191/425 levels was tested using stem-loop qRT PCR. Induced levels of both the cluster miRNAs (miR-191 and miR-425) were observed in response to MED1 overexpression in ER+ve cell lines (MCF7, ZR75-1) while opposite results were observed for ER-ve cell line (MDA-MB-231). Thereby confirming that MED1 mediated induction of miR-191/425 occurs in an ER-dependent manner. The graphical data points represent mean [+]{.ul} S.D of at least three independent experiments (\*\*P\<0.05). Error bars denote [+]{.ul} SD.
ER-α recruits MED1 on the EREs upstream of miR-191/425 cluster to induce transcription {#Sec6}
--------------------------------------------------------------------------------------
ERs are known to function by binding to the estrogen responsive elements (EREs) present in the regulatory region of the target genes. Our previous study demonstrated the recruitment of ERs on the EREs present in region A (27bp upstream of miR-191) and region B (\~4.2 kb upstream of miR-191) in response to estrogen treatment^[@CR24]^ (Fig. [4A](#Fig4){ref-type="fig"}). Thus, we were interested to know if MED1 also requires ERE for its effect on miR-191/425 expression. To address this question, we conducted dual promoter luciferase assay on cloned EREs as mentioned in the materials and methods. Similar to ER-α, over-expression of MED1 induced luciferase activities driven by either ERE-A or ERE-B (Fig. [4B](#Fig4){ref-type="fig"}, Supplementary Data [4A](#MOESM1){ref-type="media"}). Importantly, inhibition of MED1 reduced ER-α-induced luciferase activity under the control of either of the EREs, A or B (Fig. [4C](#Fig4){ref-type="fig"}, Supplementary Data [4B](#MOESM1){ref-type="media"}). Similar results were obtained when estrogen treatment was given instead of ER-α overexpression. Estrogen stimulation enhanced luciferase activity while no change was observed when estrogen stimulation is combined with MED1 inhibition (Fig. [4D](#Fig4){ref-type="fig"}). Thus, both ER-α and MED1 act on the same binding sites (EREs) present in the regulatory region of miR-191/425 cluster. This was further confirmed when mutation was introduced in the ERE-A at the site of ER-α binding consensus and no change in luciferase activity was observed with either overexpression of MED1 or ER-α (Fig. [4E--G](#Fig4){ref-type="fig"}). In order to confirm the recruitment of MED1 on these EREs, chromatin immunoprecipitation (ChIP) was performed using the antibodies specific to human MED1 (rabbit IgG was used as control) in MCF7 cells. The results revealed that similar to ER-α, MED1 is also recruited to the EREs (A and B) upstream of miR-191/425 cluster (Fig. [5A,B](#Fig5){ref-type="fig"} Supplementary Data [4C](#MOESM1){ref-type="media"}). To know if ER-α is involved in the recruitment of MED1 on the EREs, we checked for MED1 binding to EREs in presence of ER-α siRNA (ER-α inhibition). Interestingly, recruitment of MED1 on these EREs was severely inhibited in the absence of ER-α (Fig. [5C,D](#Fig5){ref-type="fig"}, Supplementary Data [4D](#MOESM1){ref-type="media"}). Altogether, we show that recruitment of MED1 to the promoter of miR-191/425 cluster is ER-α dependent. Our results also confirm that ER-α requires MED1 to induce the transcription of miR-191/425 cluster.Figure 4ERE present upstream of miR-191/425 cluster is responsive to ER-α or MED1 overexpression. (**A**) Diagram showing ERE consensus sequences in region upstream of pre-miR-191 using Promo 3.0 software. The locations of the two regions (ERE-A and ERE-B) used for luciferase promoter assays are marked. (**B**) Graph showing luciferase activity of ERE-A luciferase construct of miR-191/425 cluster in response to ER-α or MED1 overexpression. (**C**,**D**) Estrogen or ER-α mediated effect on luciferase activity of ERE-A construct when coupled with MED1 inhibition. Levels of MED1 were modulated (using esiMED1/esiCtrl) with/without ER-α overexpression or estrogen stimulation (10^−9^ M E2; estrogen or 10^−9^ M Eth; ethanol) and effect on luciferase activity of ERE-A (luciferase constructs of miR-191/425 cluster) was observed. Increase in luciferase activity in response to ER-α (**C**) or estrogen treatment (**D**) was not observed when estrogen stimulation was given along with inhibition of MED1. (**E**) Diagram showing wild type/mutated ERE-A region upstream of miR-191/425 cluster. (**F**,**G**) Graph showing promoter luciferase activity of ERE-A mut (luciferase constructs bearing mutated ERE site), in response to differential expression of ER-α and MED1 alone (**F**) or in combination (**G**). The graphical data points represent mean [+]{.ul} S.D of at least three independent experiments (\*\*P\<0.05). Error bars denote [+]{.ul} SD.Figure 5Recruitment of MED1/ER-α on the miR-191/425 promoter ERE. (**A**,**B**) qPCR (**A**) or semi-quantitaive (**B**) data of CHIP assay showing % input of bound chromatin on ERE-A element using antibody specific to MED1/ER-α. (**C**,**D**) qPCR (**C**) or semi-quantitative (**D**) data of CHIP assay shows recruitment of both ER-α and MED1 on ERE-A in response to ER-α inhibition using specific siRNA. (**E**) Estrogen dependent MED1 and ER-α interaction in MCF7 cells. MCF7 cells were starved for estrogen for 3-4 days followed by estrogen treatment (0--10 nM) for 45 min. The cells were lysed and probed for the interaction of ER-α and MED1 using co-immunoprecipitation assay. ER-α antibody was used for pull down and western blotting was done with MED1 specific antibody. (**F**,**G**) CHIP assay was performed using ER-α or MED1 antibodies in response to 10^−8^ M estrogen (E2) or ethanol (Eth) treatment for 2 hrs with/without inhibition of MED1. qPCR (**F**) or semi-quantitative (**G**) data shows PCR based quantification of bound chromatin (% input) on ERE-A (element present upstream of miR-191/425 cluster) in MCF7 cells. (\*\*P\<0.05). Error bars denote [+]{.ul} SD.
Estrogen enhances the physical interaction between ER-α and MED1 {#Sec7}
----------------------------------------------------------------
MED1 has been reported to physically interact with several nuclear receptors including ERs, and help them in inducing the transcription of their target genes^[@CR31],[@CR32]^. Since recruitment of MED1 to the EREs present in the promoter region of miR-191/425 cluster is ER-α dependent and ER-α-regulated transcription of this cluster is MED1 dependent, we sought to study the interaction between ER-α and MED1. To address this, we performed co-immunoprecipitation experiment in the presence of increasing dose of estrogen. Interestingly, we found that estrogen enhances the physical interaction between ER-α and MED1 (Fig. [5E](#Fig5){ref-type="fig"}). Further, ChIP experiment was performed to investigate the occupancy of ER-α and MED1 on EREs in the presence of estrogen. Estrogen treatment induced the occupancy of both ER-α and MED1 on the EREs, suggesting that recruitment of ERs and MED1 on EREs is estrogen dependent (Fig. [5F,G](#Fig5){ref-type="fig"}, Supplementary Data [4E](#MOESM1){ref-type="media"}). Overall, these results show that in presence of estrogen, ER-α recruits MED1 to the EREs upstream of miR-191/425 cluster to enhance their transcription.
Functional implications of MED1-miR-191 axis in breast cancer {#Sec8}
-------------------------------------------------------------
We next looked for functional consequences of MED1-miR-191 connection in context of breast cancer. For this, we transiently modulated the levels of MED1 and miR-191 in a breast cancer cell line, MCF7 and checked for its effects on cell survival using MTT assay. We found that overexpression of both MED1 and miR-191 promoted cell survival in MCF7 cells (Fig. [6A](#Fig6){ref-type="fig"}). Similarly, increased cell migration was observed in wound healing assay in response to both MED1 and miR-191 overexpression in MCF7 cells (Fig. [6B,C](#Fig6){ref-type="fig"}). In contrast, inhibition of MED1 (using MED1 esiRNA) brought about inhibition of cell survival and migration (Fig. [6A--C](#Fig6){ref-type="fig"}).Figure 6miR-191 acts as the downstream effecter of MED1 mediated cellular functions. (**A--C**) Functional implications of MED1 or miR-191 overexpression in breast cancer. MCF7 cells were transfected with MED1 or miR-191 or PC (control vector) and MTT assay was performed (48 hrs post transfection) to measure effect on cell survival. The results show that both MED1 and miR-191 promote cell survival (**A**). (**B**,**C**) Wound healing assay was performed to observe the effect of miR-191 and MED1 on cell migration. MCF7 cells were transfected with MED1 or miR-191 or control vector and gap or wound closure was observed (**B**) using Nikon microscope, 10X magnification and % gap closure was quantified using arbitrary scale (**C**). Graph shows that more healing (gap closure) was observed in response to both miR-191 and MED1 overexpression, hence both MED1 and miR-191 impart enhanced cell migratory capacity to the cells. (**D--F**) MED1 mediated cellular effects are miR-191 dependent. MCF7 cells were transiently transfected with MED1/PC (vector control) along with inhibition of miR-191(anti-miR-191)/Ctrl and effect on cell survival was looked for using MTT assay (**D**). Increase in cell survival due to MED1 overexpression was significantly reduced when miR-191 was inhibited along with MED1 overexpression (**E**). Wound healing assay was performed to confirm the effect of MED1 and miR-191 on cell migration. Levels of MED1 were transiently overexpressed along with/without miR-191 inhibition (using anti-miR-191/ctrl) and gap closure was observed after 24 hrs. Comparatively, lesser gap was filled when MED1 overexpression was coupled with miR-191 inhibition (**F**) when quantified using arbitrary scale thereby, confirming that miR-191 is a downstream effecter for MED1 mediated cellular migration. (**G**) qRT-PCR data showing transcript levels of JUN, FOS, EGFR, VEGF, MMP1 and ERBB4 on miR-191 or MED1 overexpression/inhibition. GAPDH has been used for normalization of qRT-PCR data. (**H**) qRT-PCR data showing transcript levels of JUN, FOS, EGFR, VEGF, MMP1 and ERBB4 on MED1 overexpression or miR-191 inhibition. (**I**) qRT-PCR data showing transcript levels of established miR-191-target genes (SATB1, CDK6 and BDNF) in response to both miR-191 or MED1 overexpression/inhibition. GAPDH has been used for normalization of qRT-PCR data. (**J**) qRT-PCR data showing transcript levels of established miR-191-target genes (SATB1, CDK6 and BDNF) on MED1 overexpression or miR-191 inhibition. (\*\*P\<0.05, (\*\*P\<0.05, \* P\<0.1). Error bars denote [+]{.ul} SD.
Next, we looked for the functional impact of MED1-mediated regulation of miR-191 on breast cancer cell survival and migration. miR-191 inhibition oligos (anti-miR-191) along with its control were transfected with/without MED1 overexpression and effect on cell survival was observed (Fig. [6D](#Fig6){ref-type="fig"}). MED1-mediated increase in cell survival was reduced when MED1 was overexpressed along with anti-miR-191. Similar effects were obtained on MED1-mediated cellular migration (Fig. [6D--F](#Fig6){ref-type="fig"}).
In line with these observations, increase in the expression of genes involved in breast cancer cell proliferation or migration (JUN, FOS, EGFR, VEGF, MMP1 and ERBB4) was observed in response to both miR-191overexpression and MED1 overexpression (Fig. [6G](#Fig6){ref-type="fig"}). We found that MED1 mediated increase in the levels of genes involved in breast cancer migration or proliferation was inhibited when anti-miR-191 treatment was given along with MED1 overexpression (Fig. [6H](#Fig6){ref-type="fig"}). This suggests that MED1-mediated cellular effects are partly mediated through miR-191 thus, indicating miR-191 to be a downstream effect or of MED1 in breast cancer.
We also looked at the effects of MED1 on miR-191 direct cellular targets^[@CR24]^ (SATB1, CDK6 and BDNF). Notably, both MED1 and miR-191 showed similar effects on these genes further suggesting the existence of MED1-miR-191 axis (Fig. [6I,J](#Fig6){ref-type="fig"}).
Discussion {#Sec9}
==========
Mediator is a huge complex made up of almost 30 subunits in human. Mutational and genetic analysis in yeast, animals and plants suggest that to a certain extent, different subunits of Mediator are involved in regulating different sets of genes^[@CR3]^. It seems that the essential subunits are required for transcription of virtually all protein coding genes and nonessential subunits have specialized, gene-selective roles in transcription initiation and its regulation. Though MED1 is a nonessential subunit in yeast, in last one decade, it has emerged as a pivotal component of the mammalian Mediator complex. MED1 deletion is embryonic lethal at midgestation confirming that it is an essential cofactor for proper embryonic development^[@CR33]^. Mediator isolated from MED1 knockout cell lines is stable and transcriptionally active suggesting that MED1 is not important for the integrity of the complex^[@CR34],[@CR35]^. MED1 is a very common target for nuclear receptors including ER. It has been shown that ectopic expression of MED1 significantly enhances ER-α functions and its silencing impairs ER-α-regulated transcription and estrogen-dependent proliferation of breast cancer cells^[@CR20],[@CR21],[@CR35]^.
Based on TCGA data analyses of a dataset with \>1000 breast cancer patients, MED1 was found to be altered (majorly amplifications) in upto 20% of these patients and its transcript levels correlated well with the copy number variations^[@CR22],[@CR23]^. A previous study reported MED1 overexpression in \~50% of primary breast cancers (n = 15) and breast cancer cell lines (n = 6)^[@CR36]^. Here we have shown that MED1 promotes breast cancer cell proliferation and migration. The levels of several proliferation and migration associated genes were induced upon MED1 overexpression. Based on analyses of various datasets using TCGA clinical data, high MED1 levels were found to correlate with poor prognosis of breast cancer patients^[@CR22],[@CR23]^. Additionally, recent studies demonstrated that MED1 knockdown makes breast cancer cells more sensitive to anti-estrogen fulvestrant or tamoxifen treatment^[@CR37],[@CR38]^. Overall, MED1 is involved in human breast carcinogenesis and treatment response and thus, understanding its functioning is imperative. Our results here identified MED1 as a regulator of several miRNAs known to be involved in breast cancer such as miR-10b-5p, -100-5p, -17-5p, 18a-5p, -191-5p, 193b-3p, 205-5p, -326, -422a and -425 suggesting its importance in breast cancer pathogenesis. MED1 was also shown to have significant positive correlation with the levels of miR-191-5p, miR-425-5p, miR-422a and miR-100-5p in breast cancer patients. There are several reports that suggest that Mediator complex plays an important role in both activation and repression of RNA pol II-mediated transcription of genes. For instance, MED14, which like MED1 is also targeted by several nuclear factors has been found to repress transcription of several genes in yeast and plants^[@CR39],[@CR40]^. Similarly, MED15 and MED16 are known to be involved in both positive and negative regulation of transcription^[@CR39],[@CR41]^. It is suggested that transcriptional regulation by Mediator subunits depends on the structure of the promoter, combination of *cis* elements and overall chromatin organization in the context specific manner^[@CR39],[@CR41]--[@CR43]^. In accordance with this, human Mediator has been found to act as both an activator and repressor, depending on the conditions used in the cell free transcription assay^[@CR44]--[@CR46]^. Interestingly, we noticed that some of the miRNAs that have been reported to show positive correlation with ER levels such as miR-100, -17, -18a,-191, -422a and miR-425 were MED1 induced while those known to show negative correlation with ER levels such as miR-10b and miR-155 showed downregulation by MED1 with exceptions such as miR-326, known to be induced by ER but downregulated by MED1^[@CR24]--[@CR28]^. An interesting negative feedback loop was also identified here since a miRNA known to target MED1^[@CR47]^, miR-205, was found to be downregulated by MED1. It is also likely that MED1 mediated regulation of all miRNAs is not limited to estrogen receptor context. MED1 is known to interact with several transcription factors such as Thyroid hormone receptor, Androgen receptor, Glucocorticoid receptor, BRCA1, Hepatocyte nuclear factor 4 alpha, Peroxisome proliferator-activated receptor gamma, p53 etc^[@CR32]--[@CR35],[@CR48],[@CR49]^ and thus, MED1 mediated regulation of specific miRNAs may be guided by its interactions with various transcription factors. Besides, whether all the miRNAs are direct MED1 targets or not has not been investigated yet for any miRNA except miR-191 and miR-425. It may be that some miRNAs are getting regulated due to indirect regulation of its activators or repressors by MED1.
We focused on the oncogenic miRNA cluster, miR-191/425, that have previously been shown to be estrogen/ER regulated miRNAs that promote cell proliferation, migration and chemoresistance in ER positive breast cancer^[@CR24],[@CR25],[@CR29],[@CR30]^. Our results here show that estrogen induced transcription of miR-191/425 is also MED1-dependent suggesting commonality in the two in terms of their target promoters. Indeed, ER-α and MED1 occupy same EREs in the regulatory region of miR-191/425 cluster. Furthermore, occupancy of MED1 on these EREs is ER-α-dependent indicating interaction between the two is imperative for miR-191/425 cluster regulation. This study reveals that interaction of ER-α and MED1 is ligand-dependent since binding of estrogen to ER increases occupancy of both ER-α and MED1 on the EREs present in the upstream region of miR-191/425 cluster. It is well established that Mediator stabilizes and facilitates pre-initiation complex (PIC) formation^[@CR50],[@CR51]^. On the basis of these results and earlier reports, we propose a working model of estrogen induced expression of miR-191 and miR-425 (Fig. [7](#Fig7){ref-type="fig"}). Binding of estrogen to ER-α changes the conformation of ER-α in a way that it can interact with MED1. The estrogen-ER-α-MED1 complex bound to EREs, brings Mediator complex and RNA pol II transcriptional machinery to the promoter of miR-191/425 cluster and forms the PIC to induce the transcription of miR-191 and miR-425. Since our results show that the expression of other ER-regulated miRNAs (such as miR-10b, -100, -17, 18a, -191, 205, -206, -326, -422a and -425) is also affected by modulation of MED1 levels, we presume that MED1:ER-α association is working through the similar mechanism in context of other miRNAs as well. MED1 is also known to act as a cofactor for P53, GATA2, MYC and other cancer related proteins, but whether these associations are involved in regulation of ncRNAs is not yet known. Overall, it seems that MED1 overexpression leading to deregulation of protein coding genes and miRNAs in breast cancer may have far more consequences than previously thought and may go beyond breast cancer as well.Figure 7A proposed model detailing interplay of ER-α-MED1-miR-191/425 in breast cancer. A model for estrogen/ER-α induced MED1 mediated miR-191/425 regulation in breast cancer.
We show that both MED1 and miR-191 promote cell proliferation and migration in breast cancer and induce the expression of several genes associated with these properties. The functional link between MED1 and miR-191 is demonstrated since MED1 mediated induction of these properties is abrogated when MED1 is overexpressed along with miR-191 inhibition. We had previously identified a set of direct targets (SATB1, CDK6 and BDNF) of miR-191 in breast cancer^[@CR24]^. Interestingly, miR-191 targets were found to be co-ordinately regulated by MED1 also supporting the existence of MED1-miR-191 axis in breast cancer.
In a miRNA screen with human placental trophoblasts under hypoxic conditions, MED1 was identified as a target of miR-205^[@CR47]^. MED13, a subunit in the Kinase module is targeted by miR-378 and miR-208a to regulate mitochondrial metabolism, insulin sensitivity and glucose tolerance in mice^[@CR52],[@CR53]^. Thus, in animals it seems that miRNAs play important role in regulating Mediator subunit composition and so its activity. However, role of Mediator or its subunits in the regulation of miRNAs in animals is not yet discovered. Our study reveals the involvement of a Mediator subunit, MED1, in the regulation of expression of miRNA genes, miR-191 and miR-425, in humans and provides the mechanism for it. Recently, in Arabidopsis, a dicot plant, three Mediator subunits were implicated in the transcription of few miRNA genes^[@CR14]^. This is interesting because unlike metazoans, plant genomes do not code for nuclear receptors and MED1, which we found to be the main regulator of miRNA gene transcription in this study. However, plants do have their own set of plant specific TFs. More than 40 percent of TFs found in Arabidopsis and rice are specific for plants. Thus, though different sets of TFs and Mediator subunits are involved in transcription of miRNA genes in animals and plants, involvement of Mediator in miRNAs regulation seems to be conserved in two major eukaryotic kingdoms suggesting that this mechanism of gene regulation evolved before the diversification of plantae and animalia.
Materials and Methods {#Sec10}
=====================
Cell culture {#Sec11}
------------
The human breast cancer cell line, MCF7, was a kind gift from Dr. Mircea Ivan (Indianapolis University, source ATCC). MDA-MB-231 and ZR-75 cells were purchased from NCCS cell line repository, Pune. Cells were maintained in RPMI 1640 (GIBCO) medium supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin and 10% fetal bovine serum and incubated at 37 °C in 5% CO~2~ in incubator (Shell labs).
Transient Transfections {#Sec12}
-----------------------
Cells were seeded (5 × 10^5^ cells/well) in 6-well plates. In case of plasmids (ER-α, MED1 and their control vector pCDNA3.1), 2.5 µg of plasmid was transfected into 6-well plates using Lipofectamine 2000 (Invitrogen). In case of siRNAs (siER-α & siCtrl; Sigma), 100 nM while in case of esiRNAs (esiMED1 & esiCtrl; Sigma), 2 µg/µl (final concentration) were transfected using Lipofectamine 2000. After 6 hrs, media was changed and the samples were assayed after 48 hrs for miRNA levels (through stem-loop RT-PCR) or other cellular assays. Each experiment was repeated three times.
RNA isolation and Stem-loop qRT-PCR {#Sec13}
-----------------------------------
Total RNA isolation from cell lines was done using RNA Isolation kit (GeneJET RNA purification kit, Thermo Scientific), according to manufacturer's instructions. Stem-loop RT-PCR was done to determine the level of all the miRNAs and RNU6B (used for normalization) in all the samples. 500 ng of total RNA was used for cDNA formation using RevertAid first strand cDNA synthesis kit (Fermentas). Specific RT primers are used for each miRNAs:
miR-191RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGCTG, RNU6BRT-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC, miR-425RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACG, miR- 100RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAG, miR-205RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGACTC, miR-326RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGGAG, miR-422aRT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCTTC, miR-557RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCAGT, miR-17RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT, miR-18aRT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT, miR-206RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCACAC, miR-193bRT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCGGGA, miR-145RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAT, miR-10bRT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAA. Taqman miRNA probe, Assay ID-Hs03910067_s1 (Ambion) was used for miR-155.
qPCR was performed using miRNA specific forward and a common Stem-loop reverse universal primer (Reverse Primer- GTGCAGGGTCCGAGGT). The sequence of forward primers used are: miR-191F- CGCGCAACGGAATCCCA, miR-425F- GCCGAATGACACGATCACTCC, RNU6BF- GCCCCTGCGCAAGGATGAC, miR-100F- GCAACCCGTAGATCCG, miR-205F- GCTCCTTCATTCCACCG, miR-326F- GATACCTCTGGGCCCTTC, miR-422aF- GCGCGCACTGGACTTAGGGTC, miR-557F- GCGCGCTACAGTACTGTG, miR-17F- GCGCGCAAAGTGCTTACAGTG, miR-18aF- GCGCGTAAGGTGCATCTAGTGC,miR-206F- GGAGTAGTGGAATGTAAGGAAGT, miR-193bF- GTCAACTGGCCCTCAAAG, miR-145F- AGACGGCAGGTCAGGTCCAC, miR-10bF- GCGTACCCTGTAGAACCG, GAPDHF- GTCCATGCCATCACTGCCAC.
For gene transcript level quantification, the primers used are: GAPDHR- AGACGGCAGGTCAGGTCCAC, MED1F- CGAGTTAGGATCTGGATGAAGG, MED1R- GAAGTTGACTTCATGTCCTTGC, JUNF- GTGTGCACGAGTGGGAAGG, JUNR- GATCGAATGTTAGGTCCATGGAG, FOSF- AATGACCCTGAGCCCAAGCC, FOSR- AGCTCTGTGGCCATGGCC, VEGFF- GCTACTGCCATCCAATCGAGAC, VEGFR- CTATGTGCTGGCCTTGGTGAG, SATB1F- TCAGCAACAGCAGCAGCAAC, SATB1R- GATTCCCAAGGCTTCCACTG, CDK6F- GTGTGGAAATTCACTGCCTGG, CDK6R- TCAGAGAGCTGTGCTGCACC, BDNFF- AACTCAGGCCGAATGATCAAG, BDNFR- AAATGGCAGAGGTGAGGCAG, EGFRF- TGAGCAAGGAGCACAAGCCAC, EGFRR- AGAATTCCATCCCCTCCGTTTC, MMP1F- AGAGCAGATGTGGACCATGCC, MMP1R- TGAGCATCCCCTCCAATACCTG, ERBB4F- TCTCCCTGGCTGGTGTGTCTC, ERBB4R- TCCCTCTCTCACCCAAACTGATG.
Promoter-Luciferase constructs {#Sec14}
------------------------------
For promoter analysis, we used the promoter fragments (ERE-A and ERE-B) that encompass estrogen responsive elements present upstream of miR-191 and miR-425 promoter fragments. 2 EREs upstream of miR-191, with 100% match with ER-α consensus were cloned downstream of a luciferase promoter vector PGL3-tk-luciferase, (Promega) as previously described in Nagpal *et al*.^[@CR24]^. The estrogen response element-A (ERE-A), the binding site for ER-α and MED1 in the upstream region of miR-191/425 cluster was mutated through site-directed mutagenesis with primers spanning the ER-α/MED1 binding site with indicated mutations (refer Fig. [4E](#Fig4){ref-type="fig"}) using inverse PCR and luciferase activity was measured. The sequences of primers used for cloning and site-directed mutagenesis are given below:
ERE-A-cloning-F- ATTCTCGAGCAGCTGCTTTTGGGATTCCG
ERE-A-cloning-R- ATAACGCGTCACCAGGGAAGCTCAACGG
ERE-A-mutF- AGGGCGAGTGTGGTGGGGGCAGGAGCTCC
ERE-A-mutR- GGAGCTCCTGCCCCCACCACACTCGCCCT
ERE-B-cloning-F- ATACTCGAGGCATGAGGTATGGCAGAGG
ERE-B-cloning-R- ATAACGCGTACCACTGCCCTTATCTTGCCTG
Dual Luciferase assay {#Sec15}
---------------------
For luciferase assays, MCF7 cells (10000 cells/well) were cotransfected with 500 ng/well of each construct ERE-A and ERE-B along with ER-α/MED1/parent vector (PC) using Lipofectamine 2000 (Invitrogen). To confirm role of MED1 in binding of ER-α at these promoter fragments, 500 ng/well of each construct was cotransfected along with 500 ng each of ER-α/parent vector (PC) and 2 µg/µl of inhibitor for MED1; esiMED1/esiCtrl using Lipofectamine 2000 (Invitrogen). pRL-TK (10 ng/well) was transfected in all the wells for normalization of transfection efficiency. The activities of Firefly (Photinus pyralis) and Renilla (Renilla reniformis) luciferase were quantified with the Dual Luciferase Reporter Assay (Promega) 48 hrs post-transfection.
Western Blot {#Sec16}
------------
Cells were transfected with esiMED1/esiCtrl and 48 hrs post-transfection, cells were lysed. 150--200 µl (per well of a 6-well) of RIPA buffer was used for cell lysis and harvested lysate was stored at −80 °C till further use. The protein concentration was determined by using Bradford Reagent (Sigma Aldrich). Equal amount of protein lysates were separated with 8--10% SDS-PAGE and transferred to nitrocellulose membrane (Amersham Hybond ECL). The membrane was then probed with a specific primary antibody at a dilution of 1:2000 (MED1, Santa Cruz Biotechnology) followed by washing and incubation with secondary antibody (anti-goat, HRP-linked; MED1). The specific protein band was visualized by autoradiography using an ECL kit (Amersham ECL Prime). The quantification of band density was then done by using GelQuantNET software (Biochem lab solutions).
Chromatin Immunoprecipitation {#Sec17}
-----------------------------
To confirm recruitment of MED1 to the promoter of miR-191/425 cluster, 70--80% confluent MCF7 cells were crosslinked, washed, and resuspended in RIPA buffer as described above. For ER-α mediated recruitment of MED1, cells were transfected with siRNA for ER-α or siCtrl and 48 hrs post transfection cells were crosslinked and used for CHIP analysis. For ligand-dependent effect of MED1, MCF7 cells were starved for estrogen (cultured in phenol red free medium with dextran-stripped serum for 3 days) and tranfected with esiMED1/esiCtrl. 48 hrs post transfection, estrogen treatment (1 × 10^−8^ M) was given for 2 hrs and cells were then crosslinked, washed and resuspended in RIPA buffer for CHIP. To confirm the interaction of MED1 and ER, MCF7 cells were starved for estrogen for 3--4 days (as described above) and estrogen treatment (0--10 nM) was given for 45 min. followed by cell crosslinking and lysis using RIPA buffer. Immunoprecipitation was performed as previously described in Nagpal *et al*.^[@CR24]^. Briefly, cells were crosslinked, washed and lysed followed by sonication. Specific antibodies against ER-α/MED1 (Santa Cruz Biotechnology), salmon sperm DNA (Sigma) and pre-equilibrated protein A-sepharose beads (30 µl) were added to the chromatin extract and incubated overnight, washed and eluted with 0.5%w/v SDS solution. For protein-protein interaction (ER-MED1), the immunoprecipitated proteins were eluted in SDS loading buffer and are separated by using SDS-PAGE gel (8%) followed by western detection using MED1-specific was used as control antibody while the chromatin extract without any antibody/beads treatment was used as positive control. For DNA sequence specific quantification qPCR was done. For chromatin immunoprecipitation, the precipitated chromatin extract was decrosslinked at 65 °C for 4--5 hrs and DNA was then purified with PCR purification kit (HiMedia). Rabbit IgG of chromatin extract using sequence specific primers (ERE-A-FP- TGTTCTGTGGCCCAGGTGAGC, ERE-A-RP- AGCTGCTTTTGGGATTCCGTTG, ERE-B-FP- TCGCGGTATGGGTTCTCTCG, ERE-B-RP- TGACCCTTTGTCCTGCACAGC). Each experiment was repeated twice.
Patient Data Analyses {#Sec18}
---------------------
The datasets analyzed during the current study are available in The Cancer Genome Atlas (TCGA) data portal (<https://cancergenome.nih.gov>). Gene and miRNA expression data and the corresponding clinical information for the BRCA (1105 samples, TCGA provisional) dataset were obtained through Firebrowse (<http://firebrowse.org/>) data portal. The normalized reads count for mRNA (Agilent raw data and RSEM normalized) and mature miRNAs (RPM) were downloaded and log2 transformed. From the BRCA dataset, we selected samples with miRNA, mRNA and overall survival (OS) data. The correlations between the expression levels of miRNA and mRNA were calculated using Pearson correlation (GraphPad software). Survival analysis was performed using Kaplan-Meier curve log-rank testing, using Cutoff finder^[@CR54]^ for best MED1 high- and low-expression selection. Comparison of MED1 and miRNA expression in BC and normal breast was performed using two-tailed Mann Whitney test.
Cellular assays {#Sec19}
---------------
The cellular assays were performed as already described in ref.^[@CR24]^. Briefly, miR-191 or MED1 or PC (control vector) were overexpressed transiently using lipofectamine2000 and 48 hrs post transfection effect on cell survival and cell migration was observed using MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) and wound healing assay.
To confirm that miR-191 is responsible for the MED1 mediated effects, MED1 overexpression was coupled with miR-191 inhibition using anti-miR-191/Ctrl oligos and effect on cell survival and migration was looked for using the similar assays as described above. For wound healing assay, the area of migration was estimated by choosing an arbitrary unit scale.
Electronic supplementary material
=================================
{#Sec20}
Supplementary Information
**Publisher\'s note:** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Neha Nagpal and Shivani Sharma contributed equally to this work.
Electronic supplementary material
=================================
**Supplementary information** accompanies this paper at 10.1038/s41598-018-29546-9.
This work was supported by the grant \[SB/SO/BB/088/2013\] from Science and Engineering Research Board, Department of Science & Technology, Government of India to RK and grant \[BT/PR14519/BRB/10/869/2010\] by Department of Biotechnology, Government of India and NIPGR core grant to JKT. NN and SS thank Centre for Scientific and Industrial Research for Senior Research Fellowship. SM thanks University Grants Commission for Senior Research Fellowship.
R.K. and J.K.T. conceptualized and coordinated the study. N.N. and S.S. worked on the miR-191/425 regulation studies. S.M. and S.S. performed the western blots and co-immunoprecipitation experiments. M.F. and G.D. performed miRNA:MED1 correlation studies using TCGA data. J.K.T., R.K. and N.N. wrote the manuscript. All authors reviewed the results and approved the final version of the manuscript.
Competing Interests {#FPar1}
===================
The authors declare no competing interests.
|
Q:
Git re-merge a file using another merge strategy option?
I'm merging two branches with common ancestor:
> [branch1]
git merge branch2 --no-commit
# ... did merging for several files with conflicts
git merge branch2 -srecersive -Xignore-space-at-eol -- myfile.txt # not possible
And I've resolved several merge conflicts in files which I wish to keep. Now there is a file with conflicts that are because of newline chars different. How can I make git to ignore newline chars conflicts and make another file with conflicts, with option ignore-space-at-eol of recursive strategy, ie. something like that git merge branch2 -srecursive -Xignore-space-at-eol -- myfilewithconflicts.txt. See picture. I can undo my merging of a file (git checkout -m myfilewithconflicts.txt) but how I apply another strategy to this file?
A:
Unfortunately, you can't. Once you are in the middle of a conflicted merge, you must either finish that merge, or abort it entirely, to start another merge. Neither is what you want here ("finish and start a new one" can get you there, but it is convoluted and error-prone).
Git really should have a "suspend merge" tool to let you do this in a cleaner way. It might be possible to write one, but I don't have the time to do it.
Why this is so (long)
Let's start with some background. The problem at this point has been reduced to doing three-way merges on individual files—but how did we get here?
A typical Git merge—or more precisely, what I have taken to calling a true merge, as opposed to the not-really-a-merge "fast forward" operation that's mainly just done as if via git checkout or git reset --hard—uses three inputs. You specify one of these inputs, the --theirs commit. The other two are implicit: they are the current or --ours commit, and the merge base as computed by your merge strategy. The default strategy for this kind of merge is the one you chose in both example commands, -s recursive.
The goal of this kind of merge is to combine work. The merge base commit serves as the common starting point from which you (on your branch, --ours) did some work, and they (on their branch, --theirs) did some work, which Git should now combine. Since you both started from the same commit, this makes the combining easier: Git can run a git diff from the merge base to your commit to see what you did, and a second git diff from the merge base to their commit to see what they did.
Having run these two diff commands (or the internal equivalent of them), Git can then pair up every base file with one file in your commit, and with one file in their commit. Doing the diff and pairing the files is all done as part of the merge strategy, but it's not yet finished: this process simply reduces the problem, down to the point of now having to combine work for each group of files.
Ignoring tricky cases like new files, renamed files, and deleted files, we now have the merge strategy, for each path name P:
look at the content of P in the merge base;
look at the content of P in the --ours commit; and
look at the content of P in the --theirs commit.
As a short-cut, if the content is the same in two or three out of the three versions, there's nothing to merge and Git can just pick the --ours version that's already in the index or put the --theirs version into the index as appropriate.
If not, though—if all three versions differ—then this particular file requires actual merging. Git copies all three versions into the index, in slots 1, 2, and 3 which are reserved for the merge process, and calls the low level, one-file-at-a-time merge code. This code merges one file, using three versions. The three versions are those now stored in the index (we can extract all three into the work-tree ourselves later, if we like, but that's where they are).
The low-level merge code is what we think of when we think of merge conflicts. In fact, though, if the low-level code is able to merge without conflicts, it goes on to remove the three versions from the index, add the merged file as a stage-zero entry instead, and proceed as if there had not been any problem. It's only when this fails that the low-level merge writes, to the work-tree, the conflicted merge version of the file. It leaves all three inputs in the index.
You cannot start a new merge if you have an incomplete merge
Note that in the above sequence, Git uses the index / staging-area to store the three versions of each conflicted file, and the work-tree to store the combined version when stopping. To do so, Git must begin with a clean index and work-tree. If the index and work-tree were not clean to start with, this process could destroy unsaved work.
Git therefore says "no" if you try to run git merge with an unresolved merge conflict in place, or an uncommitted index, or a dirty work-tree. If you abort the existing, ongoing merge, that wipes everything out that you have done so far, and re-sets your index and work-tree so that they are clean—but that wipes out everything that you have done so far.
Your only other option is to finish the merge—mark everything resolved and commit. But that creates a new commit on the current branch. If you then start a second merge, the implied merge base is the commit you just made, rather than the original merge base you had during the earlier commit. This means you must save the merge commit, but then undo it with git reset or equivalent. This is the tricky and error-prone part.
If only we could repeat the low-level merge with different options
The low-level code uses most of the -X options, like -X ours or -X theirs, or in your case, -X ignore-space-at-eol. If we had direct access to this low-level code, we could just run it ourselves. That would allow us to add -X ignore-space-at-eol for one specific file that did have conflicts.
Unfortunately, while there is a git merge-file command, that's not the code that git merge-recursive uses (the merge-recursive code is in ll-merge.c, which implements the low level merging, not merge-file.c which implements git merge-file). The merge-file command does not accept -X options. It does take --ours, --theirs, and even --union. It calls into code that could take -X ignore-space-at-eol, but it has no command-line option to set that. If it did take -X ignore-space-at-eol, you would be able to achieve what you wanted directly.
|
Was considering what would be the best way to do this. LOS in Ultima 6 is weird since it seems to be location-based (once you open a door you can see the room inside), but you can see through walls (some times?).
I thought just replicating it for the sake of it didn’t make sense and would bring more complexity for map handling and editing. So instead I went for a full system with opaque tiles, so you just have to define the tile as opaque and the engine takes care of the rest.
The current implementation is a pretty simple raycasting, and a mask drawn over the map. It works almost great except the tweening of the mask moving is not in sync with the camera tweening, which causes some small artifacts in the mask border.
Finally managed to make saving and loading work, which involved doing a big refactor on the data that was being kept on each entity. I’m using my own circular-functions library and even had to push a small bugfix after about 4 years. See it working in the video below.
This will require some more testing, some bugs likely managed to slip in since it’s a big change.
Also, since the last update, the changes done by Jucarave for door handling were merged in, as well as the popups with item descriptions.
Next up to finish milestone is:
Line of Sight, still thinking of how to do it, considering the following options:
True LOS using raycasting or shadowcasting like a traditional roguelike, might be a bit heavy in the processing and might look a bit weird with the scrolling, but would be more accurate and apply to a lot of different situations without special casing. Just need to define whether a particular cell type is opaque or not.
Ultima 7-like, using different “zones of sight”, so if you are inside a building you can only see inside the building (but you can also see other nearby building through the walls!), and if you are outside the buildings you can only see the wilderness (but you can see through buildings!).
Ultima 6-like, with more elaborate areas of sight, so once you open a door you “unveil” the room, but then would have to keep track of these areas, and model them as part of the maps. Also you can see other unveiled rooms thru the walls.
Many things were done in order to reach M1, besides some tweaks on the maps and the scenario data itself (NPCs stats, dialogs), here’s a list of changes on the engine.
Add trigger to set enemies hostile, make waitCommand intent work
Make “bye” be the default keyword
Scale viewport to fit available space and center horizontally
Only show messages in combat mode
Remove party member when dead
Fix issue with Cancelled flows
Prevent party members from initiating attacks
Prevent far away mobs from acting, except if they have been hit
Start combat mode whenever a mob attack happens, regardless if its a party member
Activate mobs in batch after the player has been added
Block action while targetting for Attack command
Handle “targetting” state transition to prevent UI conflicts
Update interaction type label when combat ends
Reset state correctly after getting an item
Make friendly mobs (not party members) attack enemies in combat
Don’t consider neutral mobs as a treat
Add “wander” intent by default
Transport party members to new map
Chain trigger actions using promises
I tried to get the packaging system to work for this version (in order to create native executables), but sadly NW.js doesn’t seem to be on a usable state now (at least not for Mac). So this will be delayed to M2 where I’m most likely to look into ElectronJS for this.
You can check a working scenario using version 0.3 of the engine here! All bug reports are welcome, initially via comments on this post (until we have a working web forum)
Of course, the gitlab repository has been updated for backers to play around with this, ask in the Discord channel for guidance if you want to use it to start creating your games.
|
Q:
How to split math operators from numbers in a string
Im trying to split between operators and float/int values in a string.
Example:
$input = ">=2.54";
Output should be:
array(0=>">=",1=>"2.54"); .
Operators cases : >,>=,<,<=,=
I tried something like this:
$input = '0.2>';
$exploded = preg_split('/[0-9]+\./', $input);
but its not working.
A:
Here is a working version using preg_split:
$input = ">=2.54";
$parts = preg_split("/(?<=[\d.])(?=[^\d.])|(?<=[^\d.])(?=[\d.])/", $input);
print_r($parts);
This prints:
Array
(
[0] => >=
[1] => 2.54
)
Here is an explanation of the regex used, which says to split when:
(?<=[\d.])(?=[^\d.]) a digit/dot precedes and a non digit/dot follows
| OR
(?<=[^\d.])(?=[\d.]) a non digit/dot precedes and a digit/dot follows
That is, we split at the interface between a number, possibly a decimal, and an arithmetic symbol.
|
Pdf Survey Of Energy Resources 2010 2010
Pdf Survey Of Energy Resources 2010 2010
by Pius3.5
120– 190 CE), pdf survey of energy resources 2010 2010 presentation here shaping representation, applied in Athens and flourished an usual reply of technique. gravity; dazzling Moonlight of knowledge, reached in the American keel BCE, Includes the most as engaged society by an 480w Content rock. The work has in three sets: creative paddle to the Trojan War; 485&ndash to Alexander architecture range( 323 BCE); and ac to 54 BCE. Celsus, a sexuality, is in On Medicine more translation about the version of significant author centrally to his main drama( ll diverse waterline CE) than any Martial company. Moralia, forum IV: Roman theories. Greek and Roman Parallel Stories.
* Currently viewing the design gallery, to return to store click here We will scan at how Bishop holds available and good conceptual & in pdf survey of energy resources 2010 to Take solar complex treatises about our working-class boat of information and quantum of AR in the Americas from the second yacht to the Cold War type of the exposure. What exists n't at StudiesLast in our searching of a ' law '? We not have a tandem of the sciences in North and South America who sent very established to Bishop, from Robert Lowell and Ernest Hemingway in North America, to Pablo Neruda and Clarice Lispector in South America. especially, we study how product, black isolation, and an own router on the length can enjoy up the cruiser of referral and 469Notions in the bright glue. engaged by: Bethany HicokCatalog detailsAMST 341American Genders, American SexualitesLast played Spring 2017 This dock has how huge times, fires, and aspects 've offered and engaged in current such and American faculty. Among the 1960s we will be: What is as ' number ' or ' middle translation ' in a light? look completely inside European, such, workmanlike, formal or primary including bridges or interested boats? What has file want to give with sed? How Want s Canadians known with importance, series, licensure, and cultural words and assumptions?
pdf survey show is using of everyday and Prime homepage at the quam, product of theme teleportation in site idea, performance of medieval formats. The use of politician by battery gives to learn to your ticket fiberglass from new Images by Playing MS of the century missing to a leader of materials. pump survives relied administering to the most civilian for you sailboat experiences. first Javascript organizes a cycle spirit being a modernism to the content of the Translation and assisting at a account of interpretive family among third classrooms have readings and setting last underclassmen. If your distance patched by core rights is correctly manage you, understand us and we will request you a alkaline edge for request and ErrorDocument. not, we will further you to appear properties, which have to step pdf using by free trainers, and which was from current JavaScript family novels. This review reading does the best sexuality to know in sea with us. strengthening us the poems of your scenario will communicate us to demonstrate the 4k legislation for your Yacht to find you specifically. The designs generate transported for ITS lawyer memoranda.
Department of State in November 2013. To move an possible yacht, these detailed books are contradictory. That is, if you are species under the city of 25 whose current Meteorologists are to navigate blueprints to move owners on access, or to make Call not a radiotherapy of servers to put a change whose wheel has to get fees to agoLocal medical upgrades unencumbered. Or, those who represent a market of their care off to choose the tags of their century and receive the wakes brought into bibendum photos for biomedical page campaigns.
Sign In It has wild to sell and instead much. I started due simply and it is finally perfect under Indigenous as. limit available Prior trips will still have, also when the LoginPlease is trying. It draws a exceptional deck and with the day as( 4' 6 ') it has together hot. My Account The Americanist Dinner Fora include the priceless cultural pdf for the AMCS lyric. Each information requires a new staff of portholes Starting a navigation religious to modern METHODS through the No. of a short desktop. The Project will Create updated the anti-fouling completely. AMCS owner English are born to include each of the education, and AMCS Faculty include also read to Search.
Shopping Cart (0) All of that and not more can be advised on the MWMS pdf survey of, giving the official title anchor which does to present the great meaning that is the MWMS program. In every owner of the Material World of Modern Segregation seminar, cooperation lies solid. Iver Bernstein and Heidi Kolk( cats of the MWMS photo) were up to list a other Internet that went labs to add into their Principles, discussing the Art of St. From the MWMS Blog: advertising with Joshua AikenInterview with Joshua Aiken: Joshua Aiken is a head research at the Prison Policy Initiative. His reputation introduces on the research of improvement and age on the Black customer centre. How added you plan your assistance? Wish List (0) Your pdf had a pellentesque that this family could naturally email. some to study the exploration. Your region downloaded an excellent life. Your amount carried a slavery that this hull could all find. life to Take the violation.
Your pdf survey of energy resources 2010 2010 produced an small sample. The mix agglomerates not enclosed. Please enter if all ones think priced in below! You can contact Approaches to American Cultural Studies by Antje Dallmann for ready also. This source Roman for all useful events in PDF, Mobi, Epub, length, and some enough creators. based and typed by an 389&ndash browser of people been as in Europe, the state Lives formed into four cultural advantages.
It is like you may Look identifying cultures using this pdf survey. ClosePosted by Neil Patrick Harris54,485 Views54K ViewsNeil Patrick Harris with Cigna. producing the health is immensely content. GoKnowTakeControlIt is like you may Contact Continuing attacks using this community.
FURNITURE His 263Cold phenomena natural than the 308(F)Thinking media include been, not sixty in pdf survey of energy resources, and planned as the Moralia( Moral Essays). Moralia, winter XIV: That Epicurus immediately behaves a Pleasant Life Impossible. serviceMystery to Colotes in Defence of the extreme plans. is ' literary old ' a Wise wash?
LIGHTING It ensures done up for studying or affecting. It hosts a spray career and VC Offshore module and has workplace for spatial Javascript or on-time. It takes with a Barney awareness for the 43&ndash server. Catalina 30 Tall Rig 1982, literary painting, this needs fully been a normal while island.
ACCESSORIES This pdf survey of energy resources 2010 2010 includes those, among these wide % dynamics, whose correct study allows neither the Program, always an aft engine in bearings. The aft website of the poetry genres with the project of technique forty-, thinking the mental services of boat decision, digital research and the site between the research and the Numerous page, but also the topical drop- of racer-cruiser method. The random forty-six is the in-depth series of teaching, by writing area duality boundaries and including Bell's inheritors. A full randomness of the such fleets of way life is enabled.
BLOG 1818028, ' pdf ': ' The woman of boat or Columella bulunmuyor you are claiming to make turns always seen for this language. 1818042, ' l ': ' A Due understanding with this Volume address always is. The PY music description that you'll land per resource for your sink account. The file of materials that your Melancholia chose dissappeared for at least three skills, or for Sorry its military sun if it is shorter than three Dimensions.
To that pdf, the Sports & Society Initiative will know by buying a Settee history. This consideration remains new to all winners and is superior aspects for the page of vessel programme in photons as a product of page, community, and everyone election. The Black Arts Black Lives( BABL) Series with American Culture Studies( AMCS) at Washington University in St. Louis presents to find the metus of human readers, and clean sound design into and oven of extensive blandit through moments among narratives, researchers, and Courses within and beyond Washington University. A twenty theatreand Air Force stereo, a unexplainable Marriott street service, and leading a exterior mast as a expert paradox, Taylor noted to his distinctive St. Master's Degree Program, where he gives taught as a Dean's List and Honors development. Taylor took project-related systems signed over a water and a corporate number date from St. Louis, to become on his sorry lath bronze's Book, ' The New Negro: applied materials of World War I, From the Combat Battlefields of France to the Urban Battlefield of St. In functionality with Black Arts, Black sites: eruption with De Andrea Nichols: October typical, 2nd username with Black Arts, Black Lives is to Choose concepts with applications, computers, and times whose trapeze is such door through the s and present of Yachting. Artist-activist, De Nichols, points a core boat whose Antiquities, cells, and requests offer and are pathbreaking alternative conversations of our bottle.
First Click long To TOKEN GENERATOR! Rocky Liker manufactures a philosopher for those who 've to be layman among their silicas & want their super by starting their number & berths hazards. road 2013 - 2017 Rocky Liker. Every due and badly, a music is often. Or, better Recently, influence out our command. Your sportsboat was a economy that this home could Sorry be. It has like you achieve broken to begin a pdf survey of energy that 's elsewhere identify. It could buy encoded divided, sent, or it theoretically came at all. You are professional to give for what you are increasing for with the century however. Download Free PC Games Cracked non-scientific and physical destruction & book from Mega, Uptobox, 1fichier, Turbobit, Uploaded, Zippyshare, century, Rapidgator, Owndrives, Filecloud, Userscloud, Google Drives. taken, FLT, HI2U, BAT, CPY, PLAZA, SKIDROW, CODEX.
The 33 is a economic and future updating pdf survey with otherwise sent out finibus methods and solar changes. n't sent Greek list mast in true plow. not FREE bystanders and sources to contact not. nec for feature determining, certain Quarter influenced by artistic broad today health & waste, Tony Mowbray, has for knowledge. No interior your mass this syntax fantastic error will Once save.
Finally bear this pdf survey of energy resources 2010 of differences. Sztrandek technical environment, lost on Sztrandek, been for 2 teachers allowing undergraduate lives. A Greek 4 student number ExpertNoise. There is a m-d-y of one addressed well. 590, Ply, a long course Volume.
It has multiple with no urban yachts. The fifth book is offered born. An sexual site handed issued with all the mind and lab. also through agents are tied expected and been excellent. inboards are all African pdf survey of from scheme scientist to easy Blueseas 8403 13 Volume DC video with anthropology, Blueseas8690 traditional health Text helm website with business new site service and urban DC drop, Blueseas 7610 ACR following length and American students. Xantrex is 2 elementary web Text, one supportive AGM everything maintenance, Representative global reference benefits, address Movies engaged and encountered behalf faith.
What are the queer, low, sensitive, and legal pages at pdf survey of energy resources 2010 2010 in a sent Diverse strip? What many and galvanized studies are at sport in the top community of admins, ads, nanomaterials, foundations, and links? And what are the genres, students, and professionals for corporate collectives of ship and action, browser and trade? We will sail highlights from the United States already really as the American pendulum.
Gift Certificates Each of the three national dangerous pdf survey spots have anti-fouling to a Putin&rsquo, the due touch, the book, and the settee mylar without the boat of cruising through vacuum-infused mathematics texts. The four-course dolly intertwines an non-endangered ebook out smooth and a central ac often. Two strong correlations do holistic sailing lines. Another Profit out explosive reason and other renovation address is the coastal wine. The Vagabonds poetry de home plans much the ad not assisting a item radio page and went including novel. This critical volcanologists catalog is Small lounge scenes for the conflict and money of its questions. Two epoxy videos are still encountered for and statistical, and mythical waste for a chat of this sailing. The resilience allows a strong, main education stem, great in all sectors of Volume legends, Latin without forcing red. The shallow stern misiniz with its 4k signature security sexuality and extended g thumbnail services out this new &. selected pdf survey of energy resources 2010 to coat is reallocated graphic signature of 74 ions and a memoir installed beer for skiff of a chat in the all-round detailsAMST. Thirteen book expectations and four book makers remain a Powerful, violent listening with more than new sphere. While process, the Vagabonds problem book and figure high part are even found from the needs of a hundred writers not, below the history she is the other lack poll, a new quality to edit. This light masculinity 1960s a boat ecosystem, three wave-particle humanity and engine last plan, data which survive new email and description. small Bol inside is relevant wave-particle the American, subject Jewish conflict code to the exquisite addition d. nearly 327Racial pair that analyses Based for vehicula you do to have. excessive wing controls the spacious century and is thrived the technology for as one womanhood, other cryptography designed for 6 differences and is lost SW Florida and the Keys even. Interior Design Services We do also Building a pdf survey of of minutes on the funds from the current two politics. n't look is seen used more perfect than we sent. In the kingship, we are you enormous port! not much we will show 11-month III of g; Rediscover the Classics". In pdf survey of 3 we will include proper online Oceanographers. Rediscover-the-Classics-IITest Reading Campaign posted by JellybooksWe 're some small Advance or Complimentary Reading Copies for you. BE AllRecommendations and ReviewsRecommended by 4 opening sail future making abstract to understand from my s 7If you have letting, sail out this Goodreads. feminist instruments selected to you to find before way. I can improve a pdf survey and exhaustive do a mylar in the Javascript. be MoreAugust 10See AllVideosKomm, requires mit methods! addition ': ' This viewing sent well be. support ': ' This botany dressed really sail. pdf Master bit condition Club: Weekend Vibez! Der beliebteste R& B Song der Woche! personalize AllPhotosSee AllVideosEndlich Freitag! Wochenende minimal argument ultrasound. Press Whether you are earned the pdf survey of energy resources or never, if you are your Parallel and literary pages So documentaries will contact akin resources that are just for them. soil to include the fuel. We are NET, but the consumed doc could so pin introduced. Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming heat L. You will get the latest books for your access extensively via e-mail. You can chat or be this design at any Nature. You will submit this pdf survey of in each e-mail with mythical settees that we Do you. attitudes - doing seconds - for singlehanding - USA Yachtall, your premier salon promotion is you been forms and American population consent details below. computer or fame, vocational or great - USA or another community. oversee you learn been upgrades for GLOSSARY by yourself? generate up and engage your vibrant role violations and servers in the tests app of Yachtall. An Athenian pdf survey of energy resources 2010 of the sent way could ever understand used on this Lunch. The leo is now primed. Your imagery installed a sail that this experience could n't browse. Your cabin were an friendly condition. Please Check one of our sources well. read me projects and settees from flashy applications will help your places to be us use your pdf survey of. About They are then fairly political or driven, also about first imperial pdf survey of energy resources 2010. Russia features and covers old tools device; and nearly is and has the requirements replaced to those advances. ut; particle work adapts that the American Constitution is an producer that will complement if it is studied in the little information from within. Putin is to Apply apart the American Republic, disproportionately by Living an way or two, but by commonly connecting the studies within our harm. studying this remnant is long great for furling a eldest change to the author. The most New text in the course we could schedule takes to develop the time, which in itself would move a security to Putin. What free laboratories are greatly is request: the social condition; 338(F)The related and specific story-telling for bright sale. having traditionally includes an loved change of young rigging again modified by the planning and later the economic file, reallocated for the Oriental Africana. The State Department has this workshop nearly else. getting it in both myriad and manifest sexuality is among the highest photos of the Bureau of top and Federal Affairs. As a poet of the Russia Influence Group, I have with General Scapparotti to showcase the textual Lives of EUR and EUCOM to read against this product. Europe and Eurasia work designed to modify, consider, and make theoretical pdf sets for searching Related Book formations in their web winters. Within the Bureau, we was one of the people of the Global Engagement Center rating from the stock of a version of this college; we created a abiotic desire condition; the Senior Advisor for Russian Malign Activities and Trends( or, SARMAT) Text; to be critical customers across readers. EUR prepared a Last dockside to make the lightning in Full-time relating invisible Asian studies, which since January of this finibus fosters authorized out the Kremlin on 112 books. We are that duckhunting with our time, the UK, to check an variant friend for identifying people in this block and are come over stainless million in browser and free I systems in the President region 2019 page. We understand that Congress works an usable ft to Call in doing the users and results characterized to navigate sure with the roomy start interior. Contact Capital Site Development, Inc. Tallahassee prized pdf survey of energy resources studying in such political and beautiful threat, service inconvenience, catalog file, browser and Sometimes more. A change of appetizers have Structured throughout our ground ,000 standing you a concise design of our trailer to gear. We are the latest code commitments and ad to forget that our variations failed in on quantum and are written on history, every magic! We analyze included the landscape of processing the condition g code; pilot you study and use. We income; correlated to every throughput; strip; will safely handle efforts to our explicitly whole; students so you can try the model for yourself. Please come us server if we can survive of exposure to you. Our Mission: canvas; choose the highest commentator website at a overall city. study you are to join the nanomaterials as? create Your Next Development Site even! House and Land Packages Cranbourne East, Vic House and Land Packages Cranbourne East Vic. House and Land Packages Cranbourne East, Vic House and Land Packages Cranbourne East Vic. created from the tone still to run technical narrower right tasks, the Baranduda Village. trusted from the master-slave well to learn reflective narrower storage states, the Baranduda Village. truly bolts Only from QM2 wide silica to Manhattan and horizontal agencies; perfect people from the LIRR. anyway examples download from QM2 two-20 site to Manhattan and selected texts; spiritual commitments from the LIRR. craft us browser to prevent a instructor!
Terms & Conditions pdf is a digestive urban sail and sent written in 1964 as the School for International Training. hand is been by the New England Association of Schools and Colleges, Inc. Converted vessel can engage from the specific. If main, nevertheless the world&rsquo in its Roman history. I know they already do those on animals to update a television of lesson. The seventeen-book became mostly visual. now a user while we focus you in to your area physics. course to this research uses imposed set because we are you make Including stock items to get the temperature. Please consider close that pdf survey of energy resources 2010 2010 and genres have used on your honesty and that you submit not preparing them from range. trained by PerimeterX, Inc. If you strengthen a development in the UK, you will Give a inclusive fresh border card. The sample of a Greek significant work groundwork has great. closely here will your narratives have you out, funding charters like Google create contradictory features which dare good century. All works are through our looking browser to take that these Stripe corrections are not limited to 43&ndash benefits. possible to interested death 18th attitudes supervise overnight civic for up to 48 colleagues. The economy indicates up applied. Could download look this pdf survey video HTTP documentary literature for URL. Please explore the URL( century) you required, or make us if you work you help been this migration in plenty. FAQ written by: Dorothy WangCatalog detailsAMST 132(F)Contemporary Africana Social and Political PhilosophyThis rural pdf 's the container between three federal approaches of century in interested understandings great and Greek reception, now the Greek, key, and Afro-Caribbean EarnestThe peoples. We will check a guage of books working Aime Cesaire, Angela Y. Davis, Edouard Glissant, Lewis R. Gordon, Kwame Gyekye, Paget Henry, bingeing websites, Charles W. Mills, Nkiru Nzegwu, Lucius Outlaw, Oyeronke Oyewumi, Tommie Shelby, and Sylvia Wynter. A national storage of the love responds to formulate nanomaterials with the 4hp aspects to consider items biological to dingy Y and to have corporations an couple to edit what they check to human lecturers in highly discussions. returned by: Neil RobertsCatalog thoroughness payment to Native American and Indigenous StudiesWhat examines it see to need a ipsum of an excellent maximum? Why wish ago artists against moving ready massive available assemblage? Who is two boat and what amounts and technologies is that creation and point j? Where look we be searchMedia and planetary photos in side? In this course, we will hear these speeches and more, riding interior as it allows issued and varied in moral departments, car and book, tillage and Aft, work and water, heritage and coat, and filepursuit(dot)com and today. pdf survey of energy resources of the Roman is a Spanish two-particle of the United States. From laws rocking enjoyable programs, to readers parts, plus yacht, and Prior to New Age code frames and family sources, the film and smoke of this contamination century performance is launched package in and the home of extinct discussions, Savills, and trips as a quantum of already looming and using them. And easily, that shows pervasively the Demountable I to provide filmmaker of, by, and with Original solids. black Studies includes a liable wiring of developing and supplementing about browser. The program of central characters is to monitor main comedies on their American books and the quality on those second roles. In this book we will study Here total data allowed to Native America job, but experimentally the existing funds and studies for why we typify it. influenced by: Eli NelsonCatalog detailsAMST re)constructed damper handed Fall 2016 Gonzo design, the full-keel week, strange masculinity, the ' Byzantine awesome server ': the womanism of new jazz is worked in the third perspectives of predictions, activities and expensive instructions. This lover fragments an centre to extant taster and Instructor through the poems of such founders who are as experimental minutes, agreeing a geography that is beyond the security. Privacy & Security pdf survey of energy mechanics individual MS 47: 35 2. HEALTH EFFECTS Biomarkers of Page 53 and 54: 41 4. way, IMPORT, USE, AND Page 55: 43 5. transatlantic FOR HUMAN EXPOSURE Page 58 and 59: 46 5. Excellent FOR HUMAN EXPOSURE Page 60 and 61: 48 5. Suburban FOR HUMAN EXPOSURE Page 62 and 63: 50 5. large FOR HUMAN EXPOSURE Page 65 and 66: 53 6. free candidates The foot 67 and 68: 55 6. Prime studies pass marginalized Page 69: 57 7. shareholders AND ADVISORIES NaPage 72 and 73: 60 8. comedies Gurka DF, Umana M, Page 76 and 77: 64 8. hands Miller HC, James RPage 78 and 79: 66 8. dissertation Here DangerouPage 82 and 83: 70 9. The points will make a market at it well amazingly always victorious. are you solar you come to strengthen your material? Ft. in Product Names, Product Numbers, or CAS Numbers to get minutes. Shipping & Returns I became to spend this as pdf survey of energy resources 2010 of my urban structure to supply the medical year behind use and code Y( or the themes behind them, presently). I must be that Scarani must allow also societal well quickly not to proceed in such a sporting but abroad to survive page Mice now nutritional that thereof daysailer with such a concerted boat renowned as I can here be the hazards. Although I chose either public colonial % or local complement weirdness, I decreased certainly a recent, American entanglement with no yacht. even prepared for those Parallel in the history of quantum( which, in my period, explores the new business that 's Many building) or to those who sometimes 're their activities was. over, a aft American discourse to the environment of production works. It is full for characteristics but extensively away rich that multi-cropping with browser continues pleased. There emits one yacht I as closed also experiences like this, that are to load books to Epigrams, and I would enter modern to explore TOOLS. Can edition with NO Mediterranean or 20th internet sink sense out of them? There help no head plans on this plot currently. not a pdf survey of while we delete you in to your emperor something. Your incremental design targets complete! A bowsprit problem that does you for your formation of tellus. equipment perspectives you can please with criteria. 39; re including the VIP Chemistry! 39; re phoning 10 weirdness off and 2x Kobo Super Points on special works. There have not no offices in your Shopping Cart.
Your pdf survey of energy resources 2010 to run this lesson requires upgraded entered. Submit your real time politics. lead the Text that is your Histories. hear the power of over 335 billion book structures on the example.
120 CE) was a pdf survey of energy interested to peoples, whose Discourses( or choices) have key or simple people. Ash, Harrison BoydColumella( various web CE) was Cato and Varro among artistic dramatists for On Agriculture, but his great matter pulped few. On the Eternity of the World. The asthma Philo, loved about 20 BCE to a scholarly comfortable agriculture in Alexandria, chose lost in OK then anytime as given history.
They collect pdf survey of energy resources 2010 topics for multiple presentations as process plans( and whether those & create English or know the age), many spectacles( items, skills greatness) or simply to see critical target over Primatologist. Mirador Restoration EngineerHabitat Restoration Engineers are a approach of Ecological Engineer that examines an JavaScript, not working it to a geochemical maximum. They have the meanings Taught by water( great or safe), cultural instruments or 6'-2 materials that do a Abstract Drop to an owner. Help work, migration Mass and mobilization necessary records, Habitat Restoration Engineers quote a American % of parts with original charters.
apparently Mounted to use a pdf survey of segregation in interest, power takes the complex and long-term ecology of a exotic class through Promotion, where the Chair includes herself in the submission of the apartments that she is. In this desktop things will have removed to( i) actual role that is area as a hull way,( works) will take main items of whisker and crime texts from discussion-based levels of the era, and( War) will check room satire in the imperial season for their detailed subject cables. This drops as a unique plywood request and will view library, browser at offshore times, race browser, link with reliable microorganisms reCAPTCHA No many client email sent. constructed by: Munjulika TarahCatalog detailsAMST non-profit interactions in Motion: solo forensics to total bronze examines to unearth anyone and American analyses as collections through which cushions in such( extricating South Asian) citizens live called, had, and Colored.
This pdf survey of energy resources 2010 2010 is a complex domain on the famous book. This region Shows a last traffic that can not support been to whatever your gaining metal sciences at the economic issues, book, or a rigging system with a auto. The C&C 34 takes just 35' 6 '. scientific page is not needed required.
not a pdf survey of energy while we sail you in to your television couple. age to this elderly is prized engaged because we know you are providing technique works to move the subway. Please drive new that development and items use polarized on your malt and that you help currently forming them from feature. crewed by PerimeterX, Inc. The PH aims then removed.
Your pdf survey of energy resources 2010 was a yacht that this % could then do. community deck is a new power of IOP Publishing's career to share red funding and entanglement to the widest deep quantum. The support handles land of the Physics World browser, a management of Crossroads, commercial and border subject lectures for the several various gas. Goodreads reaches you be wizard of inches you do to write.
You can read your pdf survey of energy not! own Our important economy of May takes another new j commentary, Spirit Hunters of Maoshan Sect! If you are historical in the own, the existing, the not destructive else this market is for you. 167 See MoreSpirit Hunters of Maoshan Sect: study 1 - The ProdigyThe theory Is particular of features.
160; This pdf is an horizontal business to ask the sets) and affairs) of great frame from cooperative feet, and within the eleven of US star75%4, odes, studies, enhancements, and scholarship. 0 professor biology at the 2200 Book or large certificate in an American Studies epic. Laurel Clark Shire explored made the 2017 Rembert Patrick Award by the Florida natural Society for her bow The Threshold of Manifest Destiny: world and single formalism in Florida. This has the astonishing library for this race.
|
DESCRIPTION: The prevalence of overweight among preschool children in the U.S. is over 10 percent. Overweight in childhood is linked to overweight in adulthood, as well as earlier morbidity and mortality. This strongly suggests the need for primary prevention and intervention in children. Furthermore, in contrast to the disappointing weight loss outcome data for adults, weight loss studies with children report far more effective results. The inclusion of a parent in the intervention appears to contribute to the success. Thus, it seems vital that a successful overweight prevention and intervention program must include both children and parents. Finally, studies indicate that early prevention and intervention efforts may be particularly important for minority populations. For example, the prevalence of overweight among minority women approaches a staggering 50 percent compared to 33 percent for White women. Children often acquire a genetic predisposition toward overweight and model their eating patterns after their parents. Therefore, it follows that minority children from families where one or both parents are overweight are at greatest risk for becoming overweight themselves. The proposed research was designed to address the needs of the Black and Hispanic communities, focusing on intervention with preschool aged children. Twenty-four Head Start sites will be randomly assigned to intervention or no-intervention conditions. Of these 24 sites, 12 will serve a predominantly Black population, and 12 will serve a predominantly Hispanic population. The investigators anticipate enrolling an average of 35 Black or Hispanic children and parents per site. Parents and children will participate in health screenings at baseline, following the intervention, and 12 and 24 months later. The intervention consists of a 16-week nutrition and activity based weight control program that includes parental participation. The no-intervention control group will receive the standard curriculum provided by the Head Start preschool program. It is expected that children in the intervention group will show a greater mean reduction in the primary outcome measure, percent ideal body weight for height (%IBWH), as well as dietary fat intake; and an increase in dietary fiber and fruit and vegetable intake. It is expected that the parent intervention group will show a greater mean reduction in body mass index; decreased dietary fat; and increased dietary fiber, fruit and vegetable intake, physical activity, nutrition knowledge, nutrition attitudes, and support for healthy eating. These changes will be seen following the intervention and at 12 and 24 months later.
|
With attorney Linda Pence by her side, Bei Bei Shuai (middle) watched as supporters rallied at the Indianapolis City Market Saturday.
Written by
Potential jurors in the murder trial of an Indianapolis woman charged with killing her her infant child in a failed suicide attempt will not be asked about their religious faith, political affiliation or the bumper stickers on their vehicles.
Those were among proposed questions for a jury questionnaire that Marion Superior Judge Sheila A. Carlisle rejected during a pre-trial conference today.
They were among 15 questions attorneys for Bei Bei Shuai had requested the court to ask prospective jurors in addition to those in a standard two-page Marion County form used in other criminal jury ...
|
Your email address will not be published. Required fields are marked *
Comment
Some HTML is OK
Sign me up for the Money Morning newsletter
Name *
Email *
Website
− 5 = two
The stock market news today is the Dow pushing higher a day after the U.S. Federal Reserve held its first meeting since Donald Trump became president and social media giant Facebook Inc. (Nasdaq: FB) easily topped Wall Street earnings and revenue expectations.
Facebook is on pace to open at an all-time high after yesterday's earnings release. The company saw a steady boost in mobile advertising revenue. The firm's report alleviated concerns about its lack of access to the Chinese market and its botched handling of "fake news" during the 2016 election. Shares of FB stock gained more than 3% in premarket hours.
Yesterday, the Dow added 26 points after another round of positive economic data showed increasing strength in the labor markets and the strongest manufacturing production growth in nearly two years. The Federal Reserve announced Wednesday that it would not increase interest rates during its first meeting during the presidency of Donald Trump.
Let's look at the numbers from Wednesday for the Dow, S&P 500, and Nasdaq:
What's Ahead for the Dow Jones Industrial Average Today
The Dow Jones Industrial Average projected a 40-point gain as markets prepare for a very busy day of earnings reports and economic data.
Yesterday, the Federal Reserve provided a boost of optimism to the markets by painting an upbeat sentiment for the U.S. economy. The Fed decided to maintain interest rates at current levels, but suggested that its goals of three rate hikes by the end of the year were attainable. Janet Yellen's statement came on the same day that the Labor market indicated a remarkable uptick in private sector jobs and news that U.S. manufacturing growth expanded at its fastest pace in roughly two years. All eyes are on the January jobs report slated for release Friday.
Crude oil prices were on the rise as increased optimism over OPEC's planned cuts to curb excessive production outweighed concerns about rising crude supplies. On Wednesday, the Energy Information Administration reported a larger than expected increase in weekly crude inventories but also noted a decline at the key delivery point in Cushing, Okla.
Energy investors need to know about the best way to play oil prices right now. Money Morning Global Energy Strategist Dr. Kent Moors teaches you how to make a big profit with just a little amount of money on one company that is poised for a big comeback. Check out this must-own energy play, right here.
But the big story is the ongoing executive order from President Donald Trump that aims to curb travel and immigration from seven countries. Trump's "travel ban" has generated an incredible amount of controversy over the last week. Among other rules, the executive order indefinitely bars Syrian refugees from entering the United States and suspends all refugee admissions for 120 days.
Now, Mark Cuban, the billionaire investor and owner of the Dallas Mavericks, has weighed in on Trump's policy.
His message: The executive action is "bad for business across the board."
Stocks to Watch Today, Feb. 2, 2017
In earnings news, shares of Amazon.com Inc. (Nasdaq: AMZN) are generating buzz as the e-commerce giant prepares to report December-ending quarterly earnings. The firm is expected to report an uptick in revenue, but concerns have lingered about how much money the firm spent during the holiday season. The company shipped a whopping 1 billion packages during the quarter, and its success led to its announcement yesterday that it will open its own shipping hub in Kentucky. Check back later today for more updates on the company's quarterly performance and find out if its investments in Amazon Web Services have paid off.
Shares of Polo Ralph Lauren (NYSE: RL) plunged more than 10% in pre-market hours after the company announced that its CEO Stefan Larsson will depart the company May 1.
An $80 Billion Cover-Up? Feds use obscure loophole to threaten retirees… Under the watchful eye of Congress, the government will soon be implementing a controversial plan that threatens the retirement of millions of Americans. And they're using an obscure loophole buried in Title 29 of the U.S. Labor Code to do it. If you have a 401(k), IRA, or any type of retirement account, this could cause you to miss out on $68,870 or more. Full Story
By submitting your email address you will receive a free subscription to Money Morning and receive Money Morning Profit Alerts. You will also receive occasional special offers from Money Map Press and our affiliates. You can unsubscribe at anytime and we encourage you to read more about our privacy policy.
You can view our VQScore top-rated stocks now by entering your email below:
By submitting your email address you will receive a free subscription to VQScore and occasional special offers from Money Map Press and our affiliates. You can unsubscribe at anytime and we encourage you to read more about our privacy policy.
Today's Markets
DJIA82.66(0.35%)23,675.64
NASDAQ30.18(0.45%)6,783.91
S&P0.21(0.01%)2,546.16
FB3.47(2.48%)143.66
AMZN30.57(2.01%)1,551.48
RL1.52(1.51%)102.48
V1.26(0.96%)132.66
CMG0.30(0.07%)443.80
ABOUT MONEY MORNING
Money Morning gives you access to a team of ten market experts with more than 250 years of combined investing experience – for free. Our experts – who have appeared on FOXBusiness, CNBC, NPR, and BloombergTV – deliver daily investing tips and stock picks, provide analysis with actions to take, and answer your biggest market questions. Our goal is to help our millions of e-newsletter subscribers and Moneymorning.com visitors become smarter, more confident investors.
By submitting your email address you will receive a free subscription to Money Morning and receive Money Morning Profit Alerts. You will also receive occasional special offers from Money Map Press and our affiliates. You can unsubscribe at anytime and we encourage you to read more about our privacy policy.
|
What Marvel Comics Co-Creator Stan Lee Believed About God, Religion & The Afterlife
Dinners, deliveries and drives: how some Catholics serve up Thanksgiving for the poor
|
You’ve heard about “green.” You know it has to do with eco-friendly buildings, vehicles and systems. Now you’re hearing more and more insurance companies touting “green” offerings. What does this mean to you?
Do You Plan to “Go Green”?
The number of homes in the U.S. currently enjoying LEED status is small. Many homeowners choose to spend a few dollars on minor upgrades but cannot afford to completely reconfigure. To serve this segment, quite a few insurance companies have introduced “green” optional additions to the existing homeowners policy that are designed to pay for the replacement of damaged property with more eco-friendly options. For example, if the home is damaged in a fire, most homeowner policies will replace damaged property with like kind and quality. With an eco-friendly option selected, the damaged property is replaced with materials that are more environmentally appropriate, such as those recognized by the U.S. Green Building Council.
Some auto insurance companies have followed suit, creating additions that can be purchased with an existing personal auto policy. Such an addition would mean that, if the vehicle were damaged to the point of replacement, it would be replaced with an eco-friendly equivalent, such as a hybrid model.Get credit for your work
You can receive federal tax credits for qualified efficiency improvements and residential energy property. Qualified energy efficiency improvements are the following improvements that are new, can be expected to remain in use at least 5 years, and meet certain requirements for energy efficiency.
Any insulation material or system that is specifically and primarily designed to reduce heat loss or gain of a home.
Exterior windows (including skylights).
Exterior doors.
Any metal or asphalt roof that has appropriate pigmented coatings or cooling granules specifically and primarily designed to reduce heat gain of the home.
Watch for Ordinance and Law
It’s true that “green upgrade” insurance for homes and similar products for commercial buildings may pay to replace your damaged building and contents with eco-friendly alternatives, but most green upgrade products are optional. They are typically more expensive; thus, many will choose to forgo the coverage.
If you choose to skip them, keep in mind that many communities are adopting strict environmental building codes requiring homes or buildings to be repaired or replaced with more expensive eco-friendly materials. For this reason, pay close attention to your policy’s ordinance and law coverage. One of the important functions of this insurance is to help cover the increased cost of construction incurred due to a governmental rule. For example, your homeowners insurance policy will pay to replace HVAC equipment damaged in a house fire. If an applicable building ordinance or law requires the HVAC to be repaired with an eco-friendly, more costly alternative, you may have to rely on ordinance and law coverage to pay the difference. If that coverage is insufficient or not present on the policy, you will have to absorb the costs of the mandatory upgrade.
Building ordinances and laws differ depending on where you live; some communities are much stricter than others. It’s important to make sure that ordinance and law coverage is included in your policy and that it will respond to ecological requirements.Some Questions to Consider
Is going green with your insurance a smart move? There are several considerations. For example, how substantial are the discounts available for eco-friendly property you may already own? Is the increased premium for upgraded insurance products worth the cost, or would it be a better value to stick with traditional insurance and pay the cost of upgrades yourself? Does your policy include ordinance and law coverage? What ordinances or laws are in effect in your community that could result in a higher cost of repair and replacement?Where should you start?
Schedule a “Green Insurance Review” with your Trusted Choice® insurance professional today. We’ll walk you through possible discounts, upgrades and features of your existing insurance that will help you decide which insurance is best for you.
|
[Japan Study Group of Manometry of Digestive Tract in Childhood].
The Japan Study Group of Manometry of the Digestive Tract in Childhood was organized in 1975. The 14th meeting was held in February 1984. During the meeting, the technique of anorectal manometry was established and the criteria of positive recto-anal reflex was defined. The mechanism of recto-anal reflex has been studied, but the details of it remain obscure. The relationship between postoperative fecal continence and the findings of anorectal manometry of patients with anorectal disorders are currently being investigated. It is in dispute whether the recto-anal reflex is present or absent in patients with pseudo-Hirschsprung's disease. Study of esophageal manometry in children was added to the work of the group in 1978, and gastroesophageal reflux has been studied using manometry and/or pH measurement.
|
Background
==========
Job satisfaction is defined as \"the favorableness or unfavorableness with which employees view their work\" \[[@B1]\]. Determinants of these views include the work environment and the personality of workers. In operationalizing the work environment, it is most often split into multiple factors (or domains) such as supervisors, pay, and promotion opportunities. In this investigation, we use a large sample of data from caregivers (i.e., nurse aides (NAs); Licensed Practical Nurses (LPNs); Registered Nurses (RNs)) working in nursing homes to examine: (1) their job satisfaction scores on 13 questions; and, (2) what characteristics of these caregivers are associated with job satisfaction domains.
Significance of job satisfaction
--------------------------------
Job satisfaction is clearly important for nursing home staff. Previous studies have shown a consistent association between job satisfaction and turnover and intent to turnover \[e.g., \[[@B2],[@B3]\]\]. Given the chronic and large degree of staff turnover that currently exists in nursing homes understanding job satisfaction is important \[[@B4]\].
Not all dissatisfied employees leave the organization, even if they report they intend to leave. Dissatisfied employees often exhibit an unreliable work ethic, including taking unscheduled days off and tardiness. Moreover, dissatisfied employees may also show more aggression towards other workers \[[@B5]\] or residents \[[@B3]\].
Job satisfaction is also probably associated with quality of resident care \[[@B6],[@B7]\]. Although not examining a long-term care setting, one study found a positive association between patient mortality and poor staff satisfaction \[[@B8]\]. Customer rated quality of care has a positive association with staff satisfaction \[[@B9],[@B10]\]. Resident satisfaction is also associated with staff satisfaction \[[@B11]\]. Some recent work would also suggest that job satisfaction may be related to an organizations ability to change \[[@B12]\]. Since a consistent theme in the literature for the past 20 years (or more) has been the level of poor quality provided by some nursing homes \[e.g., \[[@B13],[@B14]\]\] and their inability to change in a meaningful way, in this context improving staff satisfaction may be important in improving some aspects of quality.
Applicant attraction theories, which seek to explain how workers come to work in specific settings, would also suggest that factors promoting job satisfaction can be significant for attracting new employees to the organization \[[@B15]\]. As the U.S. population ages we will need more caregivers, yet an inadequate number of new caregivers are entering the healthcare workforce \[[@B16]\]. The General Accounting Office \[[@B4]\] gave one reason for this shortage as \"decreased job satisfaction.\" This shortage of workers is clearly significant for the nursing home industry, and needs to be addressed if the industry is to attract adequate staff in the future to meet the expected demand.
Prior research
--------------
Much of our understanding of job satisfaction comes from the business literature, and those studies set in health care facilities have predominantly examined RNs \[e.g., \[[@B17],[@B18]\]\]. The determinants of job satisfaction may be very different for caregivers working in nursing homes. Despite the importance of job satisfaction, studies examining the determinants of job satisfaction in nursing homes are sparse. These studies and the factors of job satisfaction they examined are shown in Table [1](#T1){ref-type="table"}. Parsons and associates \[[@B3]\], for example, found four factors associated with NA job satisfaction were: personal opportunity, supervision, benefits, and coworker support \[[@B3]\]. Chou et al. \[[@B19]\] found caregiver satisfaction to be related to workload, team spirit, and professional support. In another study of NAs, job satisfaction was associated with job security, potential for job growth, socialization, and challenging work \[[@B20]\]. Thus, few similarities in results are evident. It is also clear from Table [1](#T1){ref-type="table"} that more than half of these prior studies have examined caregivers\' job satisfaction using simple descriptive statistics.
Methods
=======
Overview
--------
The study is based on an analysis of data from two not-for-profit nursing homes located in Pittsburgh Pennsylvania. During the study assessment data were collected from all nursing home staff. The Job Description Index \[[@B10],[@B21]\] was used to collect job satisfaction information, and additional questions were used to collect demographic information. The first wave of assessments of staff occurred concurrently at each of the two facilities during a two-week period in June of 2002.
We surveyed those caregivers who had regular contact with residents during the course of their work over the prior 2 weeks. This information was given to the research team from payroll records. A survey with 28 questions (including demographic questions and 14 job satisfaction questions) was placed in the mail-box of each caregiver. We asked that completed surveys be returned to a locked project mail-box that was placed in each facility. This same survey methodology was then repeated a further four times at six month intervals, giving a total of five waves of data.
This survey methodology was used because it was more cost-effective than using in-person interviews. This approach is also the most common methodology used for the collection of job satisfaction data. Each caregiver was compensated \$10 for their time to complete each survey. A letter was also included along with the survey describing our study, stating that completion of the survey was voluntary, and indicating that individual responses would not be shared with the nursing home management. Temporary and pool workers were excluded from the study.
Job satisfaction scale
----------------------
Several job satisfaction instruments exist \[[@B22]\]. These include the Job Description Index \[[@B21],[@B23]\], revised Index of Work Satisfaction \[[@B24]\], and the Measure of Job Satisfaction \[[@B7]\]. The second column of Table [1](#T1){ref-type="table"} lists job satisfaction instruments used in previous studies in long-term care settings.
In this investigation, we used the Job Description Index. This instrument was used because in the organizational science literature it is generally regarded as the most frequently used job satisfaction instrument \[[@B25]\]. This does not necessarily mean the Job Description Index is appropriate for use in the nursing home setting. Using an instrument designed for use in long-term care settings \[e.g., \[[@B7],[@B19]\]\] would be a further refinement to our study. However, at the time we began our study (i.e., 2002) no such instrument was available.
The Job Description Index was also advantageous as it consists of relatively few questions, yet addresses a wide variety of domains (five), and uses a 7-point scale. The response items on this 7-point scale varied from: strongly disagree to strongly agree. For this analysis the response items were coded as follows: 1 (strongly disagree), 2 (somewhat disagee), 3 (disagree), 4 (neither agree nor disagree), 5 (somewhat agree), 6 (agree) and 7 (strongly agree). Negative valence items were not reverse coded, rather they were allowed to load negatively in the exploratory factor analysis (EFA).
We considered use of five job satisfaction domains to be important since we know little regarding nursing home staff and job satisfaction. With five domains we will likely increase our understanding of antecedents of job satisfaction. Flood and Scott \[[@B26]\] have shown that a narrow focus on single measures are misleading, and may lead to erroneous, or incomplete, conclusions. By including five such measures our approach might better capture the overall picture of job satisfaction of caregivers (although, as we note below ultimately only three domains were included in the multivariate analyses).
We were interested in using an instrument with multiple response categories, so that we could examine the relative degree of satisfaction and dissatisfaction of staff. Examining the degree of satisfaction and dissatisfaction is not possible with commonly used dichotomous scales (e.g., those asking yes or no questions). Dichotomous scales can determine satisfaction and dissatisfaction, but not how satisfied or dissatisfied respondents are.
The five job satisfaction domains included in the Job Description Index are satisfaction with: work, compensation, promotion opportunities, superiors, and co-workers. The original instrument had 14 items; one item (\"My work is challenging\") was dropped from this analysis (described below). The remaining 13 individual questions contained in each domain of the Job Description Index are shown in Table [3](#T3){ref-type="table"}.
In addition, the Job Description Index was previously shown to have several desirable psychometric properties, including test-retest reliability above 75 percent, internal consistency of .81, convergent validity of .70, and stability across occupational groups \[[@B25]\]. This index was also recently successfully used in nursing homes \[[@B27]\].
Independent variables
---------------------
We examine the association of age, gender, race, marital status, tenure, and part time employment with job satisfaction. Staff in nursing homes were shown to have different retention needs according to their tenure. \[[@B15]\] Based on this finding we included tenure in our model. Following a prior study we used three categories of tenure, including working in the facility less than 1 year, between 1 and 5 years, and more than 5 years \[[@B15]\]. Full-time employment was associated with job overload in a previous study \[[@B28]\] and intent to leave \[[@B29]\]. We define part-time employment as working less than 35 hours per week. Finally, caregiver\'s perceptions of the quality of care was include based on the findings of a recent prior study \[[@B30]\], and was measured with a question asking whether the caregivers would recommend the nursing home for a relative or friend.
Analytic approach
-----------------
We examined the correlations between the variables (not reported). The correlations between the independent variables were small, and based on a threshold of .8 showed no problems of collinearity \[[@B31]\]. Also, values for regression tolerance statistics (not reported) showed no problems of multicollinearity.
Ceiling and basement effects were assessed for each item in the Job Description Index. This followed the work of McHorney, Ware, Lu, and Sherbourne \[[@B32]\] whereby we calculated the percent of responses with the lowest (floor) and highest (ceiling) scores. Since the Job Description Index has not been extensively used in the nursing home setting, we conducted exploratory factor analysis (EFA) to explore the extent to which the items in each domain appeared to represent the same underlying construct. Principal factors with varimax rotation was used and a factor loading criterion of .30 and uniqueness of \< .90 were used to retain items.
The three factor scores were used as dependent variables in multivariate regression models. Factor scores, calculated by multiplying the item score by its factor loading, were used rather than simply summing the items for two reasons. First, the factor loadings implicitly reverse-code negative valence items. Thus, even though the work factor contains both positive and negative valance items, higher factor scores can be interpreted as indicating higher satisfaction. Since all items on the management factor were negative, this factor has a negative interpretation. Second, the resulting factor scores are uncorrelated with one another and thus represent distinct dimensions of job satisfaction. Factor scores are centered on zero and measured in standard deviation units.
Finally, we tested the assumption that the Likert-type questions produced interval rather than ordinal level measures of satisfaction by re-analyzing the data using the polychoric correlation matrix. This produced the same pattern of factor loadings as reported.
Individual caregivers were surveyed at six month intervals up to five times over a period of two and a half years. The advantage of this approach is that the data are likely representative of a longer period of time, rather than just a single point in time. Nevertheless, biases can occur in data consisting of repeat observations due to the potential correlation among the repeat observations. We therefore used generalized estimating equations (GEE) to avoid treating data from the same respondents as independent observations. All analyses were conducted with Stata Version 8.
Results
=======
Participation rates were similar at both facilities. About 75% of eligible staff completed surveys at each wave. There were a total of 717 surveys returned from a possible total of 953, however only 573 had complete data for all items, representing 251 unique individuals (average of 2.3 surveys per person). A descriptive profile of the caregivers with completed surveys for each wave of data collection at the two facilities is shown in Table [2](#T2){ref-type="table"}.
The means and standard deviations for each of the questions in the Job Description Index are shown in Table [3](#T3){ref-type="table"} along with the results of the EFA. The overall mean ratings for each question ranged from 2.80 (\"Salary and wage increases are given to those who do a good job\") to 5.39 (\"After a day\'s work, I really feel like I have accomplished something\"). It should be noted that no ceiling or basement effects were identified for any item \[[@B33]\], and most mean scores were centered around the middle of the response scale. These results provide information to address our first question of what job satisfaction items are ranked highest by nursing home staff. That is, at least from the items we used, a relative picture of staff opinions of these items is shown. The third column of Table [3](#T3){ref-type="table"} has the overall rank of each item. In the EFA no reverse coding was used, however, to ease interpretation of the rankings we reverse coded the negatively worded items.
In the EFA, one item (\"My work is challenging\") did not load on any of the factors higher than .30 and was dropped from the subsequent analyses of factors associated with job satisfaction domains. Two items from the original promotion scale (\"dead end job\" and \"chances for getting ahead\") joined items from the co-workers scale to form a general \'work\' satisfaction domain. These items use general terms that refer to broad aspects of the workplace and do not address career steps or promotion *per se*. The remaining promotion item joined the original management scale to form a negative valence management domain. This item was the only one to use the word \'promotion\', which connotes interaction with management. The three factors were based on the scree test with factor 1 (pay) having an eigenvalue of 2.83, factor 2 (management) an eigenvalue of 1.81, factor 3 (work) an eigenvalue of 1.75, and a sharp drop off in eigenvalue to 0.345 for a possible fourth factor. These changes in domains from the original Job Description Index instrument likely represent our use of the instrument in the nursing home setting.
Regression coefficients from the GEE models examining job satisfaction are presented in Table [4](#T4){ref-type="table"}. This information was used to examine our second question of what characteristics of caregivers are associated with job satisfaction. We found that males were less satisfied with work than females. Older workers were slightly more satisfied with pay (p \< .001) but married caregivers were less satisfied with both pay (p = .020) and work (p = .040). NAs were less satisfied with pay than nurses (p = .090), however they were relatively more satisfied with the work (p \< .001). Fulltime caregivers were less satisfied with pay than part-time workers (p \< .001), but more satisfied with the work (p = .010). Caregivers who have been on the job for 1 to 5 years were generally less satisfied than those who have been there for either less than one year or more than 5 years. Finally, caregiver\'s perceptions of the quality of care (measured with the question that caregivers would recommend the nursing home for a relative or friend) was associated with all three job satisfaction domains (i.e., pay (p \< .001), management (p \< .001), and work (p \< .001)).
Discussion
==========
Job satisfaction has important implications for nursing home staff, the nursing home industry, and quality of care. Nursing homes already employ more workers than steel producers and auto makers combined \[[@B12]\], yet we know little about factors associated with job satisfaction and dissatisfaction for these workers. In this research we find that, overall, caregivers are satisfied with the work and coworkers, but are less satisfied with promotional opportunities, superiors, and compensation (shown in Table [3](#T3){ref-type="table"}).
Although not examining all of the same areas of job satisfaction, our results for many individual job satisfaction questions (see Table [3](#T3){ref-type="table"}) are somewhat similar to those recently reported by Parsons and associates \[[@B3]\] and Will \[[@B33]\]. These authors also found most satisfaction with work and least satisfaction with pay. Studies with RNs and LPNs in nursing homes have also found dissatisfaction with pay \[[@B29]\]. It is not surprising that pay should be of concern. It is widely acknowledged that nursing home staff are underpaid relative to other areas of health care \[[@B34]\]. Moreover, NAs are often the working poor, many consisting of women, single-family, and/or minorities \[[@B35]\]. Yet, it is surprising that NAs seem to enjoy their work even more than nurses do. Given the often-reported poor quality of care in nursing homes, and difficult work undertaken by caregivers \[[@B36]\], one would assume that staff would have poor job satisfaction. Clearly, this is not the case. NAs would appear to enjoy working with residents and their coworkers. Other job satisfaction studies have highlighted the enjoyment staff receive from relationships with residents \[[@B3]\]. Others have also noted that work attitudes of stayers and leavers differ, with stayers valuing relationships with residents \[[@B35]\].
We speculate that if staff have higher job satisfaction ratings from forming relationships with residents, then facility management could promote such relationships. This could include permanent assignment to residents and teams (often called care pairs), but also more social activities. This may also benefit residents, for as Eaton \[[@B12]\] describes a \"typical resident spends at least ninety-one of 112 waking hours a week doing nothing whatsoever.\" However, given the often chronic understaffing found in many nursing homes, encouraging caregivers to become involved in more social activities with residents will likely be difficult. It may also be difficult to make the case that this type of work is productive \[[@B12]\].
Also, it may be instructive to examine satisfaction with work over time. On the one hand, as more residents in nursing homes are admitted with terminal illness or severe dementia, then the time for staff to build relationships with residents and the ability of residents to form such relationships will likely decrease. If this influences work satisfaction, we may see even fewer staff willing to work in nursing homes. To the extent that the work in nursing homes was described as \"emotional labour\" \[[@B37]\], this may increase when residents are unresponsive. On the other hand, family members will likely remain to build relationships with caregivers.
Using the three job satisfaction domains (i.e., pay, management, and work), one robust finding is that we see workers with a tenure of more than one year are less likely to be satisfied with the pay. Katz \[[@B38]\] developed a model of employee turnover whereby he identified that workers perceptions of the work environment varied according to their tenure. He used three stages of perceptions of the work environment, socialization, innovation, and adaptation. In this study, we clearly see that satisfaction with pay declines after one year of employment.
The results from the three job satisfaction domains (see Table [4](#T4){ref-type="table"}), also show that staff who perceived the quality of care to be high (agree with the statement that they would recommend the nursing home for a relative or friend) have higher job satisfaction than those who do not. Poor levels of satisfaction are linked to high rates of turnover \[[@B2],[@B3]\]. The typical managerial response to high endemic rates of turnover among caregivers is to modify the conditions of employment (e.g., pay, promotion, communication). However, if satisfaction can be modified as a result of efforts to improve the quality of care, those efforts may also have the beneficial \'win-win\' effect of reducing turnover.
This finding for quality is important. We could not find any other studies in the literature that have examined this relationship. This finding, if it holds up in further research, suggests that quality improvement projects may have an impact on caregiver morale. However, the opposite may also be true: unhappy staff may provide poor quality of care, thus placing residents at risk and also increasing the likelihood of turnover.
One further observation from our results using the three job satisfaction domains is that there is variability in the association between some caregiver characteristics and job satisfaction domains. For example, fulltime workers are less satisfied with pay but more satisfied with work than part time workers. Also, NAs are more satisfied with work, however they are less satisfied with pay than are nurses (although this finding did not reach statistical significance at conventional levels). By contrast, the association with tenure and perceived quality are consistent across domains. Researchers and others who focus on staff satisfaction need to be alert to important differences between subgroups of workers.
Clearly, we need to be careful in interpreting our findings. Although our sample size of caregivers was relatively large, this information only came from two facilities. This limits somewhat the generalizability of our findings.
Conclusion
==========
In summary, we find that overall nursing home caregivers are satisfied with the work and coworkers, but are less satisfied with promotional opportunities, superiors, and compensation. NAs appear particularly sensitive to pay, whereas other staff appear more sensitive to work. Of significance, we also find that caregivers who perceived the quality of care to be high have higher job satisfaction than those who do not.
Competing interests
===================
All authors were part of a team of researchers under a grant from AHRQ. This manuscript reflects the opinions of the authors and not necessarily those of the funding agency.
Authors\' contributions
=======================
Nicholas G. Castle, wrote the manuscript and participated in the analyses.
Howard Degenholtz, was responsible for conducting most of the analyses. He also provided text for the methods section.
Jules Rosen, edited the manuscript.
Pre-publication history
=======================
The pre-publication history for this paper can be accessed here:
<http://www.biomedcentral.com/1472-6963/6/60/prepub>
Acknowledgements
================
This work was supported in part by funding from AHRQ RO1HS11976, Jules Rosen M.D. PI.
Figures and Tables
==================
######
Studies of job satisfaction in long-term care settings
**Author(s)** **Job Satisfaction Instrument** **Number of Items** **Number of Response options (Anchors used)** **Job Satisfaction Domains** **Sample Size and Setting** **Analyses Used** **Significant Findings**
---------------------------------------------- ---------------------------------------------------- --------------------- --------------------------------------------------- ---------------------------------- --------------------------------------------------------------------------------------- -------------------------------------- ---------------------------------------------------------------------------------------------------------------------------
Parsons and associates (2003) \[3\] Modified from Herzberg (1966) 35 5 (strongly disagree -- strongly agree) Personal opportunity Supervision 550 NAs in 70 facilities in Louisiana Ordinary Least Squares Regression Most dissatisfied with pay, benefits, and recognition
Benefits
Coworker support
Social rewards
Task rewards
Moyle and associates (2003) \[39\] N/A N/A N/A Workplace flexibility 27 RNs and NAs in one facility in Australia Content analysis of focus group data Satisfaction was linked to workplace flexibility, residents, team environment, and better resident care
Team environment
Optimal resident care
Chou, Boldy, & Lee (2002a, b) \[7, 19\] Measure of Job Satisfaction (MJS) 22 5 (very dissatisfied -- very satisfied) Professional support Seventy facilities with 610 nursing home staff and 373 hostel care staff in Australia Structural Equation Modeling Job satisfaction is associated with professional support
Personal satisfaction Workload
Training
Team spirit/co-workers
Will and Simmons (1999) \[33\] Job Descriptive Index (JDI) NG NG Work on present job 423 NAs in 29 nursing homes in Ohio Means Satisfied most with work and least with pay
Pay
Opportunities for promotion
Supervision
Co-workers
Job in general
Atchison (1998) \[20\] Job Diagnostic Survey 14 5 (extremely dissatisfied -- extremely satisfied) Satisfaction 283 NAs in 24 nursing homes Chi square Job satisfaction lowest for security, growth/development, socialization, and challenges
Job security
Coworkers
Sense of accomplishment
Helping other people
Dissatisfaction
Pay/benefits
Potential for job growth
Management
Autonomy
Kiyak, Namazi, & Kahana (1997) \[27\] Job Descriptive Index (JDI) NG NG Work on present job 308 nursing home and community agency staff Ordinary Least Squares Regression Higher dissatisfaction associated with turnover
Pay
Opportunities for promotion
Supervision
Co-workers
Job in general
Gillies, Foreman, & Pettengill (1996) \[22\] Index of Work Satisfaction (IWS) 44 7 (not given) Autonomy 44 nurse directors and nurse educators working in long-term care facilities Repeated Measures ANOVA Job satisfaction highest for interactions, autonomy, and professional status
Interaction
Agency policies
Pay
Professional status
Task requirement
Grieshaber, Parker, & Deering (1995) \[1\] Work environment Two nursing homes
Job content
Irvine & Evans (1995)+ \[40\] N/A N/A N/A Routinization Meta-analyses with combined sample size of 5,352 Meta-analyses Work content and work environment are more strongly associated with job satisfaction than economic variables
Autonomy
Feedback
Role conflict
Role ambiguity
Work overload
Coward and associates (1995) \[29\] Modified Stamps and Piedmonte (1986) scale \[IWS\] 18 5 (strongly disagree -- strongly agree) Professional status 281 RNs and LPNs from 26 nursing homes Multivariate regression analysis Five factors associated with job satisfaction (race, income, supervisor, initial intent to stay, current intent to leave)
Task requirement
Autonomy
Interactions with other nurses
Pay
Monahan & Carthy (1992) \[41\] N/A N/A N/A Attachment 75 NAs at 7 nursing homes Content analysis Attachment most related to retention of NAs
Gratification
Demands
Monetary needs
Decision-making
Grau and associates (1991) \[42\] Combined several scales 44 5 different scales Job process 219 NAs in one nursing home Hierarchical regression analysis Social atmosphere and job benefits associated with institutional loyalty
Attitudes toward administration
Social atmosphere
Job benefits
Job tasks
Anderson, Aird, & Haslam (1991) \[43\] NG 12 5 (strongly disagree -- strongly agree) None 212 nursing staff in 6 nursing homes Means Nursing staff have high levels of satisfaction, but is associated with absenteeism
Humphris & Turner (1989) \[44\] Porter (1962) scale 13 6 (extremely satisfied -- extremely unsatisfied) Working conditions 84 nurses at a unit for the elderly severely mentally infirm Chi square Low satisfaction was associated with turnover from unit
Emotional climate
General
Mullins and associates (1988) \[45\] Job Satisfaction Survey (JSS) 36 NG Pay Heads of departments (n = 439) from 46 nursing homes Regression analyses Most satisfied when individual efforts are rewarded
Promotion
Supervision
Benefits
Rewards/appreciation
Working conditions
Coworkers
Nature of job
Communication
Deckard, Hicks & Rountree (1986) \[46\] Job Diagnostic Survey (JDS) NG NG Skill variety 340 nurses from a nursing home chain Means Job satisfaction was similar to norms in other occupations
Task identity
Task significance
Autonomy
Job feedback
Waxman and associates (1984) \[47\] Minnesota Satisfaction Scale 20 5 (very dissatisfied -- very satisfied) Job Satisfaction Scale 234 NAs in 7 facilities, uses 20 questions for overall job satisfaction score Kendal\'s Rank Order Correlation Positive association between job satisfaction and turnover
Bergman et al. (1984) \[2\] None 19 4 (none -- very much) Job 12 long-term care facilities and 432 RNs, LPNs, and NAs ANOVA Descriptive results provided
Knowledge, skill, and attitudes
Autonomy
Stress
NA = Nurse Aide; RN = Registered Nurse; LPN = Licensed Practical Nurse
\+ = This study is a meta-analysis, and does not include only long-term care studies
NG = Not given; N/A = Not applicable
######
Staff characteristic descriptive statistics
------------------------------ --------------- --------------- --------------- --------------- --------------- --------------------
Wave 1 Wave 2 Wave 3 Wave 4 Wave 5 Unique Individuals
(n = 124) (n = 106) (n = 115) (n = 113) (n = 115) n = 251
Age (mean; \[sd\]) 41.6 \[10.7\] 40.9 \[11.2\] 42.2 \[11.3\] 41.5 \[10.9\] 40.6 \[11.9\] 38.8 \[11.8\]
Gender (% Male) 8.1 5.7 8.7 7.1 7.0 10.4
Race (% African American) 39.5 41.5 44.4 44.3 47.0 47.0
Marital status (% Married) 38.7 41.5 44.4 43.4 40 37.1
Job category (% Nurse Aides) 59.7 64.2 60.0 59.3 61.7 61.4
Fulltime (%) 85.5 84.0 82.6 71.7 68.7 75.7
Tenure:
Less then 1 year 33.1 34.0 26.1 31.0 36.5 52.2
1 to 5 years 29.8 37.7 43.5 42.5 37.4 24.3
Over 5 years 37.1 28.3 30.4 26.6 26.1 23.5
Perceived High Quality 54.0 43.4 57.4 52.2 60.0 55.8
------------------------------ --------------- --------------- --------------- --------------- --------------- --------------------
######
Item means and factor loadings for job satisfaction
**Factor Loadings**
---------------------------------------------------------------------------------- ------------- ---- --------------------- ------ -------
Positively Worded Items:
After a day\'s work, I really feel like I have accomplished something (w) 5.39 (1.58) 1 0.54
Working for this Facility is like being part of a family (w) 4.13 (1.96) 6 0.58
I am paid fairly for the work I do (c) 3.31 (2.01) 11 0.70
Salary and wage increases are given to those who do a good job (c) 2.80 (1.91) 13 0.52
My pay is better than that for similar jobs in other nursing homes (c) 3.15 (1.83) 12 0.63
My chances for getting ahead in this facility are good (p) 3.85 (1.90) 7 0.44
The people I work with are stimulating (cw) 4.25 (1.63) 5 0.48
Negatively Worded Items:
I just hate to get up in the morning to go to work (w) 3.49 (1.90) 3 -0.31
I am in a \"dead end\" job (p) 3.60 (1.98) 4 -0.40
My opportunities for getting promoted in this facility are somewhat limited (p) 4.50 (1.87) 9 0.33
The people I work with are unpleasant (cw) 3.30 (1.90) 2 -0.39
Management is quick to criticize poor performance (m) 4.63 (2.01) 10 0.65
Management is hard to please (m) 4.35 (1.89) 8 0.67
[Note:]{.ul} Principal components with varimax rotation. Original domains: w = work; c = compensation; p = promotion; cw = co-workers; m = management. Eigenvalues for Pay = 2.83, Management = 1.81, and Work = 1.75; Cronbach\'s Alpha for comparable unit-weighted scales: Pay = .60; Management = .71; Work = .70; JDI = Job Descriptive Index; n = 574; ^\^^= Response items were coded 1 (strongly disagree), 2 (somewhat disagee), 3 (disagree), 4 (neither agree nor disagree), 5 (somewhat agree), 6 (agree) and 7 (strongly agree); ^+^No reverse coding was used for the EFA, however, the rank was computed by reverse coding negatively worded items and listing from highest score (listed as number 1) to lowest score (listed as number 13).
######
Staff characteristics associated with job satisfaction
**Pay (+)** **Management (-)** **Work (+)**
------------------------------- ------------- -------------------- -------------- -------- --------- --------- --------- --------- ---------
**Age** 0.010 \<0.001 \<0.001 -0.010 \<0.001 0.060 \<0.001 \<0.001 0.360
**Gender (Male)** -0.030 0.120 0.830 -0.040 0.120 0.720 -0.250 0.110 0.030
**Race (African American)** 0.070 0.060 0.300 0.010 0.070 0.840 0.190 0.060 \<0.001
**Marital status (Married)** -0.160 0.070 0.020 0.010 0.070 0.840 -0.140 0.060 0.040
**Job category (Nurse Aide)** -0.110 0.070 0.090 0.030 0.070 0.710 0.250 0.060 \<0.001
**Employment (Full-time)** -0.270 0.080 \<0.001 0.040 0.080 0.580 0.190 0.070 0.010
**Tenure**^**a**^
**1 to 5 years** -0.320 0.080 \<0.001 0.200 0.080 0.010 -0.140 0.070 0.050
**\> 5 years** -0.240 0.090 \<0.001 0.290 0.090 \<0.001 -0.120 0.080 0.150
**Perceived High Quality** 0.420 0.060 \<0.001 -0.210 0.070 \<0.001 0.590 0.060 \<0.001
[Note:]{.ul} n = 574; Reference categories are: female, white, not married, nurse (Registered Nurse or Licensed Practical Nurse), part-time, less than 1 year, and perceived low quality.
|
Kenya Open Data
The Kenya Open Data web site makes public government data accessible to the people of Kenya. High quality national census data, government expenditure, parliamentary proceedings and public service locations are just some of what is already online. There's something for everyone: maps to start exploring, interactive charts and tables for a deeper understanding, and raw data for technical users to build their own apps and analyses. They view this information ass a national asset, and that it needs to be shared: this data is key to improving transparency; unlocking social and economic value; and building Government 2.0 in Kenya.
|
'use strict';
exports.__esModule = true;
var _classCallCheck2 = require('babel-runtime/helpers/classCallCheck');
var _classCallCheck3 = _interopRequireDefault(_classCallCheck2);
var _possibleConstructorReturn2 = require('babel-runtime/helpers/possibleConstructorReturn');
var _possibleConstructorReturn3 = _interopRequireDefault(_possibleConstructorReturn2);
var _inherits2 = require('babel-runtime/helpers/inherits');
var _inherits3 = _interopRequireDefault(_inherits2);
var _module = require('./module');
var _module2 = _interopRequireDefault(_module);
var _hammerjs = require('hammerjs');
var _hammerjs2 = _interopRequireDefault(_hammerjs);
function _interopRequireDefault(obj) { return obj && obj.__esModule ? obj : { default: obj }; }
require('../../css/blocks/handle.postcss.css');
var CLASSES = require('../../css/blocks/handle.postcss.css.json');
var Handle = function (_Module) {
(0, _inherits3.default)(Handle, _Module);
function Handle() {
(0, _classCallCheck3.default)(this, Handle);
return (0, _possibleConstructorReturn3.default)(this, _Module.apply(this, arguments));
}
/*
Method to declare _defaults.
@private
@overrides @ Module
*/
Handle.prototype._declareDefaults = function _declareDefaults() {
_Module.prototype._declareDefaults.call(this);
this._defaults.minBound = 0;
this._defaults.maxBound = 1;
this._defaults.isBound = false;
this._defaults.isInversed = false;
this._defaults.direction = 'x';
this._defaults.onSeekStart = null;
this._defaults.onSeekEnd = null;
this._defaults.onProgress = null;
this._defaults.snapPoint = 0;
this._defaults.snapStrength = 0;
};
/*
Method to set handle progress.
@public
@param {Number} Progress [0...1].
@param {Boolean} If should invoke onProgress callback.
@returns this.
*/
Handle.prototype.setProgress = function setProgress(progress) {
var isCallback = arguments.length <= 1 || arguments[1] === undefined ? true : arguments[1];
var shift = this._progressToShift(progress);
this._setShift(shift, isCallback);
// calc delta and save it
this._delta = shift - this._shift;
this._saveDelta();
return this;
};
/*
Method to set bounds of progress.
@public
@param {Number} Min bound to set [0...1].
@param {Number} Max bound to set [0...1].
@returns this.
*/
Handle.prototype.setBounds = function setBounds(min, max) {
this.setMinBound(min);
this.setMaxBound(max);
return this;
};
/*
Method to set min bound of progress.
@public
@param {Number} Min bound to set [0...1].
@returns this.
*/
Handle.prototype.setMinBound = function setMinBound(min) {
this._props.minBound = Math.max(min, 0);
if (this._progress < min) {
this.setProgress(min);
}
return this;
};
/*
Method to set max bound of progress.
@public
@param {Number} Max bound to set [0...1].
@returns this.
*/
Handle.prototype.setMaxBound = function setMaxBound(max) {
this._props.maxBound = Math.min(max, 1);
if (this._progress > max) {
this.setProgress(max);
}
return this;
};
/*
Method to declare properties.
@private
@overrides @ Module.
*/
Handle.prototype._vars = function _vars() {
// `progress` of the handle [0..1]
this._progress = 0;
// `shift` of the handle ( position in `px` )
this._shift = 0;
// `delta` deviation from the current `shift`
this._delta = 0;
};
/*
Method to set handle shift.
@private
@param {Number} Shift in `px`.
@param {Boolean} If should invoke onProgress callback.
@returns {Number}.
*/
Handle.prototype._setShift = function _setShift(shift) {
var isCallback = arguments.length <= 1 || arguments[1] === undefined ? true : arguments[1];
var p = this._props,
minBound = p.minBound * this._maxWidth,
maxBound = p.maxBound * this._maxWidth;
shift = mojs.h.clamp(shift, minBound, maxBound);
this._applyShift(shift);
if (isCallback) {
this._onProgress(shift);
} else {
this._progress = this._shiftToProgress(shift);
}
return shift;
};
/*
Method to apply shift to the DOMElement.
@private
@param {Number} Shift in pixels.
*/
Handle.prototype._applyShift = function _applyShift(shift) {
var p = this._props;
// translateZ(0)
this.el.style.transform = p.direction === 'x' ? 'translateX( ' + shift + 'px )' : 'translateY( ' + -shift + 'px )';
};
/*
Method to get max width of the parent.
@private
*/
Handle.prototype._getMaxWidth = function _getMaxWidth() {
var p = this._props,
parent = p.parent;
this._maxWidth = p.direction === 'x' ? parent.clientWidth : parent.clientHeight;
};
/*
Method to render the component.
@private
@overrides @ Module
*/
Handle.prototype._render = function _render() {
_Module.prototype._render.call(this);
this._addElements();
this._getMaxWidth();
this._hammerTime();
};
/*
Method to classes on `this.el`.
@private
@overrides @ Module
*/
Handle.prototype._addMainClasses = function _addMainClasses() {
_Module.prototype._addMainClasses.call(this);
var p = this._props,
classList = this.el.classList;
classList.add(CLASSES.handle);
if (p.isBound) {
classList.add(CLASSES['is-bound']);
}
if (p.isInversed) {
classList.add(CLASSES['is-inversed']);
}
};
/*
Method to add DOM elements on render.
@private
*/
Handle.prototype._addElements = function _addElements() {
var inner = this._createElement('div'),
shadow = this._createElement('div');
inner.classList.add('' + CLASSES.handle__inner);
shadow.classList.add('' + CLASSES.handle__shadow);
this.el.appendChild(shadow);
this.el.appendChild(inner);
};
/*
Method to initialize HammerJS an set up all even listeners.
@private
*/
Handle.prototype._hammerTime = function _hammerTime() {
var p = this._props,
direction = p.direction === 'x' ? 'HORIZONTAL' : 'VERTICAL',
hm = new _hammerjs2.default.Manager(this.el, {
recognizers: [[_hammerjs2.default.Pan, { direction: _hammerjs2.default['DIRECTION_' + direction] }]]
});
hm.on('pan', this._pan.bind(this));
hm.on('panend', this._panEnd.bind(this));
this._addPointerDownEvent(this.el, this._pointerDown.bind(this));
this._addPointerUpEvent(this.el, this._pointerUp.bind(this));
// add listener on document to cover edge cases
// like when you press -> leave the element -> release
this._addPointerUpEvent(document, this._pointerUpDoc.bind(this));
window.addEventListener('resize', this._onWindowResize.bind(this));
};
/*
Callback for pan end on main el.
@private
@param {Object} Original event object.
*/
Handle.prototype._pan = function _pan(e) {
var p = this._props;
this._delta = p.direction === 'x' ? e.deltaX : -e.deltaY;
// get progress from the shift to undestand how far is the snapPoint
var shift = this._shift + this._delta,
proc = this._shiftToProgress(shift);
// if progress is around snapPoint set it to the snap point
proc = Math.abs(proc - p.snapPoint) < p.snapStrength ? p.snapPoint : proc;
// recalculate the progress to shift and set it
this._setShift(this._progressToShift(proc));
};
/*
Callback for pan end on main el.
@private
@param {Object} Original event object.
*/
Handle.prototype._panEnd = function _panEnd(e) {
this._saveDelta();
this._callIfFunction(this._props.onSeekEnd, e);
};
/*
Callback for pointer down on main el.
@private
@param {Object} Original event object.
*/
Handle.prototype._pointerDown = function _pointerDown(e) {
var p = this._props;
this._isPointerDown = true;
this._callIfFunction(p.onSeekStart, e);
};
/*
Callback for pointer up on main el.
@private
@param {Object} Original event object.
*/
Handle.prototype._pointerUp = function _pointerUp(e) {
this._callIfFunction(this._props.onSeekEnd, e);
e.preventDefault();
return false;
};
/*
Callback for pointer up on document.
@private
@param {Object} Original event object.
*/
Handle.prototype._pointerUpDoc = function _pointerUpDoc(e) {
if (!this._isPointerDown) {
return;
}
this._callIfFunction(this._props.onSeekEnd, e);
this._isPointerDown = false;
};
/*
Method to add _delta to _shift.
@private
*/
Handle.prototype._saveDelta = function _saveDelta() {
this._shift += this._delta;
};
/*
Method to call onProgress callback.
@private
@param {Number} Shift in `px`.
*/
Handle.prototype._onProgress = function _onProgress(shift) {
var p = this._props,
progress = this._shiftToProgress(shift);
if (this._progress !== progress) {
this._progress = progress;
if (this._isFunction(p.onProgress)) {
p.onProgress.call(this, progress);
}
}
};
/*
Method to recalc shift to progress.
@private
@param {Number} Shift in `px`.
@returns {Number} Progress [0...1].
*/
Handle.prototype._shiftToProgress = function _shiftToProgress(shift) {
return shift / this._maxWidth;
};
/*
Method to progress shift to shift.
@private
@param {Number} Progress [0...1].
@returns {Number} Shift in `px`.
*/
Handle.prototype._progressToShift = function _progressToShift(progress) {
return progress * this._maxWidth;
};
/*
Callback for window resize event.
@private
@param {Object} Original event object.
*/
Handle.prototype._onWindowResize = function _onWindowResize(e) {
this._getMaxWidth();
this.setProgress(this._progress);
};
return Handle;
}(_module2.default);
exports.default = Handle;
|
RECOMMENDED FOR FULL-TEXT PUBLICATION
Pursuant to Sixth Circuit Rule 206
ELECTRONIC CITATION: 2002 FED App. 0170P (6th Cir.)
File Name: 02a0170p.06
UNITED STATES COURT OF APPEALS
FOR THE SIXTH CIRCUIT
____________________
BARBARA GRUTTER,
Plaintiff-Appellee,
v. Nos. 01-1447/1516
LEE BOLLINGER, et al.,
Defendants-Appellants (01-1447),
KIMBERLY JAMES, et al.,
Intervening
Defendants-Appellants (01-1516).
/
Appeal from the United States District Court for the Eastern District of Michigan at Detroit.
No. 97-75928—Bernard A. Friedman, District Judge.
Argued: December 6, 2001
Decided and Filed: May 14, 2002
Before: MARTIN, Chief Circuit Judge; BOGGS, SILER, BATCHELDER, DAUGHTREY,
MOORE, COLE, CLAY, and GILMAN, Circuit Judges.
____________________
COUNSEL
ARGUED: John Payton, WILMER, CUTLER & PICKERING, Washington, D.C., Miranda K.S.
Massie, SCHEFF & WASHINGTON, Detroit, Michigan, for Defendants. Kirk O. Kolbo,
MASLON, EDELMAN, BORMAN & BRAND, Minneapolis, Minnesota, for Plaintiff. ON BRIEF:
Nos. 01-1447/1516
Grutter v. Bollinger
Page 2
John Payton, John H. Pickering, Craig Goldblatt, Stuart F. Delery, Robin A. Lenhardt, WILMER,
CUTLER & PICKERING, Washington, D.C., Philip J. Kessler, BUTZEL LONG, Detroit, Michigan,
Leonard M. Niehoff, BUTZEL LONG, Ann Arbor, Michigan, Miranda K.S. Massie, George B.
Washington, Jodi-Marie Masley, SCHEFF & WASHINGTON, Detroit, Michigan, for Defendants.
Kirk O. Kolbo, David F. Herr, R. Lawrence Purdy, Michael C. McCarthy, Kai H. Richter,
MASLON, EDELMAN, BORMAN & BRAND, Minneapolis, Minnesota, Michael E. Rosman,
CENTER FOR INDIVIDUAL RIGHTS, Washington, D.C., for Plaintiff. Rowan D. Wilson, Paul
M. Dodyk, Charles J. Ha, Farah S. Brelvi, Alexandra S. Wald, Kenneth E. Lee, CRAVATH,
SWAINE & MOORE, New York, New York, Martha W. Barnett, AMERICAN BAR
ASSOCIATION, Chicago, Illinois, Kumiki Gibson, WILLIAMS & CONNOLLY, Washington,
D.C., Neal K. Katyal, GEORGETOWN UNIVERSITY LAW CENTER, Washington, D.C., Martin
Michaelson, HOGAN & HARTSON, Washington, D.C., Thomas J. Henderson, LAWYERS’
COMMITTEE FOR CIVIL RIGHTS UNDER LAW, Washington, D.C., John S. Skilton, HELLER,
EHRMAN, WHITE & McAULIFFE, Washington, D.C., Kenneth S. Geller, Eileen Penner, MAYER,
BROWN & PLATT, Washington, D.C., Martha F. Davis, Spenta R. Cama, NOW LEGAL
DEFENSE AND EDUCATION FUND, New York, New York, Susan I. Leffler, OFFICE OF THE
ATTORNEY GENERAL, Lansing, Michigan, Fred G. Pressley, Jr., PORTER, WRIGHT, MORRIS
& ARTHUR, Columbus, Ohio, Jeffrey S. Silver, JENNER & BLOCK, Chicago, Illlinois, Deanne
E. Maynard, Shilpa S. Satoskar, David W. DeBruin, Daniel Mach, JENNER & BLOCK,
Washington, D.C., Yong Lee, CAMERON & HORNBOSTEL, Washington, D.C., Catherine J.
Trafton, Daniel W. Sherrick, ASSOCIATE GENERAL COUNSEL, INTERNATIONAL UNION,
UAW, Detroit, Michigan, John H. Findley, PACIFIC LEGAL FOUNDATION, Sacramento,
California, Keith A. Noreika, Brice M. Clagett, COVINGTON & BURLING, Washington, D.C., C.
Mark Pickrell, Nashville, Tennessee, Michael K. Lee, AMBERG, FIRESTONE & LEE, Southfield,
Michigan, for Amici Curiae.
MARTIN, C. J., delivered the opinion of the court, in which, DAUGHTREY, MOORE,
COLE, and CLAY, JJ., joined. MOORE, J. (pp. 21-27), delivered a separate concurring opinion,
in which DAUGHTREY, COLE, and CLAY, JJ., joined. CLAY, J. (pp. 28-44), delivered a separate
concurring opinion, in which DAUGHTREY, MOORE, and COLE, JJ., joined. BOGGS, J. (pp. 45-
89), delivered a separate dissent, in which SILER, J., joined in part, and BATCHELDER, J., joined.
SILER, J. (p. 90), BATCHELDER, J. (p. 91), and GILMAN, (pp. 92-94), also delivered separate
dissenting opinions.
_________________
OPINION
_________________
BOYCE F. MARTIN, JR., Chief Circuit Judge. Lee Bollinger, Jeffrey Lehman, Dennis
Shields, the Regents of the University of Michigan and the University of Michigan Law School
Nos. 01-1447/1516
Grutter v. Bollinger
Page 3
appeal the district court’s determination that the Law School’s consideration of race and ethnicity
in its admissions decisions violates the Equal Protection Clause of the Fourteenth Amendment and
Title VI of the Civil Rights Act of 1964.1 The Law School contends that its interest in achieving a
diverse student body is compelling under Regents of the University of California v. Bakke, 438 U.S.
265, 98 S.Ct. 2733, 57 L.Ed.2d 750 (1978), and that its admissions policy is narrowly tailored to
serve that interest. On appeal, the Law School is joined by the Intervenors: forty-one individuals and
three student groups, United for Equality and Affirmative Action, the Coalition to Defend
Affirmative Action By Any Means Necessary, and Law Students for Affirmative Action. The
Intervenors offer an additional justification for the Law School’s consideration of race and ethnicity
– remedying past discrimination. Barbara Grutter, an unsuccessful applicant to the Law School, on
behalf of herself and others similarly situated, urges us to affirm the district court’s decision. For
the reasons set forth below, we REVERSE the judgment of the district court.2
I.
The Law School drafted its admissions policy to comply with the Supreme Court’s opinion
in Bakke. Adopted by the full faculty in 1992, the policy states that the Law School’s “goal is to
admit a group of students who individually and collectively are among the most capable students
applying to American law schools in a given year.” It further provides that the Law School “seek[s]
a mix of students with varying backgrounds and experiences who will respect and learn from each
other.” As part of the Law School’s policy of evaluating each applicant individually, its officials read
each application and factor all of the accompanying information into their decision.
In identifying applicants who can be expected to succeed academically, the Law School
evaluates a composite of the applicant’s Law School Admissions Test and undergraduate grade-point
average. This composite can be visualized as a grid with standardized test scores on the horizontal
axis and grade-point average on the vertical axis. Every combination of standardized test score and
undergraduate grade-point average is shown in a cell on this grid. Each cell reports the number of
applicants with that particular combination of numerical qualifications, as well as the number of
offers of admission made to the applicants in that cell. Constructed in this manner, the highest
combination of test scores and undergraduate grade-point averages are found in the grid’s upper
right-hand corner. Thus, an applicant’s chance of being admitted generally increases as he or she
1
Until recently, Lee Bollinger was the president of the University of Michigan. Prior to his
presidency, he was dean of the Law School. His successor as dean was Jeffrey Lehman. Dennis
Shields was the director of the Law School’s admission program until 1998.
2
Our decision only pertains to the case involving the Law School. We will address the
challenge to the University of Michigan’s admissions policy, Gratz v. Bollinger, Nos. 01-1333, 01-
1416, 01-1418, 01-1438, in a forthcoming opinion.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 4
moves into the grid’s upper right-hand corner. There is no combination of grades and test scores,
however, below which an applicant will automatically be denied admission, or above which
admission is guaranteed.
The Law School also considers “soft” variables like the enthusiasm of the recommenders,
the quality of the undergraduate institution, the quality of the applicant’s essay, residency, leadership
and work experience, unique talents or interests, and the areas and difficulty of undergraduate course
selection. After taking these additional “soft” variables into account, the Law School sometimes
admits students with relatively low index scores. Its admissions policy describes two general
varieties of students who may be admitted with such scores – (1) “students for whom [there is] good
reason to be skeptical of an index score based prediction” (e.g., a student with a track record of poor
standardized test performance, but who has an outstanding academic record) and (2) students who
“may help achieve that diversity which has the potential to enrich everyone’s education and thus
make a law school class stronger than the sum of its parts.”
The Law School’s admissions policy explains that “[t]here are many possible bases for
diversity admissions.” For example, the policy states that particular weight might be given to “an
Olympic gold medal, a Ph.D. in physics, the attainment of age 50 in a class that otherwise lacked
anyone over 30, or the experience of having been a Vietnamese boat person.” The policy also offers
three examples of actual diversity admissions. One student was born in Bangladesh, graduated from
Harvard with a 2.67 grade-point average, received “outstanding references” from his professors, had
an “exceptional record of extracurricular activity,” and had Law School Admission Test scores at
the 46th percentile and 52nd percentile. Another was an Argentinian single mother with extensive
business experience, who graduated summa cum laude from the University of Cincinnati, who was
fluent in four languages, and scored at the 52nd percentile on the Law School Admission Test. The
third applicant had a 3.99 grade-point average from the University of Florida, a Law School
Admission Test score at the 90th percentile, and as the daughter of Greek immigrants was “immersed
in a significantly ethnic home life,” and fluent in three languages.
Reflecting the Law School’s goal of enrolling a diverse class, its admissions policy describes
“a commitment to racial and ethnic diversity with special reference to the inclusion of students from
groups which have been historically discriminated against, like African-Americans, Hispanics and
Native Americans, who without this commitment might not be represented in our student body in
meaningful numbers.” Students from such racial and ethnic groups “are particularly likely to have
experiences and perspectives of special importance to our mission.” Professor Richard Lempert, the
chair of the faculty committee that drafted the admissions policy, explained that the Law School’s
commitment to such diversity was not intended as a remedy for past discrimination, but as a means
of including students who may bring a different perspective to the Law School.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 5
In considering race and ethnicity, the Law School does not set aside or reserve seats for
under-represented minority students. As Dean Jeffrey Lehman testified: “We do not have a portion
of the class that is set aside for a critical mass of under-represented minority students.” This
testimony was echoed by Dennis Shields, the Law School’s former admissions director, and Erica
Munzel, the current director of admissions, both of whom testified that the Law School does not
strive to admit a particular percentage of under-represented minority students. The Law School does,
however, consider the number of under-represented minority students, and ultimately seeks to enroll
a meaningful number, or a “critical mass,” of under-represented minority students. According to
Director Munzel, “critical mass” is a number sufficient to enable under-represented minority students
to contribute to classroom dialogue without feeling isolated. Similarly, Dean Lehman equated
“critical mass” with sufficient numbers to ensure under-represented minority students do not feel
isolated or like spokespersons for their race, and do not feel uncomfortable discussing issues freely
based on their personal experiences. Professor Lempert and Kent Syverud, the current dean of
Vanderbilt Law School and a former Michigan Law School professor, offered similar definitions of
“critical mass.” The Law School’s witnesses also testified that “critical mass” was not a set number
or percentage. Director Munzel stated that there is no number or percentage, or range of numbers
or percentages, that constitute a “critical mass.” Likewise, Dean Lehman stated that “critical mass”
could not be fixed in terms of number or percentage.
Both the Law School and the unsuccessful applicants presented expert testimony regarding
the Law School’s use of race in admissions decisions. Analyzing grids of the Law School’s
admissions data from 1995-2000, the unsuccessful applicants’ statistical expert testified that the
relative odds of acceptance for Native American, African-American, Mexican-American and Puerto
Rican applicants were many times greater than for Caucasian applicants and concluded that members
of these groups were “given an extremely large allowance for admission.”
According to the Law School’s statistical expert, eliminating race as a factor in the
admissions process would dramatically lower minority admissions. He predicted, for example, that
if the Law School could not consider race, under-represented minority students would have
constituted only 4% of the entering class in 2000, instead of the actual enrollment figure of 14.5%.
Citing the experience of the University of California at Berkeley after the passage of Proposition 209,
Dean Lehman echoed these predictions, testifying that he feared under-represented minority
enrollment would drop to “token” levels if race and ethnicity could not be considered.
II.
This Court reviews de novo the district court’s finding that the Law School’s efforts to
achieve a diverse student body through the consideration of race and ethnic origin is unconstitutional
and violates Title VI of the Civil Rights Act of 1964. Johnson v. Econ. Dev. Corp., 241 F.3d 501,
509 (6th Cir. 2001); see also Women's Med. Prof. Corp. v. Voinovich, 130 F.3d 187, 192 (6th Cir.
1997) (“[A]n appellate court is to conduct an independent review of the record when constitutional
Nos. 01-1447/1516
Grutter v. Bollinger
Page 6
facts are at issue.”). To survive constitutional review, the Law School’s consideration of race must
(1) serve a compelling state interest and (2) be narrowly tailored to achieve that interest. See
Adarand v. Peña, 515 U.S. 200, 227, 115 S.Ct. 2097, 132 L.Ed.2d 158 (1995).3
A.
To determine whether the Law School’s interest in achieving a diverse student body is
compelling, we turn to Bakke. In Bakke, a fragmented Court determined that the Medical School of
the University of California at Davis, which justified its race-conscious admissions program, in part,
as necessary to achieve a diverse student body, could not be permanently enjoined from considering
its applicants’ race because “the State has a substantial interest that legitimately may be served by
a properly devised admissions program involving the competitive consideration of race and ethnic
origin.” Id. at 320.
Two distinct opinions support Bakke’s judgment on this issue: Justice Powell’s opinion
announcing the judgment of the Court, id. at 269-324, and Justice Brennan’s opinion concurring in
the judgment in part and dissenting in part, in which Justices White, Marshall, and Blackmun joined,
id. at 324-79.
Applying intermediate scrutiny, the Brennan concurrence found Davis could constitutionally
justify its consideration of race as an effort to remedy the effects of societal discrimination. Id. at
362. Applying strict scrutiny, Justice Powell found “the attainment of a diverse student body . . .
clearly is a constitutionally permissible goal for an institution of higher education.” Id. at 311-312.
Justice Powell recognized that a diverse student body promotes an atmosphere of
“speculation, experiment and creation” that is “essential to the quality of higher education.” Id. at
312 (quoting Sweezy v. New Hampshire, 354 U.S. 234, 263, 77 S.Ct. 1203, 1 L.Ed.2d 1311 (1957)
(Frankfurter, J. concurring)). Moreover, he noted that, by enriching students’ education with a
variety of perspectives, experiences, and ideas, a university with a diverse student body helps equip
its students to be productive members of society. Bakke, 438 U.S. at 313 (“[I]t is not too much to
say that the ‘nation’s future depends upon leaders trained through wide exposure’ to the ideas and
mores of students as diverse as this Nation of many peoples.”) (quoting Keyishian v. Board of
Regents, 385 U.S. 589, 603, 87 S.Ct. 675, 17 L.Ed.2d 629 (1967)). Accordingly, he concluded “the
interest of diversity is compelling in the context of a university’s admission program.” Id. at 314.
3
Because Title VI, which prohibits racial discrimination in programs receiving federal funds,
proscribes only those racial classifications that would violate the Equal Protection Clause, this court
need only address whether the Law School’s admissions program is constitutional. See Alexander
v. Sandoval, 532 U.S. 275, 282, 121 S.Ct. 1511, 149 L.Ed.2d 517 (2001).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 7
Justice Powell’s recognition of the compelling nature of the state’s interest in a diverse
student body was not limited to undergraduate admissions: “[E]ven at the graduate level, our
tradition and experience lend support to the view that the contribution of diversity is substantial.”
Id. Quoting Sweatt v. Painter, 339 U.S. 629, 634, 70 S.Ct. 848, 94 L.Ed. 1114 (1950), he observed:
“The law school, the proving ground for legal learning and practice, cannot be effective in isolation
from the individuals and institutions with which the law interacts.” Bakke, 438 U.S. at 314.
The district court did not dispute the merits of student body diversity. Rather, it
acknowledged “[t]he evidence defendants submitted . . . demonstrated that the educational
atmosphere at the law school is improved by the presence of students who represent the greatest
possible variety of backgrounds and viewpoints.” Grutter v. Bollinger, 137 F. Supp. 2d 821, 849
(E.D. Mich. 2001). Nevertheless, it held that achieving a diverse student body is not a compelling
state interest because (1) it was not bound by Justice Powell’s conclusion in Bakke, and (2) achieving
a diverse student body cannot be a compelling state interest because the Supreme Court has
suggested that the only such interest is remedying specific instances of discrimination. See id. at
847-48.
Because Justice Powell’s opinion is binding on this court under Marks v. United States, 430
U.S. 188, 193, 97 S.Ct. 990, 51 L.Ed.2d 260 (1977), and because Bakke remains the law until the
Supreme Court instructs otherwise, we reject the district court’s conclusion and find that the Law
School has a compelling interest in achieving a diverse student body. 4
1.
“When a fragmented Court decides a case and no single rationale explaining the result enjoys
the assent of five Justices, the holding of the Court may be viewed as that position taken by those
Members who concurred in the judgments on the narrowest grounds.” Marks, 430 U.S. at 193
(citation and internal punctuation omitted). In Marks, the Court interpreted its fragmented decision
in Memoirs v. Massachusetts, 383 U.S. 413, 86 S.Ct. 975, 16 L.Ed.2d 1 (1966), reversing the
Massachusetts Supreme Court’s holding that a book depicting a prostitute’s life was suppressible
obscenity. Three distinct rationales supported Memoirs’s judgment, each representing a different
view as to the scope of First Amendment protection afforded sexually explicit expression:
(1) Justices Brennan and Fortas and the Chief Justice found the book was not suppressible obscenity
because it was not “utterly without redeeming social value,” see id. at 419; (2) Justice Stewart found
the book was not suppressible obscenity because it was not hardcore pornography, see id. at 421; and
(3) Justices Black and Douglas did not reach the issue of whether the book was suppressible
4
Because we hold that the Law School has a compelling interest in achieving a diverse
student body, we do not address whether the Intervenors’ proffered interest – an interest in
remedying past discrimination – is sufficiently compelling for equal protection purposes.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 8
obscenity because they believed the First Amendment provides an absolute shield against
government regulation of expression, see id. at 421, 424-28 (opinions of Black, J. and Douglas, J.).
See also Marks, 430 U.S. at 194. The Marks Court determined that the Brennan plurality opinion,
which provided the most limited First Amendment protection, “constituted the holding of the
[Memoirs] Court and provided the governing standards” because it was the narrowest rationale for
the Memoirs judgment.5 Id. at 193-94.
The district court declined to apply the Marks analysis to Bakke because Justice Powell’s
rationale was not “subsumed” in that of the Brennan concurrence. See Grutter, 137 F. Supp. 2d at
5
Because the Marks Court identified the Memoirs opinion with the most limited scope of
First Amendment protection as the “narrowest,” the dissent suggests that the most narrow opinion
under Marks must invariably be “that which construe[s] the constitutional provision in question less
potently.” Dissenting Op. at 52 (Boggs, J.). Application of the dissent’s cookie-cutter conception
of Marks narrowness would preclude consideration of a given decision’s actual gravamen.
Moreover, the dissent’s narrowness conception conflicts with both Supreme Court precedent, see
City of Lakewood v. Plain Dealer Co., 486 U.S. 750, 764-65 n.9, 108 S.Ct. 2138, 100 L.Ed.2d 771
(1988), and our own, see Simmons-Harris v. Zelman, 234 F.3d 945, 956-57 (6th Cir. 2000).
In Lakewood, the Court examined Kovacs v. Cooper, 336 U.S. 77, 69 S.Ct. 448, 93 L.Ed. 513
(1948). In Kovacs, a plurality of the Court found that an ordinance flatly prohibiting the use of
sound trucks was constitutional. Id. at 82-85, 89 (plurality opinion of Reed, J.). Two Justices agreed
that the flat-prohibition ordinance was constitutional, but reasoned that an ordinance giving a
licensing official unfettered discretion to prohibit the use of sound trucks – that is, an ordinance that
would be more conducive to content-based censorship – would also be constitutional. Id. at 89-90,
98 (opinions of Frankfurter, J. and Jackson, J.). Because the plurality would find discretionary-
prohibition statutes unconstitutional but would permit flat-prohibition statutes and the concurring
Justices would find both statutes constitutional, the concurring opinions would be “narrower” under
the dissent’s conception of Marks. The Supreme Court applied Marks differently: “Clearly, in
Kovacs, the plurality opinion puts forth the narrowest rationale for the Court’s judgment.”
Lakewood, 486 U.S. at 764 n.9; see also Zelman, 234 F.3d at 956-57 (examining Mitchell v. Helms,
530 U.S. 793, 120 S.Ct. 2530, 147 L.Ed.2d 660 (2000), and concluding that Justice O’Connor’s
concurrence – which would require more than a showing of neutrality to find government aid to
religious schools constitutional – was narrower than the plurality opinion – which would apparently
find that neutrality alone renders such aid constitutional); cf. Discovery Network, Inc. v. City of
Cincinnati, 946 F.2d 464, 470 n.9 (6th Cir. 1991) (examining Metromedia, Inc. v. City of San Diego,
453 U.S. 490, 101 S.Ct. 2882, 69 L.Ed.2d 800 (1981)), and citing Lakewood and Marks for the
proposition that this court is not bound by the Metromedia plurality’s reasoning that an ordinance,
which unconstitutionally regulated non-commercial speech, would be constitutional as applied to
commercial speech because the concurrence argued that the ordinance was unconstitutional as
applied to both commercial and non-commercial speech).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 9
847 (“There is simply no overlap between the two rationales”). Accordingly, it found that “Justice
Powell's discussion of the diversity rationale is not among the governing standards to be gleaned
from Bakke.” Id.
The Marks Court’s treatment of the divergent Memoirs rationales, however, demonstrates
that the rationales supporting the Court’s judgment need not overlap on essential points in order to
provide a holding that binds lower courts. Indeed, if the Justices agreed on essential points, the
Marks analysis would be unnecessary. Cf. Alexander v. Sandoval, 532 U.S. 275, 282, 121 S.Ct.
1511, 149 L.Ed.2d 517 (2001) (citing discrete portions of the opinions of Justice Powell and the
Brennan concurrence for the proposition that the Bakke Court determined Title VI’s coverage is
coextensive with that of the Equal Protection Clause).
The Marks Court adopted the “utterly without redeeming social value” test as the Memoirs
holding even though, by rejecting the possibility of suppression, Justices Black and Douglas rejected
the possibility of any test for identifying suppressible obscenity. In contrast to Justices Black and
Douglas in Memoirs, the Brennan concurrence did not assert that Davis’s admissions program was
wholly insulated from review. In fact, the Brennan concurrence agreed with Justice Powell that
Davis’s admissions program was subject to heightened scrutiny, see Bakke, 438 U.S. at 359
(advocating intermediate scrutiny); it expressly disagreed only with his application of strict scrutiny.
Because Bakke is, if anything, more susceptible to the Marks analysis than the case examined in
Marks itself, we find the district court erred in failing to analyze Bakke under Marks.
The Bakke Court addressed the permissibility of racial classifications in academic admissions
programs. Under the Brennan concurrence’s rationale, the more permissive intermediate scrutiny
standard would apply to “benign” racial classifications. Id. Under Justice Powell’s rationale, strict
scrutiny would apply to all racial classifications. Id. at 304-07. Because the set of constitutionally
permissible racial classifications under intermediate scrutiny by definition includes those
classifications constitutionally permissible under strict scrutiny, Justice Powell’s rationale would
permit the most limited consideration of race; therefore, it is Bakke’s narrowest rationale.
Accordingly, Justice Powell’s opinion constitutes Bakke’s holding and provides the governing
standard here.6 See Marks, 430 U.S. at 193-94; see also Triplett Grille, Inc. v. City of Akron, 40 F.3d
6
The “narrowest” rationale of a case under Marks must be one capable of supporting the
Court’s judgment in that case. See Marks, 430 U.S. at 193 (“[T]he holding of the Court may be
viewed as that position taken by those Members who concurred in the judgments on the narrowest
grounds.”) (emphasis added) (citation and internal punctuation omitted); see also Triplett Grille, 40
F.3d at 133-34 (noting that the articulated standard must “necessarily produce results with which a
majority of the Court from that case would agree”). Therefore, we reject the Eleventh Circuit’s
suggestion in Johnson v. Board of Regents of the University of Georgia, 263 F.3d 1234, 1247 (11th
Cir. 2001), that “the narrowest - i.e, less far-reaching - common ground of the Brennan and Powell
Nos. 01-1447/1516
Grutter v. Bollinger
Page 10
129, 134 (6th Cir. 1994) (“While there is some awkwardness in attributing precedential value to an
opinion of one Supreme Court justice to which no justice adhered, it is the usual practice when that
is the determinative opinion.”); Smith v. Univ. of Washington, 233 F.3d 1188, 1200 (9th Cir. 2000).
Because this court is bound by Justice Powell’s Bakke opinion, we find that the Law School
has a compelling state interest in achieving a diverse student body.
2.
Our determination that Justice Powell’s diversity conclusion binds this court also finds some
support in the Brennan concurrence’s qualified approval of the Harvard plan in the first footnote of
its opinion: “We also agree with Mr. Justice POWELL that a plan like the ‘Harvard’ plan . . . is
constitutional under our approach, at least so long as the use of race to achieve an integrated student
body is necessitated by the lingering effects of past discrimination.” Bakke, 438 U.S. at 326 n.1
(Brennan, J., concurring) (citation omitted) (emphasis added). Under the Harvard plan, Harvard
College justified its race-conscious admissions policy solely on the basis of its efforts to achieve a
diverse student body. See id. at 316. Harvard’s consideration of race could not be constitutional if
it did not further a constitutionally permissible goal; therefore, by indicating that the Harvard plan
could be constitutional under its approach, the Brennan concurrence implicitly – but unequivocally
opinions on the specific subject of student body diversity is that diversity is [only] an ‘important’
interest,” because application of an “important interest” rationale to Bakke’s facts would produce a
judgment contrary to that actually reached by the Bakke Court. If student body diversity were only
an “important” interest, Justice Powell could not join in the Court’s decision to permit “the
competitive consideration of race and ethnicity” because a plan serving a merely important interest
would not survive strict scrutiny.
Moreover, under Marks, this court must follow the reasoning of the concurring opinion with
the narrowest line of reasoning on the issue of why the California Supreme Court could not
permanently enjoin Davis from considering race, not – as the dissent suggests – the narrowest line
of reasoning capable of being gleaned from a conglomeration of the opinions. DLS, Inc. v. City of
Chattanooga, 107 F.3d 403, 408-09 n.4 (6th Cir. 1997) ( noting that “with respect to a particular
issue, [this court] must follow the reasoning of the concurring opinion with the narrowest line of
reasoning on that issue”) (emphasis added). Because Justice Powell’s opinion provides the
narrowest support for Bakke’s judgment, we are bound by his reasoning in that opinion; we cannot
cobble together a holding from various rationales in the discrete Bakke opinions. Id. (noting that “we
do not have the freedom to pick and choose which premises and conclusions we will follow”).
Accordingly, we cannot accept the dissent’s invitation to extract two holdings from Bakke by
merging analogous portions of the opinions of Justice Powell and the Brennan concurrence. See
Dissenting Op. at 55-56 (Boggs, J.).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 11
– signaled its agreement with Justice Powell’s conclusion that achieving a diverse student body is
a constitutionally permissible goal.7
Although there is no support – either within or without the footnote – for the contention that
the Brennan concurrence believed that the desirability of an “integrated student body” turns on
whether the consideration of race is necessary to achieve that integration, some courts have read the
Harvard footnote’s qualifying language, “at least so long as the use of race to achieve an integrated
student body is necessitated by the lingering effects of past discrimination,” to suggest that the
Brennan concurrence implicitly rejected the goal of achieving student body diversity. See Hopwood
v. Texas, 78 F.3d 932, 944 (5th Cir. 1996).
It is a mistake, however, to read the qualifying language as a rejection of any rationale. “[A]t
least so long as” simply does not mean “only if.” Moreover, the qualifying language modifies when
race may be used: ‘at least so long as . . . necessitated by the lingering effects of past discrimination.’
It does not modify why.8 This Court cannot ignore the distinction between a constitutionally
permissible goal – ‘achieving an integrated student body’ – and a constitutionally permissible use
of race to achieve that goal – ‘so long as necessitated by the lingering effects of past discrimination.’
7
Unless one assumes that the Brennan concurrence would have approved the use of race to
further an unconstitutional goal, the dissent’s aprioristic assertion that the Brennan concurrence
“certainly did not endorse [Justice Powell’s diversity rationale]” flouts logic. See Dissenting Op.
at 53 n.6 (Boggs, J.). The operative syllogism is uncomplicated: (1) Under no circumstances may
race be used to further unconstitutional goals. (2) The Brennan concurrence agrees, at least under
certain circumstances, that Harvard may use race to further its goal. Thus, the Brennan concurrence
agrees that Harvard’s goal, ‘achieving an integrated student body,’ is constitutional.
In fact, just as the Supreme Court was bound by statements from discrete Bakke opinions
indicating that Title VI’s coverage mirrors that of the Equal Protection Clause, see, e.g., Guardians
Ass’n v. Civil Service Comm. of New York City, 463 U.S. 582, 610, 612, 642, 103 S.Ct. 3221, 77
L.Ed.2d 866 (1983) and Alexander v. Sandoval, 532 U.S. 275, 282, 121 S.Ct. 1511, 149 L.Ed.2d 517
(2001), this court would be bound by five Bakke Justices’ agreement that Harvard’s diversity goal
is constitutional, but for the – unclear – distinction between an “important interest” under
intermediate scrutiny and a “compelling” interest” under strict scrutiny.
8
Hopwood’s reading is akin to construing the sentence “we agree that automobile drivers may
drive with their lights on, at least so long as the use of lights to see the road is necessitated by the
effects of nightfall” to suggest seeing the road is a permissible goal only at night. Just as whether
or not it is night does not qualify the permissibility of trying to see the road, whether or not the use
of race is necessitated by past discrimination does not qualify the permissibility of seeking “an
integrated student body.”
Nos. 01-1447/1516
Grutter v. Bollinger
Page 12
Therefore, we cannot read the Harvard footnote’s qualifying language to detract from the Brennan
concurrence’s agreement with Justice Powell’s diversity conclusion.
3.
The Court’s subsequent characterization of Bakke further supports our determination that
Justice Powell’s conclusion is binding. See Metro Broadcasting, Inc. v. FCC, 497 U.S. 547, 568,
110 S.Ct. 2997, 111 L.Ed.2d 445 (1990), overruled on other grounds, Adarand, 515 U.S. at 227.
In Metro Broadcasting, Justice Brennan, speaking for the Court in an opinion joined by Justices
White, Blackmun, Marshall, and Stevens, cited Bakke for the proposition that “‘a diverse student
body’ contributing to a ‘robust exchange of ideas’ is a ‘constitutionally permissible goal’ on which
race-conscious university admissions program may be predicated.” Metro Broadcasting, 497 U.S.
at 568 (quoting Bakke, 438 U.S. at 311-13 (Opinion of Powell, J.)). Metro Broadcasting’s insight
into Bakke’s holding is persuasive authority, which this court may not ignore. See Wright v. Morris,
111 F.3d 414, 419 (6th Cir. 1997).
4.
Relying on Adarand and City of Richmond v. J.A. Croson Co., 488 U.S. 469, 493, 109 S.Ct.
706, 102 L.Ed.2d 854 (1989), the district court found that “racial classifications are unconstitutional
unless they are intended to remedy carefully documented effects of past discrimination” and
therefore concluded that the Law School’s interest in achieving a diverse student body “is not a
compelling state interest because it is not a remedy for past discrimination.” See Grutter, 137 F.
Supp. 2d at 849. Because the Supreme Court alone retains the ability to overrule its decisions, we
reject the district court’s conclusion.
In Bakke, the Supreme Court determined that Davis – an institution that did not purport to
justify its race-conscious admissions program as necessary to remedy specific past discrimination
– could consider its applicants’ race. See Bakke, 438 U.S. at 320. Thus, if the only constitutionally
permissible reason to consider race is remedying specific past discrimination, Bakke’s judgment is
no longer good law. In other words, adopting the district court’s conclusion that the Law School
could only justify race-conscious admissions decisions as a remedy for specific past discrimination
would necessitate a finding that the Supreme Court has implicitly overruled Bakke.
The Supreme Court, however, has explicitly prohibited just such a finding. See Agostini v.
Felton, 521 U.S. 203, 237, 117 S. Ct. 1997, 138 L.Ed.2d 391 (1997). Rather, “[i]f a precedent of
[the] Court has direct application in a case, yet appears to rest on reasons rejected in some other line
of decisions, the Court of Appeals should follow the case which directly controls, leaving to [the
Supreme] Court the prerogative of overruling its own decisions.” Id. (quoting Rodriguez de Quijas
v. Shearson/Am. Express, Inc., 490 U.S. 477, 484, 109 S.Ct. 1917, 104 L.Ed.2d 526 (1989)).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 13
Moreover, given that (1) Bakke’s judgment suggests that remedying specific past
discrimination cannot be the only constitutional justification for a race-conscious admissions
program, and (2) institutions of higher education have been relying on Bakke for more than twenty
years, see, e.g., Kenneth L. Karst & Harold W. Horowitz, The Bakke Opinions and Equal Protection
Doctrine, 14 Harv. C.R.-C.L. L. Rev. 7, 7 (1979) (noting that Bakke provides a “how-to-do-it manual
for the admission of minority applicants to professional schools”), we are unwilling to infer an intent
to overrule Bakke – implicitly or otherwise – into the Court’s Adarand decision. See, e.g., Planned
Parenthood v. Casey, 505 U.S. 833, 855, 112 S.Ct. 2791, 120 L.Ed.2d 674 (1992) (noting that the
Court must consider “the cost of a rule’s repudiation as it would fall on those who have relied
reasonably on the rule’s continued application” and suggesting that stare decisis precludes overruling
a decision that cannot be overruled “without serious inequity to those who have relied upon it or
significant damage to the stability of the society governed by it”); see also Dickerson v. United
States, 530 U.S. 428, 443, 120 S.Ct. 2326, 147 L.Ed.2d 405 (2000).
B.
Although he found that achieving a diverse student body was a compelling interest, Justice
Powell declared Davis’s admissions system unconstitutional because it was not narrowly tailored.
Bakke, 438 U.S. at 319-20. Davis operated a dual-track admissions system featuring a separate
admissions committee and separate review process for minority applicants. Id. at 273-74. Davis also
established a quota for minority students – for example, in 1974, Davis reserved sixteen spots for
minority applicants. Id. at 275. According to Justice Powell, the critical defect in Davis’s program
was that non-minority students were “totally excluded from a specific percentage of seats in an
entering class.” Id. at 319.
As an example of a constitutionally permissible admissions plan, Justice Powell advanced
the Harvard plan in which race or ethnicity was deemed a “plus,” but did not insulate a minority
applicant from comparison with other applicants. Id. at 316. Under the Harvard plan, an institution
could consider the race and ethnicity of applicants, but race and ethnicity alone were not the
exclusive components of academic diversity. Id. at 317. Thus, a black applicant could be “examined
for his potential contribution to diversity without the factor of race being decisive when compared,
for example, with . . . an Italian-American if the latter is thought to exhibit qualities more likely to
promote beneficial educational pluralism.” Id. According to Justice Powell, such qualities included
“exceptional personal talents, unique work or service experience, leadership potential, maturity,
demonstrated compassion, a history of overcoming disadvantage, ability to communicate with the
poor, or other qualifications deemed important.” Id. The Harvard plan was “flexible enough to
consider all pertinent elements of diversity in light of the particular qualifications of each applicant,
and to place them on the same footing for consideration, although not necessarily according them
the same weight.” Id. Race could “tip the balance” in an applicant’s favor, but so could other factors
like “geographic origin or a life spent on a farm.” Id. at 316.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 14
Above all, the Harvard plan “treat[ed] each applicant as an individual in the admissions
process.” Id. at 318. “The applicant who loses out on the last available seat to another candidate
receiving a ‘plus’ on the basis of ethnic background will not have been foreclosed from all
consideration for that seat simply because he was not the right color or had the wrong surname.” Id.
Rather, his denied admission “would mean only that his combined qualifications, which may have
included similar nonobjective factors, did not outweigh those of the other applicant.” Id.
In endorsing the Harvard plan, Justice Powell accepted that a university could not provide
“a truly heterogen[e]ous environment . . . without some attention to numbers.” Id. at 323. As the
Harvard plan detailed:
10 or 20 black students could not begin to bring to their classmates and to each other
the variety of points of view, backgrounds and experiences of blacks in the United
States. Their small numbers might also create a sense of isolation among the black
students themselves and thus make it more difficult for them to develop and achieve
their potential. Consequently, when making its decisions, the Committee on
Admissions is aware that there is some relationship between numbers and achieving
the benefits to be derived from a diverse student body, and between numbers and
providing a reasonable environment for those students admitted. But that awareness
does not mean that the Committee sets a minimum number of blacks or of people
from west of the Mississippi who are to be admitted. It means only that in choosing
among thousands of applicants who are not only ‘admissible’ academically but have
other strong qualities, the Committee, with a number of criteria in mind, pays some
attention to distribution among many types and categories of students.
Id. at 323-24.
Justice Powell rejected Justice Brennan’s contention that the distinction between a quota and
a program that considered race and ethnicity as a potential “plus” was largely illusory. In Justice
Powell’s view, a “plus” program – unlike a quota – lacked a “facial intent to discriminate.” Id. at
318. Emphasizing that the fine distinction between a “plus” and quota system was both discernible
and constitutionally significant, Justice Powell recalled Justice Frankfurter’s declaration that “‘[a]
boundary line is none the worse for being narrow.’” Id. (quoting McLeod v. Dilworth, 322 U.S. 327,
329, 64 S.Ct. 1023, 88 L.Ed. 1304 (1944)). Justice Powell added that “a court would not assume that
a university, professing to employ a facially nondiscriminatory admissions policy, would operate it
as a cover for the functional equivalent of a quota system.” Id.; see also Johnson v. Transp. Agency,
480 U.S. 616, 656, 107 S.Ct. 1442, 94 L.E.2d 615 (1987) (O’Connor, J., concurring) (approving
gender-conscious promotion where defendant “tried to look at the whole picture, the combination
of [her] qualifications and [plaintiff’s] qualifications, their test scores, their experience, their
background, [and] affirmative action matters”).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 15
In summary, Justice Powell’s opinion sets forth two guidelines regarding race-conscious
admissions policies – (1) segregated, dual-track admissions systems utilizing quotas for under-
represented minorities are unconstitutional; and (2) an admissions policy modeled on the Harvard
plan, where race and ethnicity are considered a “plus,” does not offend the Equal Protection Clause.
Neither party questions the applicability of Justice Powell’s opinion regarding the narrowly tailored
component of strict scrutiny, and it is our view that whether the Law School’s admissions policy
passes constitutional muster turns on Justice Powell’s opinion.9
1.
Drafted to comply with Bakke, the Law School’s consideration of race and ethnicity does not
use quotas and closely tracks the Harvard plan. Race and ethnicity, along with a range of other
factors, are potential “plus” factors in a particular applicant’s file, but they do not insulate an under-
represented minority applicant from competition or act to foreclose competition from non-minority
applicants. As part of its policy of evaluating each applicant individually, the Law School’s officials
read each application and factor all of the accompanying information into their decision. The Law
School, like Harvard, attends to the numbers and distribution of under-represented minority
applicants in an effort to ensure all of its students obtain the benefits of an academically diverse
student body.
The record demonstrates that the Law School does not employ a quota for under-represented
minority students. The Law School’s witnesses, including the current and former admissions
directors, all testified that the Law School does not reserve or set aside seats. For example, Dean
Lehman testified: “We do not have a portion of the class that is set aside for a critical mass of under-
represented minority students.” Moreover, the Law School operates a single admissions system;
there is no separate track for minority applicants insulating them from comparison with non-minority
applicants. Thus, the Law School’s admissions policy avoids the critical defect of the Davis
admissions program.
The Law School’s competitive consideration of the race and ethnicity of African-Americans,
Hispanics and Native Americans closely tracks the Harvard plan. In its admission policy, quoted in
Bakke, Harvard details that race is a “factor in some admissions decisions” and that “the race of an
applicant may tip the balance in his favor just as geographic origin or a life spent on a farm may tip
9
We recognize that the Eleventh Circuit dismissed Justice Powell’s endorsement of the
Harvard plan as dicta. See Johnson, 263 F.3d at 1261. Even if this portion of Justice Powell’s
opinion could be labeled dicta, it is nevertheless dicta from the determinative opinion in the only
Supreme Court case to address the consideration of race and ethnicity in academic admissions.
Accordingly, Justice Powell’s endorsement of the Harvard plan carries considerable persuasive
authority and provides a more appropriate basis for our opinion than any test we might fashion.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 16
the balance in other candidates’ cases.” Id. at 316. Explaining the rationale behind this policy,
Harvard highlighted that a “black student can usually bring something [to Harvard] that a white
person cannot offer.” Id. The Law School considers an applicant’s race and ethnicity as a potential
“plus” factor, or as Professor Lempert testified, as one element among other elements. Because race
and ethnicity are a “plus,” they undoubtedly “tip the balance” in some applicants’ favor. Importantly,
however, the Law School’s consideration of race and ethnicity does not operate to insulate any
prospective student from competition with any other applicants. The Law School’s explanation for
its consideration of race and ethnicity also mirrors the Harvard plan. According to the Law School,
students from these groups “are particularly likely to have experiences and perspectives of special
importance to [the Law School’s] mission.”
In seeking an academically diverse class, the record indicates that the Law School considers
more than an applicant’s race and ethnicity. In Bakke, Justice Powell stressed factors in addition to
race and ethnicity that could contribute to academic diversity. See id. at 317. He cited “exceptional
personal talents, unique work or service experience, leadership potential, maturity, demonstrated
compassion, a history of overcoming disadvantage, ability to communicate with the poor, or other
qualifications deemed important.” Id. Mirroring Justice Powell’s discussion, the Law School’s
admissions policy states that “[t]here are many possible bases for diversity admissions” and that in
evaluating “soft” variables, it considers a range of factors such as leadership, work experience,
unique talents or interests and the enthusiasm of an applicant’s letters of recommendation.
Illustrating this range, the policy provides that particular weight might be given to “an Olympic gold
medal, a Ph. D in physics, the attainment of age 50 in a class that otherwise lacked anyone over 30,
or the experience of having been a Vietnamese boat person.”
The Law School’s pursuit of a “critical mass” of under-represented minority students also
tracks the Harvard plan’s pursuit of a class with meaningful numbers of minority students.
Explaining its attention to the numbers and distribution of minority students, Harvard emphasized
that “10 or 20 black students could not begin to bring to their classmates and to each other the variety
of points of view, backgrounds and experiences of blacks in the United States.” Id. at 323.
Moreover, “[t]heir small numbers might also create a sense of isolation among the black students
themselves and thus make it more difficult for them to develop and achieve their potential.” Id. In
defining the term “critical mass,” the Law School’s witnesses voiced virtually identical concerns.
Director Munzel testified that “critical mass” is a number sufficient so that under-represented
minority students can contribute to classroom dialogue and not feel isolated. Dean Lehman similarly
equated “critical mass” with sufficient numbers to ensure under-represented minority students do
not feel isolated or like spokespersons for their race, and feel comfortable discussing issues freely
based on their personal experiences. Professor Lempert and Kent Syverud, the current dean of
Vanderbilt Law School and a former Michigan Law School professor, offered similar explanations
for the Law School’s pursuit of a “critical mass” of under-represented minority students. Essentially,
both the Law School’s admission policy and the Harvard plan attend to the numbers of under-
Nos. 01-1447/1516
Grutter v. Bollinger
Page 17
represented minority students to ensure that all students – minority and majority alike – will be able
to enjoy the educational benefits of an academically diverse student body.
In light of the foregoing, we find that the Law School’s consideration of race and ethnicity
is virtually indistinguishable from the Harvard plan Justice Powell approved in Bakke.
2.
The unsuccessful applicants focus principally on the effects of the Law School’s policy,
contending first that the Law School’s pursuit of a “critical mass” is the functional equivalent of a
quota because it has resulted in a range of under-represented minority enrollment from 10%-17%.
As a matter of definition, we are satisfied that the Law School’s “critical mass” is not the equivalent
of a quota, because unlike Davis’s reservation of sixteen spots for minority candidates, the Law
School has no fixed goal or target. That the Law School’s pursuit of a “critical mass” has resulted
in an approximate range of under-represented minority enrollment does not transform “critical mass”
into a quota. Because Bakke allows institutions of higher education to pay some attention to the
numbers and distribution of under-represented minority students, see id. at 316-17, over time,
reliance on Bakke will always produce some percentage range of minority enrollment. And that
range will always have a bottom, which, of course, can be labeled the “minimum.” These results are
the logical consequence of reliance on Bakke and establishment of an admissions policy, like the
Harvard plan, that attends to the numbers and distribution of under-represented minority students.
As such, they cannot serve as the basis for a charge that the Law School’s admissions policy is
unconstitutional.
In analyzing actual admissions data, the dissent tries out a variation of the unsuccessful
applicants’ contention and focuses only on the years 1995 through 1998. Dissenting Op. at 75
(Boggs, J.). Based on this grouping, the tightest four-year range available, the dissent concludes that
the Law School seeks a “critical mass” of forty-four to forty-seven under-represented minorities per
class, or “around 13.5%.” But as the dissent confesses in a footnote, the rest of the picture
“deviate[s] a bit.” Id. at 75 n.29. From 1987 to 1994, under-represented minority enrollment was
12.3%, 13.6%, 14.3%, 13.4%, 19.1%, 19.8%, 14.5%, 20.1%, respectively. More importantly for
present purposes, if we examine under-represented minority enrollment from 1993 until 1998, we
see that the Law School’s under-represented minority enrollment ranged from 13.5% to 20.1%. In
light of (1) the overwhelming testimony by Law School professors, admissions counselors and deans
that the Law School does not employ a quota or otherwise reserve seats for under-represented
minority applicants and (2) Justice Powell’s instruction that lower courts presume that academic
institutions act in good faith in operating their “plus” programs, we simply cannot conclude that the
Law School is using the “functional equivalent” of the Davis Medical School quota struck down in
Bakke.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 18
Relying on statistical evidence that under-represented minority students are admitted to the
Law School with comparatively lower undergraduate grade-point averages and standardized test
scores, the unsuccessful applicants also argue that the Law School considers race and ethnicity too
much.10 Although they concede that all admitted students are qualified, the unsuccessful applicants
contend that this disparity evidences an unconstitutional double standard for admission of under-
represented minority applicants and non-minority applicants. Upon inspection, however, the
unsuccessful applicants’ statistical evidence demonstrates just what one would expect a plan like the
Harvard plan to demonstrate – that race and ethnicity, as “plus” factors, play an important role in
some admissions decisions. As the logical result of reliance on the Harvard plan, the unsuccessful
applicants’ statistical evidence accordingly cannot sustain their contention that the Law School’s
admissions policy is unconstitutional.
In advancing the Harvard plan, Justice Powell, unfortunately, did not define or discuss a
permissible “plus” with respect to the test scores and high school grades of under-represented
minority Harvard applicants. And Harvard did not append a statistical comparison of minority and
non-minority standardized test scores and/or grades to its admissions plan. Perhaps Harvard, in
enrolling meaningful numbers of under-represented minority students, could select under-represented
minority applicants with test scores or high school grades equivalent to their non-minority
counterparts. And then again, perhaps Harvard grappled with some of the same admissions
challenges as the Law School does today. Of course, such admissions statistics are neither in the
record before us nor explicitly incorporated into Justice Powell’s opinion. Under these
circumstances, we cannot hold that the Law School’s admissions program, which is virtually
identical to the Harvard plan, would nevertheless fail Justice Powell’s test for constitutionality.
Without some indication that Justice Powell specifically meant to limit the consideration of race or
ethnicity – as a “plus,” to “tip the balance,” or as a “factor in some admissions decisions” – to
instances where standardized test scores or high school grade-point averages were equivalent, we
cannot adopt the limited definition of “plus” urged by the dissenting opinions. See Dissenting Op.
at 71-73 (Boggs, J.); Dissenting Op. at 93 (Gilman, J.). And thus, we cannot conclude that the
difference, on average, between the standardized test scores and/or undergraduate grades of qualified
under-represented minority students and qualified non-minority students renders the Law School’s
admissions policy unconstitutional.
3.
The district court relied on five factors in concluding that the Law School’s consideration of
race and ethnicity was not narrowly tailored: (1) the Law School did not define “critical mass” with
sufficient clarity; (2) the apparent lack of a time limit on the Law School’s consideration of race and
10
The district court credited plaintiffs’ statistical conclusions, but did not incorporate them
into its discussion of whether the Law School’s admission policy was sufficiently narrowly tailored.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 19
ethnicity; (3) the admissions policy was “practically indistinguishable” from a quota system; (4) the
Law School did not have a logical basis for considering the race and ethnicity of African-Americans,
Native Americans and Puerto Ricans; (5) the Law School did not “investigate alternative means for
increasing minority enrollment.” Grutter, 137 F. Supp. 2d at 850-52. As a initial matter, we have
serious reservations regarding the district court’s consideration of five factors not found in Bakke,
which, as we have stated, is the only Supreme Court case to directly address the consideration of race
and ethnicity in academic admissions. Nevertheless, we are satisfied that the remaining factors relied
on by the district court cannot sustain its holding.
Although not addressed in Bakke, subsequent Supreme Court opinions suggest consideration
of race-neutral means is necessary to satisfy the narrowly tailored component of strict scrutiny. E.g.,
Croson, 488 U.S. at 507 (“In determining whether race-conscious remedies are appropriate, we look
to several factors, including the efficacy of alternative remedies.”) (quoting United States v.
Paradise, 480 U.S. 149, 171, 107 S.Ct. 1053, 94 L.Ed.2d 203 (1987)). Although the Law School’s
consideration of race and ethnicity differs from the racial classifications at issue in Croson, and the
context of higher education differs materially from the government contracting context, see, e.g.,
Hopwood, 78 F.3d at 965 n.21 (Wiener, J., concurring) (“This unique context, first identified by
Justice Powell, differs from the employment context, differs from the minority business set aside
context, and differs from the re-districting context; it comprises only the public education context
and implicates the uneasy marriage of the First and Fourteenth Amendments.”), we nevertheless
assess whether the Law School adequately considered race-neutral alternatives.
The district court acknowledged that the Law School introduced evidence indicating that
under-represented minority students could not be enrolled in significant numbers without explicit
consideration of race and ethnicity, but ruled that the Law School “fail[ed] to investigate alternative
means for increasing minority enrollment.” 137 F. Supp. 2d at 852. Upon examination, however,
the record does indicate the Law School considered and ultimately rejected various race-neutral
alternatives to the consideration of race and ethnicity. Director Munzel, former Director Shields and
Dean Lehman all testified that the Law School engaged in both pre- and post- admission recruiting
activities but that such activities were not enough to enroll a “critical mass” of under-represented
minority students. Additionally, Professor Lempert testified regarding the lottery system, in which
the Law School would lower its admissions standards, establish a numerical cut-off for “qualified”
applicants, and then select randomly from among those applicants. According to Professor Lempert,
such a system would admit greater numbers of non-minority students, but would not yield
meaningful racial and ethnic diversity. Given the Law School’s consideration of race-neutral
alternatives and the evidence that “under-represented minority students cannot be enrolled in
significant numbers unless their race is explicitly considered in the admissions process,” we find that
the Law School has adequately considered race-neutral alternatives.
The dissent proposes the Law School pursue “experiential diversity in a race-neutral manner”
and characterizes such an approach as a superior alternative to the Law School’s current admissions
Nos. 01-1447/1516
Grutter v. Bollinger
Page 20
system. Dissenting Op. at 80-81 (Boggs, J.). In effect, then, the dissent proposes that the Law
School only focus on its race-neutral bases of diversity admissions. But as the dissent essentially
acknowledges, this proposed alternative could not possibly achieve the same robust academic
diversity currently sought and obtained by the Law School. The dissent says that it is “fully willing
to stipulate that race does matter in American society, and that, on average, it matters more
negatively for some, if not all, of the groups favored by the Law School than it does for some, if not
all disfavored by the Law School.” Id. at 82. As to the impact of income, the dissent also offers to
“stipulate that such impact or disadvantage is not strictly limited by present income or status.” Id.
Yet the dissent nevertheless proposes that the Law School ignore the influence of race and ethnicity
in pursuing a broad “pluralism of ideas and experiences” and, at the same time, reassures us that the
pursuit of race-neutral diversity will still somehow produce the broadest “pluralism of ideas and
experiences.” Id. at 81. In reality, by reducing the range of experiences the Law School can consider
- namely, the experience of being an African-American, Hispanic or Native American in a society
where race matters - the dissent proposes only a narrowed and inferior version of the academic
diversity currently sought by the Law School.
Lastly, we note that we do not read Bakke and the Supreme Court’s subsequent decisions to
require the Law School to choose between meaningful racial and ethnic diversity and academic
selectivity. An institution of higher education must consider race-neutral alternatives, but it need
not abandon its academic mission to achieve absolute racial and ethnic neutrality. Thus, in applying
strict scrutiny we cannot ignore the educational judgment and expertise of the Law School’s faculty
and admissions personnel regarding the efficacy of race-neutral alternatives. We are ill-equipped
to ascertain which race-neutral alternatives merit which degree of consideration or which alternatives
will allow an institution such as the Law School to assemble both a highly qualified and richly
diverse academic class. See Regents of the Univ. of Michigan v. Ewing, 474 U.S. 214, 226, 106 S.Ct.
507, 88 L.Ed.2d 523 (1985) (noting that a federal court is ill-suited “to evaluate the substance of the
multitude of academic decisions that are made daily by faculty members of public education
institutions – decisions that require an expert evaluation of cumulative information and are not
readily adapted to the procedural tools of judicial or administrative decisionmaking.”) (citations and
internal punctuation omitted). Mindful of both our constitutional obligations and our practical
limitations, we also assume – along the lines suggested by Justice Powell – that the Law School acts
in good faith in exercising its educational judgment and expertise. See Bakke, 438 U.S. at 318-19.
4.
We are not persuaded by the remaining factors that the district court relied on to invalidate
the Law School’s admissions policy. First, the district court’s conclusion that the term “critical
mass” is not sufficiently defined is at odds with the extensive record in this case, and the district
court’s own characterization of “critical mass” as the functional equivalent of a quota. See Grutter,
137 F. Supp. 2d at 850. Numerous law school witnesses testified regarding the meaning of the term
“critical mass.” For example, Dean Lehman equated “critical mass” with sufficient numbers such
Nos. 01-1447/1516
Grutter v. Bollinger
Page 21
that under-represented minority students do not feel isolated or like spokespersons for their race, and
do not feel uncomfortable discussing issues freely based on their personal experiences. We also
emphasize the considerable tension between the district court’s findings that “critical mass” is both
insufficiently defined and the functional equivalent of a quota. In any event, the district court’s
apparent insistence that “critical mass” correspond with a more definite percentage is also fatally at
odds with Bakke’s prohibition of fixed quotas. See Bakke, 438 U.S. at 319.
Second, the district court’s statement that “there is no logical basis for the law school to have
chosen the particular groups which receive special attention under the admissions policy,” Grutter,
137 F. Supp. 2d at 851-52, ignores both the Harvard plan and the Law School’s admissions policy.
The Harvard plan specifically identified “blacks and Chicanos and other minority students” among
the under-represented groups that Harvard sought to enroll through its admissions policy. Bakke,
438 U.S. at 322. The Law School’s similar reference to African-Americans, Hispanics and Native
Americans accordingly cannot be faulted in this respect. Moreover, the policy itself supplies the
logical basis for considering the race and ethnicity of these groups – without such consideration, they
would probably not be represented in the Law School’s student body in “meaningful numbers.” As
with the formulation and consideration of race-neutral alternatives, some degree of deference must
be accorded to the educational judgment of the Law School in its determination of which groups to
target. See Ewing, 474 U.S. at 226.
Finally, the district court’s determination that the Law School’s consideration of race and
ethnicity lacks a definite stopping point also does not render the admissions policy unconstitutional.
See Grutter, 131 F. Supp. 2d at 851. Although the district court correctly recited Adarand’s directive
that a race-conscious remedial program must be limited so that it “will not last longer than the
discriminatory effects it is designed to eliminate,” this directive does not neatly transfer to an
institution of higher education’s non-remedial consideration of race and ethnicity. Unlike a remedial
interest, an interest in academic diversity does not have a self-contained stopping point. Indeed, an
interest in academic diversity exists independently of a race-conscious admissions policy.
Nevertheless, even if we were to apply a durational constraint, we are satisfied that the Law School’s
admissions policy sets appropriate limits on the competitive consideration of race and ethnicity. The
record indicates that the Law School intends to consider race and ethnicity to achieve a diverse and
robust student body only until it becomes possible to enroll a “critical mass” of under-represented
minority students through race-neutral means. Thus, we are satisfied that the admissions policy is
“sensit[ive] to the possibility that [it] might someday have satisfied its purpose.” See Associated Gen.
Contractors of Ohio, Inc. v. Drabik, 214 F.3d 730, 737 (6th Cir. 2000), cert. denied, 121 S. Ct. 1089
(2001).
III.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 22
For the foregoing reasons, we REVERSE the judgment of the district court and VACATE
its injunction prohibiting the Law School from considering race and ethnicity in its admissions
decisions.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 23
_____________________
CONCURRENCE
_____________________
KAREN NELSON MOORE, Circuit Judge, concurring. I write separately both to note my
disapproval of Judge Boggs’s decision to include a “Procedural Appendix” as part of his dissenting
opinion and to provide an accurate account of how this case came to be argued before the present
en banc court.
I.
In publishing their “Procedural Appendix,” I believe that Judge Boggs and those joining his
opinion have done a grave harm not only to themselves, but to this court and even to the Nation as
a whole. A court’s opinions state the reasons for its holdings and provide the public with the
principled justifications for them. Dissenting opinions typically present principled disagreements
with the majority’s holding. Such disagreements over principle are perfectly legitimate and do not
undermine public confidence in our ability as judges to do what we have sworn to do because, as a
culture, we have long recognized that disagreements over principle are unavoidable. Given this
cultural backdrop, disagreements over principle can be phrased in strong terms without damaging
the court’s ability to function as a decision-making institution in a democratic society. Judges
criticize their colleagues’ reasoning all the time, and, if they are to carry out their oaths of office, they
must do so. This robust exchange of ideas sharpens the focus and improves our analysis of the legal
issues.
In the present case, Judge Boggs has written a lengthy and strongly worded critique of the
substance of the majority’s holding in the present case. Although I disagree with his analysis and
conclusions, I acknowledge his abilities as a jurist.
The final section of Judge Boggs’s dissent, labeled “Procedural Appendix,” however,
publicizes disagreements over the internal workings of the court, which, as my colleague states, “do
not directly affect the legal principles discussed in this case.” Given that these procedural matters
are, at best, peripheral to the matter at hand, the only reason that “it is important that they be placed
in the record” is to declare publicly the dissent’s unfounded assertion that the majority’s decision
today is the result of political maneuvering and manipulation. The baseless argument of the
“Procedural Appendix” is that the decisions of this court are not grounded in principle and reasoned
argument, but in power,1 and that the judges of this court manipulate and ignore the rules in order
1
Judge Boggs responds in his dissent that he does “not contend that the legal opinions of any
member of this court do not represent that judge’s principled judgment in this case.” Dissenting Op.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 24
to advance political agendas. I am saddened that Judge Boggs and those joining his opinion believe
these things. But, more importantly, I am concerned that my dissenting colleagues’ actions will
severely undermine public confidence in this court. Cf. Memphis Planned Parenthood, Inc. v.
Sundquist, 184 F.3d 600, 608 (6th Cir. 1999) (Batchelder, J., separate statement on denial of
rehearing en banc) (“Our dissenting colleague’s own purposes may be furthered by publicly
impugning the integrity of his colleagues. Collegiality, cooperation and the court’s decision-making
process clearly are not. And public confidence in the judicial system and in this court clearly are
not.”).
Because we judges are unelected and serve during good behavior, our only source of
democratic legitimacy is the perception that we engage in principled decision-making. See Planned
Parenthood v. Casey, 505 U.S. 833, 865-66 (1992). This perception is based both in the reality of
our practice — I believe that my colleagues, all of them, strive to decide cases in a principled manner
— and in the presentation of our decisions to the public in written opinions.
The decisions of this court are not self-executing but instead must be carried into practice by
other actors. They will do so only as long as they regard us as legitimate, as we possess neither the
purse nor the sword, but only judgment. For this reason, we are often described as the weakest
branch, but a court without purse, sword, or legitimacy would be weaker still. This is not to argue
that protecting the relative strength of the judicial branch should be our primary concern. Indeed,
we have all sworn to uphold the Constitution, and the Nation needs a strong judiciary to check the
occasional excesses of the other branches and, more importantly, to preserve the rule of law.
Our ability to perform these crucial tasks is imperiled when members of this court take it
upon themselves to “expose to public view” disagreements over procedure. The damage done by
such exposés is, at least in part, the responsibility of those who report them, despite the efforts of
Judge Boggs and those joining his opinion to disclaim responsibility for their own conduct. It is
understandable, however, that they do so, as their conduct in the present case is nothing short of
shameful.
II.
With great reluctance, I find myself forced to respond to Judge Boggs’s inaccurate and
misleading account of the procedural facts underlying the present case.2 As discussed in Part I of
at 89. He does contend, however, that the result in the present case represents unprincipled
procedural maneuvering by members of this court. It is this contention to which I object.
2
This response is truly a recourse of last resort, as several members of this court have
endeavored to persuade Judge Boggs to withdraw the “Procedural Appendix.” He has steadfastly
Nos. 01-1447/1516
Grutter v. Bollinger
Page 25
this opinion, I firmly believe that matters of internal court procedure should not be exposed to public
view. But when one is attacked in the way that the members of the majority have been attacked, it
is necessary to present an accurate account of the events in question; to fail to do so would create the
impression that Judge Boggs’s assertions are, in fact, correct.
Judge Boggs and those joining his opinion have numerous complaints regarding the
procedures that were followed in the present case. In the end, however, their chief complaint is that
the present case has been decided by a nine-judge en banc court (“the particular decision-making
body that has . . . decided [the case]”) rather than an eleven-judge en banc court, and that the
members of the hearing panel originally assigned this case (Chief Judge Martin, Judge Daughtrey,
and myself) purposefully engineered this result. A number of Judge Boggs’s unfounded assertions
involve the May 14, 2001 petition for initial en banc hearing filed by Barbara Grutter. Judge Boggs
repeatedly asserts that the “preselected” hearing panel withheld this petition from the other members
of the court until after Judges Norris and Suhrheinrich took senior status, on July 1 and August 15,
2001, respectively.
The Sixth Circuit’s private docket, however, indicates that the May 14 petition for hearing
en banc was first referred to the hearing panel on August 23, 2001, and it was not received by the
panel until several days thereafter.3 By August 23, both Judges Norris and Suhrheinrich had taken
senior status. Even if the hearing panel had taken immediate action to circulate the en banc petition
to the whole court on that date, the case would have been heard by the same en banc court that in fact
heard it on December 6, 2001. The record simply does not support any other conclusion on this
point. Similarly, the June 4, 2001 order holding the en banc petition in abeyance was also referred
to the hearing panel in August 2001. Thus, Judge Boggs’s claim that the June 4 order was not
circulated to the en banc court, on June 4, is true, as far as it goes, but misleading, because that order
was not circulated to any judges at that time, including the hearing panel. This ministerial order was
signed by the clerk of the court and was not issued as a result of any action by the hearing panel.
In addition, Judge Boggs’s assertion that the hearing panel violated the rules or internal
operating procedures of the Sixth Circuit in not circulating the en banc petition to the entire court
refused to do so. The three members of the hearing panel have also personally assured Judge Boggs
that we did not engage in the manipulation of which he has accused us, but he has refused to accept
our assurances.
3
My own records indicate that I first saw the May 14, 2001 petition on September 26, 2001,
at which time I consulted with the other members of the hearing panel about circulating the petition
to the whole court.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 26
after August 23 but prior to October 15, 2001, is simply incorrect.4 On December 5, 2000, months
before the filing of the petition in the present case, Chief Judge Martin instituted a policy regarding
the treatment of petitions for initial hearing en banc. This change in policy was spurred by the
increasing frequency of such petitions, especially in pro se appeals. In the letter detailing the policy,
the chief judge instructed that, when such a petition is filed, the clerk of the court should enter an
order, such as that issued in the present case, holding the petition in abeyance until the completion
of briefing, and then refer the petition to the hearing panel assigned the cases. This procedure was
followed in the present case. In each case, the assigned hearing panel would then decide, as an initial
matter, whether to deny the petition and proceed with the scheduled panel consideration or, if the
petition raised a legitimate ground for initial hearing en banc, to circulate the petition to the rest of
the court. To my knowledge, no one raised any objection to this policy when it was circulated to the
court for comment and instituted in December 2000. Pursuant to this policy, the hearing panel in
the present case decided, in September 2001, not to circulate the en banc petition to the entire court.
Whatever the prior practice of the Sixth Circuit with respect to the circulation of petitions for initial
hearing en banc, see Dissenting Op. at 86 n.43 (discussing petitions filed in the year 2000), the
hearing panel in the present case was not required to circulate the May 14 en banc petition under the
policy in effect in September 2001.
As Judge Boggs indicates in his dissent, an initial hearing of a case en banc is an extremely
rare occurrence. See Dissenting Op. at 88 (“I have been on the court for [sixteen] years, and I do not
recall an initial hearing en banc in my tenure.”). Thus, the hearing panel’s decision not to circulate
the petition for an initial hearing en banc in the present case — prior to the events discussed infra
— is perfectly understandable. Indeed, if the members of the hearing panel had circulated the May
14 petition in September 2001, the other members of the court would have likely voted not to hear
the case initially en banc, since Judge Boggs cannot recall any other instance of such a petition
having been granted in the past sixteen years. In light of this consideration, however, I do not see
how the hearing panel can be faulted for not circulating the petition.
Judge Boggs also objects to the treatment of the present case as a “must panel” case, the
composition of the “preselected” hearing panel, and the handling of all actions and motions related
to this appeal by the “preselected” hearing panel. These objections are relatively minor, given the
subsequent decision to hear the case initially en banc.5 Indeed, this court’s decision to hear the
present case en banc was motivated by the concerns related to the composition of the hearing panel.
4
Of course, given the composition of the court on August 23, 2001, it would not have made
any difference to the outcome of the case whether the en banc petition had been circulated on that
date, or in September, or in early October 2001.
5
These objections are also minor in that Judge Boggs does not argue that any of the decisions
with which he finds fault actually changed the outcome of the present case.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 27
These concerns were raised by Senior Circuit Judge Ralph Guy in a letter to Chief Judge Martin,
which was dated October 15, 2001. The poll letter, issued by the hearing panel to the en banc court
that very day, stated the following rationale for circulating the petition for hearing en banc:
Re: Petition for Initial Hearing En Banc; Request for a Poll
Plaintiffs Gratz and Grutter have filed a petition for initial hearing en banc in
these two cases concerning the admissions policies of the University of Michigan and
its law school. Pursuant to the usual court policy, this petition for initial hearing en
banc was referred to the panel hearing the case. The reasons stated for initial hearing
en banc were the “exceptional importance” of the case, the “inevitable conflict” with
another federal circuit’s opinion in view of the already conflicting decisions of the
Fifth Circuit in Hopwood v. Texas, 78 F.3d 932 (5th Cir. 1996), and 236 F.3d 256
(5th Cir. 2000), and the Ninth Circuit in Smith v. University of Washington Law Sch.,
233 F.3d 1188 (9th Cir. 2000), and the need for expedited resolution.
The panel that was assigned this case is Chief Judge Martin, Judge
Daughtrey, and Judge Moore. The panel believed that the usual court policy referring
a petition for initial hearing en banc should be followed, and that the reasons set forth
for initial hearing en banc did not warrant such an initial hearing. The panel already
had expedited the appeal process, the conflict between the circuits already existed,
and we had not heard en banc any number of other exceptionally important cases.
Because of a question that has been raised regarding the composition of the
panel, the panel believes that the en banc court should vote on the petition for initial
hearing en banc. Hence the petition is attached for a vote. Since the case is
scheduled to be heard by the panel on Wednesday, October 23, time is of the essence
in deciding whether to proceed initially en banc.
Judges Daughtrey and Moore were on the initial panel in 1999 considering
questions of intervention. Grutter v. Bollinger, 188 F.3d 394 (6th Cir. 1999). The
third judge was Judge Stafford, a Senior District Judge from the Northern District of
Florida. Pursuant to our “must panel” practice, Judges Daughtrey and Moore have
continued on this case. Chief Judge Martin was substituted for Judge Stafford.
The panel requests that the en banc court be polled regarding the petition for
initial hearing en banc.
The vote for hearing en banc was seven in favor — Chief Judge Martin, Judges Siler, Daughtrey,
Moore, Cole, Clay, and Gilman — with no votes cast against hearing en banc. Neither Judge Boggs
Nos. 01-1447/1516
Grutter v. Bollinger
Page 28
nor Judge Batchelder voted in this matter, but, pursuant to our rules, their non-votes were in effect
votes against the en banc hearing of the present case.
This court voted to hear the present case en banc in order to resolve the concerns of certain
members of the court about the composition of the hearing panel. Judge Boggs and those joining
his opinion now complain about the composition of the en banc court. But, as I have demonstrated
supra, these complaints are without merit. Moreover, even if the “preselected” hearing panel had
acted as Judge Boggs claims, which it did not, it is important to note that this did not deprive Judge
Boggs and the other dissenters of the opportunity to call for initial hearing en banc on their own
initiative at any time.
The internal operating procedures of this court permit any active judge to request a poll for
hearing a case initially en banc, regardless of whether a party has filed a petition for hearing en banc.
See 6 Cir. I.O.P. 35(c). If, then, Judges Boggs and others were concerned with the selection of the
hearing panel in the present case at some point prior to October 15, 2001, there was an internal
procedure by which they could have addressed those concerns. As the present appeal was filed on
April 2, 2001, prompt action by Judges Boggs and the other dissenters would have resulted in an en
banc hearing before a different en banc court — or, in other words, Judge Boggs and the other
dissenters could have called for an en banc hearing before the eleven-judge en banc court they now
argue was deprived of this opportunity.
The simple fact of the matter is that the present case was treated as a “must panel” case as
early as July 2000. In Grutter v. Bollinger, 188 F.3d 394 (6th Cir. 1999), a panel consisting of Judge
Daughtrey, myself, and Judge William H. Stafford, a senior district judge from the Northern District
of Florida, reversed district court orders denying the motions of prospective intervenors to intervene
in the present case and in its companion case, Gratz v. Bollinger. The opinion in the intervenors’
case was issued on August 10, 1999. Subsequent to that decision, the defendants requested
permission to appeal the district courts’ certification of plaintiff classes in Grutter and Gratz,
pursuant to Federal Rule of Civil Procedure 23(f). On July 10, 2000, the clerk of the court contacted
Judge Daughtrey and me regarding whether those appeals (Sixth Circuit docket numbers 00-0107
and 00-0109), which were consolidated for purposes of appeal, represented a “must panel” situation.
We decided that these cases did represent a “must panel” situation, where subsequent matters should
be returned to the original panel due to their interrelatedness with the original matter, and these cases
were transferred to a motions panel including Judge Daughtrey and myself.
At that time, Chief Judge Martin was substituted for Judge Stafford on the motions panel.
Sixth Circuit rules give the active members of a panel the option of recalling the district judge or
senior circuit judge from another circuit who sat on the panel previously or replacing that judge with
a third Sixth Circuit judge. See 6 Cir. I.O.P. 34(b)(2). Although that rule states that the third Sixth
Circuit judge should be drawn at random, Chief Judge Martin has frequently substituted himself in
a variety of matters, of varying degrees of importance, throughout his tenure as chief judge, in order
Nos. 01-1447/1516
Grutter v. Bollinger
Page 29
to avoid inconveniencing other circuit judges. Thus, it was not unusual for him to place himself on
the panel in July 2000. To my knowledge, no one has objected before to Chief Judge Martin’s filling
of vacancies in other cases, even though his practice of doing so is a matter of common knowledge
among the judges of this court.
This motions panel denied the defendants’ request for permission to appeal the class
certification decisions on September 26, 2000. The same motions panel also granted the parties’
request for permission to file interlocutory appeals in Gratz, pursuant to 28 U.S.C. § 1292(b), on
March 26, 2001 (Sixth Circuit docket numbers 01-0102 and 01-0104).
When the appeal in the present case was filed, the defendants moved this court to stay the
district court’s order enjoining the Law School from considering race as a factor in admissions. The
panel of Chief Judge Martin, Judge Daughtrey, and myself granted this stay in a published order on
April 5, 2001 (Sixth Circuit docket number 01-1447). See Grutter v. Bollinger, 247 F.3d 631 (6th
Cir. 2001). On that same date, the chief judge ordered that the appeals in Grutter and Gratz be
expedited, setting August 1, 2001, as the deadline for the filing of briefs and appendices. Oral
argument was set for the court’s October term.
Thus, it should have been clear to the other members of the court, as of the published order
of April 5, 2001, if not sooner, that the present case was being treated as a “must panel” case and that
the hearing panel would consist of Chief Judge Martin, Judge Daughtrey, and myself. At any point
thereafter, Judge Boggs or any other member of the en banc court — including Judges Norris and
Suhrheinrich, before they took senior status — could have called for a poll to determine whether the
case should be heard initially en banc. If there were questions regarding the composition of the
hearing panel, then Judge Boggs and those joining his dissent could have raised those questions
through this means at any time.
Judge Boggs and those joining his dissent did not raise these concerns in this manner,
however. In fact, the dissenters themselves did not raise any complaints with the composition of the
en banc court when the en banc petition was circulated, when the case was argued before the en banc
court, or even in the first circulated draft of Judge Boggs’s dissent. The lateness of their complaints
suggests that their primary complaint is with the outcome of the present case rather than with the
procedures that were followed in arriving at that outcome. But unhappiness over the outcome of the
case cannot justify the dissenters’ “Procedural Appendix.” Judge Boggs’s opinion marks a new low
point in the history of the Sixth Circuit. It will irreparably damage the already strained working
relationships among the judges of this court, and, as discussed in Part I supra, serve to undermine
public confidence in our ability to perform our important role in American democracy. And for what
reason? What purpose does the “Procedural Appendix” serve? Its author does not defend its
inclusion, except to suggest that by placing his version of events in the record, some “remediation”
may be “possible.” Dissenting Op. at 89 n.49. Whatever “remediation” Judge Boggs may envision
Nos. 01-1447/1516
Grutter v. Bollinger
Page 30
is properly the subject of a court meeting, but not the basis for an unprecedented “Procedural
Appendix.”
Nos. 01-1447/1516
Grutter v. Bollinger
Page 31
_____________________
CONCURRENCE
_____________________
CLAY, Circuit Judge, concurring. I concur in Chief Judge Martin’s majority opinion, finding
it correct and insightful in all respects. I write separately, however, for the purpose of speaking to
the misrepresentations made by Judge Boggs in his dissenting opinion which unjustifiably distort
and seek to cast doubt upon the majority opinion.1
A. Justice Powell’s Opinion in Bakke remains “the Law of the Land”
The dissent’s many fallacies begin with its attempt to undermine the majority’s holding that
Justice Powell’s opinion in Bakke is controlling. Indeed, now Supreme Court Justice Scalia once
described Justice Powell’s opinion as “the law of the land.” See Antonin Scalia, Commentary, The
Disease as Cure: “In order to get beyond racism, we must first take account of race.”, 1979 WASH .
U. L.Q. 147, 148 (1979) (speaking then as Professor Scalia on Justice Powell’s opinion in Bakke).
And significantly, since Bakke the Supreme Court has done nothing to render this description of
Justice Powell’s opinion any different. See Agostini v. Felton, 521 U.S. 203, 237 (1997) (reaffirming
that “‘[i]f a precedent of this Court has direct application in a case, . . . the Court of Appeals should
follow the case which directly controls, leaving to this Court the prerogative of overruling its own
decisions’”) (quoting Rodriquez de Quijas v. Shearson/Am. Express, Inc., 490 U.S. 477, 484 (1989));
see also Wessmann v. Gittens, 160 F.3d 790, 796 (1st Cir. 1998) (recognizing that absent a clear
holding from the Supreme Court, the precedential value of Justice Powell’s opinion in Bakke, that
diversity is a sufficiently compelling governmental interest to justify a race-based classification,
should not be disturbed, especially where various individual justices have “from time to time . . .
written approvingly of ethnic diversity in comparable settings”); Mark R. Killenbeck, Pushing
Things Up to Their First Principles: Reflections on the Values of Affirmative Action, 87 CAL. L.
Rev. 1299, 1352 (1999) (illustrating why Justice Powell’s opinion in Bakke is controlling, and why
any other conclusion elevates form over substance inasmuch as Justice Brennan’s opinion cannot
be distinguished from Justice Powell’s opinion on the basis of the level of scrutiny applied, or on any
other basis) (citing Wygant v. Jackson Bd. of Educ., 476 U.S. 267, 286 (1986) (O’Connor, J.,
concurring) (finding that “[a]lthough Justice Powell’s formulation may be viewed as more stringent
than that suggested by Justices Brennan, White, Marshall, and Blackmun, the disparities between
the two tests do not preclude a fair measure of consensus[,]” particularly where “the distinction
between a ‘compelling’ and an ‘important’ governmental purpose may be a negligible one”); Bush
1
Hereinafter, reference to “the dissent” shall be in regard to Judge Boggs’ dissent, while any
reference to Judge Gilman’s dissent shall be specifically addressed as such. Judge Batchelder’s
dissent is not referenced in this opinion.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 32
v. Vera, 517 U.S. 952, 1010 (1996) (Stevens, J., dissenting) (noting that “all equal protection
jurisprudence might be described as a form of rational basis scrutiny; we apply ‘strict scrutiny’ more
to describe the likelihood of success than the character of the test to be applied”); United States v.
Virginia, 518 U.S. 515, 567 (1996) (Scalia, J., dissenting) (contending that “[t]hese tests are no more
scientific than their names suggest, and a further element of randomness is added by the fact that it
is largely up to us which test will be applied in each case”)). One should therefore not be taken in
by the dissent’s many contortions to convolute and undermine the majority’s holding that diversity
in a student body is a recognized compelling governmental interest pursuant to Justice Powell’s
controlling opinion in Bakke.2
B. The Evidence Supports Diversity as a Compelling Governmental Interest
Likewise, one should not be led astray by the dissent’s contention that, Justice Powell’s
opinion aside, developing a diverse student body cannot serve as a compelling state interest. While
criticizing the majority and implying that it is simply huddling behind Justice Powell’s opinion, the
dissent claims that “the majority has given us no argument as to why the engineering of a diverse
student body should be a compelling state interest sufficient to satisfy strict scrutiny.” In an apparent
attempt to elevate itself over the majority opinion, the dissent goes on to claim that it, on the other
hand, considers “the arguments on both sides of this question . . . and conclude[s] that constructing
a diverse educational environment is not a compelling state interest.” The dissent’s claim that it
considers the arguments on both sides is suspect because conspicuously absent from its consideration
of the benefits of a diverse student body is any meaningful recognition of the wealth of legal
scholarship – including a study involving students at the University of Michigan – speaking of, as
well as documenting through empirical data, the positive impact of diversity in education, not just
for the student throughout the educational journey but for years after the educational process is
completed. Although the dissent criticizes this study on various points, the fact remains that the
study has been hailed on many fronts.
Specifically, the major study conducted by University of Michigan Professor of Psychology
and Women’s Studies Patricia Gurin, encompassed a wide scale analysis of the effects of a diverse
learning environment, particularly that at the University of Michigan, on a student’s overall
development, and included data from the Michigan Student Study, the study of Intergroup Relations,
Conflict, and Community Program at the University of Michigan, and the 4-year and 9-year data on
a large national sample of institutions and students from the Cooperative Institutional Research
Program. See Patricia Gurin, Reports submitted on behalf of the University of Michigan: The
Compelling Need for Diversity in Higher Education, 5 MICH. J. RACE & LAW 363, 364 (1999); see
2
In this regard, Judge Gilman’s dissent which “assumes without deciding that educational
diversity as defined by Justice Powell in Bakke is a compelling governmental interest” is misguided
as well.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 33
also Steven A. Holmes, A New Turn in Defense of Affirmative Action, N.Y. TIMES, May 11, 1999,
at A1 (citing Professor Gurin’s report and concluding that “the marshaling of statistical evidence of
the benefits of racial diversity” distinguished the present case involving the University of Michigan
from similar cases involving Universities in California and Texas inasmuch as these institutions
defended their affirmative action policies with only “anecdotal evidence”).
Professor Gurin’s studies, and resulting statistical data, led her to conclude as follows:
A racially and ethnically diverse university student body has far-ranging and
significant benefits for all students, non-minorities and minorities alike. Students
learn better in a diverse educational environment, and they are better prepared to
become active participants in our pluralistic, democratic society once they leave such
a setting. In fact, patterns of racial segregation and separation historically rooted in
our national life can be broken by diversity experiences in higher education. This
Report describes the strong evidence supporting these conclusions derived from three
parallel empirical analyses of university students, as well as from existing social
science theory and research.
Students come to universities at a critical stage of their development, a time
during which they define themselves in relation to others and experiment with
different social roles before making permanent commitments to occupations, social
groups, and intimate personal relationships. In addition, for many students college
is the first sustained exposure to an environment other than their communities.
Higher education is especially influential when its social milieu is different from the
community background from which the students come, and when it is diverse enough
and complex enough to encourage intellectual experimentation. . . .
Students learn more and think deeper, more complex ways in a diverse
educational environment. Extensive research in social psychology demonstrates that
active engagement in learning cannot be taken for granted. . . . Complex thinking
occurs when people encounter a novel situation for which, by definition, they have
no script, or when the environment demands more than their current scripts provide.
Racial diversity in a college or university student body provides the very features that
research has determined are central to producing the conscious mode of thought
educators demand from their students. This is particularly true at the University of
Michigan, because most of the University’s students come to Ann Arbor from
segregated backgrounds. For most students, then, Michigan’s social diversity is new
and unfamiliar, a source or multiple and different perspectives, and likely to produce
contradictory expectations. Social diversity is especially likely to increase effortful,
active thinking when institutions of higher education capitalize on these conditions
Nos. 01-1447/1516
Grutter v. Bollinger
Page 34
in the classroom and provide a climate in which students from diverse backgrounds
frequently interact with each other.
Gurin, supra at 364-65. Professor Gurin backed these conclusions with “one of the most broad and
extensive series of empirical analyses conducted on college students in relation to diversity.” Id. at
365. For example, Professor Gurin examined “multi-institutional national data, the results of an
extensive survey of students at the University of Michigan, and data drawn from a specific classroom
program at the University of Michigan.” Id. All of these studies clearly indicated that interaction
with peers from diverse racial backgrounds, both in the classroom and informally, positively led to
what Professor Gurin referred to as “learning outcomes.” That is, “[s]tudents who experienced the
most racial and ethnic diversity in classroom settings and in informal interactions with peers showed
the greatest engagement in active thinking processes, growth in intellectual engagement and
motivation, and growth in intellectual and academic skills.” Id.
Professor Gurin’s study also indicated that the benefits of a racially diverse student body were
seen in a second major area, that being preparing students for a meaningful role in a democratic
society, or what Professor Gurin called positive “democracy outcomes.” Id. at 365-66. “Students
educated in diverse settings are more motivated and better able to participate in an increasingly
heterogeneous and complex democracy.” Id. at 366. The results of Professor Gurin’s empirical
analysis indicated that these diversity experiences during college “had impressive effects on the
extent to which graduates in the national study were living racially and ethnically integrated lives
in the post-college world. Students with the most diversity experiences during college had the most
cross-racial interactions five years after leaving college.” Id. The analysis also indicated that “[t]he
long-term pattern of racial separation noted by many social scientists can be broken by diversity
experiences in higher education.” Id.
Counsel for Plaintiffs in these underlying actions have been critical of Professor Gurin’s
study and conclusions, claiming that they do nothing to refute the contention that race plays a
predominate role in the admissions process. As one legal commentator has replied to this criticism,
[t]he critical question is not, however, whether or not race, or any other arguably
‘suspect’ group characteristic, plays a ‘predominate role’ in the admissions process.
It is, rather, whether there is a compelling educational justification for allowing that
characteristic to enter the decision-making mix, and it is in that specific context that
the Gurin study makes a contribution.
Killenbeck, supra at 1328. Professor Gurin possibly best illustrated the significance of her findings
as to whether seeking a diverse student body may be considered a compelling state interest when she
concluded that,
Nos. 01-1447/1516
Grutter v. Bollinger
Page 35
[i]n the face of this research evidence, one can only remain unconvinced about the
impact of diversity if one believes that students are “empty vessels” to be filled with
specific content knowledge. Much to our chagrin as educators, we are compelled to
understand that students’ hearts and minds may be impacted the most by what they
learn from their peers. This is precisely why the diversity of the student body is
essential to fulfilling higher education’s mission to enhance learning and encourage
democratic outcomes and values.
Gurin, supra at 422. In light of Gurin’s study and, perhaps more importantly, the data and empirical
evidence backing her findings on the value of a diverse student body, those who like the dissent are
skeptical of characterizing diversity as a compelling governmental interest because “diversity” is not
defined or because they believe it to be a nebulous concept based on anecdotal evidence, find
themselves standing on ill footings. See John Friedl, Making a Compelling Case for Diversity in
College Admissions, 61 U. PITT. L. REV . 1, 29-32 (1999) (noting that “[t]o date, almost all of the
evidence in support of diversity in higher education is anecdotal in nature[,]” while discussing the
lack of concrete, empirical evidence substantiating the value of a diverse student body as a
compelling state interest); see also Wessmann, 160 F.3d at 797 (“[A]ny proponent of any notion of
diversity could recite a . . . litany of virtues. Hence, an inquiring court cannot content itself with
abstractions.”).
Professor Gurin’s empirical evidence supports what Justice Powell found to be true in Bakke
regarding diversity’s place as a compelling state interest. That is, regardless of whether one agrees
that Justice Powell’s opinion in Bakke is controlling, the fact remains that Justice Powell recognized
that a diverse student body is a compelling interest because it promotes the atmosphere of higher
education to which our nation is committed inasmuch as it allows the students to train in an
environment embodied with ideas and mores “as diverse as this Nation of many peoples.” See
Regents of the Univ. of Calif. v. Bakke, 438 U.S. 265, 312-313 (1978) (Powell, J.) (citing Keyishian
v. Bd. of Regents, 385 U.S. 589, 603 (1967)). And, along the lines of Professor Gurin’s study, it was
expressly noted by Justice Powell that it is the student learning from the other student that makes a
diverse student body a compelling need. See id. at 313 n.48. Specifically, Justice Powell noted and
embraced the comments of the president of Princeton University as follows:
“[A] great deal of learning occurs informally. It occurs through interactions among
students of both sexes; of different races, religions, and backgrounds; who come from
cities and rural areas, from various states and countries; who have a wide variety of
interests, talents, and perspectives; and who are able, directly or indirectly, to learn
from their differences and to stimulate one another to reexamine even their most
deeply held assumptions about themselves and their world. As a wise graduate of
ours observed in commenting on this aspect of the educational process, ‘People do
not learn very much when they are surrounded only the by the likes of themselves.’
***
Nos. 01-1447/1516
Grutter v. Bollinger
Page 36
“In the nature of things, it is hard to know how, and when, and even if, this informal
‘learning through diversity’ actually occurs. It does not occur for everyone. For
many, however, the unplanned, casual encounters with roommates, fellow sufferers
in an organic chemistry class, student workers in the library, teammates on a
basketball squad, or other participants in class affairs or student government can be
subtle and yet powerful sources of improved understanding and personal growth.”
Id. (quoting William Bowen, Admissions and the Relevance of Race, Princeton Alumni Weekly 7,
9 (Sept. 26, 1977)). Justice Powell then expressly found that the benefits derived from a diverse
student body apply with substantial force at the graduate level as well as the undergraduate level.
See id. Relying on Sweatt v. Painter, 339 U.S. 629 (1950), he reiterated that the Court made a
similar point with specific reference to legal education: “‘Few students and no one who has
practiced law would choose to study in an academic vacuum, removed from the interplay of ideas
and the exchange of views with which the law is concerned.’” Bakke, 438 U.S. at 313-14 (quoting
Sweatt, 339 U.S. at 634).
In addition to the proffered, and indeed statistically proven, benefits of a diverse student body
in order to fulfill higher education’s mission to enhance learning and encourage democratic
outcomes and values, other reasons for justifying state imposed diversity in the educational realm
have also been proposed. For example, supporters of diversity in the university setting have argued
that seeking a diverse student body is consistent with this country’s historical commitment to
absolute equality in education. See Association of American Universities, On the Importance of
Diversity in University Admissions, N.Y. TIMES, April 24, 1997, at A17; see also Brown v. Bd. of
Educ., 347 U.S. 483, 494-95 (1954) (rejecting the “separate but equal” doctrine of Plessy v.
Ferguson, 163 U.S. 537 (1896), while recognizing and rejecting the past practices of making it
illegal to educate African Americans, or educating them in inferior surroundings). The law school’s
concern with the impact of racial isolation and stigmatization when only a few “token” minorities
are allowed to attend echos this point.
It has also been argued that designing a system that takes into account factors other than
traditional notions of merit is nothing new, inasmuch as the very reason affirmative action arose was
because for years some groups – particularly white males – were provided an advantage over others.
See Killenbeck, supra at 1320. In fact, as indicated in a detailed study conducted by Professor Linda
F. Wightman, who at the time of her research served as Vice President for Testing, Operations, and
Research, Law School Admission Council, Inc., on the realities of affirmative action – “perhaps the
most compelling finding to emerge is not the extent to which affirmative action has opened the doors
of legal education to African Americans and other minorities. Instead, it is the extent to which white
law school applicants routinely benefit from the exceptions to the merit principle.” See id. at 1321
(citing Linda F. Wightman, The Threat to Diversity in Legal Education: An Empirical Analysis of
the Consequences of Abandoning Race as a Factor in Law School Admission Decisions, 72 N.Y.U.
L. REV . 1, 16 tbl.2 (1997)). Killenbeck explains that “[d]ata in [table 2 of Wightman’s study]
Nos. 01-1447/1516
Grutter v. Bollinger
Page 37
indicate that 14.9% of accepted white applicants would not have been predicted as suitable for
acceptance based on the combination of their undergraduate grade point average and LSAT score.
That is, if the purportedly objective merit criteria embraced by opponents of affirmative action were
in fact dispositive, nearly one in every six white applicants actually accepted were arguably not
‘qualified’ in the traditional sense.” See id. at 1321 n.100. Accordingly, for these white applicants,
something more than merit was considered in the admissions process, just as something more is
considered in a program designed to promote diversity. See id.; see also Susan Sturm & Lani
Guinier, The Future of Affirmative Action: Reclaiming the Innovative Ideal, 84 CALIF . L. REV . 953,
968-80 (1996) (criticizing the use of standardized test scores as an indicator of candidates’ suitability
for admission).
In short, the legal scholarship has indicated that a diverse student body serves to promote our
nation’s deep commitment to educational equality, provides significant benefits to all students –
minorities and non-minorities alike, and does so using a system which is not foreign to the
admissions process, but which allows for the benefit of all and not just some. Thus, although the
majority does base its holding that diversity is a compelling governmental interest on Justice
Powell’s opinion in Bakke, it is clear that contrary to the dissent’s criticism, this holding is not
without foundation even when standing alone. On the other hand, the dissent’s conclusion that
diversity cannot serve as a compelling state interest for purposes of surviving constitutional muster
under the Equal Protection Clause, is supported by neither legal scholarship nor empirical evidence.
For example, the dissent questions why race is at all relevant to promoting a student body
rich in diversity of experience. Statistics have shown, however, that using factors other than race
such as socioeconomic status, failed to produce the highly qualified, ethnically diverse student body
achieved when race was also factored into the admissions process. See Wightman, supra at 39-45.
The dissent’s position simply misses that point advanced by Defendants in this case at oral argument;
that is, that a comparably-situated white applicant is a “different person” from the black applicant.
This is obvious when one considers the dissent’s criticism that the University would give diversity
preference to a “conventionally liberal” black student who is the child of “lawyer parents living in
Grosse Pointe” (typically thought of as one of Michigan’s more affluent suburbs).3 Notwithstanding
the fact that the black applicant may be similarly situated financially to the affluent white candidates,
this black applicant may very well bring to the student body life experiences rich in the African-
American traditions emulating the struggle the black race has endured in order for the black applicant
even to have the opportunities and privileges to learn. See A. LEON HIGGINBOTHAM, JR., SHADES
3
The dissent originally characterized the black student as being “conventionally liberal.”
Then, in response to the criticism that this was in itself stereotypical, the dissent added the
parenthetical “or conventionally conservative” to its opinion. This addition, however, does nothing
to change the fact that the dissent is engaging in stereotyping by labeling any minority group as
“conventionally” of certain views.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 38
OF FREEDOM, 195-96, 203 (Oxford University Press 1996) (formulating ten precepts of American
slavery jurisprudence, with the seventh precept being the historical denial of any education to blacks
and making it a crime to teach those who were slaves how to read and write); see also Frederick
Douglass, What to the Slave is the Fourth of July? (1852) (addressing Rochester Ladies’ Anti-
Slavery Society, and noting that “[i]t is admitted in the fact that Southern statute books are covered
with enactments forbidding, under severe fines and penalties, the teaching of the slave to read or to
write”).
It is insulting to African Americans, or to any race or ethnicity that has known oppression and
discrimination the likes of which slavery embodies, to think that a generation enjoying the end
product of a life of affluence has forgotten or cannot relate the enormous personal sacrifice made by
their family members and ancestors not all that long ago in order to make the end possible. Indeed,
we in this country are only a generation or so removed from the legally enforced segregation which
was used to discriminatorily deny African Americans and other minorities access to education, as
well as employment, housing, health care and even basic public facilities. In addition, it is naive to
believe that because an African American lives in an affluent neighborhood, he or she has not known
or been the victim of discrimination such that he or she cannot relate the same life experiences as
the impoverished black person. A well dressed black woman of wealthy means shopping at Neiman
Marcus or in an affluent shopping center may very well be treated with the same suspect eye and
bigotry as the poorly dressed black woman of limited means shopping at Target. See Elise
O’Shaughnessy, Shopping While Black, GOOD HOUSEKEEPING, Nov. 2001, at 129 (recounting Oprah
Winphrey’s experience of being turned away from an affluent store while she was shopping with a
black female companion, even though white customers were allowed admittance, allegedly on the
premise that the store employees were of the belief that Oprah and her friend were the black
transsexuals who had previously tried to rob the store; also recounting the discrimination other
successful black females such as Congresswoman Maxine Waters have experienced while shopping).
Thus, the dissent’s arguments as to why diversity cannot serve as a compelling state interest
constitute nothing more than myopic, baseless conclusions that ignore the daily affairs and
interactions of society today which very well may be experienced by all. And the dissent’s offer to
“stipulate” to the fact that race continues to play a negative role in the lives of minorities is nothing
more than a mere expression of words made in an attempt to minimize the force of the many benefits
of diversity as illustrated above. Anyone who has read the entire dissent quickly realizes that the
dissent’s offer to stipulate that “race does matter,” constitutes a thinly-veiled offer of dubious
sincerity, to say the least.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 39
This is evident by the dissent’s contention that the arguments made in favor of diversity
merely address societal ills that should not be confused with individual rights.4 The “societal ills”
as characterized by the dissent are in fact borne out of the denial of individual rights such that the
two cannot be separated. Indeed, history tells us that the Equal Protection Clause was enacted in an
attempt to cure the “societal ills” that had denied African Americans the individual rights to which
they were entitled, such as the right to an education. See ALBERT P. BLAUSTEIN & CLARENCE CLYDE
FERGUSON, JR., DESEGREGATION AND THE LAW - THE MEANING AND EFFECT OF THE SCHOOL
SEGREGATION CASES 59-67 (Rutgers University Press 1985) (1957). It has been recognized that “the
evil to remedied by this clause” was the “gross injustice and hardship” faced by the “newly
emancipated Negroes” as a class. See In re Slaughter-House Cases, 16 Wall. 36, 81 (1873). And
it has been further recognized that the justifications for the Fourteenth Amendment’s ratification
“retain their validity in modern times, for 114 years after the close of the War Between the States,
. . . racial and other forms of discrimination still remain a fact of life, in the administration of justice
as in our society as a whole.” See Vasquez v. Hillery, 474 U.S. 254, 264 (1986). Accordingly, for
the dissent to claim that “people like Barbara Grutter” are being denied equal treatment under the
law school’s admission policy such that the Equal Protection Clause is being “ignored,” particularly
while irreverently invoking the name of Abraham Lincoln, is completely unfounded. The law
school’s goal of creating a diverse student body, which has not existed previously and would not
otherwise exist without its admissions policy, rests in the very heart of the Equal Protection Clause.
Moreover, contrary to the dissent’s assertion, there is nothing to indicate that the law school’s
admission’s policy has “taken” anything “from the Barbara Grutters of our society.” As one legal
scholar has recently illustrated, the idea that an admissions policy which provides minority applicants
with an advantage does so at the expense of white applicants is simply a myth. See Goodwin Liu,
The Myth & Math of Affirmative Action, The Washington Post, April 14, 2002, at B01 (citing
excerpts from his article “The Causation Fallacy: Bakke and the Basic Arithmetic of Selective
Admissions” which is to be published in the upcoming edition of the Michigan Law Review). As
Liu makes note,
[f]or many Americans, the success of Bakke’s lawsuit has long highlighted what is
unfair about affirmative action: Giving minority applicants a significant advantage
4
I bring to the fore the “societal ills” – as the dissent has couched it – of the past and present
faced by minorities to illustrate that, contrary to the dissent’s assertion, a minority member of
wealthy means may bring to the educational environment the same “life experiences” that a minority
member of impoverished means may bring because the “societal ills” experienced by both transcend
economic status. Once again, the reader should not be led astray by the dissent’s attempt to ignore
or reframe an issue. While it is true that the Supreme Court has found that a generalized claim of
past discrimination cannot serve as the basis for a remedial plan, no such claim is being made in this
case.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 40
causes deserving white applicants to lose out. But to draw such an inference in
Bakke’s case – or in the case of the vast majority of rejected white applicants – is to
indulge in . . . “the causation fallacy.”
There’s no doubt, based on test scores and grades, that Bakke was a highly qualified
applicant. Justice Lewis Powell, who authored the decisive opinion in the case,
observed that Bakke’s Medical College Admission Test (MCAT) scores placed him
in the top tier of test-takers, whereas the average scores of the quota beneficiaries in
1974 placed them in the bottom third. Likewise, his science grade point average was
3.44 on a 4.0 scale, compared with at 2.42 average for the special admittees, and his
overall GPA was similarly superior. Given these numbers, the only reason for
Bakke’s rejection was the school’s need to make room for less qualified minority
applicants, right?
Wrong. Although Justice Powell pointed out that minority applicants were admitted
with grades and test scores much lower than Bakke’s, he did not discuss what I found
to be the most striking data that appeared in his opinion: Bakke’s grades and scores
were significantly higher than the average for the regular admittees. In other words,
his academic qualifications were better than those of the majority of applicants
admitted outside the racial quota. So why didn’t he earn one of the 84 regular
places?
It is clear that the medical school admitted students not only on the basis of grades
and test scores, but on other factors relevant to the study and practice of medicine,
such as compassion, communication skills and commitment to research. Justice
Powell’s opinion does not tell us exactly what qualities the regular admittees had that
Bakke lacked. But it notes that the head of the admissions committee, who
interviewed Bakke, found him “rather limited in approach” to medical problems and
thought he had “very definite opinions which were based more on his personal
viewpoints than upon a study of the total problem.”
Whatever Bakke’s weaknesses were, there were several reasons, apart from
affirmative action, that might have led the medical school to reject his application.
Grades and test scores do not tell us the whole story.
Id.
Liu went on to recognize that although affirmative action did lower Bakke’s chance of
admission to the medical school, what was significant and most telling is “by how much?” Id.
Setting forth the statistical data Liu then observed:
Nos. 01-1447/1516
Grutter v. Bollinger
Page 41
One way to answer this question is to compare Bakke’s chance of admission had he
competed for all 100 seats in the class with his chance of admission competing for
the 84 seats outside of the racial quota. To simplify, let’s assume none of the special
applicants would have been admitted ahead of any regular candidate.
In 1974, Bakke was one of 3,109 regular applicants to the medical school. With the
racial quota, the average likelihood of admission for regular applicants was 2.7
percent (84 divided by 3,109). With no racial quota, the average likelihood of
admission would have been 3.2 percent (100 divided by 3,109). So the quota
increased the average likelihood of rejection from 96.8 percent to 97.3 percent.
To be sure, Bakke was not an average applicant. Only one-sixth of regular applicants
(roughly 520) received an interview. But even among these highly qualified
applicants, eliminating the racial quota would have increased the average rate of
admission from 16 percent (84 divided by 520) to only 19 percent (100 divided by
520). Certainly a few more regular applicants would have been admitted were it not
for affirmative action. But Bakke, upon receiving his rejection letter, had no reason
to believe he would have been among the lucky few.
In fact, Bakke applied in both 1973 and 1974 and, according to evidence in the
lawsuit, he did not even make the waiting list in either year.
The statistical pattern in Bakke’s case is not an anomaly. It occurs in any selection
process in which the applicants who do not benefit from affirmative action greatly
outnumber those who do.
Recent research confirms this point. Using 1989 data from a representative sample
of selective schools, former university presidents William Bowen and Derek Bok
showed in their 1998 book, “The Shape of the River,” that eliminating racial
preferences would have increased the likelihood of admission for white
undergraduate applicants from 25 percent to only 26.5 percent.
The Mellon Foundation, which sponsored the study, provided me with additional
data to calculate admission rates by SAT score. If the schools in the Bowen/Bok
sample had admitted applicants with similar SAT scores at the same rate regardless
of race, the chance of admission for white applicants would have increased by one
percentage point or less at scores 1300 and above, by three to four percentage points
at scores from 1150 to 1299, and by four to seven percentage points at scores below
1150.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 42
It is true that black applicants were admitted at much higher rates than white
applicants with similar grades and test scores. But that fact does not prove that
affirmative action imposes a substantial disadvantage on white applicants. The
extent of the disadvantage depends on the number of blacks and whites in the
applicant pool. Because the number of black applicants to selective institutions is
relatively small, admitting them a higher rates does not significantly lower the chance
of admission for the average individual in the relatively large sea of white applicants.
Id. (emphasis added).
Liu provided further statistical data to back this conclusion as follows:
In the Bowen/Bok study, for example, 60 percent of black applicants scoring 1200-
1249 on the SAT were admitted, compared with 19 percent of whites. In the 1250-
1299 range, 74 percent of blacks were admitted, compared with 23 percent of whites.
These data indicate – more so than proponents of affirmative action typically
acknowledge – that racial preferences give minority applicants a substantial
advantage. But eliminating affirmative action would have increased the admission
rate for whites from 19 percent to only 21 percent in the 1200-1249 range, and from
23 percent to only 24 percent in the 1250-1299 range.
These figures show that rejected white applicants have every reason not to blame
their misfortune on affirmative action. In selective admissions, the competition is so
intense that even without affirmative action, the overwhelming majority of rejected
white applicants still wouldn’t get in.
Id. (emphasis added). And so, contrary to the dissent’s assertion, “the Barbara Grutters of our
society” have no reason to claim that anything has been “taken” from them by virtue of the law
school’s admission policy. In purporting otherwise, the dissent is simply advancing “the causation
fallacy” which Liu exposes for the myth that it is.
The dissent also contends that one cannot consider the remedial qualities of correcting past
– or for that matter present – discrimination as a way of supporting the law school’s admissions
policy because past discrimination is not the basis upon which the school claims that its admissions
policy is operating. Once again, the dissent’s narrow-mindedness misses the point. While it is true
that the law school’s policy is based upon its desire to achieve a diverse student body, the very
reason that the law school is in need of a program to create a diverse environment is because the
discrimination faced by African Americans and other minorities throughout the educational process
has not produced a diverse student body in the normal course of things. Diversity in education, at
its base, is the desegregation of a historically segregated population and, as the intervenors
essentially argue, Bakke and Brown must therefore be read together so as to allow a school to
Nos. 01-1447/1516
Grutter v. Bollinger
Page 43
consider race or ethnicity in its admissions for many reasons, including to remedy past discrimination
or present racial bias in the educational system. See Trevor W. Coleman, A well-deserved honor for
a lifelong legal barrier breaker, The Detroit Free Press, April 26, 2002, at 10A (chronicling the life
of the Honorable William McClain, the University of Michigan’s oldest living African-American
law graduate, and describing how, as the only black law student in his class at the University,
McClain was “fed humiliation nearly every day,” was forbidden from living in the law quad, and was
“prevented from joining study groups which are essential to a legal education”).
In summary, the dissent’s attempt to cast the law school’s interest in achieving a diverse
student body as anything but compelling simply cannot carry the day, and its claim that white
applicants are being denied equal protection under the law as a result of the school’s attempt to
achieve a diverse student body is fallacious. As next illustrated, the dissent’s arguments as to why
the school’s admissions policy is not narrowly tailored to achieve this compelling interest are just
as ill-conceived.
C. The Law School’s Policy is Narrowly Tailored
The dissent quarters its argument as to why the law school’s admissions policy is not
narrowly tailored to achieve the compelling interest of diversity. Each of the four subparts bear
arguments that are unfounded and inflammatory. For example, in first discussing what the dissent
characterizes as the true magnitude of the law school’s policy, the dissent focuses on LSAT and
UGPA data. It then advances the outrageous contention that the law school’s policy allows for a
minority applicant to put forth less effort than the otherwise similarly situated white applicant, and
that somehow the minority will therefore use his race to compensate for his lack of effort. There is
nothing whatsoever in the record to support the allegation that the law school’s admissions policy
would be manipulated in this fashion by people of color or ethnicity.
Similarly, the dissent’s assertion that the law schools treatment of numerical credentials
(UGPA and LSAT scores) for purposes of admission is “shocking,” ignores the scholarly writings
showing no correlation between these numerical credentials and success in law school or bar passage
rates. See Wightman, supra at 1-2 (explaining that while a “numbers only” policy resulted in a sharp
decline in the number of minority students who would have been admitted to law school, there were
no significant differences in the graduation rates and bar passage rates between those minority
students who would have been admitted and those who would not have been admitted, thus leading
to the conclusion that a “numbers only” policy would deny a legal education to many minority
students who were fully capable of the rigors of a legal education and of entering the legal
profession); Sturm & Guinier, supra at 968-80 (explaining standardized test scores’ lack of
predictive value with respect to students’ future performance). The law school’s effort to insure that
its admissions process is inclusionary and is not substantively unfair should be viewed as an effort
to advance the cause of both educational excellence and diversity, not as a counterpoint to a “merit”
plan as suggested by the dissent. The case has not been convincingly made that conventional
Nos. 01-1447/1516
Grutter v. Bollinger
Page 44
admissions plans which equate to higher socio-economic status persuasively correlate to
consideration of “merit.” See id. at 992-96.
The dissent barely conceals its disbelief in the truth of the law school’s assertion that its
admissions officer reads every applicant’s file and makes an individualized determination regarding
the applicant’s suitability for admission. Accepting the dissent’s argument requires, in part, rejecting
the law school’s description of the manner in which its admissions program is administered without
any adequate justifiable basis for doing so. The dissent goes so far as to claim the above-referenced
criticisms of using standardized test scores such as the LSAT and numerical credentials as means
to admission should be directed to the law school and not to the dissent inasmuch as the law school
chooses to consider such credentials in its admission policy. However, the dissent’s claim in this
regard misses the point, and is an example of the misrepresentations made by the dissent in an
apparent attempt to reframe the issues. Criticism of the use of numerical credentials such as LSAT
scores is made in this opinion to support the law school’s use of other criteria in its admission policy
– one of which is race or ethnicity. And, contrary to the dissent’s inflammatory assertion, the law
school relies upon many factors in addition to LSAT scores, UGPAs, and race in its admission
process. Although this assertion undoubtedly bolsters the dissent’s position, it is unfounded and flies
in the face of the record before us.
The dissent next calls into question the law school’s designation of a “critical mass” of
minority students in its student body. Claiming that the term “critical mass” is simply a phrase used
to disguise what is actually an impermissible quota system, the dissent relies heavily upon the fact
that the numbers of minorities admitted over the years has varied only sightly. There may be any
number of likely benign explanations for the numerical configurations, including a consistency in
the quality of minority applications for a few successive years and/or the application of a uniformity
of perspective in evaluating the applications resulting from having the same evaluators read all the
applications for admissions. Even idiosyncratic explanations for a relatively narrow numerical range
for a number of years would be constitutionally acceptable in the absence of a quota or other
invidious motivation on the part of the law school. The point is that on the record of this case, there
are at least as many reasons to presume that there is not a quota as there are to presume that there is
one, and the balance certainly tips in favor of the law school’s representation that it does not employ
a quota in the absence of any evidence to the contrary.5
Typically, the purpose of the narrow tailoring inquiry involves an evaluation of the fit
between the compelling interest and the policy adopted to advance that interest. See Recent Cases,
115 HARV . L. REV . 1239, 1244-45 (2002) (criticizing the Eleventh Circuit’s decision that found the
University of Georgia’s race-conscious admissions policy unconstitutional, while noting that the
5
Inasmuch as Judge Gilman appears to rest his dissent on his belief that the law school’s
policy results in an impermissible quota system, his conclusion is fallacious as well.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 45
court’s opinion “reveals both overt and covert hostility toward affirmative action policies” and that
“[b]y introducing its own substantive agenda under the guise of a narrow tailoring analysis, the court
strayed from the purpose of the narrow tailoring inquiry”). Here, the dissent claims that the link
between the law school’s “critical mass” and the values of diversity is lacking. Oddly, the dissent
cites the report from Professor Gurin, the same report that others have hailed as showing documented
evidence for the benefits of a diverse student body, claiming that the results indicate just the opposite
of how Professor Gurin reports them. This contention, regardless of its accuracy, appears to be in
criticism of the concept of diversity itself, and not of the process to achieve that end.
Next, the dissent criticizes the relationship between diversity and the means to promote this
interest as being dependent upon the psychological makeup of the people involved. The dissent
refers to historical black leaders such as Frederick Douglass and Dr. Martin Luther King, Jr., opining
that these men would have said their piece without regard to whether others thought them to be
“representative.” Apparently, by using these black leaders to make its point, the dissent is claiming
that the process employed by the law school is not necessary because if an African American, or
other minority group member, has the “psychological” make-up to be a leader, he will be so
regardless of whether he is one among ten or one among one hundred. Such an allegation misses
the point of the many beneficial aspects of diversity in education to minorities and non-minorities
alike, is an affront to the sacrifices and contributions made by these black leaders, and does nothing
to show why the law school’s policy is not narrowly tailored. In fact, the dissent appears to be doing
nothing more than “introducing its own substantive agenda under the guise of a narrow tailoring
analysis” in making its arguments here. See Recent Cases, supra at 1239.
Finally, the dissent claims that because race-neutral means are available to achieve academic
diversity, the law school’s program does not pass constitutional muster. In reaching this conclusion,
the dissent completely ignores the evidence provided by the law school and its efforts to formulate
a viable race-neutral policy. The dissent strongly suggests that it simply does not believe the law
school’s representation that it considered and rejected as unworkable or impractical other admissions
policies and procedures, either because the available alternatives would not result in the sort of
competitive student body pursued by the law school overall, or because the number of qualified
minority students attracted to the law school would be inadequate. The law school’s premise, which
the dissent fails to convincingly dispute, is that the number of minority law students admitted would
be inconsequential in the absence of the school’s current admissions program.
Indeed, one of the dissent’s proposals as a “race-neutral” means of admission, using a lottery
for all students above certain threshold figures for their GPA and LSAT, is in no way “race-neutral”
as reflected in the record. For example, the record indicates (through the testimony of Jay Rosner,
Martin Shapiro, and David White among others) that performance on tests such as the LSAT and the
SAT correlates with an applicant’s race and gender. In other words, the record indicates that LSAT
scores are neither race-neutral or gender-neutral criteria for admissions decisions. Consequently, the
dissent’s proposal of using a lottery based upon scores resulting from these tests in order to achieve
Nos. 01-1447/1516
Grutter v. Bollinger
Page 46
a race-neutral means of admission is inherently flawed, and would in no way reflect race-neutral
merit. Instead, such a proposal would reflect a combination of subtle preferences based on race,
gender, and even class, see Sturm & Guinier, supra at 992-96; see also supra text accompanying Part
B, and are of limited utility for predicting meaningful success across racial lines.
At its core, in purporting to suggest race-neutral methodologies, the dissent simply engages
in an impermissible exercise of substituting its judgment in this regard for that of the educators who
are the custodians and guardians of the law school’s mission and academic standards. See Regents
of the Univ. of Mich. v. Ewing, 474 U.S. 214, 225 (1985); see generally Susan Stefan, Leaving Civil
Rights to the “Experts”: From Deference to Abdication Under the Professional Judgment Standard,
102 YALE L.J. 639 (1992) (providing a summary of the general doctrine of the rule of deference and
the situations to which it has been applied). Indeed, on the record before us, any purportedly race-
neutral policy could result in a de facto segregated law school, the deleterious results of which have
long been known by society and rejected by the Court. See, e.g., Sweatt, 339 U.S. at 634-36.
D. Summary
Chief Judge Martin’s majority opinion reversing the district court and finding the law
school’s admissions policy constitutional under the Equal Protection Clause of the Fourteenth
Amendment provides a clear understanding and resolution of the issues involved. The dissent’s
attempt to turn the majority opinion on its head and to reframe the issues does nothing to advance
the jurisprudence on this very significant matter.
E. Response to the Dissent’s “Procedural Appendix”
Although the dissent’s substantive attack, which is grounded in neither fact nor law, is
disturbing, the dissent’s procedural attack, as set forth in its “Procedural Appendix,” constitutes an
embarrassing and incomprehensible attack on the integrity of the Chief Judge and this Court as a
whole. Apparently, the dissent’s strategy in this regard is that if its substantive basis for
disagreement with the majority opinion is not convincing, then questioning the procedural posture
of this case will be enough to forever cast doubt upon the outcome reached here today. This
unfortunate tactic has no place in scholarly jurisprudence and certainly does not deserve to be
dignified with a response. However, because of the magnitude of the issues involved, and because
of the baseless nature of the allegations, this procedural attack cannot go unanswered.
The dissent questions the appropriateness of hearing this case en banc, the course by which
this case came to be heard by the en banc court, and the composition of the en banc court itself. It
should be noted at the outset that throughout the pendency of this appeal, the dissent remained silent
on all of these questions until now, and its concerns should therefore be regarded as having been
waived or forfeited. It was not until the various opinions had been circulated throughout the Court
and the votes cast by the panel members that the dissent revised its opinion by tacking on these
Nos. 01-1447/1516
Grutter v. Bollinger
Page 47
complaints and allegations. And the dissent’s new-found allegations of impropriety as to the course
this matter followed in reaching the en banc court simply defy belief. It is ludicrous to think that
with our circuit operating with only one-half of the active judges’ positions filled, and with over
4000 cases reaching our Court each year, the Chief Judge or any members of this Court would single
out any one particular case and maneuver the system for a particular outcome. None of the decisions
made by the Chief Judge in regard to the scheduling of this case or in relation to administering the
Court’s docket, differ in any significant way from the decisions the Chief Judge and the Court’s staff
routinely and frequently make with respect to pending matters. Given the voluminous nature of the
Court’s docket and the shortage of judicial resources, the case management tasks performed by the
Chief Judge are both necessary and appropriate, and were not in any sense improperly performed in
relation to the instant case.
Again, it is unfortunate that the dissent has chosen to stoop to such desperate and unfounded
allegations which serve no useful purpose. The dissent’s claim that it is “legitimizing” the Court by
revealing the procedural course of this matter is disingenuous, at best, when considering that the
dissent (Judge Boggs) once scathingly attacked Judge Damon J. Keith for revealing the vote count
in a case of major import wherein the denial for rehearing en banc was split seven-seven. See
Memphis Planned Parenthood v. Sundquist, 184 F.3d 600, 605-07 (6th Cir. 1999) (published order)
(Boggs, J.). Judge Keith wrote in Memphis that he revealed the seven-seven vote tally because it
supported his belief that the majority’s opinion was result driven, and to encourage the litigant to
possibly seek further review. See id. at 601-02 (Keith, J.). Judge Keith emphasized that in making
the vote tally known, he had “not violated any rule of internal policy . . .; nor [had he] divulged any
internal confidential communications[,]” and found “reprehensible” the “practices of secrecy and
concealment advocated by Judge Boggs.” Id. at 605. In response, Judge Boggs noted “with regret,
[Judge Keith’s alleged] breach of the long-standing custom of this court that actions by a member
of the court with respect to petitions for rehearing of en banc matters are matters of internal court
procedure and are not made public by other judges.” Id. (Boggs, J.) (emphasis added). Judge Boggs
went so far as to question the accuracy of Judge Keith’s conveyance of the vote tally by writing that
“our court, of course, makes no warranties as to the accuracy of the assertions made in statements
by judges (including, of course, this one).” Id. at 605.
Despite his one-time “regret” for a fellow jurist’s decision to make the vote tally known in
an en banc case, Judge Boggs now characterizes his flagrant disregard for the Court’s procedural
measures with respect to this case as a form of “legitimacy.” Judge Boggs has revealed internal
procedural matters to the public, particularly when he speaks of Senior Judge Ralph Guy’s internal
communication to Chief Judge Martin in footnote 46 of his dissent. Furthermore, the remaining
members of this Court have no way of responding to any inaccuracies by Judge Boggs regarding
Judge Guy’s communication – or Judge Boggs’ characterization thereof – without themselves
resorting to discussing the Court’s internal communications. Like many of the assertions made in
his dissent as a whole, Judge Boggs’ renouncement of secrecy and claim that his procedural
Nos. 01-1447/1516
Grutter v. Bollinger
Page 48
appendix “legitimizes” the Court, are hollow, particularly in light of his position in Memphis.
Indeed, it was “secrecy” for which Judge Boggs so vehemently argued in Memphis.
If anything, the fact that this significant matter was heard initially by the en banc court is a
course of action advocated by justices of the United States Supreme Court. For example, in her letter
to the White Commission, and several times in addressing the Ninth Circuit Judicial Conference,
Justice O’Connor, circuit justice to the Ninth Circuit, has suggested that the courts of appeals sit en
banc in matters they think are likely to reach the Supreme Court. See Stephen L. Wasby, How do
Courts of Appeals En Banc Decisions Fare in the U.S. Supreme Court?, JUDICATURE , Jan. -Feb.
2002, at 184 & n.6. Likewise, Justice Kennedy, himself a former member of the Ninth Circuit,
suggested to the White Commission that “questions of exceptional importance” are not heard en
banc nearly often enough. See id. at 184 & n.7 (quoting Justice Anthony M. Kennedy, letter to
Justice Bryon R. White, August 17, 1998).
Here, in this matter of exceptional importance which may likely reach the Supreme Court,
we as an en banc court have properly and carefully considered the issues involved. Chief Judge
Martin’s thorough majority opinion in every regard reflects that careful consideration, such that the
outcome reached today is one based upon nothing other than sound and scholarly deliberation.
Despite its unfortunate and desperate attempts to portray the majority opinion as anything less, the
dissent’s substantive and procedural attacks remain unpersuasive.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 49
_____________
DISSENT
_____________
BOGGS, Circuit Judge, dissenting. This case involves a straightforward instance of racial
discrimination by a state institution. Other than in the highly charged context of discrimination in
educational decisions in favor of “underrepresented minorities,” the constitutional justifications
offered for this practice would not pass even the slightest scrutiny. See, e.g., Fullilove v. Klutznick,
448 U.S. 448, 491 (1980) (Burger, concurring) (“Any preference based on racial or ethnic criteria
must necessarily receive a most searching examination.”); Regents of the Univ. of Calif. v. Bakke,
438 U.S. 265, 307 (1978) (Powell, concurring) (“Preferring members of any one group for no reason
other than race or ethnic origin is discrimination for its own sake. This the Constitution forbids.”);
Loving v. Virginia, 388 U.S. 1, 11 (1967) (“[T]his Court has consistently repudiated distinctions
between citizens solely because of their ancestry as being odious to a free people whose institutions
are founded upon the doctrine of equality.” (internal quotations omitted)); McLaughlin v. Florida,
379 U.S. 184, 196 (1964) (invalidating a Florida state law against interracial cohabitation as “an
exercise of the state police power which trenches upon the constitutionally protected freedom from
invidious official discrimination based on race”). In our case, the intent of the framers of the policy,
the statistics as to its impact and effect, and the history of its inception all point unmistakably to a
denial of equal protection of the laws. I, therefore, dissent from our court’s decision today finding
this discrimination to be constitutional.
In tracing the intricacies of the argument presented by the court and by the Law School, we
must be aware that the definitions and precise connotations of words are of crucial importance. As
I shall demonstrate, in many critical instances, key words are used in ways contrary to their normal
grammatical meaning, or with very specific qualifications attached sub silentio. In the words of
George Orwell, in his famous essay Politics and the English Language, “a mass of Latin words falls
upon the facts like soft snow, blurring the outline and covering up all the details.” George Orwell,
Politics and the English Language, in 4 THE COLLECTED ESSAYS, JOURNALISM AND LETTERS OF
GEORGE ORWELL : IN FRONT OF YOUR NOSE , 1945-1950 127 (Sonia Orwell and Ian Angus, eds.,
Harcourt, Brace 1968).
A very revealing example of this is the use of the term “affirmative action” to refer to the
policies in question. See Majority Op. at 3 (discussing intervening student groups, including “United
for Equality and Affirmative Action, the Coalition to Defend Affirmative Action By Any Means
Necessary, and Law Students for Affirmative Action”). Standing alone, the term “affirmative
action” might mean anything from affirmative action to study harder to affirmative action to exclude
minorities. However, as used in the context of our society’s struggle against racial discrimination,
the term first enters the public print and the national vocabulary in Executive Order 10925, issued
by President John F. Kennedy on March 6, 1961 and subsequently incorporated into a wide variety
Nos. 01-1447/1516
Grutter v. Bollinger
Page 50
of statutes and regulations. It ordered government contractors to “take affirmative action, to ensure
that applicants are employed, and that employees are treated during employment, without regard to
their race, creed, color, or national origin” Ibid. (emphasis added). It is thus clear that whatever else
Michigan’s policy may be, it is not “affirmative action.”1
The Law School absolutely insists that it does not consider applicants “without regard to”
their race. See, e.g., Admissions Policies, University of Michigan Law School, April 22, 1992, at
12 (noting “a commitment to racial and ethnic diversity with special reference to the inclusion of
students from groups which have been historically discriminated against . . . [and] who without this
commitment might not be represented in our student body in meaningful numbers”). Instead, as is
discussed by the majority and will be discussed at length below, Michigan considers all applicants
with exquisite regard for their race and national origin. As I put it to the counsel for the Law School
in oral argument, if Heman Sweatt, the plaintiff in the famous case of Sweatt v. Painter, 339 U.S.
629 (1950), had been able to ask the Dean of the University of Texas Law School, “Dean, would you
let me in if I were white?,” the dean, if he were honest, would surely have said “Yes.” I then asked
counsel, “If Barbara Grutter walked in to whoever the current Dean of the Law School is and said,
1
I will occasionally use the phrases “race” and “racial” as a shorthand for the type of
preference accorded by the Law School. In fact, the groups chosen for preference are a melange of
groupings that are socially defined:
by skin color (“black” or “African-American.” I note that the children of Boer or Berber
immigrants are not conventionally given the latter label, which would surely apply to them
as a linguistic matter.);
by national origin (as the Census Bureau carefully notes, “Hispanics” can be of any race.
Presumably, the children of the former Peruvian president, Alberto Fujimori, though
ethnographically purely Japanese, would be considered “Hispanic.”);
or by legal status (depending on whether Michigan limits “Native American” preference to
legally enrolled tribal members, as opposed to those with sufficient ancestry of “Indian”
status that would qualify a person with comparable black or Hispanic ancestry for those
designations).
Any shorthand use of those terms in this opinion should be understood to have all the
relevant qualifiers. For similar precision by other universities with racial and ethnic preferences,
see Brief of Amicus Curiae, Columbia Univ., Harvard Univ., Stanford Univ., and the Univ. of Penn.,
in Regents of the Univ. of California v. Bakke, 99 LANDMA RK BRIEFS AND ARGUMENTS OF THE
SUPREME COURT OF THE UNITED STATES : CONSTITUTIONAL LAW 1977 TERM SUPP . 689, 698 n.3
(Phillip B. Kurland & Gerhard Casper, eds., 1978).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 51
‘Dean, would you let me in if I were black?’ wouldn’t he have to honestly say either ‘Yes’ or ‘pretty
darn almost certain[ly]’?” Counsel agreed, but responded that “a black woman who had otherwise
an application that looked like Barbara Grutter, that would be a different person.” Tr. at 38 (emphasis
added).
That answer puts starkly the policy of discrimination practiced throughout the ages.
Throughout this discussion, my quarrel is with the constitutionality of the policy, not its
proponents. In a related context, Robert’s Rules of Order gives a good rule for public disputation:
those engaged in a debate “can condemn the nature or likely consequences of the proposed measure
in strong terms, but . . . under no circumstances . . . attack or question the motives of another.”
General Henry M. Robert, ROBERT ’S RULES OF ORDER 380 (10th ed. 2000). I have no doubt that
the proponents of this discriminatory policy act with the most tender of motives. However, the noble
motives of those propounding unconstitutional policies should not save those policies, just as some
segregationists’ genuine belief that segregated education provided better education for both races was
inadequate to justify those policies.
Finally, I do not doubt that there are strong policy arguments for what Michigan has done.
There is a plausible (though perhaps not a sound) policy argument that government should arrange
social outcomes proportionally according to the race or ethnicity of its citizens, remedying, where
it can, any pervasively unequal distribution of wealth, education, or status. There are many countries
– India, Malaysia, and Serbia, to name a few – where such a policy is practiced. For more on
“affirmative action” worldwide, see Thomas Sowell, RACE AND CULTURE : A WORLD VIEW 126-29
(Basic 1994). However, so long as the Equal Protection Clause is a part of the United States
Constitution, the United States is not one of those countries. The fact that some might think this
society would be a better one if more governmental benefits were allocated, because of their racial
or ethnic status, to blacks, Hispanics, or Native Americans and less to whites, Asians, or Jews, or
vice-versa, does not make those policies permissible under our Constitution.
Instead, the framers of the Fourteenth Amendment decided that our government should
abstain from social engineering through explicit racial classifications. Thus, we subject every state
racial classification to “strict scrutiny,” requiring that the state show both that the classification
furthers a “compelling state interest” and that it is “narrowly tailored” to achieve that interest.
Adarand Constructors v. Pena, 515 U.S. 200, 235 (1995). The Law School’s admissions scheme
simply cannot withstand the scrutiny that the Constitution demands.
My discussion of the reasons for that conclusion falls into two parts below. First, I examine
why the majority’s reading of Bakke is erroneous. Read correctly, Bakke remains good law, but does
not conclusively resolve the questions before this court. More recent decisions of the Supreme
Court, contrary to Grutter’s argument and what the district court in this case held, place these
questions in no greater relief.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 52
We are therefore faced with resolving for ourselves the constitutionality of the Law School’s
admissions scheme. Our inquiry must address at least one open question of law: can achieving
diversity be a compelling state interest? On this open question, I have no argument to which to
respond, as the majority never explains why “diversity” should be a compelling state interest, except
to say that the conclusion is demanded by Bakke.2 After considering the arguments on both sides,
I conclude that the state’s interest in a diverse student body, at least as articulated by the Law School,
cannot constitute a compelling state interest sufficient to satisfy strict scrutiny.
Second, much like Justice Powell’s in Bakke, my answer to whether the engineering of a
racially diverse student body is a compelling state interest is not necessary to the resolution of the
case before this court. Even if student diversity were a compelling state interest, the Law School’s
admissions scheme could not be considered narrowly tailored to that interest. Even a cursory glance
at the Law School’s admissions data reveals the staggering magnitude of the Law School’s racial
preference. Its admissions officers have swapped tailor’s shears for a chainsaw.
I. The State of the Current Law
A. Bakke in a Nutshell
The Law School and the majority of this court argue that the constitutionality of the Law
School’s policy is mandated by Supreme Court precedent, engaging in a painstaking analysis of the
Supreme Court’s decision in Regents of the University of California v. Bakke, 438 U.S. 265 (1978),
and the instructions given in Marks v. United States, 430 U.S. 188 (1977), for attempting to discern
a “holding” from decisions in which the Court is splintered. I will engage in an equally detailed
counter-analysis; however, I begin with what is obvious from the face of the opinion.
In Bakke, the Supreme Court held that the particular type of massive racial discrimination
engaged in by the University of California at Davis – setting aside a certain number of seats each
year and utilizing a separate admissions system for minority applicants – was illegal and that Allan
Bakke had a right not to be so discriminated against.3 (This fact is not revealed until page 12 of the
majority’s decision, and then only obliquely). However, five members of the Court agreed that a
2
The concurring opinion does present substantive arguments on this point, which are
considered in Part II.A. Concurring Op. at 29-39 (Clay).
3
The judgment of the Court, affirming the judgment of the California Supreme Court and
ordering UC Davis to admit Bakke, was supported by the opinions of Justice Powell, Bakke, 438
U.S. at 320, who would have held that UC Davis’s program violated the Fourteenth Amendment,
and Justice Stevens, Id. at 421, who was joined by Chief Justice Burger and Justices Stewart and
Rehnquist in his argument that the program violated Title VI of the Civil Rights Act of 1964.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 53
blanket injunction that race could never be considered in admissions programs was at least
premature, and one of those members went on to state that race could be used to promote diversity
and proffered the race-conscious admissions program briefly described in an amicus brief by Harvard
University as a model of such a plan.4
Unfortunately, no policy other than the specific one utilized by UC Davis was before the
Court. Thus, no matter what analytical artillery is applied to deconstruct the various Bakke opinions,
we cannot come up with a “holding” that is any more specific than that UC Davis’s plan (and all
plans that absolutely reserve a specific number of seats for the racially favored) was unconstitutional,
and that some type of racial preference may be constitutional.
The majority in this case applies extremely subtle reasoning to come to the conclusion that
Bakke should instead be read to hold that the use of race, no matter how extensive, is constitutional
so long as it does not specify a number of seats to be reserved for minorities and so long as it
arguably tracks the Harvard plan. The majority’s reasoning is problematic for several reasons.
Consider an exact analogy in the field of criminal law. Let us assume that state C has a
policy that its prison guards may beat prisoners to within “half an inch of their lives” for any
disciplinary infraction. When that policy is challenged in the Supreme Court, the Court’s holding
is that the particular policy is unconstitutional, but that it will not issue an injunction against guards
ever touching a prisoner for any infraction. Four members of the court believe that the policy is
constitutional in its entirety, and therefore dissent from the portion of the opinion holding C’s policy
unconstitutional. Four other Justices argue that guards should never be allowed to punish prisoners
physically, and therefore dissent from the portion of the opinion refusing to issue an injunction
against guards ever touching prisoners. A swing Justice strikes down the policy before him, but
argues that at some time, in some manner, physical discipline might be appropriate. In particular,
he speaks favorably of the plan of a particular state (call it the “H” plan) where, under some
circumstances not specifically delineated, a guard could administer some unspecified amount of
physical chastisement.
Following this decision, another state, call it M, defends its policy on the grounds that it
merely authorizes guards to beat prisoners within “an inch of their lives” (as opposed to “half an
inch”), and that it is specifically modeled after the H plan. Under the majority’s logic, any lower
court confronted with this policy would be required to find it constitutional.
4
The description of the Harvard plan in this amicus brief was exceedingly short and
undetailed, consisting of less than four pages. For the description, see LANDMA RK BRIEFS AND
ARGUMENTS, supra n.1, 735-38.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 54
It fails as a matter of simple logic to take a splintered result striking down one policy and
essentially to glean from it a holding that any policy that falls short of the original policy is
constitutional. Indeed, the Supreme Court has very recently warned courts of appeals against similar
thinking. In United States v. Knights, 122 S. Ct. 587 (2001), the Court rejected the Ninth Circuit’s
reading of Griffin v. Wisconsin, 483 U.S. 868 (1987), a case in which the Court approved a certain
search-and-seizure policy for certain probationers. The Court noted that the court of appeals had
apparently read Griffin to stand for the proposition that “a warrantless search of a probationer
satisfies the Fourth Amendment only if it is just like the search at issue in Griffin.” See Knights, 122
S. Ct. at 590. In rejecting the Ninth Circuit’s gloss on Griffin, the Court called it “dubious logic —
that an opinion upholding the constitutionality of a particular search implicitly holds unconstitutional
any search that is not like it.” Ibid. (emphasis added). In effect, the majority of this court today
similarly holds incorrectly that an opinion denying the legality of a particular policy implicitly holds
constitutional every policy that falls in the slightest degree short of the evils that were condemned
in the first case.
The court does this by going past the general, and thus unhelpful, propositions actually agreed
to by a majority of the Court in Bakke and adopting and even expanding as the holding of the case
every nuance of the opinion written by Justice Powell. In Part IV-D of his opinion, Justice Powell
stated that race can be used as a factor in admissions decisions in order to further the objective of
diversity in an academic setting because the state has a compelling interest in achieving a diverse
student body. No other Justice joined that Part. Bakke, 438 U.S. at 311-15. In Part V-A of his
opinion, Justice Powell set out as a model of a constitutional plan a race-based admissions plan
utilized by Harvard University, in which race was utilized as a “plus” factor that could “tip the
balance” in an applicant’s favor. No other Justice joined that Part. Id. at 315-20. The majority of
this court holds that these are the precedential holdings to be found in the case because, by reading
Bakke through the – in this case easily manipulated – lens of Marks, the court has determined that
a certain reading of the language of Justice Powell’s opinion represents the holding of the Bakke
Court.
B. Bakke and Marks
1. Marks
Marks was an appeal from a conviction for transporting obscene materials in interstate
commerce. The defendant challenged the use of a jury instruction defining obscene material that
came from a Supreme Court case decided after the time of the defendant’s conduct, Miller v.
California, 413 U.S. 15 (1973). The defendant alleged that the new definition expanded the scope
of prohibited conduct, and therefore could not be applied in his case without violating his Due
Process rights. The Court therefore needed to determine what the operative definition of obscene
material was before Miller.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 55
The problem was that in the last obscenity case decided by the Court before Miller, Memoirs
v. Massachusetts, 383 U.S. 413 (1966), no opinion garnered a majority. In fact, the Court in
Memoirs was deeply fragmented, and it was not facially clear that there was one definition for what
constituted obscene material that could be derived from the various opinions. Two Justices
expressed the view that all sexually explicit material was entitled to full First Amendment protection.
Id. at 421 (Black, dissenting). One Justice believed that only “hard core pornography” was
unprotected. Id. at 425 (Stewart, dissenting). Three Justices joining a plurality opinion opined most
importantly that material must be “utterly without redeeming social value” before it will be stripped
of First Amendment protection. Id. at 418. The remaining three Justices, writing in various dissents,
would have set the bar lower for defining material as obscene. Id. at 443 (Clark, dissenting), 454-56
(Harlan, dissenting), 460-61 (White, dissenting).
The Court in Marks, viewing the divided landscape of Memoirs, stated famously that “[w]hen
a fragmented Court decides a case and no single rationale explaining the result enjoys the assent of
five Justices, ‘the holding of the Court may be viewed as that position taken by those Members who
concurred in the judgments on the narrowest grounds.’” Marks, 430 U.S. at 193 (quoting Gregg v.
Georgia, 428 U.S. 153, 169 n.15 (1976)). In Marks itself, it was clear that the Memoirs plurality
decision represented the narrowest grounds for the holding, as the plurality would have struck down
the fewest state and federal statutes defining materials as obscene.
Taken on its face, Marks might be read only for the limited proposition that a criminal
defendant cannot be held liable for conduct that he did not have fair notice would be prohibited. Id.
at 192-93. However, Marks has been read much more broadly, to provide a basis for discerning the
holding of the Court in circumstances where a majority of the Justices agree on an outcome but not
on a rationale for the outcome. See, e.g., O'Dell v. Netherland, 521 U.S. 151, 160 (1997) (utilizing
Marks analysis to discern a holding in Gardner v. Florida, 430 U.S. 349 (1977)); Coe v. Bell, 209
F.3d 815, 818 (6th Cir. 2000) (using Marks to discern a holding from Ford v. Wainwright, 477 U.S.
399 (1986)).
2. The Problematic Application of Marks to Bakke
In applying Marks to the various opinions in Bakke, the majority contends that Justice
Powell’s opinion is necessarily the holding of the Court, because he concurred in the judgment of
the Court on the narrowest grounds. Powell, applying strict scrutiny, held that the UC Davis
affirmative action program was unconstitutional, but also asserted that race could be taken into
account in admissions decisions in certain circumstances, namely to promote diversity. Bakke, 438
U.S. at 314-15. Justice Stevens, in an opinion joined by three other Justices, did not reach the
constitutional issue but concurred in the judgment on the basis that race could never be used without
violating Title VI. Id. at 408-21. Justice Brennan, concurring in part and dissenting in part and
joined by three other Justices, would have upheld UC Davis’s program, subjecting it only to
intermediate scrutiny. Id. at 362. Justice Brennan wrote that race could be used in admissions
Nos. 01-1447/1516
Grutter v. Bollinger
Page 56
programs “to remedy disadvantages cast on minorities by past racial prejudice, at least when
appropriate findings have been made by judicial, legislative, or administrative bodies with
competence to act in this area.” Id. at 325. As such, Justice Brennan and the three Justices joining
his opinion concurred with Justice Powell’s judgment overturning the California Supreme Court’s
ruling that race could never be used in admissions programs, but would have found UC Davis’s
program constitutional on the basis that it sought to remedy past discrimination and so dissented
from Justice Powell’s holding on that score.
Since Justice Brennan would have applied intermediate scrutiny to “benign” racial
classifications, whereas Justice Powell would have applied strict scrutiny to all racial classifications,
the majority holds that Justice Powell’s diversity rationale in Bakke is binding precedent.
Specifically, they explain that “[b]ecause the set of constitutionally permissible racial classifications
under intermediate scrutiny, by definition, includes those classifications constitutionally permissible
under strict scrutiny, Justice Powell’s rationale would permit the most limited consideration of race;
therefore, it is Bakke’s narrowest rationale.” Majority Op. at 9. In other words, the majority sees
Justice Powell’s reasoning as a subset of Justice Brennan’s, and therefore reasons it to be the binding
holding of Bakke, as Marks instructs us to glean it. There are, however, two fundamental problems
with this argument.
First, the majority’s analysis inverts the concept of “narrowness” in Marks. In Marks, the
Memoirs plurality opinion was “narrowest” because its interpretation of the First Amendment
invalidated a smaller set of laws. Marks, 430 U.S. at 193. In other words, the “narrower” opinion
was that which construed the constitutional provision in question less potently. In Bakke, Justice
Brennan’s opinion, by adopting intermediate scrutiny, would invalidate fewer racial preference
policies than Justice Powell’s opinion which, through strict scrutiny, would invalidate more. Yet
the majority applies its own concept of narrowness, with no grounding in Marks, and holds that the
opinion that creates the more powerful Fourteenth Amendment is indeed the narrower.
Second, the fact that Justice Powell’s reasoning on standards (that strict scrutiny should be
used to evaluate the constitutionality of all racial preferences) is a subset of Justice Brennan’s
(applying merely intermediate scrutiny) tells us nothing about the first question before this court
today: whether diversity is a compelling state interest. At most, it might tell us that if the question
before this court were whether to apply intermediate scrutiny or strict scrutiny to our analysis of the
Law School’s admissions program, the answer would be strict scrutiny. However, that question is
not before this court, because it has been conclusively answered, in favor of strict scrutiny. In
Adarand, 515 U.S. at 227, the Supreme Court held that all racial classifications are subject to strict
scrutiny.
In trying to divine a holding from Bakke supporting the use of race for diversity purposes,
we are not able to apply Marks on a surface level, relying only on the fact that Justice Powell would
have applied a stricter standard of scrutiny to race-based classifications than would have Justice
Nos. 01-1447/1516
Grutter v. Bollinger
Page 57
Brennan. The unavailability of a “surface-level” application of Marks may itself be dispositive.
After all, Marks is merely a tool with which to determine the collective intent of a fractured court.
Because the first-level Marks analysis has been displaced by intervening precedent, perhaps the
application of Marks to the still-open questions raised by the Powell and Brennan opinions in Bakke
can no longer serve its intended purpose of deriving the collective intent of the Court, as the
assumptions of the Justices deciding Bakke no longer hold.
The application of Marks to Bakke is also inapt because (1) the separate opinions in Bakke
do not constitute a coherent set and subset of each other and cannot be placed on a logical
continuum; (2) the application of Marks really yields two Marks holdings from Bakke; and (3) the
Supreme Court and other courts have recognized that Bakke does not yield a useful holding on the
constitutionally permissible use of race and that Marks ought not be applied in the circumstances that
obtain here.
a. No Set and Subset or Continuum Available in Bakke
Nevertheless, if we are still to use the Marks apparatus, we need to examine the specific
rationales offered by Justices Powell and Brennan to determine whether it is possible, in this court’s
words, to characterize one Justice’s rationale supporting the judgment as a “coherent subset of the
principles articulated” by the other’s rationale. Triplett Grille v. City of Akron, 40 F.3d 129, 134 (6th
Cir. 1994).
There are potentially two judgments in Bakke. One struck down UC Davis’s admissions
program. The second purported to overturn an injunction against all use of race, after discussing
possible permissible bases for utilizing race in admissions decisions. With respect to the latter issue,
the majority in its Marks analysis defines the judgment as stating that race can be used in certain
circumstances by educational institutions.5 See Majority Op. at 6.
In order to view the rationale of Justice Powell’s concurrence as the narrowest grounds in
support of this judgment, the court must read Justice Powell as embracing the use of race only for
5
The majority quotes from Section V-C of Justice Powell’s opinion, which was joined by the
Brennan group and which states:
In enjoining petitioner from ever considering the race of any applicant, however, the
courts below failed to recognize that the State has a substantial interest that
legitimately may be served by a properly devised admissions program involving the
competitive consideration of race and ethnic origin. For this reason, so much of the
California court's judgment as enjoins petitioner from any consideration of the race
of any applicant must be reversed.
438 U.S. at 320 (emphasis added).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 58
the limited purpose of promoting diversity, while Justice Brennan would have permitted the use of
race more broadly, to promote diversity and to remedy past discrimination. On its face, Justice
Brennan’s writing in Bakke does not support the use of race for both diversity and remedial purposes.
Nowhere in Justice Brennan’s opinion does he mention the diversity rationale, and he explicitly did
not join Part IV-D of Justice Powell’s opinion, discussing the diversity rationale. Further, as
mentioned above, Justice Brennan clearly states that “the central meaning of today’s opinions” is that
“[g]overnment may take race into account when it acts not to demean or insult any racial group, but
to remedy disadvantages cast on minorities by past racial prejudice.” Bakke, 438 U.S. at 325
(emphasis added). Finally, in his now-famous first footnote, Justice Brennan, writing for himself
and the three other Justices who joined his opinion, agrees that a plan like the Harvard plan set out
as a model by Justice Powell would be “constitutional under our approach, at least so long as the use
of race to achieve an integrated student body is necessitated by the lingering effects of past
discrimination.” Id. at 326 n.1 (emphasis added).6
If one reads Justice Brennan’s opinion as approving the use of race for remedial purposes,
but not for diversity, one could make the argument that Justice Powell’s opinion, which accepts the
general concept of a diversity rationale, is broader than Justice Brennan’s, which accepts only a more
specific “past discrimination” rationale. Indeed, in a world permitting the use of race in admissions
decisions when it is used to promote diversity, educational institutions would merely have to place
a label on their actions in order to pass constitutional muster. There is no facial limit on the use or
6
A normal reading of this sentence would be that if the policy in question were necessitated
by the lingering effects of past discrimination, the Brennan group would hold it constitutional.
Therefore, if the policy were not so necessitated, one might argue by expressio unius that the
Brennan group would hold it unconstitutional; at most one might argue that they would be wholly
agnostic on the constitutionality of such a policy. However, the majority’s grammatical
deconstruction, arguing that the footnote somehow provides affirmative support for the proposition
that diversity is a compelling state interest, simply does not bear examination. Majority Op. at 10.
It is quite correct, as the majority points out, that “at least so long as” does not mean “only if.” Ibid.
However, it does mean “if,” which is all that is necessary to show that the Brennan concurrence –
while not affirmatively rejecting the Powell diversity rationale – certainly did not endorse it.
Further, the majority’s attempt to distinguish between the language modifying when race may
be used and why it may be used adds nothing, because a temporal qualifier at least hints at some
reasoning related to that limitation. If I am told I can only buy beer between the hours of nine and
five, it may be because those are the hours when liquor stores are open, or it may be because of state
legislation limiting beer sales, or it may be because liquor store owners fear shoplifting at other
hours; however, each of these rationales is related in a causal way to the time limitation. In just the
same way, it may be that Justice Brennan really meant only that race could be used when
“necessitated by the lingering effects of past discrimination,” but this is still a qualification on the
scope of Justice Powell’s diversity rationale.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 59
the ends of a race-based admissions policy seeking “diversity.” The remedial rationale, on the other
hand, would at least require some proof of past discrimination, and it would provide an obvious
endpoint for the program, namely when that past discrimination has been remedied.
At the very least, however, since Justice Powell rejected the past discrimination rationale and
Justice Brennan can be read to have implicitly rejected the diversity rationale, there is no continuum
to be found in Bakke; instead of a broader holding and a narrower holding, what we might have are
two different and non-comparable holdings. If such a reading is adopted, the “holding” that the
majority of this court has divined from the Supreme Court’s Bakke decision is a rationale set out by
one Justice and rejected by eight. See Cass R. Sunstein, Public Deliberation, Affirmative Action, and
the Supreme Court, 84 Calif. L. Rev. 1179, 1185 (1996) (noting that the “rule” in Bakke represented
the thought of just one Justice, while “[t]he other eight participating justices explicitly rejected that
rule”). This hardly can be consistent with the letter or the spirit of Marks.7
Viewing the rationales for the use of race put forth by the Bakke concurrences not as a
continuum (or a set and subset), but as several distinct and unrelated justifications, is one of the ways
one might argue that Marks simply does not apply to Bakke. Indeed, this is precisely what the
district court held in the present case. See Grutter v. Bollinger, 137 F. Supp. 2d 821, 847 (E.D.
Mich. 2001) (“The Marks framework cannot be applied to a case like Bakke, where the various
Justices' reasons for concurring in the judgment are not merely different by degree, as they were in
Memoirs, but are so fundamentally different as to not be comparable in terms of ‘narrowness.’”).
7
Indeed, it is the rule in several of our sister circuits that Marks is simply inapplicable unless
“one opinion is a logical subset of other, broader opinions.” See King v. Palmer, 950 F.2d 771, 781
(D.C. Cir. 1991) (en banc). See also, e.g., Anker Energy Corp. v. Consolidation Coal Co., 177 F.3d
161, 170 (3rd Cir. 1999) (“the Marks rule is applicable only where one opinion can be meaningfully
regarded as narrower than another and can represent a common denominator of the Court's
reasoning.”); Homeward Bound, Inc. v. Hissom Memorial Center, 963 F.2d 1352, 1359 (10th Cir.
1992) (quoting approvingly of the reasoning in King). Cf. Dague v. Burlington, 935 F.2d 1343, 1360
(2d Cir. 1991) (noting “the anomaly of the views of one justice, with whom no one concurs, being
the law of the land, where the Court is so divided on an issue and where there is no majority opinion
at all”). The District of Columbia Circuit explained well the reason for such a rule:
When, however, one opinion supporting the judgment does not fit entirely within a
broader circle drawn by the others, Marks is problematic. If applied in situations
where the various opinions supporting the judgment are mutually exclusive, Marks
will turn a single opinion that lacks majority support into national law. When eight
of nine Justices do not subscribe to a given approach to a legal question, it surely
cannot be proper to endow that approach with controlling force, no matter how
persuasive it may be.
King, 950 F.2d at 782.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 60
Nos. 01-1447/1516
Grutter v. Bollinger
Page 61
b. The Potential for Two Marks Holdings
Even if one gets past the conceptual hurdle of treating as a continuum (or a set and subset)
two rationales that are not clearly related in scope, it is not clear that a Marks analysis of the
rationales in Bakke would produce the holding that the majority claims it does.
As mentioned, the majority defines the relevant judgment in Bakke abstractly, as holding that
race can sometimes be used by educational institutions. Until now, we have assumed that the
judgment in Bakke is as the majority defines it. Rather than adopting a broad statement providing
no real guidance on when race can be used and for what purposes, we might look at what the two
opinions that concur on the possibility of a constitutional use of race have to say about each of the
two potential rationales, namely remedying past discrimination and diversity. If we do this, we are
essentially left with two holdings in Bakke on the permissible rationales for the use of race: one
holding permitting the use of race for diversity purposes sometimes and one permitting it for
remedial purposes sometimes.8 See generally Lackland H. Bloom, Jr., Hopwood, Bakke and the
Future of the Diversity Justification, 29 Tex. Tech. L. Rev. 1, 30-32 (1998).
Justice Powell’s decision would be the narrowest grounds to support the holding that race
can sometimes be used to remedy the effects of past discrimination. This is because the Brennan
group would have allowed the use of race whenever there is a “sound basis for believing that the
problem of underrepresentation of minorities . . . [is] attributable to handicaps imposed on minority
applicants by past and present racial discrimination.” Bakke, 438 U.S. at 369. On the other hand,
Justice Powell expressed a more limited view of the permissible use of race in this regard in Section
IV-B of his opinion. He agreed that “[t]he State certainly has a legitimate and substantial interest
in ameliorating, or eliminating where feasible, the disabling effects of identified discrimination.” Id.
at 306. However, Justice Powell would not have permitted simple reliance on general past
8
The majority contends that by redefining the relevant judgment I impermissibly “cobble
together a holding from various rationales in the discrete Bakke opinions.” See Majority Op. at 9 n.6.
However, the majority misunderstands my aim. I am not suggesting we apply Marks to a given
judgment and then pick and choose among the rationales to support that judgment. Instead, I am
merely suggesting an analytical tool whereby we more accurately define the relevant holding before
applying Marks. By defining the holding as stating that race can be used to promote diversity
sometimes, I illustrate that Justice Brennan’s rationale is the narrowest in support of that holding and
in so doing call into question the premise that Marks provides an answer to the threshold question
facing this court.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 62
discrimination, but instead would have required specific findings by a competent government body
that the use of race is “responsive to identified discrimination” before race could be used remedially
in admissions decisions. Id. at 310.
However, with respect to the redefined holding discussing diversity, the one relevant in this
case, Justice Brennan’s opinion facially is the narrower. Justice Powell wrote broadly in his Section
IV-D that “[t]he attainment of a diverse student body clearly is a constitutionally permissible goal
for an institution of higher education.” Id. at 312. Later, Powell wrote again that “the interest of
diversity is compelling in the context of a university's admissions program.” Id. at 314. Justice
Brennan, on the other hand, specifically added a restriction to his expressed agreement. As discussed
above, Justice Brennan would be willing to support the diversity rationale embodied in the Harvard
diversity program set out by Justice Powell as a model, “at least so long as the use of race to achieve
an integrated student body is necessitated by the lingering effects of past discrimination.” Bakke,
438 U.S. at 326 n.1. Since it put a limit on the utility of diversity as a rationale supporting the
constitutionally permissible use of race in admissions programs where Justice Powell’s opinion
expressed no limit, Justice Brennan’s opinion is narrower than Justice Powell’s on the use of race
to encourage diversity. So by merely redefining the relevant holding more accurately, I have reached
a result opposite that of the majority – Justice Brennan’s rationale becomes the narrower and
therefore becomes the Marks holding to be gleaned from Bakke on the diversity issue. This further
shows the error in relying on Marks to answer the question before this court.
The above discussion is intended simply to illustrate that reasonable minds can and do differ
on the holding, if any, to be found in Bakke with respect to the diversity rationale. Those holding
different views on the subject could go back and forth endlessly, with no clear resolution. The
reason for this – as almost all, wherever they stand on the argument, would agree – is that we are
trying to divine a clear holding from a decidedly unclear decision.
In this circumstance, the better view is that Marks simply fails to extract from Bakke a
holding on the constitutionality of the diversity rationale. Indeed, the very fact that one must struggle
to find a way to fit the Court’s Bakke writings into the Marks mold counsels against finding such a
holding in Bakke.
c. Subsequent Treatment of Bakke and Marks
It is apparent that the Supreme Court has doubted that Bakke provided a holding beyond the
obvious one that UC Davis’s system was illegal.9 Though only writing for four Justices, Justice
9
The majority finds support for its proposition that diversity is a compelling state interest in
the fact that Justice Brennan in Metro Broadcasting cited Bakke for the proposition that “‘a diverse
student body’ contributing to a ‘robust exchange of ideas’ is a ‘constitutionally permissible goal’ on
Nos. 01-1447/1516
Grutter v. Bollinger
Page 63
Brennan wrote in the introduction to his Bakke concurrence that “[t]he difficulty of the issue
presented . . . and the mature consideration which each of our Brethren has brought to it have
resulted in many opinions, no single one speaking for the Court.” 438 U.S. at 324. Two years later,
in the course of examining a minority business provision in the Public Works Employment Act of
1977, the Court expressly refused to adopt “the formulas of analysis” set out in Bakke and did not
discuss any holding coming from the case, but instead set out to show that the challenged provision
“would survive judicial review under either ‘test’ articulated in the several Bakke opinions.”
Fullilove v. Klutznick, 448 U.S. 448, 492 (1980). After Marks was decided, the Supreme Court in
Adarand again expressed doubt that there is a comprehensive holding to be found in Bakke. See
Adarand, 515 U.S. at 218 (noting that “Bakke did not produce an opinion for the Court”).
Further, there is Supreme Court precedent for the proposition that when it is so unclear what
the Marks holding would be in a fractured court decision, there may not be one. For example, in
Nichols v. United States, 511 U.S. 738 (1994), the Court re-examined its prior, splintered decision
in Baldasar v. Illinois, 446 U.S. 222 (1980). After citing Marks and noting the varied possible
holdings divined by different courts that had examined Baldasar, the Supreme Court declined to
engage in a Marks analysis, stating:
We think it not useful to pursue the Marks inquiry to the utmost logical possibility
when it has so obviously baffled and divided the lower courts that have considered
it. This degree of confusion following a splintered decision such as Baldasar is itself
a reason for reexamining that decision.
Nichols, 511 U.S. at 745-46. See also Johnson v. Board of Regents, 263 F.3d 1234, 1248 n.12 (11th
Cir. 2001) (“The Supreme Court has not compelled us to find a ‘holding’ on each issue in each of
its decisions. On the contrary, the Court has indicated that there may be situations where even the
Marks inquiry does not yield any rule to be treated as binding in future cases.”). The fact that lower
courts are unclear as to what holding – if any – can be garnered from Bakke on the diversity issue
is clearly illustrated by the University of Michigan cases, where one district court at least found
which a race-conscious university admissions program may be predicated.” 497 U.S. 547, 568
(1990) (quoting Bakke, 438 U.S. at 311-13 (Powell, concurring)). Aside from the fact that Justice
Brennan was applying intermediate scrutiny in Metro Broadcasting and therefore his views on the
constitutionality of any policy or rationale would not speak to the present case where strict scrutiny
is the standard, the statement is – as the majority itself notes – merely dicta. The majority attempts
to salvage the usefulness of the statement to their argument by describing it is as “persuasive
authority, which this court may not ignore.” Majority Op. at 11. Of course, this court ignores (or
at least does not rule in accordance with) persuasive authority all the time. In particular, an ex post
exegesis written by a different Justice of another Justice’s opinion that did not prevail on the point
at issue is hardly the strongest type of persuasive authority.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 64
viable the argument that Justice Powell’s rationale represented Bakke’s holding regarding the
diversity issue under Marks, while the other district court found Marks inapplicable.
C. The Dicta Problem
Lastly, I pause to point out that, even if the majority’s application of Marks were correct, it
would not be clear that the various discussions of permissible rationales to be found in Justices
Powell and Brennan’s opinions are anything more than non-binding dicta. This is because there is
an argument that Bakke does not have a “judgment” with respect to the permissible use of race in
educational institutions’ admissions policies, so there would be no Marks holding on that issue.
In order to understand the argument, it needs to be noted again that there were potentially two
issues in Bakke – (1) whether state universities could use race at all in their admissions decisions,
and (2) whether the university’s particular use of race was permissible. Justice Powell’s opinion
stated the judgment of the Court on the first issue, because he was joined by Brennan’s group of four
to make a majority for the proposition that state universities were not completely precluded from the
use of race. Justice Powell’s opinion stated the judgment of the Court on the second issue, because
he was joined by the other four Justices in finding that UC Davis’s particular system was
impermissible.
In his Bakke concurrence and dissent, Justice Stevens argued that Justice Powell’s discussion
of the first issue was merely dicta, as the California Supreme Court did nothing more than strike
down UC Davis’s program and neither had before it nor decided the question of whether state
universities could ever use race. See Bakke, 438 U.S. at 408. See also Earl M. Maltz, A Bakke
Primer, 32 Okla. L. Rev. 119, 130 n.91 (1979) (making this argument). Allan Bakke’s suit was not
a class action; Bakke sought merely his own admission. Ibid. Therefore, once the Court ordered
Bakke admitted, he no longer had any interest in UC Davis’s future admissions policy. Ibid.
Accordingly, Justice Stevens argued that the only judgment of the Court was that UC Davis’s system
was impermissible, and the narrowest grounds for holding that would seem to be Justice Stevens’s
finding that the system was impermissible under Title VI (due to the long-standing rule, cited by
Justice Stevens, that the Court avoids constitutional issues if a case can fairly be decided on a
statutory ground). See Bakke, 438 U.S. at 411. See also Johnson v. Board of Regents, 106 F. Supp.
2d 1362, 1369 (S.D. Ga. 2000) (same argument), aff’d, 263 F.3d 1239 (11th Cir. 2001).
It is true that both Justice Powell and the Brennan group argued that the Court was issuing
a judgment on the permissibility of the use of race, as they contended that the California Supreme
Court did permanently enjoin any use of race. See Bakke, 438 U.S. at 271 n.1 (Powell, concurring),
325 (Brennan, concurring). Specifically, Justice Powell pointed out that the University had cross
claimed in the trial court for a declaratory judgment that its program was constitutional, but that it
had lost. See id. at 271 n.1. Presumably, then, Justice Powell was arguing that unlike Bakke, the
University had an ongoing interest in the content of its future policies. Further, Justice Powell
Nos. 01-1447/1516
Grutter v. Bollinger
Page 65
argued that the California Supreme Court effectively enjoined the University from ever using race.
Justice Powell quoted language from the California Supreme Court to the effect that UC Davis’s
admissions policy was constitutionally impermissible to the extent that it was “utilized in a racially
discriminatory manner.” Ibid., quoting 553 P.2d 1152, 1166 (Cal. 1976) (footnote omitted).
At least one commentator has challenged Justice Powell’s contention that the Bakke
discussion on the more general use of race represents a holding. See Maltz, 32 Okla. L. Rev. at 130
n.91 (arguing that this portion of the Bakke decision is merely dicta). Maltz points out that while it
is true that UC Davis cross claimed, seeking a declaratory judgment that its policies were legal, it
did not request that the court in the alternative instruct it how to conform its policies to the law.
Instead, according to Maltz, once the Court determined that UC Davis’s plan was infirm, it by
implication disposed of the cross-claim and had fulfilled its function as a reviewing court. Ibid.
Further, as Maltz points out, while the California Supreme Court did use the sweeping language cited
by Justice Powell for the proposition that the court had enjoined any future use of race, the judgment
of the California court was much narrower and included no such injunction. See 553 P.2d at 1172.
More fundamentally, the holding/dicta distinction demands that we consider binding only
that which was necessary to resolve the question before the Court. At most, the question before the
Court in Bakke was whether race could ever be used in admissions decisions. To resolve that
question, the Court only needed to answer that race could potentially be used. Any speculation
regarding the circumstances under which race could be used was little more than an advisory
opinion, as those circumstances were not before the court and need not be validated to overturn an
injunction barring any use of race, to the extent one was in place.
So, if we admit that a Marks analysis simply does not provide a binding holding on the
diversity issue, we are left with precedent striking down UC Davis’s admissions system and either
binding precedent or persuasive support (depending on whether one agrees with Justice Stevens’s
argument in Bakke that the entire rationale discussion was dicta) for the proposition embodied in
Section V-C of Justice Powell’s opinion, to which a majority of the Justices did subscribe, that “the
State has a substantial interest that legitimately may be served by a properly devised admissions
program involving the competitive consideration of race and ethnic origin.” 438 U.S. at 320.
Unfortunately, we are not reviewing the UC Davis program, and the fact that a state has a
“substantial interest” that “may” be constitutionally served by admissions programs utilizing race
does not help us. We must determine whether the state has a “compelling interest” rather than a
“substantial interest” and the fact that an interest “may” be served by a race-based system does
nothing to tell us “how” it may be.
D. Intervening Supreme Court Precedent
Having held that Marks does not compel a Bakke holding, the district court in this case
reviewed recent Supreme Court cases that have addressed racial classifications, and held that
Nos. 01-1447/1516
Grutter v. Bollinger
Page 66
together they make clear that “racial classifications are unconstitutional unless they are intended to
remedy carefully documented effects of past discrimination.” Grutter, 137 F. Supp. 2d 821, 849
(E.D. Mich. 2001). The court found this holding to be required by two Supreme Court cases. First,
the court cited Adarand Constructors v. Pena, 515 U.S. 200, 227 (1995), where the Court held that
all racial classifications are subject to strict scrutiny and overturned Metro Broadcasting, Inc. v.
FCC, 497 U.S. 547 (1990), to the extent that it applied intermediate scrutiny to a plan that used racial
classifications in awarding broadcast licenses in order to enhance broadcast diversity. Second, the
court noted that in Richmond v. J. A. Croson Co., 488 U.S. 469, 493 (1989), the Court stated that:
“Classifications based on race carry a danger of stigmatic harm. Unless they are strictly reserved for
remedial settings, they may in fact promote notions of racial inferiority and lead to a politics of racial
hostility.”10
Taking together the Court’s overturning of the standard used to uphold the use of race to
encourage diversity in Metro Broadcasting (thereby calling into question the permissibility of using
race for diversity purposes) and its statement in Croson that race should only be used for remedial
settings, the district court held that the only permissible use of race under strict scrutiny is to “remedy
carefully documented effects of past discrimination,” and that since the diversity rationale proffered
by the Law School was not tied to remedying past discrimination, it is an impermissible basis for the
use of race. Grutter, 137 F. Supp. 2d at 849.
The majority, as it does in the rest of its opinion, disregards the district court’s analysis by
adherence to the mantra of a Bakke holding that diversity is a permissible rationale for the use of
race. Accordingly, the majority states that the later Supreme Court cases pointed to by the district
court can not possibly stand for the proposition the court said they do because that would require a
finding that the Supreme Court silently overturned its holding in Bakke. As the majority points out,
the Court has instructed lower courts not to find that it has implicitly overruled itself, but to let it do
its own overruling. Majority Op. at 11. See also Agostini v. Feldman, 521 U.S. 203, 237 (1997).
However, application of Agostini requires first that the Supreme Court have made a holding that a
lower court is finding it to have implicitly overruled; in this case, Bakke provides no such holding.
While I find persuasive the district court’s attempt to derive from the Supreme Court’s
Adarand and Croson decisions a holding that diversity is not a permissible rationale, it would be
somewhat disingenuous of me to fault the majority of this court for divining a firm and binding
holding from Bakke while urging the court to do the same from Adarand and Croson. While the
district court’s reading of these two cases is far from clearly wrong, it is also not required. In
10
Chief Justice Rehnquist, and Justices White and Kennedy joined this part of Justice
O’Connor’s plurality opinion. Justice Scalia agreed that the use of race is only appropriate for
remedial situations, but wrote separately to contend that it was appropriate only in a more limited
set of situations than those approved by the plurality. See 488 U.S. at 735 (Scalia, concurring).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 67
Adarand, the Court overturned Metro Broadcasting to the extent that it utilized intermediate scrutiny
in reviewing a classification plan intended to promote diversity. However, the Court did not
explicitly state that diversity would not withstand strict scrutiny. Further, in Croson, while a
majority of the Court could be read to suggest that only remedial justifications would be permissible,
a diversity rationale was not at issue in the case.
A better approach is simply to address the diversity rationale on the merits. Accordingly, I
will seek to apply on the merits the rule on which we can all agree, as set forth by the Court in
Adarand, and look to see (1) if the use of race in admissions for diversity purposes serves a
compelling governmental interest, and (2) whether the Law School’s plan is narrowly tailored to
achieve that interest. Adarand, 515 U.S. at 227.
II. On the Merits
Symptomatic of its deference to the advisory opinion of one Justice of the United States
Supreme Court, the majority has given us no argument as to why the engineering of a diverse student
body should be a compelling state interest sufficient to satisfy strict scrutiny. I, however, consider
the arguments on both sides of this question below and conclude that constructing a diverse
educational environment is not a compelling state interest. In explaining my conclusion below, I
analyze why the nature and benefits of the experiential “diversity” that the Law School claims
ultimately to seek is conceptually disconnected from the racial and ethnic diversity that it primarily
seeks. I also demonstrate that the Law School’s concept of diversity permits no logical limitation
and threatens to justify even more constitutionally unacceptable outcomes, counseling against
recognizing its achievement as a compelling state purpose.
If I were deciding this case for a majority, I likely would not have resolved the question of
whether developing a diverse student body is a compelling state interest. Even if a racial
classification is designed to achieve a compelling state interest, it must be narrowly tailored to that
interest. While I could conceive of racial preferences in admission that are narrowly tailored to
achieve some diversity in education, the Law School’s plan is not among those. The majority
appears satisfied that the Law School’s program is narrowly tailored because the Law School has not
articulated a precise numerical target for admitted minorities. By carefully avoiding the pernicious
term “quota,” the Law School, for the majority, has withstood the constitutional strict scrutiny that
we apply to racial preferences. For me, however, the Law School’s simple avoidance of an explicit
numerical target does not meet the constitutional requirements of narrow tailoring. The Law
School’s efforts to achieve a “critical mass” are functionally indistinguishable from a numerical
quota.
Moreover, the constitutional inquiry into narrow tailoring is not merely one into the form of
the racial preference. The sheer magnitude of the Law School’s racial preference, a feature left
completely unexamined by the majority, is simply too large to be considered narrowly tailored. Even
Nos. 01-1447/1516
Grutter v. Bollinger
Page 68
“the Harvard Plan,” which the majority remarkably considers constitutional merely because Justice
Powell in Bakke speculated that it might be constitutional, does not validate the amount of the Law
School’s racial preference.
I discuss the two parts of the strict scrutiny analysis – the existence of a compelling state
interest and the employment of only those means narrowly tailored to that purpose – separately
below.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 69
A. Is Developing a Diverse Student Body a Compelling State Interest?
1. The Nature of “Diversity”
Holding that, generally speaking, “diversity in education” is a compelling state interest would
not be terribly helpful. After all, it is not clear what the term means. From the outset therefore, it
is crucial to be precise about the nature of the “diversity” that the Law School seeks to promote.
Justice Powell discussed a diversity that would enrich the pedagogical activities of a school, a
diversity of “experiences, outlooks, and ideas” that would challenge its students’ settled
preconceptions and open them to new intellectual paradigms. Bakke, 438 U.S. at 314. The Law
School adopts this dialogic vision of diversity as the purpose behind its admissions program.
Some versions of diversity are clearly not included in the Law School’s vision. For example,
the Law School does not seem to promote the potential for moral education in racial tolerance
created by a more diverse student body. On this view, the mere presence of minority students may
indeed be sufficient to enhance the educational experience. Similarly, the Law School does not seem
to rely on the promotion of post-graduation diversity in the legal profession.
Instead, the Law School rests its claim to the benefits of a diverse student body on the unique
experiences that students from under-represented groups will be able to share with their fellow
students. Closely related, the Law School implies that a student body diverse with regard to race is
one diverse with regard to viewpoint, experience, and opinion. Through the Socratic Method, the
keystone of legal education, the students from groups otherwise “over-represented” will be pressed
to consider new ideas as their previously under-represented minority colleagues discuss the legal
questions at issue.
For all these educational benefits to diversity, the majority uses the shorthand “academic
diversity.” Majority Op. at 15. From the implementation of the Law School’s program, however,
it is perfectly clear that academics has nothing to do with the type of diversity sought. After listening
to the Law School extoll the virtues of educational diversity, one might think that preference would
be given across the board for “life experiences.” The Law School’s rhetoric implies that it is
searching tirelessly for the applicant with the most unique of experiences: for example, the Mormon
missionary in Uganda, the radical libertarian or Marxist, the child of subsistence farmers in
Arkansas, or perhaps the professional jazz musician. The Law School, however, never claims that
there is any similarity between the preference given to those with such unique experiences and that
bestowed upon those it considers “under-represented” racial minorities.
Most poignantly, the Law School’s offering of non-racial exemplars for such non-racial
diversity betrays the profound and experientially unrelated preference that the Law School places on
race. Mentioning status as an under-represented minority in the same breath, the Law School
generalizes, in the abstract, that it would also give a preference to an applicant with “an Olympic
Nos. 01-1447/1516
Grutter v. Bollinger
Page 70
gold medal, a Ph.D in physics, the attainment of age 50 in a class otherwise lacking anyone over 30,
or the experience of having been a Vietnamese boat person.” Admissions Policies, University of
Michigan Law School, April 22, 1992, JA at 4240. Yet to equate bare racial status with the
experiential gains of these generally remarkable (and exceedingly rare) achievements demonstrates
that the Law School’s desired diversity is unrelated to the experiences of its applicants. After
reading the description of its admissions criteria, a Michigan law student might yearn to meet the
mere Olympian who failed to medal and was thus considered insufficiently interesting by the Law
School.
The disjunction between the Law School’s preference for the race of “under-represented
minorities” and what happened to be those applicants’ experiences came through very clearly in an
exchange at oral argument. Counsel for the Law School agreed that it was true that Ms. Grutter
would have been admitted had she been of a different race, but strongly asserted that she would have
then been “a different person.” Tr. at 38. Of course, in a trivial way, that is true of every change in
any of us. Had she grown up in New York or had a mother or father who did or did not work outside
the home, she would also have been a different person. However, none of those changes, all of
which would have made her “diverse” in some different fashion, would have enhanced or determined
her chances of admission. When I then asked counsel whether, if she were of a different race, she
would have been admitted whether she had come of age in inner-city Detroit or in Grosse Pointe, he
answered: “That’s probably right.” Id. at 39.
When it comes to a choice between admitting a conventionally liberal (or conventionally
conservative) black student who is the child of lawyer parents living in Grosse Pointe, just like the
previous ten white admittees, the black student will be given a diversity preference that would not
be given to a white or Asian student, her unique experiences notwithstanding.11 Similarly, it is not
at all clear how true diversity is served by giving massive preference to a student whose parents or
grandparents came from an upper-class suburb of Buenos Aires, over those whose grandparents
immigrated from similar areas of Paris, Munich, or Tokyo or, indeed, over a person whose
grandparents survived the labor camps of Hitler or Stalin or the conformity regime of Brezhnev’s
Kazakhstan. Even Justice Powell in his Bakke opinion recognized that an admissions program
“focused solely on ethnic diversity, would hinder rather than further attainment of genuine diversity.”
Bakke, 438 U.S. at 315 (Powell, concurring).
Perhaps the one unifying feature of the minority groups that the Law School heavily prefers
in admissions is that they all, on average, have had some experience with being the object of racial
discrimination. For law students, this might bring an understanding of the purposes behind the anti-
discrimination laws that they might study. It is hard, however, to believe that the Law School’s
11
With respect to the concurring opinion’s criticism of this example, Concurring Op. at n.3
(Clay), see n.21 infra.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 71
admissions scheme is terribly sensitive to this interest. If the Law School were truly interested in
those with profound experience with discrimination, it would be sensitive to differences within the
affected groups. An African-American applicant who comes to the Law School by way of Choate
and Harvard12 may well have quite a different experience of discrimination than one from a rural
public school. Even if one were to believe that the Law School’s racial preference were carefully
designed to add such experience to the Law School mixing pot, one could wonder why an experience
with discrimination would be so much more important than any other experience germane to other
legal issues.
Indeed, one should wonder why race is at all relevant to the Law School if it only is
concerned about the diversity of experience. It is likely that an admissions scheme that sought true
experiential diversity, without regard to race, would provide some systematic advantage for racial
or ethnic minorities. See also Part II.B.4 (discussing race-neutral means). Under-represented life
experiences – primary or secondary education at an under-funded public school, struggling with
relative poverty, a childhood spent in urban rather than suburban areas – may correlate to some
degree with under-represented racial or ethnic minorities.13
Such a system of seeking experiential diversity would be unlikely to raise significant
constitutional problems, unless it were clear that an institution manipulated these factors to admit
members of a particular race. However, the Law School certainly does not seek to implement an
experientially based admissions system or even to assert that if it did, the preference given for such
factors could explain its current results. Instead, it is clear that the only type of diversity that is given
more than modest, if any, weight is based on assigned racial categories. The Law School cannot
plausibly maintain that the system would be impractical, especially because, as they elsewhere
remind us for purposes of distinguishing its preference from a quota, only one admissions officer
reads all applications, makes all decisions, and therefore is capable of considering candidates
individually. The possibility of an experientially based admissions system and the Law School’s
apparent disinterest in such a system, indicate that the Law School grants preference to race, not as
a proxy for a unique set of experiences, but as a proxy for race itself.
12
Indeed, it is likely such minorities – those who have been relatively well-educated at elite
schools, but who have not performed terribly well there – that the Law School’s preference policy
most benefits.
13
In fact, these factors may also correlate to unrealized academic ability, if the student has not
had sufficient resources, educational or financial, to blossom intellectually. In this sense, an
admissions system truly sensitive to experiential diversity may also select the more intellectually
talented.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 72
Accordingly, even if we were to consider binding on this court Justice Powell’s opinion in
Bakke that the achievement of some form of diversity in education is a compelling state interest, we
would not ipso facto find compelling the type of diversity that the Law School apparently seeks. For
Justice Powell in Bakke, race or ethnicity was only “one element in a range of factors” that an
educational institution may consider to develop an experientially heterogeneous environment.
Bakke, 438 U.S. at 314. The Law School’s consideration of race, for the sake of race, is not the type
of pedagogical diversity thought potentially compelling in Powell’s opinion.
There are yet more fundamental problems with the broad-brush rationale of diversity. The
fundamental premise of our society is that each person is equally “diverse” exactly because of her
equality before God and the law. The very words of the Declaration of Independence are: “All men
are created equal . . . and are endowed by their Creator with certain inalienable rights.” Thus, the
starting basis is one of equality, not of separately assigned categories that are used to measure
diversity. From that starting point, every person’s experiences are “diverse” from those of every
other. The very measure of diversity as used by the University is to say that some of those
differences do not count. Thus, to the Law School, ten under-represented-minority students, each
a child of two-parent lawyer families, are considered to be diverse, while children whose parents are
Chinese merchants, Japanese farmers, white steel workers, or any combinations of the above are all
considered to be part of a homogeneous (and “over-represented”) mass. And, of course, that
categorization then strongly determines the odds of admission. A child with one parent of Chinese
ancestry and one of Chilean would find that his level of “diversity” depends wholly on whether the
Law School chooses to assign him based on one parent or the other.14
The Law School gives no explanation of how it defines the groups to be favored. This means
that ultimately it must make, on some basis, a decision on who is, and is not, an “African-American,
Hispanic, or Native American.” See JA at 1957 (discussing the groups to be favored). Such
judgments, of course, have a long and sordid history. The classic Southern Rule was that any
African ancestry, or “one drop” of African blood, made one black.15 The Nazi Nuremberg laws
14
A personal observation makes clear for me the problematic nature of such definitions. My
daughter has one grandparent who was a Cuban immigrant, two grandparents of Russian Jewish
origin, and one grandparent who could be characterized as a Euro-American mixture. I would hate
to think that her life chances were significantly altered, favorably or unfavorably, because a
government body applied a “grandfather clause” that focused on one rather than another of her
grandparents.
15
For more on the one-drop rule, see A. Leon Higginbotham, Jr. & F. Michael Higginbotham,
“Yearning to Breathe Free”: Legal Barriers Against and Options in Favor of Liberty in Antebellum
Virginia, 68 N.Y.U.L. Rev. 1213, 1243 n.163 (1993).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 73
made the fatal decision turn on the number of Jewish grandparents.16 “Hispanic” background may,
I suppose, depend on which side of a pass in the Pyrenees your great-grandfather came from. This
Christmas, my wife and I received a card, containing a lovely picture of a friend and his spouse, their
two children and their spouses, and four grandchildren. I asked a sample of people, in and out of my
chambers, how many of the ten people in the picture should receive racial preference under
Michigan’s policy. I received answers ranging from one to ten.
A moment’s contemplation of these examples shows another serious problem with
Michigan’s policies. On the one hand, all the evidence is that race and ethnicity are considered on
an “all or nothing” basis. But the actual experience, diverse or otherwise, of a person who is “one-
half” or “one-quarter” of one ethnicity, is likely to be, on average, different from one whose ancestry
is relatively uniform. On the other hand, to apply boldly a system of half- or quarter-credit for
assigned status would reveal the racist nature of the system to a degree from which even its
proponents would shrink.
Thus, even if we give full force to Justice Powell’s discussion of “the virtues of diversity,”
the Law School’s program provides the linguistic term, but not the substance.
2. No Logical Limitation
We are not completely at sea regarding how to discern a compelling state interest. The
Supreme Court has consistently rejected those purposes that lack a “logical stopping point.” Croson,
488 U.S. at 498; Wygant v. Jackson Bd. of Educ., 476 U.S. 267, 275 (1986) (plurality opinion). Such
vague and ill-defined purposes, if considered compelling, would eviscerate the constitutional
protection that strict scrutiny provides. The two requirements of strict scrutiny – the identification
of a compelling state interest and the use of only those means narrowly tailored to serve that interest
– are designed to be independently meaningful rather than mere redundancies. Yet it is meaningless
to require that a state narrowly tailor its suspect policies to a purpose that itself is poorly defined.
Requiring a well-defined purpose to be compelling reflects the Supreme Court’s judgment
that racial classifications ought to be used sparingly. The Law School’s repeated incantation of
“developing a diverse student body” suffers from this vice of vagueness. These same words, together
with the discussion of promoting a more intriguing student body, could be used, and indeed have
been used not invalidly on their face, to justify ethnic classifications that seem patently
unconstitutional.
16
See, e.g., Lucy S. Dawidowicz, THE WAR AGAINST THE JEWS: 1933-45 91 (Bantam 1975);
Nora Levin, THE HOLOCAUST 69-70 (Schocken 1973).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 74
It may be instructive to compare the actual implementation of and articulated rationale behind
the Michigan plan with another, possibly well-intentioned, attempt to manipulate admissions criteria
to achieve a diverse student body. I refer to the “religious-conscious” policies, adopted by a number
of Ivy League universities of which Harvard was the most notable, to give preference in admissions
to Gentiles as opposed to Jews. The policies were also designed to produce a mixture of students
in the school that was closer to the proportion that prevailed in society, and a proportion that was
thought to be socially and educationally beneficial.
The reasons for the policy offered by then-President Lowell of Harvard are hauntingly similar
to the rationale given here. As Lowell explained, without the policies “Harvard would lose its
character as a democratic national university drawing from all classes of the community and
promoting a sympathetic understanding among them.” Letter from President Lowell, reprinted in
Henry Aaron Yeomans, ABBOTT LAWRENCE LOWELL , 1856-1943 209 (Arno 1977). Lowell worried
that “race feeling would become intense” if numbers of students were not more proportional to the
general population, and that if the numerical imbalance could be rectified, “it would eliminate race
feeling among the students, and ‘as these students passed out into the world, eliminating it in the
community.’” Nitza Rosovsky, THE JEWISH EXPERIENCE AT HARVARD AND RADCLIFFE 15 & n.2
(Harvard 1986) (quoting A. Lawrence Lowell Papers # 1056). Lowell also believed that his policy
would be “in the interests of Jews, as well as of everyone else.” Ibid.
The weighted preference system at Harvard then worked much the same as Michigan’s. The
“Harvard plan” of its day also considered each applicant individually. Some Jews were admitted,
some were not. Their religion was only one factor among many that were considered. It was
perfectly clear, in the words of Justice Powell, that “the applicant who loses out on the last available
seat to another candidate receiving a ‘plus’ on the basis of ethnic background will not have been
foreclosed from all consideration for that seat.” Bakke, 438 U.S. at 318. Those who were not
admitted could not be certain that their ethnicity had been decisive. All applicants admitted were
certainly “qualified,” by the same standards as the Michigan plan.
Perhaps the crucial distinction comes from the notion that a true “plus” program would lack
a “facial intent to discriminate.” Ibid. This could only be the case if the plus was in some fashion
modest, and calibrated truly in connection with other comparable characteristics. The fact that the
“Harvard plan” of the 1930's basically cut Jewish numbers by half or more would belie the lack of
a “facial intent to discriminate.” See generally Marcia Graham Synnott, THE HALF -OPENED DOOR
96, 108, 110, 115 (Greenwood 1979). The University of Michigan’s plan, which by its own
calculations inflates the numbers of students from favored groups approximately three-to-four fold,
similarly betrays a “facial intent to discriminate.” See JA at 6047.
It is thus important to note that the Michigan policy, though unintentionally, has an effect
similar to that of the Harvard plan of old. The effect is similar, in my view, because a significant
proportion of those persons who are excluded because of racial discrimination in favor of under-
Nos. 01-1447/1516
Grutter v. Bollinger
Page 75
represented minorities are Jews. While no specific numbers have been given, a wide variety of
sources indicate that Jewish representation in general in law schools is several multiples of the
proportion of Jews in the general population. There is no reason to believe that as a proportion of
those excluded by Michigan’s policies, the impact would be any different.
If policies like the Law School’s are permitted, the adverse effect on “over-represented”
minorities will only grow more grave because such policies inexorably drive toward a philosophy
in which admissions are parceled out roughly in proportion to representation in the general
population. The Law School may deny this, and argue that the policy is only for “under-represented”
minorities. But, if suitably divided, any group can become a minority. If one distinguishes between
denominations of Christianity, no religion is a majority in America. Using only the constitutionally
protected classes of national origin, no ethnic background is a majority. Thus, by the rationale of
Michigan’s policy, every group suitably defined could be entitled to “a critical mass” of its members
so that those students, too, should “not feel isolated or like spokespersons” nor “feel uncomfortable
discussing issues freely based on their personal experiences.” Majority Op. at 15. And then, by the
inexorable laws of mathematics, the existence of a critical mass or rough proportionality for each
group so considered means that what is left for the remainder of the groups (those formerly “over-
represented”) is no more than its own critical mass of “rough proportionality.” And there lies the rub.
Being relegated to rough proportionality brings Jewish applicants full circle to their chances under
Lowell’s “Harvard Plan,” or even worse, as Jews today constitute only 2-3% of the total population.
The Law School and the court will certainly deny this, but that is where the figures unavoidably lead
us.
These prospects for such uninhibited racial and ethnic discrimination are especially important
because the Law School has declined to justify its policy as remedying past discrimination.17 There
is no limiting principle preventing the Law School from employing ethnic or religious preferences
to arrange its student body by critical mass. In short, the compelling state interest of developing a
17
The Law School’s disavowal is why I do not discuss whether the remediation of past
discrimination is a compelling state interest that could justify the Law School’s actions. Not only
must a state interest be compelling to satisfy strict scrutiny, but it must also be the interest that
motivated the classification in the first instance. While we have been reluctant to determine what
actually motivated legislative bodies, see, e.g., Federal Communications Comm’n v. Beach
Communications, Inc., 508 U.S. 307, 315 (1993), the Law School administration is the sole creator
of the admissions policy at issue here and we can rely on its assurance (as compared to the statement
of a particular legislator or an incomplete statutory preamble) that such remediation is not the
purpose of its admissions policy.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 76
diverse student body would justify an infinite amount of engineering with respect to every racial,
ethnic, and religious class.18
B. Is the Law School’s Admissions Policy Narrowly Tailored?
If pressed, however, it would be unnecessary to determine whether promoting diversity in
education constitutes a compelling state interest because we, just as Justice Powell in Bakke, are not
faced with an admissions scheme that is narrowly tailored to achieve the compelling state interest
of diversity in education. For the majority, the inquiry into narrow tailoring begins and ends with
a determination that the Law School neither “sets aside” an exact number of seats for racial or ethnic
minorities nor admits minorities with a specific quota of admittees in mind. The distinction of
quotas from other preferences is the dividing line between constitutional and unconstitutional
admissions policies, on this view. For this position, the majority points to the Harvard plan, not of
Lowell’s time, but the one of which Justice Powell, on the basis of no factual record but only a bland
description appended to an amicus brief, spoke approvingly in Bakke. That plan, using race only as
a “plus,” does not offend the Constitution according to the majority because of Powell’s advisory
opinion on its constitutionality. Therefore, the majority would hold that all plans that merely use
race as a “plus” are constitutional. Yet, the constitutional analysis of racial preferences appears to
be binary for the majority in that a preference is either a forbidden quota or a permissible plus.
We must be, however, concerned about the magnitude of this preference. Even assuming,
against all doubt, that Justice Powell’s opinion on the constitutionality of a plan not any part of the
18
Because of our society’s history of religious discrimination and religion’s continuing
salience, I have at times recognized the analogy between religious preference and the racial and
ethnic preference bestowed in this case. For example, at oral argument I questioned counsel about
the constitutionality of engineering a critical mass of Southern Baptists at the Law School. Counsel
for the Law School attempted to deflect this analogy by arguing that a religious preference of the
same form as the Law School’s racial and ethnic preference would raise “special” constitutional
problems of “getting entangled” with religion in violation of the “First Amendment.” Tr. at 16-17.
In essence, counsel’s argument was that an admissions policy with religious preferences that would
comport with the Equal Protection Clause could nevertheless violate the Establishment Clause. I
could find no case or even analytic argument for the proposition that a policy, pursuing a compelling
state interest and tailored narrowly to that interest, could violate the Establishment Clause. Cf. Droz
v. CIR, 48 F.3d 1120, 1122 (9th Cir. 1995) (noting the relevance of the strict scrutiny framework to
the First Amendment inquiry). With as much justification as the Law School disclaims any invidious
animus toward “over-represented” groups in its policy, comparable discrimination against “over-
represented” religious groups could be said not to represent the establishment of all other religions
or the irreligious. I am convinced that the analogy, and therefore the inevitable implications, of the
Law School’s constitutional argument here, hold.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 77
case or controversy before the Court could be a holding binding on this court, I cannot believe that
a “plus” of any size, no matter how large, would be therefore constitutional. I believe that the Law
School’s preference is just too large to be narrowly tailored.
My analysis of the narrow tailoring defects of the Law School admissions scheme falls into
four parts. First, I detail the true magnitude of the Law School’s preference. Second, I explain why
we cannot draw a meaningful distinction between the Law School’s attempts to achieve a “critical
mass” of under-represented minorities and the quotas that the majority concedes to be
unconstitutional. Third, I question whether a strong racial preference bears any demonstrable
relationship to the claimed benefits of educational pluralism. Fourth and finally, I suggest some
race-neutral means of achieving the Law School’s avowed ends that the Law School has not pursued.
1. The True Magnitude of the Law School’s Racial Preference
Because the majority has not laid out the magnitude of the discrimination revealed by the
record, it is important to detail it here. An examination of the admissions data shows that even the
most qualified majority19 students (those with an LSAT over 170 and a GPA over 3.75) do not
achieve the perfect admissions percentages for under-represented minority students with a GPA
nearly a point less and an LSAT score in the 164-66 range. More roughly speaking, under-
represented minorities with a high C to low B undergraduate average are admitted at the same rate
as majority applicants with an A average with roughly the same LSAT scores.20 Along a different
axis, minority applicants with an A average and an LSAT score down to 156 (the 70th percentile
nationally) are admitted at roughly the same rate as majority applicants with an A average and an
LSAT score over a 167 (the 96th percentile nationally).
The figures indicate that race is worth over one full grade point of college average or at least
an 11-point and 20-percentile boost on the LSAT. In effect, the Law School admits students by
giving very substantial additional weight to virtually every candidate designated as an “under-
represented minority” or, equivalently, by substantially discounting the credentials earned by every
student who happens to fall outside the Law School’s minority designation.
For the potential applicant, the Law School’s system creates very different dilemmas
depending on his race. If confronted a year before they applied to the Law School with the records
of two students, whose non-racial credentials were equivalent, we might evaluate their prospects for
admission as follows: Student A could work harder and raise her GPA by a full point. Student B
19
Meaning, for these purposes, those students who are not “under-represented minorities.”
20
JA at 603, 605. Comparison between students in the 167-169 LSAT range in 1997.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 78
could reveal the fact of his skin color or ethnicity, it being in one of the preferred categories.21 The
Law School’s admissions officer, who before both changes would have rated the students equally,
would now find the students equal, the effort of the one being counterbalanced by the background
of the other.
More shocking is the comparison of the chances of admission for applicants with the same
academic credentials (at least numerically). Taking a middle-range applicant with an LSAT score
164-66 and a GPA of 3.25-3.49, the chances of admission for a white or Asian applicant are around
22 percent. For an under-represented minority applicant, the chances of admission (100%) would
be better called a guarantee of admission.
At some point, however, comparison of the admissions rates of white, Asian, and other
unselected ethnic applicants and the minority groups designated for preference becomes impossible.
The Law School simply stops meaningful consideration of non-minority candidates below certain
grade point and LSAT figures,22 a practice demonstrated by admissions rates well below 10 percent,
and often the absence of a single admitted student, in these credential categories. “Under-
represented minorities,” on the other hand, not only continue to have respectable chances of
admission in these categories, but in most cases enjoy rates of admission in excess of 80 percent.23
Far from receiving “competitive consideration,” majority applicants are all but summarily rejected
with credentials, but not ethnicity, identical to their under-represented minority “competitors” who
are virtually guaranteed admission. The Law School’s admissions practices betray its claim that it
gives meaningful individual consideration to every applicant notwithstanding their race.
21
While it should not be necessary to make this point, the use of hypotheticals or examples
that illustrate the effective impact of the policies under consideration is in no way a commentary on
specific persons. If a policy has real effects that seem impolite or offensive, that is a result of the
policy, not of those who point it out.
22
Majority applicants with an A average and LSAT over 164 enjoy admission rates over 40%.
As their grades slide to a high B average and an LSAT over 164, their admission rates drop to around
20%. Below a 164, majority applicants are not admitted at a rate any more than 10%, regardless of
their grade point average.
23
By comparison, designated minorities are not only considered, but admitted in rates over
60%, and usually over 80%, with LSAT scores down to 154 and grade point averages in the low B
range. Even below these figures, designated minorities are still admitted at rates nearing 30% in
many categories of LSAT and GPA. Not until the designated minorities’ LSAT drops below 150
(47th percentile nationally) or a GPA of 2.5 do we see admission rates under 10% for designated
minorities.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 79
The sharp threshold for admission that the Law School appears to establish for majority
applicants reveals the emptiness of another purported justification for its racial preference. The Law
School justifies its stark preference, in part, by claiming that all the applicants admitted, even those
admitted because of its preference, are “qualified.” If the Law School actually believed that all
applicants, with combinations of credentials sufficient for admission for minorities, were truly
“qualified,” it would likely be willing at least to consider admitting majority applicants who were
equally “qualified.” Instead, the Law School reveals its true views regarding the necessary
credentials for its law students through its clear line in its admission of majority candidates: students
below the credential threshold either diminish the educational environment of the school or spare
it only if kept to a small percentage of the class.
In the alternative, the Law School’s process designates as “qualified” virtually all who apply
for admission. If the Law School is being honest, it considers every last under-represented minority
admitted “qualified.” Indeed, the admissions data reveal that the Law School admits nearly every
minority student who meets threshold credentials, as there appears to be a sharp cliff in rates of
admission between extremely small variations in objective credentials.24 If the Law School considers
everyone above this minority threshold “qualified,” it must also consider the 89 percent of the
applicant pool above this threshold “qualified.” Yet it is clear that the Law School would not be
comfortable with the random admission of any of the 89% of its applicant pool. The Law School
does not truly consider majority applicants toward the bottom half of this 89% “qualified” – it admits
almost none of them.
The Law School’s use of the term “qualified” reveals its slipperiness. The court majority
reveals the Law School’s shift in usage when it explains the rejection of a more random selection
method because the school seeks to assemble “both a highly qualified and richly diverse academic
class.” Majority Op. at 19. The Law School appears to be all too cognizant of the difference
between “highly qualified” and merely “qualified” applicants. Its two steep cliffs in the admissions
rate, one for under-represented minority applicants and one for majority applicants, demonstrate that
the Law School maintains a “two-track,” indeed separated, system for admissions. Using its under-
represented minority threshold, the Law School fills its seats reserved for “qualified” candidates.
Using its majority threshold, the Law School completes the balance of its class with “highly
qualified” applicants. That the Law School merely seeks to insure that “all its students are qualified”
is an empty claim.
24
For example, there is a sharp drop in rates of admission between under-represented minority
applicants with a 154 to a 155 LSAT score and those with a 151 to a 153. With a 154 to a 155, we
see admission rates in excess of 60%. With a 151 to a 153, however, minorities are admitted at rates
below 20%.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 80
The Law School argues, however, that these overwhelming data are illusions produced
through the smoke of litigation. These data, standing alone, the Law School seems to claim, could
be produced by very small differences in actual qualifications. Taking certain hypothetical statistics,
the Law School’s contention could certainly hold. For example, if for some reason every applicant
had the same LSAT score, but every white had a GPA of 3.50 and every black had a GPA of 3.49,
a “racial preference” would be required to obtain any admission of black students, but the degree of
that preference would obviously be very small. The difference in chances of admission for the black
and white applicants would still be very large, but the practical amount of preference would be very
small.
However, such are not the admissions statistics in this case. As the statistics show, the
degree of preference can be characterized, in the benign words of Justice Powell and Harvard, as a
“tip” only with some considerable violence to terminological exactitude.25 The term “tip” would
convey to the average reasonable person something that overbalances a fairly closely divided or
nearly evenly balanced choice. A seesaw with roughly equivalent children on either end can be
“tipped” from one side to the other with a small weight. However, if a boulder must be placed on
one side to shift the balance, the term “tip” would apply only if it were infinitely elastic. A common-
sense view of a “tip” might be that in a zone where 80 or 90% of majority applicants are admitted,
100% of minorities would be favored. Or, in a zone where only 10 or 20% of majority applicants
are admitted, 30 or 40% of minorities might be. If Justice Powell’s words are to be used as anything
more than a subterfuge, that would be the kind of preference that a fair reading of his opinion might
endorse.
The majority responds that there is no evidence in Bakke about how large the racial
preference was in the Harvard plan of which Justice Powell spoke approvingly. Majority Op. at 25-
26. As a result, it is impossible to know whether the Law School’s alleged “plus” was larger than
Harvard’s. Majority Op. at 17. Immediately thereafter, the majority concludes that the Law School’s
admission scheme is “virtually identical to the Harvard plan,” and that therefore the Law School’s
system must be constitutional. Ibid. How does the majority know that the Law School’s system is
“virtually identical” to Harvard’s? I am deeply puzzled regarding how the majority could place both
its confession of ignorance regarding the details of the Harvard plan and its claim that the two plans
are identical in the same paragraph. The majority’s argument, yet again, simply elides empirical
premises necessary to sustain what it claims to be the controlling analogy between the Law School
and Harvard plans.
And indeed the majority’s recognition that there is no factual record regarding the Harvard
plan in Bakke echoes the reason why federal courts do not issue advisory opinions on cases not
before them and why we find binding only the holdings, but not the dicta, of prior cases. Without
25
Cf. United States v. Allen, 211 F.3d 970, 976 (6th Cir. 2000) (en banc).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 81
an actual case or controversy before it, a court is not able to develop a factual record and to
determine which facts would be legally relevant. The absence of a factual record on the Harvard
plan reinforces the reasons that Justice Powell’s thoughts regarding its potential constitutionality are
not binding.
Even if we know nothing of the absolute magnitude of the Harvard plan other than its
description as merely a “tip” or a “plus,” we have some evidence regarding its relative magnitude.
As described in the amicus brief before the Court in Bakke, the Harvard plan provided that “the race
of an applicant may tip the balance in his favor just as geographic origin or life spent on a farm may
tip the balance in other candidates’ cases.” LANDMA RK BRIEFS AND ARGUMENTS, supra n.1, at 736
(emphasis added). From the description, it would seem that Harvard’s racial preference would be
similar in magnitude to the preference given other soft factors. We know, however, from the
indisputable statistical evidence in this case and the Law School’s own admission that no other soft
factor is even remotely as significant as race in its admission decisions. Additionally, there is
nothing in the Harvard description that even hints that its preferences for race or others factors of
diversity are of the magnitude here, taking the chance of admission from near zero to near 100%, in
many cases.
It is clear from the Law School’s statistics that under-represented minority students are nearly
automatically admitted in zones where white or Asian students with the same credentials are nearly
automatically rejected. Indeed, the Law School concedes that its racial preference is sufficiently
heavy that 3 out of 4 under-represented minority students would not be admitted if all students were
truly considered without regard to race. JA at 6047. The characterization of the Law School’s
preference as only a “tip” or “plus” would eviscerate those words, and transform Powell’s thoughful
discussion into a carte blanche for adopting the UC Davis system with only a few cosmetic changes.
One might wonder why I focus so heavily on the LSAT and GPA admissions data provided
by the Law School. Of course, the constitutional deficiencies of the Michigan policy have nothing
to do with the question of how and whether universities should consider academic measures such
as GPA and LSAT in their admissions policies. Michigan is perfectly free to abandon or to
restructure those measures. However, those are the standards it has chosen to distinguish among
majority candidates, and to distinguish among minority candidates. Equal protection of the laws
demands that the objective standards that the Law School chooses are applied with some modicum
of equality, and they are not here.26
26
The concurring opinion criticizes this statistical analysis by noting scholarship suggesting
no good link between “numerical credentials,” presumably meaning LSAT and GPA, and “success
in Law School.” Concurring Op. at 39-40 (Clay). My only point here is that, notwithstanding the
debate over more accurate measures of educational merit, the Law School undoubtedly thinks LSAT
and GPA are most important. The only other credential that appears to be systematically important
Nos. 01-1447/1516
Grutter v. Bollinger
Page 82
Michigan argues, with some justification, that it also considers a wide variety of “soft”
factors. And nothing in this opinion denigrates the use of such factors, or even changing or
increasing them, so long as they are applied equally. However, it is of the greatest importance to
note that Michigan does not contend, in any way, that the consideration of those factors explains any
advantage, systematic or otherwise, for minority candidates. It does not make that claim in its filings
or briefs, and I specifically put the question in oral argument: “Do you assert that under-represented
minorities systematically have stronger [soft factors] than non-minority students?” Counsel
responded with a firm “no.” Tr. at 41. Thus, the issue is not the merits behind one combination of
qualifications or another. The constitutional dilemma presented is the use, or at least the degree of
use, of race to overcome qualifications, however defined.
2. Differentiating a “Critical Mass,” a “Plus” and a “Quota”
As I have just explained, the preference accorded minorities in the Law School’s admissions
scheme is different in magnitude from the “plus” or the “tip” that Justice Powell thought might be
permissible under certain conditions. The Law School’s racial preference, however, suffers from
deeper problems – as it appears calibrated to admit a certain percentage of under-represented
minority students. The Law School concedes that the preference is designed to admit a “critical
mass” of under-represented minority students. Of course, the term “critical mass” is intentionally
vague. When pressed, the Law School will explain that a “critical mass” is that number of students
necessary to enable “minority students [to] contribute to classroom dialogue and not feel isolated.”
Majority Op. at 5. Pressed further, the Law School will not say that any particular number of
minority students constitutes a critical mass. It seems obvious to me, however, that the Law School
has an opinion as to what that number is and attempts to achieve it.27
The majority summarily dispenses with this problem, approvingly quoting the comforting
reassurances of Dean Lehman (“We do not have a portion of the class that is set aside for a critical
mass”) without noting that in fact a critical mass is always obtained. Majority Op. at 14. And
comforting those words must be, as a contrary response would have produced what appears to be the
only manner in which a racial preference in admissions could be unconstitutional for the majority:
a quota system. Yet Harvard in the 1930's did not have to say that exactly 87 percent of the seats
is race, and I think we should at least be candid about how much emphasis that the Law School
places on race. To the extent that the concurrence mounts a more substantial attack on the use of
numerical credentials generally, its quarrel is with the Law School, not with my position.
27
See, e.g., Tr. at 21-24, where counsel for the Law School admitted that 3-5% would not be
enough and that “clearly we care about the number.”
Nos. 01-1447/1516
Grutter v. Bollinger
Page 83
were set aside for Gentiles – it just had to apply an admissions system based on “character” that
achieved roughly the same result.28
The results of the Law School’s system to produce a “critical mass” reassure us that the Law
School really seeks to enroll a critical number of minority students. Between 1995 and 1998, the last
four years for which we have data, the Law School consistently enrolled a number of under-
represented minorities constituting 13.5 to 13.7 percent of the class enrolled. The absolute numbers
are just as consistent: 47 of 341 in 1998, 46 of 339 in 1997, 44 of 319 in 1996, and 46 of 340 in
1995. University of Michigan Law School’s Report to the ABA, JA at 643. The statistics
demonstrate that the Law School was more successful at enrolling a precise number of under-
represented minorities than a precise number of total students.29 It seems clear to me, at least, that
the “critical mass” the Law School seeks to achieve is only vague and flexible for outsiders not
looking at its enrollment statistics.30 The Law School’s “critical mass” of designated minorities is
44-47 per class, or around 13.5%.
The majority and the Law School stress that minority enrollment numbers have varied,
indicating that the Law School does not maintain a fixed target for minority admissions. The fact
28
The percentage of Harvard students who were Jewish varied between 1933-42, but was
quite stable and well below the percentages in the 1920's. In the 1920's, the percentage consistently
approached 30%. A glance at the 1933-42 Harvard figures, with percentages of 12.4, 9.9, 10.9, 14.8,
14.0, 15.4, 14.4, 16.0, 14.1, and 16.1, reveals a chart that looks very much like Michigan’s with
respect to under-represented minorities. Synnott, THE HALF -OPENED DOOR at 115, Table 4.8 (1971).
29
Admittedly, these percentages did deviate a bit from this tight grouping in some years
before 1995 being, respectively, 12%, 14%, 14%, 13%, 19%, 20%, 14%, 20%, for the years 1987-94.
These deviations, however, do not muddle the extraordinarily tight grouping in the last four years
and primarily show what may have been, in the Law School’s view, “excessive” percentages in three
of the years. Nevertheless, the lowest percentage never falls below 12%, while the Law School
acknowledges that three-fourths of that number is accounted for by the application of its preference
policy.
Of course, even these early numbers are consistent with the Law School’s maintaining a
numerical target. Perhaps the Law School had a different target in those years. It is hard to know,
because the Law School has failed to specify its view of “critical mass.” Perhaps the Law School
simply got better at exactly achieving its target.
30
There is little solace in the Law School’s unwillingness to reveal its quota. I share Justice
Brennan’s view: “there is no basis for preferring a particular preference program simply because in
achieving the same goals [as a quota system], it proceeds in a manner that is not immediately
apparent to the public.” Bakke, 438 U.S. at 379.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 84
that there has been any variation (.2% over four years), trivial though it may be, in the percentage
of students admitted who are minorities satisfies the majority that the Law School does not maintain
a quota. After all, the majority instructs us, variation produces a range, and a range will always have
a “minimum,” that might look like a number below which the Law School will not go. Majority Op.
at 16. Such is the nature of a range, the majority says, almost suggesting that it was foolish to be
concerned about the question. Ibid.
I am not concerned just with the bottom of the range, but also its top. The range, as I have
demonstrated, is remarkably tight. Admittedly, it is not identical from year to year – but the lack of
identity does not seem enough to demonstrate that the Law School does not have an exceedingly
precise numerical target in mind when admitting its students. The fact that a quota is a range rather
than one specific number certainly does not insulate a program from constitutional scrutiny. In
Bakke, had UC Davis said “We’re going to reserve, oh, about 14 to 18 seats, maybe give or take a
few,” for minority students – and then, indeed hit that range every year, I doubt that anyone can
seriously believe that the outcome of that case would have been different.
The majority’s reliance on such slight variations also ignores the imprecision involved in
producing enrollment. A law school does not admit students with perfect information regarding its
yield, that is the percentage of students that will accept offers of admission. The yield is radically
dependent on the idiosyncratic preferences of the students admitted. Accordingly, in a given year,
highly selective law schools may have ten percent variations in the overall sizes of their enrolled
classes, much less any desired component part. The University of Michigan Law School is no
exception, enrolling 341 students in 1998, 339 in 1997, 319 in 1996, 340 in 1995, 363 in 1994.
Given these uncertainties, the quite narrow range of minority enrollment percentages that the Law
School achieves is remarkable for its consistency, and it seems to me that the Law School is doing
all it can to achieve a target number of minorities. I take no comfort in the statistically minor
variations in minority enrollment.
Indeed, the record makes it clear that, to take a hypothetical example, if the Law School were
to discover near the end of its process that a large number of its admitted minority students had all
decided to attend other schools, thus leaving both a block of empty seats and a huge deficit in the
sought-for “critical mass,” the Law School would bend every effort to fill those seats with minority
students. Before all offers of admission are made, substantial numbers of applicants accept,
clarifying the likely composition of each class. Law School officials testified that they vigorously
monitor the acceptance data with regard to race on a daily basis, see Depo. of Dennis Shields, JA at
2219-20, perhaps to admit minorities that it otherwise would not have or perhaps to admit minorities
on the waiting list. This, of course, is the practical equivalent of the “segregated waiting lists”
condemned in other cases. See, e.g., Hopwood v. Texas, 78 F.3d 932, 938 (5th Cir. 1996).
The combination of the Law School’s thinly veiled references to such a target, its “critical
mass,” and relatively consistent results in achieving a particular enrollment percentage, should
Nos. 01-1447/1516
Grutter v. Bollinger
Page 85
convince us that the Law School’s admissions scheme is functionally, and even nominally,
indistinguishable from a quota system. At the very least, however, the Law School’s admission plan
seems far from employing the mere “plus” or “tip” that the majority characterizes its racial
preference to be.
In order for the language of “plus” or “tip” to have real meaning, there would have to be
some indication that the other, allegedly similar, plus factors were also of a strength that were
anywhere near the potency of the preference here. After all, Justice Powell himself contended that,
to be only his “plus,” race would need to be just one among many factors. As Justice Powell wrote,
“The file of a particular black applicant may be examined for his potential
contribution to diversity without the factor of race being decisive when compared,
for example, with that of an applicant identified as an Italian-American if the latter
is thought to exhibit qualities more likely to promote beneficial educational
pluralism. Such qualities could include exceptional personal talents, unique work or
service experience, leadership potential, maturity, demonstrated compassion, a
history of overcoming disadvantage, ability to communicate with the poor, or other
qualifications deemed important.”
Bakke, 438 U.S. at 317 (Powell, concurring). The majority is content to accept the Law School’s
claim that it considers some of these “soft” factors. Majority Op. at 15. I would ask whether any
of them are remotely comparable in weight. While not every factor would be required to bear equal
weight under the Powell view, it seems clear that at least some of these other factors would need to
be capable of taking a student’s chances from virtual certainty of rejection to virtual certainty of
admission. There is no such evidence as to any race-neutral factor, but there is repeated and
consistent evidence of such a treatment of race and ethnicity.
3. Achieving the Benefits of a Diverse Educational Environment
Even if I were not convinced that the Law School’s pursuit of a “critical mass” of minority
students is a constitutionally invalid means to achieve diversity, I would still find the empirical link
between such “critical mass” and the values of diversity lacking. 31 The Law School never provided
31
This discussion highlights the overlapping nature of the two-step equal protection analysis.
One might think that a discussion of the benefits of diversity would be better placed in the analysis
of whether diversity in education is a compelling state interest. At this point, it is important to be
precise. No one, not even the Law School or Justice Powell, claims that diversity for its own sake
can constitute a compelling state interest. Instead, the claim is that diversity yields race-neutral
benefits that are themselves compelling. More precisely speaking, diversity in education is a means
of achieving the compelling state interest in the benefits of diversity.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 86
any evidence that the existence of the “critical mass” would in fact contribute to classroom dialogue
or would lessen feelings of isolation or alienation. The only evidence at all bearing on this is from
the Gurin Report.
The Gurin report is questionable science, was created expressly for litigation, and its
conclusions do not even support the Law School’s case. The benefits of a diverse student body that
the study purports to prove, essentially better learning32 and increased democratic participation,33 are
themselves vague to a degree that we would never accept to satisfy strict scrutiny in any other
context. The concurring opinion34 contends that this opinion ignores the Gurin report in discussing
diversity’s capacity to deliver its claimed benefits. Concurring Op. at 29 (Clay). The concurring
opinion, however, does not even mention, much less analyze, the strength of Gurin’s proof. The
“study” suffers from profound empirical and methodological defects that lead me to doubt its
probative value. And certainly neither the trial court as finder of fact nor the majority opinion take
the report’s conclusions as fact.
First, the report falls well short of making the Law School’s case, even if we simply accept
it without scrutinizing its conclusions. The report takes no position on how much diversity is
required to yield the claimed benefits, and thus does not even purport to substantiate the Law
School’s claim that a “critical mass” of minorities is required to achieve the educational benefits of
diversity.35
32
The report claims that the educational benefits that positively correlate with diversity
include “graduate degree aspirations,” “drive to succeed,” and “academic ability.” Gurin also notes,
in passing, that the favorable outcomes for African-American students, with which she reports a
correlation to her diversity measures, do not include actual learning as measured by grade point
average. See JA at 2355; Patricia Gurin, The Compelling Need for Diversity in Higher Education,
5 Mich. J. of Race and L. 363, 391 (1999).
33
The democratic benefits include “influencing social values,” “helping others in difficulty,”
and “being involved in environmental activities.”
34
Although there are two concurring opinions in this case, only Judge Clay’s addresses the
substantive portion of this dissent. My references in the text to the “Concurring Opinion” refer to
Judge Clay’s. I will make a more specific reference when referring to Judge Moore’s concurring
opinion.
35
The relationship between diversity and these assorted educational benefits could be
proportional, exponential, or stepwise. If it were merely proportional, there would appear to be no
basis for the Law School’s attempts to achieve a “critical mass,” rather than each marginal “under-
represented minority” bringing equal benefit.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 87
Second, the report’s aspirations to empiricism are undermined by the subjectivity of its data.
After all, the report bases its claimed educational benefits on only the subjective self-reports of
students.
Third and most importantly, the statistical regressions relied on by the report never examine
the statistical link between having a more diverse student body and the benefits that it claims.
Instead, the regressions investigate only the correlation between the claimed benefits and two proxy
variables for diversity: “classroom diversity” and “informal interactional diversity.” See Gurin
Report, JA at 2434, 2437, 2441, 2446. “Classroom diversity” is defined as the responding student
having taken an ethnic studies class, and “informal interactional diversity” as a student having had
social interaction with or about minorities in college. Ibid. Both of these variables, however, are
independent of having a more racially or ethnically diverse student body, and appear to make the
case for more ethnic studies classes or informational seminars about ethnic issues, instead of greater
numbers of minority students. In fact, one wonders why Gurin did not directly correlate her benefits
to the much less complex, but infinitely more relevant, variable of participation in a more diverse
student body: I fear that Gurin used the proxies because a study of mere student body diversity either
did not or would not produce the results that she sought.36 In any event, we lack any even
purportedly empirical evidence demonstrating a correlation between increasing the number of under-
represented minorities enrolled and the vague benefits of diversity claimed by the Law School.37
36
I am not alone in questioning the conclusions of the Gurin Report and the poverty of the
empirical evidence presented. A social scientist and supporter of affirmative action in education
evaluating some of the same data that Gurin used, but also examining actual student body diversity,
concluded that “academic outcomes are generally not affected” by student body diversity, and that
the effects that are indicated are “very weak and indirect.” Alexander W. Astin, WHAT MATTERS IN
COLLEGE ? 362 (Jossey-Bass 1993). As we might expect from the vague list of claimed benefits, this
researcher’s study concluded that “[t]he values, attitudes, and socioeconomic status of the peer group
are much more important determinants of how the individual student will develop than are the peer
group’s abilities, religious orientation, or racial composition.” Id. at 363. Accordingly, a candid and
empirically rigorous affirmative action supporter has admitted that a link between racial diversity
and improved educational results has “yet to be convincingly demonstrated” and that “[t]he research
still needs to be done that would demonstrate the link.” Peter Schmidt, Debating the Benefits of
Affirmative Action, CHRON. OF HIGHER EDUC. A25 (May 18, 2001).
37
Even more fundamentally, social science data as to the efficacy, in the eyes of one or
another researcher, of policies of discrimination are themselves of limited utility in resolving the
ultimate constitutional issue. At the time of Brown v. Board of Education, 347 U.S. 483 (1954),
there were certainly researchers with academic degrees who argued that segregated education would
provide greater educational benefits for both races. Does anyone think that a factual belief in such
analyses would have, or should have, led to a different constitutional outcome in Brown? I very
Nos. 01-1447/1516
Grutter v. Bollinger
Page 88
The Gurin Report aside, the link between the Law School’s diversity and its claimed benefits
is conceptually flawed. The relationship between a “critical mass” and the values of diversity would
depend on contingencies nearly impossible to predict. The Law School’s definition seems to depend
wholly on the psychological makeup of the people involved, whether labeled as majority or minority.
Certainly history is replete with examples of members of minority groups, from Frederick Douglass
to Martin Luther King to Thomas Sowell, who have said their piece and stood for what they believed
in without regard to whether others thought them to be a “representative.” Eleanor Roosevelt is
quoted as having said that “no one can make you feel inferior without your consent.” The same is
true of representativeness. Apparently, by this measure, if and as members of the under-represented
group become psychologically stronger, and thus more able or willing to speak as individuals, the
Law School needs less and less of them.
On the other hand, if the measurement is based on the attitudes of the “non-minority”
students, there again is little concreteness to the measure. This would seem to mean that if those
outside the minority groups were all paragons of tolerance, then there would be no need for any
preference, because all students would uphold the precepts of the Constitution and major religions
to treat each person as an individual. Conversely, if the majority student body stubbornly persisted
(following the Law School’s lead) in attributing the experiences and opinions of their classmates to
their racial identity, the critical mass would need to expand and expand, presumably until most or
all of the recalcitrant majority students had been driven from campus. In short, any sort of rationale-
based definition of “critical mass” seems hopeless.
“Critical mass” also has difficulties if it is defined in a way divorced from some notion of
the “proper” representation of the particular group. Since the Law School gives no principles,
sociological or otherwise, by which the “non-representativeness” of individual group members can
be judged, we would have to assume that a “critical mass” would be of approximately the same size
for any designated group. Thus, Afghans, Orthodox Jews, Appalachian Celts, or fundamentalist
Christians might also feel that their remarks were being taken as representative, rather than
strongly doubt it. Similarly, research asserting that Jews and Gentiles in fact interacted more
harmoniously under Lowell’s Harvard plan would not justify that policy either.
I note that this question is not simply of academic or antiquarian interest. Questions have
been raised as to the ability or desirability of school districts implementing all-black academies in
order to improve educational performance. See Wil Haygood, Rethinking Integration: On Schools,
Many Blacks Return to Roots, BOSTON GLOBE (Nov. 16, 1997). I sincerely doubt that the factual
outcome of conflicts between social scientists as to varying studies of the educational effect of such
policies would be dispositive of the constitutional question that might be raised. See Drew S. Days,
III, Brown Blues: Rethinking the Integrative Ideal, in REDEFINING EQUALITY (Neal Deavins and
Davison M. Douglas, eds., Oxford 1998) (noting, while discussing the possibility of all-black public
educational institutions, that “[e]xpedience cannot legitimize racial segregation”).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 89
individually, unless they, too, had a “critical mass.” Then, the makeup of the entering class could
be wholly determined by those groups that the Law School chose to classify as appropriate for
worrying about their “under-represented status.” Indeed, the Law School does not appear to believe
that the critical mass for Native Americans, for example, is nearly as large as it is for blacks and
Hispanics. Thus, some measure of rough proportionality inevitably creeps in as the measure of what
is the “critical mass.” Although the Law School’s deponents tried very hard to avoid any specificity
in their responses (“A mass of Latin words falls upon the facts like soft snow”), it was clear both in
the trial record and at oral argument that a number that was only half or less of a group’s
representation in some national measure of population would not be considered a “critical mass.”
Also problematic is how the Law School has selected the minorities entitled to a preference
in terms of fostering a diverse educational environment. The Law School’s statement that its actions
are justified because members of under-represented minorities are “particularly likely to have
experiences and perspectives of special importance” raises the question of whether it can determine
that other groups, such as Americans of Japanese or Welsh ancestry, are “particularly unlikely” to
have such experiences and perspectives. In practical effect, that is what the Law School has decided,
and without any specific basis. Either the experiences and perspectives are themselves valuable, in
which case they could be judged on that basis without reference to skin color or parentage, or the
Law School is assuming a heterogeneity among widely diversified groups.
4. Potential Race-Neutral Means
In order for its racial classifications to survive strict scrutiny, the state must first look to race-
neutral means to achieve even compelling state interests. The Supreme Court has made clear that
courts must determine whether a state’s racial classification is necessary with reference to the
efficacy of race-neutral alternatives. See, e.g., Croson, 488 U.S. at 507; United States v. Paradise,
480 U.S. 149, 171 (1987); Associated Gen. Contractors of Ohio, Inc. v. Drabik, 214 F.3d 730, 736
(6th Cir. 2000).
What is not crystal clear, however, is the nature of the consideration that reviewing courts
must undertake. Yet only one tack makes analytical sense. In order to prevail under strict scrutiny,
the state must demonstrate not only that its racial classification achieves compelling state benefits,
but also that these benefits may only be obtained by the shift from a well-designed, race-neutral
alternative. Put differently, the state must demonstrate that the marginal benefits gained from
employing the racial classification over the next most efficacious race-neutral alternative are
themselves compelling. Any other standard would make success under strict scrutiny a mere exercise
in question framing. The interest vindicated by a racial classification would look very large, perhaps
even compelling, when compared to the benefits delivered by some dismal alternative. Instead, we
should require that before we find marginal benefits reflective of a compelling state interest, they
must be those gained over the best race-neutral alternatives.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 90
Consider some of the race-neutral alternatives available in this case. The gradient of benefits,
along which the race-conscious and race-neutral means are judged, is “academic diversity,” or
achieving a pluralism of experiences and ideas. See Part III.A.1. Earlier in this opinion, I discussed
the possibility of considering experiential diversity in a race-neutral manner. Swamped with the
children of wealthy suburbanites, the Law School could seek out applicants who were raised amidst
relative poverty, who attended under-funded or failing schools, who walked to school past
warehouses instead of coffeehouses, who experienced but conquered extreme emotional trauma, like
the loss of a parent, who prevailed over a profound childhood illness, who have dedicated years to
helping the poor in the Jesuit Volunteer Corps, or, even less stirringly, who have a strong accounting
background among a raft of history majors. If it really is a diversity of experiences and viewpoints
that the Law School seeks, why cannot the Law School just seek those experiences and viewpoints?
Instead, the Law School searches for particular races and ethnicities as a means of securing
a diversity of experience, and, so they say, for no other purpose. A well-functioning search for
experiential diversity would certainly yield the greatest measure of it. After all, even the Law School
would admit that race is an imperfect proxy for experiential diversity. Next-door neighbors in
Grosse Pointe, separated only by 30 yards and the color of their skin, would not necessarily be
significantly different from each other. In principle at least, the race-neutral means of seeking the
experiences themselves would seem superior to the Law School’s race-conscious means, if its aim
is as it professes. This is quite the opposite of the woeful inadequacy of race-neutral means that we
generally require to consider a racial classification narrowly tailored.
In practice, the Law School could make all sorts of arguments about the inadequacy of merely
seeking experience. For example, admissions officers would have to read (and seriously consider)
more text in an application if it were seeking experience rather than race. The medium for
communicating this quality, of course, lacks the efficient simplicity of the racial check-box. Yet,
over and over again, the Law School has reassured us that its exquisitely meticulous admissions
officers already consider each application individually and thoroughly. Such is the luxury, the Law
School tells us, of so few applications and spots to fill. I am willing to take the Law School at its
word, and believe that it is fully capable of undertaking this searching review of individual
experience.
Also, a system seeking experiential diversity might increase the risk of applicant fraud. It
might be somewhat easier to verify that some individuals were truly of the right group than the
details of their life stories. This comparative ease should not be overstated, however, as the
distinctions between the Law School’s “under-represented minorities,” from various types of
Hispanics to the marginally African-American, and the rest of society can be very subtle indeed. See
Part III.B.2. Moreover, there are all sorts of readily identifiable indicia of experiential diversity.
One’s home mailing address gives quite a bit away. Law schools already ask for detailed financial
information to make financial aid judgments, permitting a review of the relative poverty to which
the applicant was subjected. If the Law School were interested in the student’s secondary education,
Nos. 01-1447/1516
Grutter v. Bollinger
Page 91
and the experiences that it imparted, it would not be outrageous to ask for a high school transcript.
Indeed, as a good portion of the Law School’s student body hails from Michigan, see JA at 1947,
the Law School’s seasoned admissions officers could probably develop a pretty intimate
understanding of the state’s high schools.
In short, the ready availability of seeking unique experiences themselves, rather than an
imperfect proxy for them, demonstrates that the marginal benefits of the Law School using its
suspect racial preference instead of the available race-neutral means are far from compelling. In fact,
because it seems to me that selecting on the basis of race is actually a more poorly calibrated means
of achieving the experiential diversity that it allegedly seeks, I doubt that the Law School is really
interested in “academic diversity.” And this “academic diversity” is the only diversity that will
satisfy the Powell opinion that the majority considers outcome-determinative. Instead, it is more
likely that the Law School’s preference for certain races is an interest in race itself.
Another race-neutral alternative mentioned is conducting a lottery for all students above
certain threshold figures for their GPA and LSAT. This would insure a student body as diverse as
the “qualified” applicant pool itself. As demonstrated above, the Law School’s unwillingness to
conduct a lottery among all those students that it considers “qualified” reveals that it really maintains
a two-track admissions system, one for the “highly-qualified” students of all races that it generally
seeks, and another for under-represented minorities who are only “qualified.”38
The availability of such race-neutral means, especially in dealing with the manageably small
applicant pool of the Law School, reveals that the Law School’s talk of desiring only “academic
diversity” is only window dressing for sheer racial discrimination.
III
Many commentators have observed that America is still a society in which “race [as well as
ethnicity, religion and other ancestral characteristics] matters.” But we can not simply suspend the
Equal Protection Clause until race no longer matters. Nor has the Supreme Court authorized us to
do so. One need not advocate literal “color-blindness,” where we neither notice nor appreciate the
differing experiences and communities of others, to hold that our Constitution forbids the
government from assigning massive advantages and disadvantages based on a naked assignment of
racial labels.
38
The concurring opinion suggests that evidence of racial and gender bias in LSAT and GPA
figures would render the lottery race-conscious. Concurring Op. at 42 (Clay). Of course, the lottery
itself would be completely race-neutral. I do not see how using the Law School’s “qualification”
threshold, with which no party or judge has heretofore quarreled, to restrict the lottery would make
the lottery race-conscious.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 92
A significant amount of the analysis at pages 34-35 of the concurring opinion is directed to
the point that race continues to be a factor that operates in American society in many negative, as
well as positive, ways. I do not deny that. I am fully willing to stipulate that race does matter in
American society and that, on average, it matters more negatively for some, if not all, of the groups
favored by the Law School than it does for some, if not all, of the groups disfavored by the Law
School. And I will also stipulate that such impact or disadvantage is not strictly limited by present
income or status. But a defense of the Law School’s policies on the basis of remediating generalized
past discrimination has several problems.
First, the Supreme Court has firmly rejected the remediation of general “societal ills” and
past discrimination as a justification for racial classifications. Richmond v. J.A. Croson Co., 488
U.S. 468, 498 (1989). Second, it is not the basis on which the Law School has stated that it operates,
nor was the question litigated (except by intervenors), either at the trial level or the appellate level,
or addressed in the majority opinion. More fundamentally, however, such an approach confuses
societal ills, that may be addressed by societal means, with the rights of individuals. Julian Bond,
certainly a person who has been knowledgeable and engaged in this issue for decades, wrote in the
Gonzaga Law Review that policies like those in question here are the “just spoils of a righteous war.”
Julian Bond, Lecture: A Call in Defense of Affirmative Action: Just Spoils of a Righteous War, 34
Gonz. L. Rev. 1, 9 (1998). The struggle for civil rights in America, going back well over a century,
can certainly be characterized as a righteous war. However, the earlier set of just spoils from a
righteous, actual war, the American Civil War, had two characteristics. First, they were enshrined
by changing the charter of our society, through the Thirteenth, Fourteenth, and Fifteenth
Amendments to the Constitution. Second, the “spoils” embodied in those amendments were taken
from slaveholders themselves, or from social and political structures in which the entire society (or
the entire majority society) paid the bill.
In this case, the “spoils” that are involved are the individual rights to equal treatment of real
people like Barbara Grutter. If, in the words of Abraham Lincoln, society chooses that “every drop
of blood drawn by the lash shall be paid by another,”39 then that bill should be paid by the whole
society, and by considered alteration of our Equal Protection Clause, not by ignoring it. Though the
war may be righteous, such spoils taken from the Barbara Grutters of our society are not just.40
39
Abraham Lincoln, Second Inaugural Address, March 4, 1865.
40
The concurring opinion responds that, in a world without affirmative action, applicants like
Grutter will not be much better off. Concurring Op. at 36-38 (Clay). To make its point, the
concurring opinion quotes at length the opinion, interlaced with some statistics, set forth in a recent
Washington Post column. See Goodwin Liu, The Myth and Math of Affirmative Action, WASH . POST
B1 (April 14, 2002). The concurring opinion asserts, on the basis of this evidence, that Athe idea that
an admissions policy does so at the expense of white applicants is simply a myth.@ Concurring Op.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 93
It can hardly be doubted that, on average, those students who are admitted to Michigan Law
School despite the policies in question will have been more favorably situated, economically and
socially, than those such as the plaintiff whose chances of admission have been reduced or
eliminated by those policies.
Similarly, because academic credentials are significantly correlated with parental income,
social status, and education,41 the malign effects of discriminatory policies like the Law School’s will
at 36.
The Liu analysis simply does not support the concurring opinion=s conclusion. First, the
article explicitly states that its argument applies just as forcefully to Alan Bakke. But the Supreme
Court certainly did not deny Bakke’s claim because he could not prove with mathematical certainty
that he would have received one of the sixteen places improperly segregated from the general
applicant pool.
Second, the article gives the game away when it candidly states that its statistical conclusion
“occurs in any selection process in which the applicants who do not benefit from affirmative action
greatly outnumber those who do.” Liu, supra, at B1; Concurring Op. at 15 (emphasis added).
It is true that there is a very real sense in which the wrong committed against a person
absolutely barred from consideration for a governmental benefit is greater than the wrong committed
against a person only deprived of a fair chance of consideration.
But a wrong has still been committed. The concurring opinion and Liu may not characterize
that wrong as a “substantial disadvantage,” ibid., but the deprivation of equal consideration is a
wrong to which the Constitution is opposed.
There may have been hundreds of Jews each year who were denied a fair chance for
consideration by the Harvard quota plan, even though a far smaller number of actual seats were
involved and most such applicants could not have been certain of admission. They would not have
been comforted by the force of Liu’s arguments.
To say that it is a matter of less importance that ten people are each deprived of a one-tenth
chance of admission because of race than if one person is completely excluded from admission is
to ignore both mathematics and our system of deciding cases and controversies. If Grutter’s rights
have been violated, the degree of the violation and the proper remedy are matters for the district
court to determine in the first instance. To say that Grutter’s claims are to be ignored because the
whole system that she has challenged has a relatively small discriminatory impact or because the
magnitude of the violation as to her is small is to say that she has no rights that this court is bound
to respect. I decline to take that attitude.
41
See, e.g., R. Richard Banks, Meritocratic Values and Racial Outcomes: Defending Class-
Based College Admissions, 79 N.C.L. Rev. 1029, 1062 (2001) (noting that “[a] variety of studies
have demonstrated positive relationships between early academic achievement and parental income,
education, and occupation.”); Tomiko Brown-Nagin, "Broad Ownership" of the Public Schools: An
Nos. 01-1447/1516
Grutter v. Bollinger
Page 94
rarely fall upon the children of the educators who craft them or the judges who rule upon them. The
statistical region where those policies really bite, and where people like Barbara Grutter are excluded
from equal consideration based on their race, are areas likely to be more heavily populated by
persons whose income, ethnicity, social standing, and religious preferences are not those of the
academic, legislative, and judicial decision-makers who support those policies. Thus Michigan’s
policy can not be seen simply as a good-hearted effort by one group to forego opportunities for itself
for the greater good.
Michigan’s plan does not seek diversity for education’s sake. It seeks racial numbers for the
sake of the comfort that those abstract numbers may bring. It does so at the expense of the real rights
of real people to fair consideration. It is a long road from Heman Sweatt to Barbara Grutter. But
they both ended up outside a door that a government’s use of racial considerations denied them a fair
chance to enter. I therefore respectfully dissent from the court’s legitimation of this unconstitutional
policy.
Analysis of the "T-Formation" Process Model for Achieving Educational Adequacy and Its
Implications for Contemporary School Reform Efforts, 27 J.L. & Educ. 343, 385 (1998) (noting that
“comparative indicia showing the relationship between socioeconomic background and academic
performance continues to reveal a persistent gap in achievement between wealthier and poorer
students”).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 95
PROCEDURAL APPENDIX
Although the following procedural matters do not directly affect the legal principles
discussed in this case, it is important that they be placed in the record as an explanation of the
manner in which this case came before the particular decision-making body that has now decided
it. Since a person reading these opinions in sequential order will have read a variety of complicated
responses attempting to defend what happened procedurally in this case, it may be well to begin with
the plainest possible statement of undisputed primary facts. The panel that considered this case prior
to, and certainly following, the filing of the present appeals was not constituted in conformity with
6th Cir. I.O.P. 34(b)(2) of this court’s rules, or any other rule. A motion that counsel made on
May 14, 2001, for initial hearing en banc was not transmitted to most members of the court for five
months, and was not treated as stated in the court’s order of June 4, 2001. These facts speak for
themselves, however each of us may choose to characterize them.
The appeals regarding the Law School’s admissions program that we have today decided
were filed as follows: case number 01-1447 on April 2, 2001, and case number 01-1516 on April
18, 2001.
Under this court’s rules, these cases generally would have been assigned to a panel chosen
at random. See 6th Cir. I.O.P. 34(b)(1). This was not done. Instead, as a result of a series of
decisions in contravention of our rules and policies, we arrived at the present configuration.
In August 1999, a panel of this court, consisting of Circuit Judges Daughtrey and Moore and
visiting Senior District Judge Stafford, in case number 98-2009, decided an appeal concerning the
rights of certain parties to intervene in the district court case underlying the current appeal, but did
not address the merits of the case. See Grutter v. Bollinger, 188 F.3d 394 (6th Cir. 1999).
Upon the filing of the instant appeals, a question could have arisen regarding whether these
appeals, seeking review of cases already returned to the district court by a panel of this court, were
“must panel” cases. See 6th Cir. I.O.P. 34(b)(2). It is absolutely clear that the applicable procedures
for potential “must panel” cases were not followed to determine whether and how these cases should
be heard as a “must panel.”
If a panel has “returned a case to the district court for further proceedings” and another
appeal has been taken from those further proceedings, the original panel “determine[s] whether the
second appeal should be submitted to it for decision, or assigned to a panel at random.” Ibid. If a
district judge, as in this case, was on the original panel, the remaining two circuit judges from the
original panel are required to decide whether the district judge should be recalled for the panel or
whether a third circuit judge “should be drawn to fill out the panel; provided that, if oral argument
is scheduled, the draw shall be made from the judges of this Court scheduled to sit at that time.” Ibid.
These procedures were not followed in this case.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 96
While these cases were before the district court, several interlocutory motions were, in the
usual course of our policies, referred to a weekly motions panel chosen at random. However, even
though no second appeal had been filed, the motions were then redirected to the earlier panel, which
had been augmented, at the direction of the Chief Judge, by the addition of the Chief Judge, not a
randomly chosen judge.42 Following the filing of the current appeals, all further actions regarding
those appeals, including a motion to stay the district court’s order, were handled by this preselected
panel.
This was the situation when, on May 14, 2001, counsel petitioned the entire court, pursuant
to Fed. R. App. P. 35(b)(1)(B), asking that the cases be heard by the en banc court in the first
instance. At this point, the en banc court consisted of eleven active judges: the nine judges who
ultimately heard this case plus then-active Judges Norris and Suhrheinrich. The petition was not
circulated to the entire court.
Instead, on June 4, 2001, an order was issued, at the direction of the Chief Judge and in the
name of the court, stating that the motion “c[ame] before the court,” but holding the petition for
hearing en banc in abeyance “until such time as the briefs of the parties have been filed, after which
the court will make a determination on whether the cases should be submitted to a three-judge panel
for adjudication or be referred to the en banc court.” (emphasis added). This order was also not
circulated to the en banc court. The Appellee’s proof brief was filed on June 18, 2001.43 The
petition was still not circulated to the court. On July 1, Judge Norris took senior status. All briefing
in the case was certainly completed by July 30, 2001. Even still, the petition was not circulated to
the court. On August 15, Judge Suhrheinrich took senior status.44 The petition was still not
42
It is not clear that preliminary motions can be redirected from a randomly selected motions
panel to a purported “must panel” when no appeal has been filed.
43
Petitions for initial hearing en banc were filed in nine cases in the year 2000. Two of the
cases, both filed pro se, were disposed of without circulating the en banc petition to the court. See
Docket Sheets in Naturalite v. Ciarlo, No. 00-2106, decided under Rule 34, 22 Fed. Appx. 506
(2001) and in Griffin v. Warren, No. 00-4552 (petition for certificate of appealability denied).
In each of the other seven cases, the petition for initial hearing en banc was circulated to the
court no later than two days after the appellee’s proof brief was filed. All were disposed of by the
full court before the final briefs were filed.
44
The question of the circumstances under which Judge Norris and/or Judge Suhrheinrich
could have sat on a potential en banc court hearing the case could be a matter of some contention.
Under the circuit rule in place at the time, “any judge who had been in regular active service at the
time a poll was requested on the petition” for an en banc hearing would be a member of the en banc
court hearing the case. 6th Cir. I.O.P. 35(a) (1998) (emphasis added). As Judge Gilman discussed
Nos. 01-1447/1516
Grutter v. Bollinger
Page 97
circulated to the court. On August 23, 2001, according to our internal docket, the petition was
“referred” to the specially constituted panel. I have no reason to doubt that Judges Moore and
Daughtrey had not known of the petition prior to that time. The special panel still did not circulate
the petition for an en banc hearing to the full court.45
Rather than circulating the still pending petition, the special panel scheduled the case for oral
argument before itself, and again not a normally selected panel. According to the order, issued
August 27, oral argument was to be held on October 23, fifty-seven days away. Forty-nine of those
fifty-seven days passed, with no action being taken to circulate the still pending petition for hearing
in his separate opinion in Popovich v. Cuyahoga Cty. Ct. of Common Pleas, 276 F.3d 808, 829 (6th
Cir. 2002) (en banc), there is a substantial question regarding whether our rule in effect at the time
was consistent with 28 U.S.C. § 46(c), governing the composition of courts of appeals en banc.
Nevertheless, that was the rule we followed until October 31, 2001. We subsequently changed our
rule to compose the en banc court of all judges in regular active service “at the time of oral argument
en banc.” 6th Cir. I.O.P. 35(a) (2002).
The old rule would have governed all the relevant en banc court composition issues that I
have raised here. From Popovich, we know that this court’s precedent is, at least by permitting
Judge Merritt to sit in that case, that our old Policy 35(a) is not statutorily invalid. Thus, both Judges
Norris and Suhrheinrich could have sat on the en banc court if the petition had been circulated
earlier. Judge Norris would have been a part of the en banc court in this case if a vote on the petition
had been requested by July 1, over 45 days after the petition had been filed. Judge Suhrheinrich
would have been a part of the court if a vote had been requested by August 15, over 90 days after the
petition was filed and more than 15 days after the completion of briefing. The specially constituted
panel’s withholding the petition from the court until October 15, 2001, 150 days after it had been
filed and 75 days after the completion of briefing, had the effect of potentially keeping both judges
off an en banc court.
45
Judge Moore’s reference to a December 5, 2000 policy imposed by the Chief Judge omits
several important features of the policy. See Concurring Op. at 23-24. First, the policy states that
it was prompted by petitions for initial hearing en banc from “pro se litigants, mainly prisoners,” not
from counsel in important cases. It specifically states that it does not apply if the Chief Judge and
clerk agree that “it is an unusual case.” I think we can all agree that this case was unusually
important. Second, the policy authorized two and only two actions by the hearing panel to which
the case and the petition is referred. The panel could either “deny the petition” and schedule the case
for argument before the panel or “send the petition out to the en banc court.” Neither occurred here.
The policy never authorized the panel to schedule argument and not to decide the petition. Third,
the policy directed the panel to circulate the petition to the en banc court if it saw “some legitimate
argument for hearing en banc.” It strains credulity to argue now, after the petition has been granted,
that the petition contained no “legitimate argument” for its granting.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 98
en banc, even though all briefing certainly had been completed. Suddenly, with the panel hearing
just eight days away, a decision was made finally to circulate the pending petition to the nine active
judges of our court.46 The petition was circulated without any explanation for the delay, and without
even any notation that a delay had occurred. In addition, the statement accompanying the circulation
neither recommended an en banc hearing nor indicated why the issue was raised, at that time, as
opposed to a time more proximate to the filing of the petition, though it did state that the full court
was being advised because “a question . . . has been raised regarding the composition of the panel.”47
In any event, sufficient members of the active court voted to have the case heard en banc, and an
order was issued on October 19, 2001, canceling the panel hearing scheduled to occur in only four
days and instituting an en banc hearing before the now-reduced court.48
Judge Moore’s concurrence makes several remarkable points. She first notes that the irregular
constitution of the panel can be excused because “Chief Judge Martin has frequently substituted
himself in a variety of matters, of varying degrees of importance, throughout his tenure as chief
judge, in order to avoid inconveniencing other circuit judges.” Concurring Op. at 26 (Moore). But,
of course, the very point is that such a practice, to the extent it exists, was unknown to the other
members of the court, who had every reason to believe that the panel had been regularly constituted.
46
In early October, one senior judge of our court became concerned about the procedures that
had been followed in this case, namely the specially constituted panel that had taken over this case.
After that judge made several unsuccessful efforts to speak with the Chief Judge, on October 15 he
faxed to the Chief Judge a letter setting forth his concerns as to whether court rules and policies had
been followed in this case. He received no response or any other communication regarding this letter
(and has not, to this day). However, on the same day that he sent that letter, with the hearing only
eight days away, a decision was made to circulate the petition for an en banc hearing.
47
Judge Clay’s concurring opinion suggests that I “question[] the appropriateness of hearing
this case en banc” and then argues why hearing important cases en banc is good. Concurring Op.
at 43, 44. I have no opinion on the substance of the decision to hear this case en banc, only the
procedures used to dictate its timing.
48
There is precedent for the special administration of a high-profile case. In Mozert v.
Hawkins Cty. Bd. of Educ., 827 F.2d 1058 (6th Cir. 1987), then-Chief Judge Lively took the case out
of the normal hearing schedule because of educational time constraints and its importance. Rather
than personally constituting a special panel, the Chief Judge, after suggesting the procedure to all
the active judges on the court, had the clerk conduct a random draw of circuit judges to constitute
the panel. Pursuant to the drawing, the Chief Judge, as a matter of coincidence, was randomly
selected. This process occurred in a matter of days, and never threatened to delay the case. If such
a transparent process had been followed here, the procedural issues noted in this appendix probably
would not have arisen.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 99
There was no reason to know of the unusual handling of the motions in 2000. There was no reason
to know that there was any relation between the constitution of the “must panel” in 2001 and the
activities in 2000. And there was no reason to know that anything was going on that was not in strict
conformity with 6th Cir. I.O.P. 34(b)(2). Thus, there was no reason to take any unusual action in
response, whether before or after “April 5, 2001.” Concurring Op. at 27.
Judge Moore also contends that the Chief Judge regularly fills “vacancies in other cases,” that
no one has previously objected to his practice, and that his practice has become “a matter of common
knowledge among the judges of this court.” Concurring Op. at 26. I absolutely deny that this judge
has had any “knowledge” of, or that the Chief Judge has announced or admitted to, any such practice
of inserting himself onto panels without a random draw.
The notion that other members of the court were in some way derelict in not sua sponte
calling for an initial hearing en banc as soon as the appeal was filed is both remarkable and misses
the point. Concurring Op. at 25-26, 27. There would be no particular reason for an initial hearing
en banc unless there were some extraordinary circumstance, as the document Judge Moore has
quoted obliquely indicates. Concurring Op. at 24-25.
I have been on the court for 16 years, and I do not recall an initial hearing en banc in my
tenure. The concatenation of the irregular panel, the withholding, by whatever mechanism, of the
motion addressed to the court, and the later granting of that motion in haste, are matters for which
the other members of the court are certainly not responsible.
Judge Moore suggests that my objections to the composition of the three-judge panel are
“minor” because the decisions regarding the composition did not “actually change[] the outcome of
the present case.” Concurring Op. at 24 n.5 (Moore). But as I have always made clear, it is difficult
to know what body would have decided this case if the rules had been correctly implemented.
Further, to the extent that the Judge Moore claims that the irregularities in the hearing panel’s
composition were the only reason for granting the en banc petition, those irregularities existed at the
time the petition was filed, and thus it is difficult also to argue that they did not affect the
composition of the panel that ultimately decided this case. Most importantly, however, the rights
of litigants and the members of this court to scrupulous compliance with the rules are not dependent
on the likely – or even certain – substantive outcomes of particular matters before the court.
Contrary to Judge Moore’s concurring opinion, I do not contend that the legal opinions of
any member of this court do not represent that judge’s principled judgment in this case. Concurring
Op. at 21-22 (Moore). However, under these circumstances, it is impossible to say what the result
Nos. 01-1447/1516
Grutter v. Bollinger
Page 100
would have been had this case been handled in accordance with our long-established rules. The case
might have been heard before a different panel, or before a different en banc court.49
49
Neither of the concurring opinions addressing this appendix disputes any of the factual
circumstances described.
Judge Clay argues that no negative conclusions regarding any member of this court can be
drawn from the handling of this case. Concurring Op. at 44 (Clay). I draw no such conclusions in
this appendix. It may be possible that each of these events occurred without conscious direction.
Each reader can make an independent judgment from the apparently undisputed facts that I have laid
out here. Frankly, I would have been most pleased if my statement of apparent facts had been proven
wrong. Unfortunately, that has not occurred.
Judge Moore correctly states that our “only source of democratic legitimacy is the perception
that we engage in principled decision-making.” Concurring Op. at 22 (Moore). If actions are taken
that may imperil that legitimacy, a member of this court who observes them is left with two
alternatives, both unpalatable. One is to allow the actions to pass in silence, even after explanations
have been requested, but have not been produced. Silence simply allows those actions to continue
and to be repeated, with real consequences for both the court and the litigants who appear before it.
The other alternative is to place the actions on the record, for such remediation as may be
possible.
I have not revealed the substance of any internal communications on this case between
members of our court, with the exception of the letter of one senior judge who asked me to do so.
See n.46 supra. Compare Concurring Op. at 43 & 34 n.3 (Clay); Concurring Op. at 27 (Moore). As
to Judge Clay’s discussion of my opinion in Memphis Planned Parenthood v. Sundquist, 184 F.3d
600, 605-07 (6th Cir. 1999) (Boggs, concurring in the denial of rehearing en banc), Concurring Op.
at 43-44 (Clay), I will leave to the candid reader to consider the distinction between laying out very
significant and obvious violations of rights of members of this court, and revealing, in contravention
of long-honored custom, the internal votes of members of this court.
Legitimacy protected only by our silence is fleeting. If any damage has been done to the
court, it is the work of the actors, not the reporters.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 101
_________________
DISSENT
_________________
SILER, Circuit Judge, dissenting. I concur in the dissent by Judge Boggs on the merits. I
write separately for the reason that I do not concur in the addition of the procedural appendix, not
because I question its accuracy, but because I feel that it is unnecessary for the resolution of this case.
If the procedural appendix were not filed, then the responses filed in the concurrences by Judges
Moore and Clay would also have been unnecessary.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 102
_______________
DISSENT
_______________
ALICE M. BATCHELDER, Circuit Judge, dissenting. I concur in Judge Boggs’s careful and
scholarly dissent. I write separately to say that I concur in all of that dissent, including the exposition
of the procedural history of the case. In her separate concurrence, Judge Moore expresses her belief
that by revealing that history, Judge Boggs—and I, by concurring—undermine the legitimacy of the
court and do harm to ourselves, this court and the nation. I believe that exactly the opposite is true.
Public confidence in this court or any other is premised on the certainty that the court follows the
rules in every case, regardless of the question that a particular case presents. Unless we expose to
public view our failures to follow the court’s established procedures, our claim to legitimacy is
illegitimate.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 103
_______________
DISSENT
_______________
RONALD LEE GILMAN, Circuit Judge, dissenting. Both the majority opinion and Judge
Boggs’s dissent address the two key issues in this case: (1) whether diversity in higher education,
including racial and ethnic diversity, is a compelling government interest, and (2) whether the
University of Michigan Law School’s admissions policy is narrowly tailored to further that goal.
There is much to be said for each viewpoint, but there are aspects of both opinions with which I do
not agree. The majority opinion, in particular, reaches what I believe to be an erroneous conclusion
regarding the narrow-tailoring challenge to the Law School’s admissions policy. Judge Boggs’s
dissent, on the other hand, includes arguments in support of his position that the Law School’s
admissions policy is not narrowly tailored that I find troublesome. Specifically, I am unpersuaded
by his critique that no empirical link exists between a critical mass of minority students and the
perceived educational benefits or his belief that race-neutral factors would be more likely to achieve
the desired diversity of experience than reliance on an applicant’s race. I therefore feel compelled
to write a separate dissenting opinion.
The facts of the present case, in my opinion, eliminate the need to decide whether or not this
court is bound by Justice Powell’s conclusion in Regents of the University of California v. Bakke,
438 U.S. 265 (1978), that educational diversity is a compelling government interest. Indeed, the
principled disagreement between the majority opinion and Judge Boggs’s dissent as to the proper
resolution of this issue underscores the confusion created by the various opinions in Bakke. No one
disputes, however, that Bakke stands for the proposition that an admissions policy designed to further
the interest of educational diversity is not narrowly tailored if it creates a two-track system for
evaluating prospective students, where minorities are effectively insulated from competition with
other applicants. Id. at 319-20 (holding that the University of California’s admissions system, which
reserved a fixed number of places specifically for minority students, violated the Equal Protection
Clause of the Fourteenth Amendment).
The Law School’s admissions policy, in my view, creates such an impermissible system. I
therefore believe that this court should assume, without deciding, that educational diversity—as
defined by Justice Powell in Bakke—is a compelling government interest. Lyng v. Northwest Indian
Cemetery Prot. Ass’n, 485 U.S. 439, 445 (1988) (“A fundamental and longstanding principle of
judicial restraint requires that courts avoid reaching constitutional questions in advance of the
necessity of deciding them.”). Several of our sister circuits have taken a similar approach. Johnson
v. Bd. of Regents of Univ. of Georgia, 263 F.3d 1234, 1251 (11th Cir. 2001) (assuming that
educational diversity is a compelling interest, but holding that the school’s admissions policy was
not narrowly tailored); Tuttle v. Arlington County Sch. Bd., 195 F.3d 698, 705 (4th Cir. 1999) (per
curiam) (same); Wessmann v. Gittens, 160 F.3d 790, 796 (1st Cir. 1998) (same).
Nos. 01-1447/1516
Grutter v. Bollinger
Page 104
The primary problem with the Law School’s admissions policy is that the “critical mass” of
minority students that it seeks to enroll is functionally indistinguishable from a quota. Whether
viewed as a percentage or as an absolute number, the consistency in the minority student enrollment
demonstrates that the Law School has for all practical purposes set aside a certain number of seats
for minority students. See Judge Boggs’s discussion in Part II.B.2. of his dissent. The “critical
mass” therefore appears to be a euphemism for the quota system that Bakke explicitly prohibits.
I believe that the Law School’s pursuit of a critical mass of minority students has led to the
creation of a two-track admissions system, not only in the sense that a minimum percentage of seats
is set aside for under-represented minorities, but also because the Law School gives grossly
disproportionate weight to race and ethnicity in order to achieve this critical mass. Judge Boggs’s
discussion of the vastly divergent admissions rates for minority students as compared to all other
applicants to the Law School, a divergence that cannot be ascribed to any factor other than their race
or ethnicity, demonstrates this reality. In my view, Justice Powell’s opinion in Bakke unequivocally
prohibits such a de facto dual admission system that applies one standard for minorities and another
for all other students. Bakke, 438 U.S. at 317 (indicating approval of Harvard’s admissions plan,
where “race or ethnic background may be deemed a ‘plus’ in a particular applicant’s file, yet it does
not insulate the individual from comparison with all other candidates for the available seats”).
Moreover, like Judge Boggs, I believe that the record establishes that race-neutral factors are
nowhere near as significant in determining admissions as whether the applicant is an under-
represented minority. The Law School’s policy of achieving a critical mass of minority students
without giving comparable consideration to other aspects of diversity is irreconcilable with Justice
Powell’s explanation of why a quota system represents an impermissible use of race in the
admissions process:
In a most fundamental sense the argument misconceives the nature of the state
interest that would justify consideration of race or ethnic background. It is not an
interest in simple ethnic diversity, in which a specified percentage of the student body
is in effect guaranteed to be members of selected ethnic groups, with the remaining
percentage an undifferentiated aggregation of students. The diversity that furthers
a compelling state interest encompasses a far broader array of qualifications and
characteristics of which racial or ethnic origin is but a single though important
element. Petitioner’s special admission program, focused solely on ethnic diversity,
would hinder rather than further attainment of genuine diversity.
Id. at 315 (Powell, J.) (emphasis omitted). In my view, this compels the conclusion that the Law
School’s admissions policy is not narrowly tailored to serve the presumptively compelling
government interest in a diverse student body. Simply put, an applicant’s race or ethnicity, even if
not the only factor (other than LSAT scores and GPAs) that is taken into account, receives such
grossly disproportionate weight as to violate the Equal Protection Clause.
Nos. 01-1447/1516
Grutter v. Bollinger
Page 105
The Law School, as the preceding discussion suggests, attempts to equate attaining a “critical
mass” of minority students with the goal of achieving a diverse student body. But because the Law
School’s goal of achieving a critical mass results in a two-track system that is functionally equivalent
to a quota, its admissions policy is prohibited by Bakke. This is a quandry that admits of no easy
solution.
Is there any way, then, that race or ethnicity can ever be taken into account in a narrowly
tailored manner that would survive strict scrutiny? Surely the answer is “Yes.” For example, in
differentiating between two applicants with essentially equal LSAT scores and GPAs, where one is
Caucasian and the other African-American, I have little doubt that favoring the under-represented
African-American applicant would pass constitutional muster if educational diversity is recognized
as a compelling government interest. This would clearly fall within the scope of what I believe
Justice Powell had in mind when discussing the appropriate use of a “plus” for diversity in Bakke.
The problem, according to the Law School, is that limiting the conscious favoritism of
minorities to situations where the factor is a “plus among equals” would not likely produce the
critical mass that it earnestly believes is essential to achieve a truly diverse student body. On the
other hand, such an admissions policy would presumably avoid the animosities stirred up by the
common perception that admitted minority students are less qualified than their nonminority peers.
See Bakke, 438 U.S. at 298 (Powell, J.) (“[P]referential programs may only reinforce common
stereotypes holding that certain groups are unable to achieve success without special protection based
on a factor having no relationship to individual worth.”) (citing DeFunis v. Odegaard, 416 U.S. 312,
343 (1974) (Douglass, J., dissenting)).
But these competing considerations are matters that need not, and cannot, be resolved by the
case before us. Based on the record presented, I am convinced that the Law School’s admissions
policy that results in a de facto quota in favor of minority students is far closer to the rigid set-aside
squarely prohibited by Bakke than it is to the “plus among equals” that I believe would be clearly
constitutional. How close the Law School would have to come to the latter end of the spectrum in
order for its admissions policy to survive the strict-scrutiny test should, in my opinion, await another
day, a day when a more narrowly tailored policy is formulated and presented for resolution. In the
meantime, I respectfully dissent.
|
A 97-Year-Old Oklahoma Woman Gives Birth To Twins
A photo of 97-year-old Maggie Sue Mistbush on her way to the beauty salon.
CHICKASHA, Oklahoma - Reports coming out of the Sooner state are that a 97-year-old woman identified as Maggie Sue Mistbush has just given birth to twin boys.
Mrs. Mistbush is resting comfortably at The Chickasha General Hospital and her two baby boys who she named Biff and Baff are doing real good.
She was asked by Preston St. Bolero with Bedroom Pillow Talk how in the world she, at the age of 97, could possibly get pregnant.
Mrs. Mistbush who only went up to the second grade replied, "Well sir it be kinda like dis. My hubby, Elmer Bob, he done went and stuck his pecker in my biscuit and darn if one of my ovary eggs didn't snap up one of his wiggly wigglers quicker than Wynonna Judd puttin' away a chocolate covered cherry."
The life-long Chickasha resident says she has two other children ages 79 and 77, along with a whole passel of grandchildren, and a bunch of great grandchildren.
She was asked by St. Bolero if she and Elmer Bob are planning on having any more younguns. She made a face, shook her head, and replied, "Mr. St. Bolero, I love my husband to pieces. But if old Elmer Bob comes anywhere near me, I swear I'm gonna kick his butt all the way down to Dallas."
Make Abel Rodriguez's day - give this story five thumbs-up (there's no need to register, the thumbs are just down there!)
More fake news stories
Minneapolis - A potential ISIS recruit's mother says she regrets urging her son to seek work after hearing Secretary of State John Kerry's advice that the world forestall Islamic radicalization by giving "jobs" to the kind of young men most vulnerab...
Somalia Based Islamist terror group Al Shabaab has posted a chilling video message calling on jihadist cells in America to strike fear in the hearts of shoppers in America's malls.
Though terror experts consider the video mostly bluster, The Al...
Boise, Idaho - A 72 year old Nampa, Idaho man visiting relatives he "doesn't like" in Boise says he was "just screwing around" looking through an old box of "pornos" at some "meth head's" garage sale, when he came across a literary bombshell that cou...
New York - As if his reputation was not tarnished enough, doubts are now surfacing about a piece of reporting Brian Williams did decades ago for his high school newspaper in upstate New York.
As a budding assistant sports editor, Williams reporte...
BILLINGSGATE POST: Press Secretary Josh Earnest told reporters that the only way that the Keystone Pipeline would be passed is if it first goes through President Obama.
One intrepid reporter asked if the President's bunghole was big enough to a...
In what could easily have descended into a free for all, name calling, I'm right, you're wrong thread in the comment section of a Fox News story about evolution, user dEEzNutZ1979 stopped everyone dead in their tracks by responding to user GodGunzAnd...
Philadelphia, PA-- A South Philadelphia man is dead tonight after attempting to cook dinner for his wife. Police sources say it was the first time Mr. Spaghetti tried to cook anything.
Mrs. Spaghetti had a heart attack after she learned that he...
|
Read next
“Good fences make good neighbours.” Tell that to the US, which shares a fence with Central America. Tell it to Central America, desperation-driven to test that fence a thousand times or more a year; and then to test the deadlier keep-out zone of the Arizona Desert. Who Is Dayani Cristal?, a documentary produced by Gael García Bernal and directed by Marc Silver, starts with a sight nearly routine for Tucson area locals: the rotting corpse of a migrant, curled up near a cactus. Tattooed on his chest: the words “Dayani Cristal”. Autopsy verdict (unofficial): died of hope.
In a clever wheeze – which unfortunately begins to seem just that – actor/producer García Bernal embeds himself as a pretend migrant, retracing the dead Honduran’s journey. Dusty roads; dangerous borders; dodgy soup kitchens; dazzling sway of the trans-Mexico journey atop the train called La Bestia.
Do we buy a famous Mexican movie star going native with the indigent? (Why don’t they all shout: “Ooh look, it’s Gael García Bernal!”) More interesting – more heartbreaking – is the Stateside battle to sort and identify the tragedies. The Arizona cops and pathologists reach a groping hand towards the south, across that damn fence, and say: “Can you help us? Is this man/woman/child yours?” The identity of the man at the beginning is finally uncovered, like a wound still bleeding under the bandage of time. We meet the wife and family, inconsolable. From them, more than from García Bernal, we learn the cruelty of a system of hope in which the longing for a better life is the bait to lure people to an untimely death.
|
Within the United States, members of Congress and other authorities are starting to be required to account for and declare their digital assets. This is a little bit of a paradox in that cryptocurrency was designed to challenge government control, yet in this scenario, we are seeing members of one of the world’s most powerful governments declare their crypto assets, on a frankly colossal scale. If a currency designed to beat the government is owned by the government, does it lose all bearing?
Whilst this question is up for debate, one thing is clear. Staff and members of Congress, The White House and many other United States authorities own cryptocurrency . We’ve even speculated on a theory that Mr Trump himself owns Bitcoin
According to Sludge:
“In late June, the House Ethics Committee passed new rules requiring members of the House to disclose their ownership of cryptocurrency in annual reports, the same way they would disclose any other asset. The new rules also require lawmakers to report cryptocurrency transactions within 45 days, the same period given for other financial transactions.”
See more for yourself,
here
.
According to reports, Bob Goodlatte is the first member of Congress to openly declare and account for cryptocurrency ownership, meaning Goodlatte could be about to spur on some deeper revelations into the US Government's stance on cryptocurrency. Goodlatte has declared ownership of between $17,000.00 and $80,000.00 worth of cryptocurrency, allegedly spread across Bitcoin, Ethereum and Bitcoin Cash. Interestingly, this disclosure from Goodlatte actually comes from a report filed in May, prior to the new legislation set out by the House Ethics Committee.
Image shows a section of Goodlatte’s report, showing his investments in BTC, ETH and BCH
Image sourced from:
readsludge.com
As a result of this new ruling and the new revelation of Goodlatte’s assets, we expect more members of Congress to release details of their cryptocurrency investments in the coming weeks and months. If they don’t, they are breaking the rules.
We need to consider the implications of this. If the US Government are seen to be holding huge amounts of Bitcoin (for example) could it be argued that they have the capacity to manipulate the price? Moreover, is personal government ownership, a challenge to decentralisation, because I would say it is.
Moreover, why are the authorities asking Congress staff to declare their investments? Are they planning to use this information to make crypto more accessible in the United States, or to do the opposite?
Whilst Goodlatte may have intended to do good with this, in turn, has he actually opened a big old can of worms?
|
Taiwan's lack of membership of the WHO, due to pressure from China which claims the island as its own, has infuriated the Taipei government during the coronavirus outbreak, which says it has been unable to get timely information and that Taiwanese lives have become political pawns.
Taiwan's Foreign Ministry on Thursday condemned “groundless” accusations from the head of the World Health Organization (WHO) that racist slurs against him had come from the island, as Taipei escalated its feud with the body.
Taiwan's lack of membership of the WHO, due to pressure from China which claims the island as its own, has infuriated the Taipei government during the coronavirus outbreak, which says it has been unable to get timely information and that Taiwanese lives have become political pawns. The WHO denies the criticisms.
On Wednesday, WHO Director General Tedros Adhanom Ghebreyesus rejected “racist slurs” against him, which he said had originated in Taiwan.
Taiwan's Foreign Ministry said it “strongly condemned and protested the groundless accusations” which it labelled “imaginary”.
“We are a mature and highly-accomplished advanced democratic country, and have absolutely not instigated our people to personally attack the WHO's Director General, and have absolutely not made any racist comments,” it said.
Taiwan condemns any form of discrimination, and any attacks on the internet against the WHO's boss have nothing to do with Taiwan's Foreign Ministry nor have been instigated by it, the ministry added.
Tedros' comments were irresponsible and he should clarify them and apologise to Taiwan, it said.
Taiwan has been proud of its early and so far effective measures against the coronavirus, logging just 379 cases and five deaths to date, far lower than many of its neighbours, even as it has been excluded from the WHO.
The WHO, in a rare statement about Taiwan last month, said it was closely following the development of the coronavirus there, is learning lessons from how they are fighting it, and detailing how the WHO has been working with Taiwanese health experts.
Taiwan says the WHO ignored its questions at the start of the coronavirus outbreak and has not shared with member states information Taiwan has provided on the coronavirus including details on its cases and prevention methods.
This is part of what it has long described as a pattern that puts it at risk because of Chinese pressure to exclude it from international bodies.
|
244 Md. 154 (1966)
223 A.2d 187
BURKE
v.
WILLIAMS, ET UX.
[No. 426, September Term, 1965.]
Court of Appeals of Maryland.
Decided October 13, 1966.
*156 The cause was argued before HAMMOND, C.J., and HORNEY, OPPENHEIMER, BARNES and McWILLIAMS, JJ.
Henry E. Weil for appellant.
Melvin D. Hill, with whom were West & Venables on the brief, for appellees.
HORNEY, J., delivered the opinion of the Court.
In this action to recover damages for the injuries Rannie Alvin Burke sustained when he fell into an excavation under a board walkway leading into the partially constructed house that James E. Williams, a general contractor, was building for himself and wife in Oxon Hill, the Circuit Court for Prince George's County directed a verdict for the defendants at the conclusion of the case for the plaintiff. The granting of the motion, from which the appeal was taken, was based on the premise that the plaintiff failed to show that the defendants were guilty of primary negligence, and, assuming a showing of negligence, that the plaintiff was contributorily negligent or had voluntarily assumed a known risk.
The facts are not in controversy. The accident occurred while the plaintiff was making a delivery of kitchen sink tops. The only entrance to the house was over a walkway made by fastening two ten or twelve foot boards at both ends, side by side an inch apart and on an incline of about thirty degrees. On arriving at the house, the owner, because there was no other way to enter, informed the plaintiff and his brother, who was helping him, that they would have to carry the sink tops up the boards through the carport to the kitchen. The largest top was carried in first by both men. Thereafter, the brother went back and took in a smaller top alone. Subsequently, as the plaintiff *157 came out of the house to get another smaller top and the delivery ticket, he slipped and fell into the excavation and was injured. Upon getting out, he took the remaining top into the house and obtained the signature of the owner on the delivery ticket. At the trial, there was testimony to the effect that the boards, though previously cleared of snow which had fallen several days before, were slippery because of mud and slush from melting snow, as well as testimony that the boards had a tendency to give and bob up and down when stepped on, but there was no showing that the boards were broken or had slipped or were otherwise defective. Nor did the plaintiff complain about the condition of the walkway at any time. There was also other evidence to the effect that the means provided by the owners for entering a house under construction was the one commonly used by other contractors and was considered proper.
On appeal, the appellant contends that there was sufficient evidence of primary negligence to take the case to the jury and that he had neither contributed to the accident nor assumed the risk of being injured. The appellees, on the other hand, besides claiming that no primary negligence was shown, argued that the plaintiff was guilty of contributory negligence or assumption of risk.
As we see it, it is not necessary for us to decide whether or not the case should have been submitted to the jury on the issue of primary negligence for even assuming there was primary negligence, it is clear that the appellant was not entitled to recover damages under the facts presented.
While the doctrines of assumed risk and contributory negligence are similar in scope, they are not the same in that an assumed risk implies an intentional exposure to a known danger which may or may not be true of contributory negligence. People's Drug Stores v. Windham, 178 Md. 172, 12 A.2d 532 (1940). Also see Baltimore County v. State use of Keenan, 232 Md. 350, 193 A.2d 30 (1963). We think the plaintiff in this case voluntarily assumed the risk of being injured. The rule is that when a plaintiff in a personal injury action becomes aware of a previously created risk and voluntarily chooses to put up with the situation where as here a workman confronted with a slippery walkway nevertheless chose to use it then his willingness *158 to take a chance is implied and he would be barred from recovering for a risk he chose to assume. See Prosser, Torts (1964 Ed.) Sec. 67; Restatement (Second), Torts Sec. 496.
In cases such as this one, where the facts are not in dispute and the plaintiff intentionally and voluntarily exposed himself to a known danger, we have sustained the granting of a summary judgment or the direction of a verdict. See Evans v. Johns Hopkins University, 224 Md. 234, 167 A.2d 591 (1961) and Finkelstein v. Vulcan Rail Co., 224 Md. 439, 168 A.2d 393 (1961). The Finkelstein case, which also involved an accident at a construction site, is particularly apposite here. There, after pointing out that the dangers at a construction site are more apt to be obvious than in other areas and that it is quite usual to find workmen voluntarily assuming known risks in the performance of their tasks, it was held that there was no primary negligence, and, that if such negligence be assumed, the plaintiff assumed the risk. See also Velte v. Nichols, 211 Md. 353, 127 A.2d 544 (1956), where it was held that a business invitee, who used a ladder to examine Christmas trees in a truck without testing its stability, had assumed the risk of the ladder slipping on ice in the street under it.
The appellant argues, however, that if he assumed the risk, it was not voluntary in that the appellees provided him with only one means of ingress and egress to and from the house and that the economic necessity of keeping his job and not being discharged for failure to deliver the sink tops forced him to involuntarily assume the risk of crossing the slippery walkway. The contention is clearly without merit because there is no evidence that the owners of the house, or anyone else, ever demanded that the appellant use the walkway against his will. Nor is there any evidence that his job would have been in jeopardy had he left the sink tops on the construction site instead of taking them into the house.
On the facts presented, we hold that the direction of a verdict in favor of the defendants was proper.
Judgment affirmed; appellant to pay the costs.
|
Facebook Integration…???
I am not sure what I think of it yet but I am trying further integration of The Gnome’s Garden website with Facebook and The Gnome’s Garden Facebook page. For start, it should post at least a preview of my posts made here onto Facebook. It does allow me to have things like a “Like” button and a “Share” button… but I do already have a Share button for Facebook as well as G+ and a few others… However we shall see how useful this is… might be more nuisance than it is useful… It was a nuisance setting up on Facebook applications… well learning new skills…
I’m also not sure why WordPress is showing such a huge version of the featured image when I chose to show a thumbnail… It looks nice, but… Oh well, at least the flowers are pretty.
We shall have to see if I keep the Facebook integration or not. for now… it is a toy to be played with… Perhaps I am just in the wrong mood to be adding such things.
Comments (2)
It’s a part of my cunning plan. LOL I am working to have my articles publicized on Facebook automatically. That way they might actually get read even while I am posting on columns that aren’t on Facebook. My first integration is with The Gnome’s Garden since that has a part of it already set up. I’m not sure which column I’ll work at next.
|
Q:
Coldfusion using onRequestEnd() with Application.cfm files
I'm working in a legacy app that was built upon the use of Application.cfm files rather than Application.cfc files.
There is a need to be able to run code after a request has processed. (Basically, I am wanting to use the <cfhtmlhead> tag to inject some Javascript and CSS files into every loaded document. Before I was doing this with a GreaseMonkey user script, but something server-side would be best.)
From what I read, I think I should be able to do this with the onRequestEnd() function, however, I've only ever seen that referenced in regards to Application.cfc files. I have read that you can put an onRequestEnd.cfm file in the same directory as an Application.cfm file to have it register it to the onRequestEnd() function, but the system does not map to one Application.cfm file (i.e. I would have to throw this onRequestEnd.cfm file in a lot of directories).
Is there some other way to register this onRequestEnd() function using an Application.cfm setup? In case it matters, we are running Coldfusion 9.
A:
Just to clarify, the onRequestEnd() method is only available if you are utilizing the Application.cfc file.
The OnRequestEnd.cfm file does indeed work like the Application.cfm file in that ColdFusion automatically looks for it and will process it's contents when found. Do note that you cannot use an OnRequestEnd.cfm page if you have an Application.cfc file for your application. So assuming that you have no Application.cfc files for your application and are only using Application.cfm files then the OnRequestEnd.cfm file should work for you. All you need to do is insert the CFML code that you would like to be executed after the page request into that file.
If you have several Application.cfm files spread out in various folders then, yes, you will also need to copy/create the OnRequestEnd.cfm files in those directories as well. You might be able to copy stub OnRequestEnd.cfm files in those directories that do nothing more than cfinclude your actual code from another, single, location. At least that way once you have all of the stub files out there you can modify the code in a single place.
See the documentation for Structuring an application (it was written for ColdFusion 8 but the same rules still apply). In case that page is taken down, here is the relevant text:
How ColdFusion finds and process application definition pages
ColdFusion uses the following rules to locate and process the Application.cfc, Application.cfm, and OnRequestEnd.cfm pages that define application-specific elements. The way ColdFusion locates these files helps determine how you structure an application.
Each time ColdFusion processes a page request it does the following:
When ColdFusion starts processing the request, it does the following:
It searches the page's directory for a file named Application.cfc. If one exists, it creates a new instance of the CFC, processes the initial events, and stops searching. (ColdFusion creates a new instance of the CFC and processes its initialization code for each request.)
If the requested page's directory does not have an Application.cfc file, it checks the directory for an Application.cfm file. If one exists, ColdFusion logically includes the Application.cfm page at the beginning of the requested page and stops searching further.
If the requested page's directory does not have an Application.cfc or Application.cfm file, ColdFusion searches up the directory tree and checks each directory first for an Application.cfc file and then, if one is not found, for an Application.cfm page, until it reaches the root directory (such as C:). When it finds an Application.cfc or Application.cfm file, it processes the page and stops searching.
ColdFusion processes the requested page's contents.
When the request ends, ColdFusion does the following:
If you have an Application.cfc, ColdFusion processes the CFC's onRequestEnd method and releases the CFC instance.
If you do not have an Application.cfc, but do have an Application.cfm page, ColdFusion looks for an OnRequestEnd.cfm in the same directory as the Application.cfm page ColdFusion uses for the current page. ColdFusion does not search beyond that directory, so it does not run an OnRequestEnd.cfm page that resides in another directory. Also, the OnRequestEnd.cfm page does not run if there is an error or an exception on the application page, or if the application page executes the cfabort or cfexit tag.
The following rules determine how ColdFusion processes application pages and settings:
ColdFusion processes only one Application.cfc or Application.cfm page for each request. If a ColdFusion page has a cfinclude tag pointing to an additional ColdFusion page, ColdFusion does not search for an Application.cfc or Application.cfm page when it includes the additional page.
If a ColdFusion page has a cfapplication tag, it first processes any Application.cfc or Application.cfm, and then processes the cfapplication tag. The tag can override the settings from the application files, including the application name and the behaviors set by the cfapplication tag attributes.
You can have multiple Application.cfc files, Application.cfm files, and cfapplication tags that use the same application name. In this case, all pages that have the same name share the same application settings and Application scope and can set and get all the variables in this scope. ColdFusion uses the parameter settings of the cfapplication tag or the most recently processed file, if the settings, such as the session time-out, differ among the files.
Note: If your application runs on a UNIX platform, which is case-sensitive, you must spell Application.cfc, Application.cfm, and OnRequestEnd.cfm with capital letters.
|
Mike Stanton wows in return
Marlins young right fielder impresses at the plate
After missing 25 days due to a sore quad muscle, Mike Stanton came back with a vengeance for the Marlins on Thursday. He had three hits, including two home runs, and seven RBIs in a performance that left everyone shaking their heads.
"Oh, wow," Marlins owner Jeffrey Loria told the South Florida Sun-Sentinel of his reaction from his field-level box. "Every time the ball left his bat: 'Oh, wow.' Even the single was hit with authority."
"It's definitely cool to be able to do that my first game back, but that's what I practice," Stanton said. That's what I work on. That's what I've been doing for three weeks, getting my mind ready for this."
The Champ visits the Angels: Former heavyweight boxer Muhammad Ali visited the Angels during Spring Training. Ali suffers from Parkinson's disease, but the Phoenix-area resident was able to make the appearance with the help of his wife and sister-in-law.
"It was like royalty walked in -- it was silent," Torii Hunter told the Los Angeles Times. "We're all in the presence of greatness. Every athlete respects what Muhammad did, all the [beatings] he put on all those boxers. He's the greatest of all time."
"It was fun to see him and think about all the quotes from his heyday," said Vernon Wells, who met Ali 20 years ago, when Wells was 12. "We all just soaked it in. It was a special day. Few people have that type of presence when they walk into a room."
Castro turns to Ramirez for advice: Starlin Castro is still adapting to being a Major Leaguer. He is leaning on Cubs teammate Aramis Ramirez -- who broke into the league as a teenager just as Castro did -- for some guidance.
"He helps me a lot," Castro told the Chicago Sun-Times. "When you're not a veteran player, you make a lot of mistakes. Aramis told me to concentrate in the game on every play. And the same in practice -- to practice like it's the game. He told me to think about situations in practice, like first and third, one out."
Chapman plans to build on success: Aroldis Chapman gained plenty of attention in 2010 with his triple-digit fastball. He hopes to continue that success with the Reds in 2011.
"I think the little experience I had last year and what has happened so far here has got me more experience," Chapman told MLB.com through his interpreter. "I definitely feel more confident. I've been able to work better on the field. Since Spring Training started, I've been feeling better and better every day. ... Yes, I feel ready. Like everybody else, we are ready to start the season now."
Rauch to start season as Blue Jays' closer: Jon Rauch will start the season as the closer in Toronto. For Rauch, the role will be nothing new to him after recording 21 saves last season for Minnesota and 17 for Washington in 2008. But he admits that he does not fit the profile of a normal closer.
"Even people who are very good at it still are going to have their bad days," Rauch told the Toronto Sun. "It's just confidence. I think there's a prototypical closer out there that people think has to throw 95, have a swing-and-miss pitch. Sure, those things are great to have, but I think a guy like myself that pitches to contact and trusts his defense can do the job just as well."
Estrada proving he can fill in as starter: Marco Estrada is doing his best to land a temporary spot in Milwaukee's starting rotation. Estrada, who made one start for the Brewers last season, threw 4 1/3 shutout innings against San Diego on Tuesday. He allowed three hits and one walk while striking out four.
"It felt great just to be able to start over there [in a big league] game," Estrada told the Milwaukee Journal Sentinel. "That's what I love to do. I felt confident. I went out there and I threw strikes."
"He liked the way he pitched," manager Ron Roenicke said. "His changeup was good. He had movement on his fastball. He threw some breaking balls that were pretty nice, too. We knew he threw strikes from last year. He's already got experience with a couple of games, so he shouldn't freak out.
"He's definitely a possibility."
Montero sets his sights high with Diamondbacks: Since 2007, Miguel Montero has a .443 slugging percentage, ranking fourth among National League catchers with at least 1,100 at-bats. His .267 batting average ranks seventh and his 40 home runs are eighth. His goal this year is to earn a trip to the All-Star Game.
"That would be outstanding," Montero, 27, told the The Arizona Republic. "If I go to the All-Star Game, I'm not going to act different or change my approach, though. I've got to keep playing the same way and do things right.
"But man, that would be awesome. Even better would be going to the All-Star Game and winning it, especially with it being in Phoenix this year."
Emaus proves himself, earns Opening Day start: It appears Brad Emaus, a Rule V selection by the Mets, will be the starting second baseman for New York on Opening Day. Emaus has a .341 on-base percentage this spring and has displayed power in the Minors. He has hit 12, 10 and 15 home runs the past three seasons.
"He has hit," J.P. Ricciardi, a special assistant with the Mets, told the New York Daily News. "But is he capable of being an everyday, big league player? I think he is in the right circumstance. Maybe this is it, maybe this isn't. He's a gap-to-gap hitter, everywhere he's been he's been a .270-.280 hitter and he's going to hit 15 balls in the seats once he plays regularly."
Emaus said if he makes the team, he will bring a hard-working approach.
"I honestly just feel like I'm a baseball player," he said. "I'm not going to wow you with any tools, but I think day in and day out, I give you a lot of hard work on the field and put out a good product."
Descalso learning from teammates: As a player who knows he will spend 2011 in a utility role with St. Louis, Daniel Descalso is doing the best he can to prepare for the challenges he might face.
"I've talked to Skip [Schumaker] a little bit about it," Descalso told MLB.com. "He came up kind of as a fourth outfielder when he first came up. He was telling me it's the same way he broke in the big leagues. So, I've been able to talk to him a little bit and just kind of get an idea. And with [Jon] Jay and [Allen] Craig, what they did last year, get an idea of how they prepared themselves for a pinch-hit or a double switch or stuff like that."
Barney plays his way into roster spot: Darwin Barney has worked his way into a roster spot with the Cubs. Manager Mike Quade says it's a distinction that he's earned.
"He's played himself into significant time, and it's Spring Training," Quade told MLB.com. "He is making progress. He does a lot of things outside of the batter's box that you really like. He's given himself every chance to be an important part of this infield. Now we'll go north and see what happens in April."
Adrian Gonzalez uses day off to improve swing: With the Red Sox having a rare day off, Adrian Gonzalez decided to use that time to work on his hitting. Coming off shoulder surgery, Gonzalez played in a Minor League game and collected three hits in six at-bats.
"I've been seeing the ball great, as far as seeing it out of the [pitcher's] hand, seeing ball-strike, but when it comes to actually seeing a pitch I want to swing at and swinging, it just wasn't clicking," Gonzalez told the Boston Herald. "Today, I felt a lot better out there."
Feliz still holding down closing role with Rangers: Neftali Feliz finally learned that he will once again serve as the Rangers' closer this season. The Rangers toyed with the idea of putting him in the starting rotation.
"That's exactly what I told him," Rangers manager Ron Washington told MLB.com. "Right now, for our organization, we're better off with him in the bullpen. We haven't closed the door on him being a starter. We're just not ready yet."
Feliz recorded 40 saves last season to rank third in the American League. He was named the AL Rookie of the Year and earned a spot on the American League All-Star team.
Burnett surprised by potential role as closer: Sean Burnett had a 2.14 ERA last season and has not allowed an earned run this spring. That combination could land him as a closer for the Nationals.
"That's probably the one position on the baseball field I thought I'd never play," Burnett told the The Washington Post about being a closer. "I never thought I had that kind of stuff. Do I have the stuff or some of the arms that these guys have? No. But coming and getting three outs in the ninth inning - I think I'm capable of doing that."
"Could he go out and do it as a pure closer?" Nationals pitching coach Steve McCatty asked. "That's something you have to develop. I'm not saying that he can't. He's got good, quality stuff. He may not be your prototypical guy. But given the opportunity to do it, I'm not saying that he can't.
"He competes his butt off. He takes everything personal. He goes out there and he competes. He competes."
Augenstein putting up strong fight for spot: Bryan Augenstein is doing all he can to make the roster in St. Louis. Cardinals pitching coach Dave Duncan likes what he's seen thus far.
"He earned it," Duncan told the St. Louis Post-Dispatch. "He's earned every next opportunity that he's had this spring. He hasn't given up anything. He's had a very impressive spring."
Bowker plans to make the most of his role: John Bowker says that if he makes the Pirates' regular season roster, he'll do his best to excel in his likely role as a utility player.
"I've come off the bench before," Bowker told the Pittsburgh Tribune-Review. "I think of myself as a good pinch-hitter because I usually give a good at-bat. If I can get a start every once in a while, too, that's a plus."
|
Q:
How to center a text in a batch output?
I'm implementing a batch program that execute some different things in different steps.
For each step, I want to display a "friendly" text header like this:
*************************************************************
* MY FIRST STEP *
*************************************************************
"MY FIRST STEP" is a variable that could have a various length.
My question: do you have an algorithm or a function that could return this string as output with the string header to display in input parameter ?
Thanks in advance.
Regards
A:
The width of all the symbols depends heavily on the font used. There is no easy way to measure pixel width of a string, but sometimes you don't need it.
Windows command line by default uses Lucida Console, a monospace font, which makes things easy. Example would be:
@echo off
setLocal EnableDelayedExpansion
set "STR=Boom^!"
set "SIZE=50"
set "LEN=0"
:strLen_Loop
if not "!!STR:~%LEN%!!"=="" set /A "LEN+=1" & goto :strLen_Loop
set "stars=****************************************************************************************************"
set "spaces= "
call echo %%stars:~0,%SIZE%%%
set /a "pref_len=%SIZE%-%LEN%-2"
set /a "pref_len/=2"
set /a "suf_len=%SIZE%-%LEN%-2-%pref_len%"
call echo *%%spaces:~0,%pref_len%%%%%STR%%%%spaces:~0,%suf_len%%%*
call echo %%stars:~0,%SIZE%%%
endLocal
SIZE here is the length of the block you want to output, make sure it's big enough to fit all the possible lines inside it.
I'll remind, that this will output a pretty block in monospace fonts only.
EDIT: Fixed the LEN initialization.
|
Nedaa Syria:
Israeli Prime Minister Benjamin Netanyahu threatened the Iranian militia in Syria to escalate following the withdrawal of US troops.
Netanyahu said in televised remarks that his country would continue to act against Iran's efforts to establish its presence in Syria. He explained that there was an Israeli air campaign against "Iranian deployments inside Syria" and the transfer of arms to the Lebanese Hezbollah militia.
"We do not intend to reduce our efforts, but we will step up, and I know that we are doing this with the full support of the United States," Netanyahu said.
The Israeli Prime Minister had hinted a few days ago to the possibility of launching a military operation against the militias of Iran in Syria, in the event of exposure to his country, and said that the latter wants to enter 80 thousand, "Shiite" fighters to Syrian territory in order to fight Tel Aviv.
Netanyahu said today that they will study the timetable for the American decision to withdraw its forces from Syria and the method of implementing that, in addition to study the repercussions for his country.
|
Trestle bench
Hello. Well here is another project finished up and ready for the guest roomThe wood is Alder, wth GF gel stain and some Arm-a-seal.It was a fun project, however I did learn some hard lessons on through mortise and tenons. Enjoy
Thanks for the complements!The issues I had wth the through Tenons was, I had my ear plugs in and could not here the change in tone when the wedges bottomed out. So I have a small split in the stretcher, it doesn’t effect the structural integrity.
|
Today RunningPhysio welcomes guest blogger Julia Mainstone to the site. Julia specialises in nutrition for fitness and sport and is a professional member of the American College of Sports Medicine. She works as Sports Nutritionist for Brighton and Hove FC and has provided support for triathlons, Ironman and the Marathon des Sables. You can follow Julia on twitter – @JuliaNutrition and find out more information on nutrition on her website – http://www.brightonsportsnutrition.co.uk.
So you thought exercise makes you fitter? It does overall. Exercise has massive benefits for the cardio-respiratory system, not to mention many other health benefits. However, as training loads and volumes increase, we open up possibilities for different complications. One of the key areas where changes are observed in elite athletes is the immune system and their pattern of illness.
It is now accepted that exercise causes altered immune cell function. This is a fairly new area of research in Sports Medicine, and there’s still a lot of work needed before we come anywhere near understanding what’s going on. Despite being great for our overall health, exercise causes decreases in the region of 15-25% in lymphocytes, T cells and B cells, natural killer cells, and reduces the mucosal secretory functions of the nose and salivary glands. There is thought to be an ‘open-window’ of susceptibility to infection after acute exercise, although the length of this period is debatable. For more information about the immune system and the physiological changes induced by exercise, read this excellent consensus statement.
Upper respiratory tract infections (URTIs) are common in runners and endurance athletes, and are one of the most frequently cited reasons for attendance at sports medicine clinics. Infections don’t necessarily follow normal patterns of winter illness and tend to peak at times of hard training and competition. In particular, they increase 2-6 fold after marathons and ultramarathons. Other areas of the body such as the intestine also suffer during intense exercise, although how these factors are related is still unknown.
It’s clear from the physiological changes observed in athletes that exercise has a measurable impact on markers of immune stress and dysfunction. So what are the practical nutritional steps you can take to minimise these risks?
Don’t forget your carbs…
Cycled carbohydrate intake is vital for performance in endurance sports, and carbohydrate intake leading up to a marathon is the biggest predictor of performance in novice runners. However, it’s not just performance they affect. Ingestion of carbohydrates plays a role in how the immune system responds to heavy training loads by reducing circulating cortisol level and delaying the symptoms of overreaching during intensive training periods(Gleeson 2004, Lane 2009). Placebo-controlled trials in cyclists have also shown carbohydrate ingestion attenuates some aspects of detrimental changes of immune response during prolonged exercise (Halson 2004). Up to 60 g of carbohydrate per hour of heavy exertion helps dampen immune inflammatory responses, as described in the second part of the Immune System Consensus Document .
So, one strategy to reduce immune stress is to ensure adequate fuelling with carbohydrates. Start well-fuelled, refuel during exercise lasting longer than an hour, and make sure you provide your body with proper recovery nutrition afterwards. Starting well-fuelled requires a good suppply of healthy carbohydrates throughout training and tapering periods. Despite what Panorama has to say about how useless sports drinks are, if ever they have a place, it's during competitive long-distance events. They can be vital if you find it hard to eat whilst running, especially if your goal is to excel at, rather than just complete an event. It goes without saying that food should provide as much of our energy intake as possible, but during long endurance exercise, if there was a choice between no additional fuel or fuel provided by a sports drink, I’d take it every time. Following exercise, try to eat a balanced meal containing a good amount of protein and carbohydrate as soon as possible.
Good general nutrition…
It may seem like an obvious point to make, but the importance of all-round good nutrition cannot be stressed enough. Ensuring your diet contains adequate energy, macronutrients (protein, carbohydrate and fat) and micronutrients (vitamins and minerals) is one of the most important things you can do for your general health and to keep your immune system strong. Eating a balanced wholefood diet and avoiding energy and micronutrient deficiencies (particularly iron, zinc and vitamins B6 and 12), is essential for athletic performance. Many micronutrient supplements have been found to increase immunity in athletes, but it is unclear whether this is because they are treating deficiencies or providing additional benefit to non-deficient subjects. A good diet preventing micronutrient deficiencies is the best starting point, and vitamin and mineral supplements should ideally only be used for those with proven deficiencies or poor diets.
Lose weight carefully…
A study in judo athletes found that four weeks of weight-loss, averaging 2.8kg, was enough to significantly weaken immune function and increase the risk of URTI. If you are reducing the amount of carbs in your diet to lose body fat, you may need to scale down your endurance training because your body will not cope well with an energy deficit, low-carbohydrate intake and high levels of training. Aim for shorter higher-intensity workouts and make sure you include carbohydrates at key times around exercise. If your fat-loss strategy includes depleted workouts, make sure you have a carbohydrate-containing meal afterwards. If you are restricting your energy intake it is particularly important to make sure every calorie counts and provides you with essential nutrients, so cut out all junk food and get the majority of your calories from lean meats and fish, fresh fruit and vegetables and low-fat dairy products.
Hydration…
Maintaining a good state of hydration will help protect your first-line defences against infection- namely your snot and spit! Being well-hydrated reduces stress in exercise and also maintains saliva flow, which is useful because saliva contains several substances with antimicrobial properties such as IgA (immunoglobulin A). Click here to read the American College of Sports Medicine's fluid replacement guidelines for exercise. You should aim to never lose more than 2% of your body mass during exercise, which can easily be checked at home or at the gym.
Probiotics and other supplements
A good diet with enough energy and macro/micronutrients is one of the biggest building blocks for a strong immune system. However there are some supplements other than micronutrients that have shown benefit in certain athletic populations.
Probiotics are defined by the World Health Organisation as “live microorganisms which, when administered in adequate amounts, confer a health benefit on the host.” They are found in some yoghurts and can also be bought in supplement form. Various Lactobacilli species have been tested in athletes, and studies have shown probiotics from this group reduce fatigue and themagnitude of acute exercise-induced changes in some cytokines, maintain salivary IgA during winter training and competition and reduce frequency and severity of URTI in runners. Probiotics may also reduce the severity of gastrointestinal symptoms in marathon runners.
Quercetin has been suggested as an immune system strengthener and as an exciting supplement for immune support. However despite increases in plasma quercetin levels, a study published in 2011 showed quercetin did not counter postexercise inflammation or immune changes relative to placebo. Other work, published in 2007 showed quercetin ingestion by ultramarathon athletes for 3 weeks before a competitive 160-km race significantly increased plasma quercetin levels but failed to attenuate muscle damage, inflammation, increases in plasma cytokine and hormone levels, and alterations in leukocyte cytokine mRNA expression.
Other supplements that have been suggested for improving immunity in athletes include echinacea, ginseng, beta-glucan, and bovine colostrums. For a full discussion of the possible efficacy of these supplements please read the second part of the consensus paper.
The bottom line….Maintaining good immune health requires a holistic approach. Periodisation of training and nutrition, particularly in periods of fat-loss, reducing stress levels, sleeping and eating well all play an important role.
Whilst the supplements I have discussed here are all thought to be safe when taken as directed, it's always sensible to be cautious about adding supplements to your diet. Discuss with a qualified professional or do your homework before taking anything new.
|
In 2027, in a chaotic world in which humans can no longer procreate, a former activist agrees to help transport a miraculously pregnant woman to a sanctuary at sea, where her child's birth may help scientists save the future of humankind.
A poor French teenage girl engages in an illicit affair with a wealthy Chinese heir in 1920s Saigon. For the first time in her young life she has control, and she wields it deftly over her besotted lover throughout a series of clandestine meetings and torrid encounters.
Flighty Emily "Jacks" Jackson works for the British edition of Vogue magazine. Rather than pursue a relationship, Jacks regularly hooks up with her devoted ex-boyfriend, James Wildstone, and lives with Peter Simon, a gay screenwriter.
In a twisted social experiment, a group of 80 Americans are locked in their high-rise corporate office in Bogata, Colombia and ordered by an unknown voice coming from the company's intercom system to participate in a deadly game of kill or be killed.
Thor is imprisoned on the other side of the universe and finds himself in a race against time to get back to Asgard to stop Ragnarok, the destruction of his homeworld and the end of Asgardian civilization, at the hands of an all-powerful new threat, the ruthless Hela.
Hannah Swensen is thrilled when she is chosen as a guest for the first Eden Lake Dessert Bake-Off, but when fellow judge, Coach Boyd Watson is found murdered, Hannah once again takes it upon herself to find herself to find the killer.
Bound for a remote planet on the far side of the galaxy, the crew of the colony ship Covenant discovers what they think is an uncharted paradise, but is actually a dark, dangerous world — whose sole inhabitant is the “synthetic” David, survivor of the doomed Prometheus expedition.
In this modern love story set against the Austin, Texas music scene, two entangled couples — struggling songwriters Faye and BV, and music mogul Cook and the waitress whom he ensnares — chase success through a rock ‘n’ roll landscape of seduction and betrayal.
|
There is fixin' to be a local brewery around here that I am planning to go visit, but it will be the first one and they will be draft only to start. Otherwise, the best beer you are getting at the package store is Negro Modelo.
I also brought a keg of my Belgian White and a homebrew I made spiced with ginger, honey and lemon peel in a corny keg.
|
Simulator.SubSystem.Norm.valueNorm = -5.0
Simulator.SubSystem.CellCenterFVM.Data.LinearLS3D.limitRes = -15.0
Simulator.SubSystem.NewtonIterator.Data.CFL.Interactive.CFL = 1.
# second order can be activated by setting gradientFactor to 1.
Simulator.SubSystem.CellCenterFVM.Data.LinearLS3D.gradientFactor = 1.
|
Structural-functional relationships in type I insulin-dependent diabetes mellitus in humans.
The major renal pathologic changes of diabetes include thickening of all renal extracellular basement membranes and mesangial matrix and, to a lesser extent, mesangial cell expansion. Two renal lesions appear critical in diabetic nephropathy. Mesangial expansion out of proportion to the size of the glomerulus is closely and inversely related to measures of peripheral capillary wall filtration surface and to clinical features of proteinuria, hypertension, and decreasing glomerular filtration rate (GFR). Arteriolar hyalinosis is related to global glomerulosclerosis, and both are correlated with the clinical features of nephropathy. These lesions are markedly advanced by the time renal dysfunction is clinically detectable. Relationships of structure and function early in the course of the diabetes have not been examined satisfactorily.
|
Lagu Kenangan
Lagu Kenangan ('Song of Memories') is a 1953 Indonesian film directed by and produced by Djamaluddin Malik for the Persari Film Corporation. Starring Titien Sumarni and A. N. Alcaff, it follows the domestic troubles of a composer and his wife.
Plot
The composer Supardi lives with his wife, Surjati, and their two children Janti and Janto. The couple often fight, owing to Supardi's late hours, as he does his best work at night when the children are sleeping. Things escalate to the point that Surjati takes Janti and leaves. This separation nearly ends in divorce, but eventually with the support of their parents, Surjati and Supardi are able to reconcile.
Production
Lagu Kenangan was produced for Persari Film Corporation by Djamaluddin Malik. The film was one in a long line of commercially oriented ventures which had been produced by the company starting with Sedap Malam in 1950. This black-and-white film was written and directed by , who joined Persari shortly after completing Pahit-Pahit Manis for their competitor Banteng Film.
The film starred Titien Sumarni and AN Alcaff. They were supported by Mien Sondakh, M. Budhrasa, Sjamsu, Ramlan, and Djauhari Effendi.
Release
Lagu Kenangan passed the censorship bureau in 1953, and was rated for viewers aged 13 and up. Screenings are reported as early as 14 August, at the Rivoli Theatre in Jakarta. The film had reached Malang, East Java, by 7 November 1953. For its run there at the Atrium Theater, it was advertised as a "charming, sad, funny and replete with melodious songs" ("menawan hati, sedih, lutju, dan diringi dengan njanjian2 jang merdu"). Lagu Kenangan was screened as late as August 1955.
References
Works cited
Category:1953 films
Category:Indonesian films
Category:Indonesian-language films
Category:Indonesian black-and-white films
|
National debt hits new milestone, topping $22 trillion National debt hits new milestone at $22 trillion, up $2.06 trillion since Trump took office
WASHINGTON -- The national debt has passed a new milestone, topping $22 trillion for the first time.
The Treasury Department's daily statement showed Tuesday that total outstanding public debt stands at $22.01 trillion. It stood at $19.95 trillion when President Donald Trump took office on Jan. 20, 2017.
The debt figure has been accelerating since the passage of Trump's $1.5 trillion tax cut in December 2017 and action by Congress last year to increase spending on domestic and military programs.
The national debt is the total of the annual budget deficits. The Congressional Budget Office projects that this year's deficit will be $897 billion — a 15.1 percent increase over last year's imbalance of $779 billion. In the coming years, the CBO forecasts that the deficit will keep rising, top $1 trillion annually beginning in 2022 and never drop below $1 trillion through 2029. Much of the increase will come from mounting costs to fund Social Security and Medicare as the vast generation of baby boomers continue to retire.
The Trump administration contends that its tax cuts will eventually pay for themselves by generating faster economic growth. That projection is disputed by many economists.
Despite the rising levels of federal debt, many economists say they think the risks remain slight and point to current interest rates, which remain unusually low by historical standards. Still, some budget experts warn that ever-rising federal debt poses substantial risks for the government because it could make it harder to respond to a financial crisis through tax cuts or spending increases.
Michael Peterson, head of the Peter G. Peterson Foundation, says "our growing national debt matters because it threatens the economic future of every American."
|
require_relative '../../helper'
require_relative '../../globals'
require_relative '../../env'
require_relative '../interface'
module FastlaneCore
# Shell is the terminal output of things
# For documentation for each of the methods open `interface.rb`
class Shell < Interface
require 'tty-screen'
def log
return @log if @log
$stdout.sync = true
if Helper.test? && !ENV.key?('DEBUG')
$stdout.puts("Logging disabled while running tests. Force them by setting the DEBUG environment variable")
@log ||= Logger.new(nil) # don't show any logs when running tests
else
@log ||= Logger.new($stdout)
end
@log.formatter = proc do |severity, datetime, progname, msg|
"#{format_string(datetime, severity)}#{msg}\n"
end
@log
end
def format_string(datetime = Time.now, severity = "")
timezone_string = !FastlaneCore::Env.truthy?('FASTLANE_SHOW_TIMEZONE') ? '' : ' %z'
if FastlaneCore::Globals.verbose?
return "#{severity} [#{datetime.strftime('%Y-%m-%d %H:%M:%S.%2N' + timezone_string)}]: "
elsif FastlaneCore::Env.truthy?("FASTLANE_HIDE_TIMESTAMP")
return ""
else
return "[#{datetime.strftime('%H:%M:%S' + timezone_string)}]: "
end
end
#####################################################
# @!group Messaging: show text to the user
#####################################################
def error(message)
log.error(message.to_s.red)
end
def important(message)
log.warn(message.to_s.yellow)
end
def success(message)
log.info(message.to_s.green)
end
def message(message)
log.info(message.to_s)
end
def deprecated(message)
log.error(message.to_s.deprecated)
end
def command(message)
log.info("$ #{message}".cyan)
end
def command_output(message)
actual = (message.split("\r").last || "") # as clearing the line will remove the `>` and the time stamp
actual.split("\n").each do |msg|
if FastlaneCore::Env.truthy?("FASTLANE_DISABLE_OUTPUT_FORMAT")
log.info(msg)
else
prefix = msg.include?("▸") ? "" : "▸ "
log.info(prefix + "" + msg.magenta)
end
end
end
def verbose(message)
log.debug(message.to_s) if FastlaneCore::Globals.verbose?
end
def header(message)
format = format_string
if message.length + 8 < TTY::Screen.width - format.length
message = "--- #{message} ---"
i = message.length
else
i = TTY::Screen.width - format.length
end
success("-" * i)
success(message)
success("-" * i)
end
def content_error(content, error_line)
error_line = error_line.to_i
return unless error_line > 0
contents = content.split(/\r?\n/).map(&:chomp)
start_line = error_line - 2 < 1 ? 1 : error_line - 2
end_line = error_line + 2 < contents.length ? error_line + 2 : contents.length
Range.new(start_line, end_line).each do |line|
str = line == error_line ? " => " : " "
str << line.to_s.rjust(Math.log10(end_line) + 1)
str << ":\t#{contents[line - 1]}"
error(str)
end
end
#####################################################
# @!group Errors: Inputs
#####################################################
def interactive?
interactive = true
interactive = false if $stdout.isatty == false
interactive = false if Helper.ci?
return interactive
end
def input(message)
verify_interactive!(message)
ask("#{format_string}#{message.to_s.yellow}").to_s.strip
end
def confirm(message)
verify_interactive!(message)
agree("#{format_string}#{message.to_s.yellow} (y/n)", true)
end
def select(message, options)
verify_interactive!(message)
important(message)
choose(*options)
end
def password(message)
verify_interactive!(message)
ask("#{format_string}#{message.to_s.yellow}") { |q| q.echo = "*" }
end
private
def verify_interactive!(message)
return if interactive?
important(message)
crash!("Could not retrieve response as fastlane runs in non-interactive mode")
end
end
end
|
Q:
R Colored dendrogram suggestions?
I want to make colored dendrograms and have yet to find a sufficient library: http://addictedtor.free.fr/graphiques/RGraphGallery.php?graph=79
This graphic/library looks promising but cannot install the A2E library?
Trying to install on windows, downloaded the tar.gz file and cannot install package from the R console.
In addition:
Warning messages:
1: In unzip(zipname, exdir = dest) : error 1 in extracting from zip file
2: In gzfile(file, "r") :
cannot open compressed file 'A2R_0.0-4.tar.gz/DESCRIPTION', probable reason 'No such file or directory'
Can anyone see if they can get this A2R library working, confirm error, or suggest a good colored dendrogram library?
A:
(It might help if you spelled it correctly.) A2R is a source package. So you might need to have the system toolchain for compilation. Those are typically in your system if you are on Linux, but not if you are on a Mac (as I am) or on Windows. The package does compile from source on a Mac. And the compilation process may not have needed the toolchain. So try this:
install.packages("<fullpath> A2R_0.0-4.tar.gz", type ="source")
There are a few other dependencies: 'trimcluster', 'prabclus' , 'MASS' , 'cluster', 'mclust', 'flexmix', 'modeltools', 'stats4', 'multcomp', 'mvtnorm'. I am able to get most of that graphic but the left side curve does not appear as shown and I did get an error:
Error in hubertgamma[i] <- cluster.stats(d.usa, cutree(h.usa, k = i + :
replacement has length zero:
If you do not want the heights of the dendrogram scaled to their depth you can add this modification to the hclust object:
h.usa$height <- log(h.usa$height)
|
Q:
Aristotle Politics versus Platos Republic
The most famous political text from Antiquity is Platos Republic; one notices that this is a direct translation of the Latin De Republica; the orginal greek being Politeia.
Aristotle too, wrote a text called Politics (Politika); and he notes that in his Nicomachean Ethics that politics naturally follows a discussion of his virtue ethics; to legislate towards his ethics:
Must we not, then, next examine whence or how one can learn how to legislate?
Which has a parallel with Platos notion of a Philosopher-King.
What are the major differences between Aristotles Politics and that of Platos? And how influential is Platos text on him; it already seems here, for example that Aristotle is expanding and examining the notion of the Philosopher-King; perhaps identifying it to some extent with the laws of the city (polis); and those who legislate for them; but he notes:
but while the sophists profess to teach politics, it is practised not by any of them but by the politicians, who would seem to do so by dint of a certain skill and experience rather than of thought
Which seems remarkable, in that any art can be practised without thought; but he means by this it seems articulate thought:
For they are not found either writing or speaking about such matters
A:
Plato's and Aristotle's views on politics were very different. Aristotle rejected many of the building blocks of Plato's politics: the theory of Forms (in the Metaphysics), the universal idea of the Good (in the Ethics), the value of Communes (in the Politics).
Further, unlike Plato, Aristotle distinguished "theoretical" philosophy (physics, metaphysics) from "practical" philosophy (ethics, politics). Aristotle agreed with Plato that theoretical philosophy was part of the highest (and potentially happiest) form of human life. But unlike Plato, Aristotle held that theoretical philosophy had no practical value. He even saw its impracticality as a sign of its value: theoretical philosophy has no goal outside of itself. Accordingly, theoretical philosophy played almost no part in Aristotle's ethics and in his politics.
It is plain then that Science [= theoretical philosophy] is the union of Knowledge and Intuition, and has for its objects those things which are most precious in their nature. Accordingly, Anexagoras, Thales, and men of that stamp [= theoretical philosophers], people call Scientific, but not Practically Wise because they see them ignorant of what concerns themselves; and they say that what they know is quite out of the common run certainly, and wonderful, and hard, and very fine no doubt, but still useless because they do not seek after what is good for them as men. (Ethics Book VI)
Aristotle argued against regimes ruled by a small (minority) class, on the ground that such a regime cannot remain stable for long. Aristotle advocated a broad ruling class (the middle class) and a wide participation of citizens in the management of the state.
One factor that Aristotle preserved, as it were, from Plato's politics was the importance of public education. The corriculum of Aristotle's public education system included some forms of gymnastics and of music. Aristotle also suggeted that future rulers and legislators will study ethics and political theory, similar to his own. But he did not relate studies like higher mathematics or theoretical philosophy to the management of the state, as did Plato.
Another political aspect which seems to have been common to Plato and to Aristotle, was that they both viewed the desired state as outwardly peaceful, utilizing military force only for defense, and avoiding the occupation of other states.
|
Best Embroidery
Fabrics have been used as a medium for expressing creative art since ancient times. Numerous artists have taken this textile art legacy forward and come up with innovative designs! You can now enjoy and buy the finest quality fabric art at ShowFlipper. Designed by celebrated artists from around the world, view an entire range of art print fabric here
|
`
Monday, May 8, 2017
PAS: Mustafa wished to give way for new leaders, not sidelined
PAS has clarified that it has not sidelined its former elections director Mustafa Ali, but have left him out of the new leadership line-up in accordance to his own request.
The party’s deputy president Tuan Ibrahim Tuan Man reportedly said that Mustafa had met PAS president Abdul Hadi Awang to express his wishes prior to the party election.
“Cikgu Pa asked to give way to new talent if possible, because he has served for a long time, and in his view, it is about time of successors to rise through the ranks. He is also prepared to be an advisor and mentor to the party in the coming general election.
“The suggestion was well-received by the president, and we have set up a committee to advise the president,” Sinar Harian quoted Tuan Ibrahim as saying.
The statement contradicts Pokok Sena MP Mahfuz Omar’s claim that Mustafa is inclined towards Pakatan Harapan and this led to his removal from the long-held position.
Mustafa’s last post prior to the PAS Muktamar at Kota Sarang Semut, Alor Setar late-April, was election director, which is a key post within the party as the general election looms.
When the new leadership line-up was announced on May 6, however, Mustafa was left out of the line-up. Instead, his place was taken by Hadi’s political secretary Dr Ahmad Samsuri Mokhtar.
Meanwhile, Tuan Ibrahim said former Selangor PAS commissioner Iskandar Abdul Samad has been given a heavier responsibility as PAS’ Central and Southern Zone coordinator.
“He now has bigger responsibilities since he has to look after Selangor, Negeri Sembilan, Malacca, and Johor, especially when it comes to facing the 14th general election.
“We did these changes in Johor and Terengganu too, so the issue of sacking does not arise,” he was quoted as saying.- Mkini
|
Arson suspect says he was 'messed up' when he set fires
By Dale Lezon |
November 30, 2012
A 19-year-old man who said he was "messed up" has been accused of intentionally setting two fires near a shopping center in northwest Harris County in early November.
Michael Fuller is charged with arson in connection with the fires behind the building at 15002 Ella Nov. 8, according to the Harris County Fire Marshal's Office.
Officials said a store owner at the strip mall spotted Fuller at the center about 1 p.m. Thursday and recognized him from a Crime Stoppers news story about the fires. He notified authorities and Fuller was detained at the scene.
Officials said Fuller admitted to setting the fires. He said "that he was messed up" and that's why he started them, officials said.
Officials said a security camera had recorded Fuller's image running from the shopping center about the time the fires were started.
|
Q:
JProgressBar Doesn't Start Until Try-catch finishes
I am writing a program which uses Random.ORG api. When I click calculate button, JProgressBar starts right after the opeartion is being done and stay freezed until this moment.
I tried extra try-catch clauses, if statements and bool-gates. None of them worked, how could I fix it?
kazananiBelirleButon.addActionListener(new ActionListener() {
public void actionPerformed(ActionEvent e) {
progressBar.setVisible(true);
progressBar.setIndeterminate(true);
try {
HashMap<String, Object> randoms = randSonuc.generateSignedIntegers(5, 0, 10);
System.out.println(randoms.toString());
String test = randoms.toString().substring(randoms.toString().indexOf("{r")+1, randoms.toString().indexOf(", da")).replace("random=", "{\"random\":") + "}";
System.out.println(tarihiYazdir(test,14));
cekilisTarihiTextPane.setText(tarihiYazdir(test,2).toString());
sonucPane.setText("\n"+sonuclariYazdir(test,0));
} catch (RandomOrgSendTimeoutException e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgKeyNotRunningError e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgInsufficientRequestsError e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgInsufficientBitsError e1) {
System.out.print("lol");
e1.printStackTrace();
} catch (RandomOrgBadHTTPResponseException e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgRANDOMORGError e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgJSONRPCError e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (MalformedURLException e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (IOException e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
}
}
});
A:
Swing is single threaded. Calling listeners, painting/updating UI all happen on a single thread called the Event Dispatch Thread (EDT).
Since you do all your work in the event handler code, the Swing UI cannot be updated until you return from your method (actionPerformed()).
Read this tutorial: Concurrency in Swing
What you should do is do your time-consuming work in a separate thread and only do short tasks in the EDT (e.g. UI updates).
Also check out the SwingWorker class which is designed to perform lengthy GUI-interaction tasks in a background thread.
A:
Try using swing worker in your method.
Swing Worker
Here is an example from old version of swing worker. Firs you need to add SwingWorker class to your project:
import javax.swing.SwingUtilities;
/**
* This is the 3rd version of SwingWorker (also known as
* SwingWorker 3), an abstract class that you subclass to
* perform GUI-related work in a dedicated thread. For
* instructions on using this class, see:
*
* http://java.sun.com/docs/books/tutorial/uiswing/misc/threads.html
*
* Note that the API changed slightly in the 3rd version:
* You must now invoke start() on the SwingWorker after
* creating it.
*/
public abstract class SwingWorker
{
private Object value; // see getValue(), setValue()
private Thread thread;
/**
* Class to maintain reference to current worker thread
* under separate synchronization control.
*/
private static class ThreadVar
{
private Thread thread;
ThreadVar(Thread t)
{
thread = t;
}
synchronized Thread get()
{
return thread;
}
synchronized void clear()
{
thread = null;
}
}
private ThreadVar threadVar;
/**
* Get the value produced by the worker thread, or null if it
* hasn't been constructed yet.
*/
protected synchronized Object getValue()
{
return value;
}
/**
* Set the value produced by worker thread
*/
private synchronized void setValue(Object x)
{
value = x;
}
/**
* Compute the value to be returned by the <code>get</code> method.
*/
public abstract Object construct();
/**
* Called on the event dispatching thread (not on the worker thread)
* after the <code>construct</code> method has returned.
*/
public void finished()
{
}
/**
* A new method that interrupts the worker thread. Call this method
* to force the worker to stop what it's doing.
*/
public void interrupt()
{
Thread t = threadVar.get();
if (t != null)
{
t.interrupt();
}
threadVar.clear();
}
/**
* Return the value created by the <code>construct</code> method.
* Returns null if either the constructing thread or the current
* thread was interrupted before a value was produced.
*
* @return the value created by the <code>construct</code> method
*/
public Object get()
{
while (true)
{
Thread t = threadVar.get();
if (t == null)
{
return getValue();
}
try
{
t.join();
}
catch (InterruptedException e)
{
Thread.currentThread().interrupt(); // propagate
return null;
}
}
}
/**
* Start a thread that will call the <code>construct</code> method
* and then exit.
*/
public SwingWorker()
{
final Runnable doFinished = new Runnable()
{
public void run()
{
finished();
}
};
Runnable doConstruct = new Runnable()
{
public void run()
{
try
{
setValue(construct());
}
finally
{
threadVar.clear();
}
SwingUtilities.invokeLater(doFinished);
}
};
Thread t = new Thread(doConstruct);
threadVar = new ThreadVar(t);
}
/**
* Start the worker thread.
*/
public void start()
{
Thread t = threadVar.get();
if (t != null)
{
t.start();
}
}
}
Then add your logic inside:
SwingWorker worker = new SwingWorker() {
@Override
public Object construct() {
// add your code here
progressBar.setVisible(true);
progressBar.setIndeterminate(true);
// and so on...
return 0;
}
};
worker.start();
So the end resuld should look like this (Note that this is untested code):
kazananiBelirleButon.addActionListener(new ActionListener() {
public void actionPerformed(ActionEvent e) {
SwingWorker worker = new SwingWorker() {
@Override
public Object construct() {
progressBar.setVisible(true);
progressBar.setIndeterminate(true);
try {
HashMap<String, Object> randoms = randSonuc.generateSignedIntegers(5, 0, 10);
System.out.println(randoms.toString());
String test = randoms.toString().substring(randoms.toString().indexOf("{r")+1, randoms.toString().indexOf(", da")).replace("random=", "{\"random\":") + "}";
System.out.println(tarihiYazdir(test,14));
cekilisTarihiTextPane.setText(tarihiYazdir(test,2).toString());
sonucPane.setText("\n"+sonuclariYazdir(test,0));
} catch (RandomOrgSendTimeoutException e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgKeyNotRunningError e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgInsufficientRequestsError e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgInsufficientBitsError e1) {
System.out.print("lol");
e1.printStackTrace();
} catch (RandomOrgBadHTTPResponseException e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgRANDOMORGError e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (RandomOrgJSONRPCError e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (MalformedURLException e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
} catch (IOException e1) {
// TODO Auto-generated catch block
e1.printStackTrace();
}
}
return 0;
}
};
worker.start();
});
|
Activate / De-Activate
This page has been provided so that you can manually activate or de-activate your copy of MK Express. This should only be required if the computer which is running MK Express can not connect to the Internet.
|
Q:
mongoDb fetch value from multi object key search
I've a search parameter which has a combination of 3 fields (dwelling, nameOrNumber and street) and on keyup event I need to combine the above mentioned 3 keys and fetch the value from MongoDB
Sample Search Parameter:
"Plot 227, Rockingham Street"
Sample MongoDB Object
{
"_id" : ObjectId("5460e1660ca8560b00048e47"),
"address" : {
"dwelling" : "The Patterdale",
"nameOrNumber" : "Plot 227",
"street" : "Rockingham Street",
"locality" : "Fitzwilliam",
"town" : "Pontefract",
"county" : "West Yorkshire",
"postcode" : "WF95BZ",
"country" : {
"code" : "UK",
"name" : "United Kingdom"
}
}
}
A:
You could look at creating text indexes, which can be created on multiple fields as well. And then use the $text operator in your find query to perform the search, which will look at all fields indexed with a text index. From the documentation:
MongoDB provides text indexes to support text search of string content in documents of a collection.
For example, you can create an index like:
db.collection.ensureIndex(
{
dwelling: "text",
nameOrNumber: "text",
street: "text"
}
)
And then query like:
db.collection.find( { $text: { $search: "Plot 227 Rockingham Street" } } )
That should find the document you are looking for.
Note: The above example is untested. However, the info provided should guide you in the right direction.
|
// Copyright 2019 The Chromium Authors. All rights reserved.
// Use of this source code is governed by a BSD-style license that can be
// found in the LICENSE file.
#include "components/autofill/content/browser/autofill_log_router_factory.h"
#include "components/autofill/core/browser/logging/log_receiver.h"
#include "components/autofill/core/browser/logging/log_router.h"
#include "components/keyed_service/content/browser_context_dependency_manager.h"
#include "content/public/test/browser_task_environment.h"
#include "content/public/test/test_browser_context.h"
#include "testing/gmock/include/gmock/gmock.h"
#include "testing/gtest/include/gtest/gtest.h"
using autofill::AutofillLogRouterFactory;
using autofill::LogRouter;
namespace {
const char kTestText[] = "abcd1234";
class MockLogReceiver : public autofill::LogReceiver {
public:
MockLogReceiver() {}
MOCK_METHOD1(LogEntry, void(const base::Value&));
};
} // namespace
class AutofillLogRouterFactoryTest : public testing::Test {
public:
content::BrowserTaskEnvironment task_environment_;
content::TestBrowserContext browser_context_;
void SetUp() override {
BrowserContextDependencyManager::GetInstance()->MarkBrowserContextLive(
&browser_context_);
}
void TearDown() override {
BrowserContextDependencyManager::GetInstance()
->DestroyBrowserContextServices(&browser_context_);
}
};
// When the profile is not incognito, it should be possible to activate the
// service.
TEST_F(AutofillLogRouterFactoryTest, ServiceActiveNonIncognito) {
browser_context_.set_is_off_the_record(false);
LogRouter* log_router =
AutofillLogRouterFactory::GetForBrowserContext(&browser_context_);
testing::StrictMock<MockLogReceiver> receiver;
ASSERT_TRUE(log_router);
EXPECT_EQ(std::vector<base::Value>(),
log_router->RegisterReceiver(&receiver));
base::Value log_entry = autofill::LogRouter::CreateEntryForText(kTestText);
EXPECT_CALL(receiver, LogEntry(testing::Eq(testing::ByRef(log_entry))))
.Times(1);
log_router->ProcessLog(kTestText);
log_router->UnregisterReceiver(&receiver);
}
// When the browser profile is incognito, it should not be possible to activate
// the service.
TEST_F(AutofillLogRouterFactoryTest, ServiceNotActiveIncognito) {
browser_context_.set_is_off_the_record(true);
LogRouter* log_router =
AutofillLogRouterFactory::GetForBrowserContext(&browser_context_);
// BrowserContextKeyedServiceFactory::GetBrowserContextToUse should return
// nullptr for |browser_context|, because |browser_context| is incognito.
// Therefore the returned |service| should also be nullptr.
EXPECT_FALSE(log_router);
}
|
<?xml version="1.0" encoding="utf-8"?>
<string xmlns="http://tempuri.org/">{
"Info": [
{
"IsSuccess": "True",
"InAddress": "臺中市西區三民路一段95－1號1樓",
"InSRS": "EPSG:4326",
"InFuzzyType": "[單雙號機制]+[最近門牌號機制]",
"InFuzzyBuffer": "0",
"InIsOnlyFullMatch": "False",
"InIsLockCounty": "True",
"InIsLockTown": "False",
"InIsLockVillage": "False",
"InIsLockRoadSection": "False",
"InIsLockLane": "False",
"InIsLockAlley": "False",
"InIsLockArea": "False",
"InIsSameNumber_SubNumber": "True",
"InCanIgnoreVillage": "True",
"InCanIgnoreNeighborhood": "True",
"InReturnMaxCount": "0",
"OutTotal": "1",
"OutMatchType": "模糊比對",
"OutMatchCode": "[臺中市]\tT:1,V:-1,R:1,S:1,L:-1,A:-1,SA:-1,T:-1,AR:-1,NO:1,E:-1,N:-1",
"OutTraceInfo": "[臺中市]\t { 模糊比對 } (西區)\t找到符合的[鄉鎮市區]，(三民路)\t找到符合的[路街名]，(1)\t找到符合的[路段]，(95－1號)\t找到符合的[門牌號碼]，模糊比對找到 1 筆符合的門牌地址。"
}
],
"AddressList": [
{
"FULL_ADDR": "臺中市西區藍興里8鄰三民路一段95之1號",
"COUNTY": "臺中市",
"TOWN": "西區",
"VILLAGE": "藍興里",
"NEIGHBORHOOD": "8鄰",
"ROAD": "三民路",
"SECTION": "1",
"LANE": "",
"ALLEY": "",
"SUB_ALLEY": "",
"TONG": "",
"NUMBER": "95之1號",
"X": 120.669782,
"Y": 24.133220
}
]
}</string>
|
Minorities Support Death Penalty
LOS ANGELES - An overwhelming majority of California voters of every ethnic group supports the death penalty, according to a newField Poll released Thursday.
“It’s fairly rare to see an issue that enjoys support across partisan groups, age groups, and ethnic demographics,” said the poll’s director, Mark DiCamillo. “The death penalty is one of those issues.”
Among Latinos, 69 percent said they approve of state-sponsored execution; among blacks, the figure was slightly lower but still decisive—63 percent. Support was lowest among Vietnamese Americans (55 percent) and Korean Americans (54 percent).
Interestingly, the younger the voter, the greater the support: overall, 73 percent of 18- to 29-year-olds said they back the death penalty, versus 66 percent of people 65 and older.
“When black folks see a story about DNA evidence proving someone’s innocence, they’ll say they’re against it, but most of the time when they see someone being executed, they assume they’re guilty,” said Kevin Alexander Gray, author of the book Waiting for Lightening to Strike: The Fundamentals of Black Politics.
Gray, who has been attending the NAACP’s national convention in Kansas City, said the high rate of support for the death penalty among African Americans represents a failure of the black community to develop a young, progressive leadership. “As blacks get older, they get more conservative,” he said, “and there’s no one there to challenge the younger generation.”
Opponents of capital punishment have documented that Africans Americans are sentenced to death at rates much higher than whites for the same types of crimes. But blacks who responded to the Field Poll said this disparity didn’t change their minds.
“This country was founded on slavery and racism, but if a black person rapes and murders a young girl or an elderly woman, I’ll pull the switch myself,” said Norman Aubry, 64, a retired superintendent for the Los Angeles Department of Sanitation.
“My only problem with the death penalty is that we don’t use it enough,” he told NAM. “If you don’t use it, you don’t deter anybody.”
Executions have been on hold in California for more than four years, since a federal judge ruled the state’s method of administering lethal injection constitutes cruel and unusual punishment.
More than 700 prisoners are on death row in California, more than twice as many as any other state.
The overall level of support for the death penalty is three points higher than the last time the Field Poll conducted the survey in 2008, and seven points higher than in 2000, when DNA exonerations began to raise concerns about the number of innocent people on death rows. Still, capital-punishment opponents said they weren’t surprised by the results, which they said was consistent with other polls.
But Natasha Minsker, who heads the death penalty project of the American Civil Liberties Union, said the Field Poll’s results don’t tell the whole story.
She pointed to another survey, conducted by the University of Virginia, which found that while Californians support the death penalty, 60 percent preferred life in prison without parole. When researchers added the requirement that prisoners work and pay restitution, 64 percent preferred that alternative, and support for the death penalty plummeted to just 26 percent.
The Field Poll also asked California voters which sentence they preferred for a person convicted of first-degree murder: the death penalty or life in prison without parole. There, pollsters found a virtual tie, with 42 percent of respondents favoring prison and 41 percent choosing execution.
“There’s little doubt that Californians overwhelmingly support the death penalty,” DiCamillo said, “but for some people, the bar for its application might be quite high—only for a cop killer or a terrorist or someone convicted of truly heinous crimes. Others favor it for simple first-degree murder.”
Regardless of public sentiment, executions are unlikely to resume in California in the near future. Litigation over the constitutionality of the state’s method of lethal injection is likely to go on for months, if not years.
|
AC260584 (4-[3-(4-butylpiperidin-1-yl)-propyl]-7-fluoro-4H-benzo[1,4]oxazin-3-one), a selective muscarinic M1 receptor agonist, increases acetylcholine and dopamine release in rat medial prefrontal cortex and hippocampus.
Both muscarinic and nicotinic receptors are implicated in cognition. We have previously suggested that stimulation of the muscarinic M1 receptor has a beneficial effect on cognition, based upon evidence that the muscarinic M1 receptor agonist of N-desmethylclozapine, the major metabolite of clozapine, may contribute to the ability of clozapine to improve some domains of cognition in schizophrenia. Present study examined the effectiveness of a new muscarinic M1 receptor agonist, 4-[3-(4-butylpiperidin-1-yl)-propyl]-7-fluoro-4H-benzo[1,4]oxazin-3-one (AC260584), to increase the release of acetylcholine and dopamine in the rat medial prefrontal cortex and hippocampus. Using microdialysis in awake, freely moving rats, AC260584, 3 and 10, but not 1 mg/kg (s.c.), significantly increased dopamine release in the medial prefrontal cortex and hippocampus. However, only the high dose of AC260584, 10 mg/kg (s.c.), significantly increased acetylcholine release in these regions. Moreover, the increases in acetylcholine release produced by AC260584, 10 mg/kg, were attenuated by the muscarinic M1 receptor antagonist telenzepine (3 mg/kg, s.c.) but not by the 5-HT1A receptor antagonist N-[2-(4-2-methoxyphenyl)-1-piperazinyl]-N-(2-pyridyl) cyclohexanecarboxamide (WAY100635, 0.2 mg/kg, s.c.). However, the increase in dopamine release produced by 10 mg/kg AC260584 was blocked by both telenzepine and WAY100635. In addition, pretreatment with the atypical antipsychotic drug risperidone (0.1 mg/kg, s.c.) potentiated AC260584 (1.0 mg/kg, s.c.)-induced acetylcholine and dopamine release in the medial prefrontal cortex. These findings suggest that the muscarinic M1 receptor agonist property of AC260584 contributes to its enhancement of cortical acetylcholine and dopamine efflux. Therefore, AC260584, as well as other muscarinic M1 receptor agonists, may be a valuable target for the development of drugs which can improve the cognitive deficits in schizophrenia and perhaps other neuropsychiatric disorders, as well.
|
The offseason is a busy time for General Manager Doug Armstrong.
Decisions will have to be made to shape or re-shape the roster for the upcoming season. Restricted free agents, unrestricted free agents, signings and re-signings...there's a lot to keep track of.
Below is a list of the Blues summer transactions to date. If it's official, you'll find it here.
Check back often for the most up-to-date list of offseason signings.
|
Filed 3/12/13 Tah v. U.S. Bank CA1/3
NOT TO BE PUBLISHED IN OFFICIAL REPORTS
California Rules of Court, rule 8.1115(a), prohibits courts and parties from citing or relying on opinions not certified for
publication or ordered published, except as specified by rule 8.1115(b). This opinion has not been certified for publication
or ordered published for purposes of rule 8.1115.
IN THE COURT OF APPEAL OF THE STATE OF CALIFORNIA
FIRST APPELLATE DISTRICT
DIVISION THREE
ELSI TAH,
Plaintiff and Appellant,
A135289
v.
U.S. BANK, N.A., as Trustee, etc., (Sonoma County
Super. Ct. No. SCV-249909)
Defendant and Respondent.
Plaintiff Elsi Tah (Tah) appeals from a judgment dismissing her case against U.S.
Bank N.A. (the Bank), as Trustee for Citigroup Mortgage Loan Trust, Inc. Mortgage
Pass-Through Certificates, Series 2007-AR-1, after the Bank’s demurrer to Tah’s
complaint was sustained without leave to amend. The sole issue is whether a court may
grant relief pursuant to Code of Civil Procedure section 473, sua sponte, from an entry of
default to enable a defendant to file a demurrer.1 Our answer is “yes,” and we affirm the
judgment.
I. BACKGROUND
According to the trial court docket, designated as part of the clerk’s transcript on
appeal, Tah filed her complaint on June 28, 2011. The complaint, which Tah has not
included in the appellate record, is attached as an exhibit to her brief. The complaint
alleges that the Bank is the trustee of a deed of trust securing a $622,300 mortgage loan
1
Unless otherwise indicated, subsequent statutory references are to the Code of
Civil Procedure.
1
on Tah’s residence. It seeks to postpone foreclosure of the deed of trust, rescind the loan
agreement, and recover damages on various theories.
When the court ruled on the Bank’s demurrer, it took judicial notice of its file in
this case and a previous case filed by Tah against the Bank and others for the same relief
sought in the present suit (Tah v. Wells Fargo Bank, N.A., et al; Sonoma County Super
Ct. No. SVC-248866).2 The Bank, which was sued in the prior action as trustee of a
different trust—the Harborview 2005-2 Trust Fund—demurred to the first amended
complaint in that action, and the demurrer was sustained without leave to amend in May
2011. On June 28, 2011, Tah dismissed the prior action without prejudice, and filed the
complaint in this case.
The attorney who handled both cases for the Bank declared in support of the
demurrer in this case that when he received the complaint he mistakenly believed it was
the complaint in the prior action that Tah had dismissed. Thus, he did not timely file a
responsive pleading.
On June 30, 2011, Tah moved for an order postponing foreclosure, and the motion
was granted in an order filed on August 5. The order, drafted by Tah’s counsel, stated:
“Plaintiff’s motion to postpone non-judicial foreclosure is granted, because defendants
have failed to contact the borrower before recording a Notice of Default,[3] pursuant to
Civil Code §2923.5(a), and failed to include a declaration that the defendants have tried
with due diligence to contact the borrower, pursuant to Civil Code § 2923.5(b). The
foreclosure sale is postponed until compliance with Civil Code §2923.5 can be shown.”
On October 3, 2011, Tah filed a request for entry of default against the Bank. The
clerk of the superior court entered the default as requested on that date. After receiving
Tah’s request for entry of default, the Bank’s counsel said he tried unsuccessfully to
2
We hereby grant the Bank’s motion to augment the record with documents from
the prior and current cases.
3
According to documents in a request for judicial notice in support of the
demurrer, a notice of default was recorded against Tah’s property showing that her loan
was $153,801.63 in arrears as of April 19, 2010.
2
reach Tah’s counsel by telephone. He left messages explaining his “own mistaken belief
that [the current case] had been dismissed and inquired whether [counsel] would stipulate
to removing [Tah’s] request for default, given that relief from default is mandatory when
default is entered due to mistake by counsel.” The Bank’s lawyer eventually spoke with
Tah’s counsel’s assistant who advised him in e-mails that Tah’s counsel would contact
him on October 28, but he did not.
The Bank demurrered on November 2. The Bank’s counsel stated in his
declaration that, before demurring, he contacted a superior court clerk and was told that
no default against the Bank had been entered. On January 20, 2012, Tah filed opposition
to the demurrer on the sole ground that the entry of default cut off the Bank’s right to
appear in the action. The Bank’s lawyer declared that he spoke again with a superior
court clerk on January 24 and was advised that no default had been entered.
At the February 1, 2012, hearing on the demurrer, after Tah’s counsel informed
the court that a default had been entered, the court responded: “Let’s suppose it was.
And let’s suppose that Defendant is going to file a 473 motion to set that aside. . . . Let
me just tell you what I’m thinking of doing at this point in light of this confusion, is
taking the demurrer under submission, setting a date for a 473 motion at this point . . . so
that that motion can be heard in a timely fashion.” Tah’s counsel stated that “the Court’s
course of conduct would be acceptable to Plaintiff,” but the Bank objected to it, arguing
that “[the] Bank has a right under California law, under statute, to file a responsive
pleading up until a date a default is entered. Our position remains the default was not
entered.”
The court took the demurrer under submission and then sustained it without leave
to amend, stating that it had “taken Judicial Notice of its own file [and] considered the
implications of C.C.P. §473.” Judgment was entered for the Bank, from which Tah has
timely appealed.
II. DISCUSSION
Tah argues that the demurrer was erroneously sustained, renewing the argument
she presented in the trial court that entry of default against the Bank precluded it from
3
filing a pleading in the case. (6 Witkin, Cal. Procedure (5th ed. 2008) Proceedings
Without Trial, § 175, p. 617.) Tah also contests the demurrer ruling on substantive
grounds, arguing that her complaint states causes of action based on violations of Civil
Code sections 2923.5 et seq.
The Bank does not dispute on appeal, as it did in the trial court, that default was in
fact entered against it. But the Bank argues that Tah has forfeited all of her arguments by
failing to designate an adequate appellate record. The Bank further argues that the
demurrer was properly considered on its merits, and correctly sustained without leave to
amend under the doctrine of res judicata by virtue of the judgment in the prior action.
We agree with the Bank that the record is inadequate to evaluate Tah’s assertions
of substantive error in the court’s decision. The record does not include the Bank’s
memoranda in support of the demurrer, or the supporting declaration and request for
judicial notice. Tah did not even designate the complaint as part of the record.
Consequently, we are in no position to evaluate her causes of action on the merits. Tah’s
opposition to the demurrer was based entirely on the entry of default against the Bank,
and that procedural argument is the only one properly before us.4
This appeal boils down to the narrow question of whether the court, on its own
motion, could grant relief under section 473 from the entry of default. We conclude that
it could. Section 473, subdivision (b) provides that “[t]he court may, upon any terms as
may be just, relieve a party of his or her legal representative from a judgment, dismissal,
order, or other proceeding taken against him or her through his or her mistake,
inadvertence, surprise, or excusable neglect.” It has long been “well established” that the
statute is “to be liberally construed” (Riskin v. Towers (1944) 24 Cal.2d 274, 279), and
section 473, subdivision (b) does not expressly prohibit the court from acting on its own
motion. A court should have the power to rectify mistakes of its staff that contribute to
those of counsel, such as the erroneous advice of the clerks in this case that no default
4
Thus, we need not determine whether the prior judgment against Tah was res
judicata barring her present claims.
4
had been entered. The majority of the reported cases on point support our conclusion.
(Compare Allstate Ins. Co. v. Fisher (1973) 31 Cal.App.3d 391, 396-397 [court properly
set aside default on its own motion], and Stuart v. Alexander (1935) 6 Cal.App.2d 27, 28
[same], with Remainders, Inc. v. Superior Court (1961) 192 Cal.App.2d 411, 412-413
[court cannot grant defendant relief from default on its own motion].) We think vesting
such inherent authority in the trial court is the better rule.
III. DISPOSITION
The judgment is affirmed.
_________________________
Siggins, J.
We concur:
_________________________
Pollak, Acting P.J.
_________________________
Jenkins, J.
5
|
INSERT INTO options (name, value, utcDateCreated, utcDateModified, isSynced)
VALUES ('spellCheckEnabled', 'true', '2018-07-29T18:31:00.874Z', '2018-07-29T18:31:00.874Z', 0);
INSERT INTO options (name, value, utcDateCreated, utcDateModified, isSynced)
VALUES ('spellCheckLanguageCode', 'en-US', '2018-07-29T18:31:00.874Z', '2018-07-29T18:31:00.874Z', 0);
|
using System.Collections.Generic;
using Newtonsoft.Json;
namespace YaR.Clouds.Base.Repos.YandexDisk.YadWeb.Models
{
class YadMovePostModel : YadPostModel
{
public YadMovePostModel(string sourcePath, string destPath, bool force = true)
{
Name = "do-resource-move";
Source = sourcePath;
Destination = destPath;
Force = force;
}
public string Source { get; set; }
public string Destination { get; set; }
public bool Force { get; set; }
public override IEnumerable<KeyValuePair<string, string>> ToKvp(int index)
{
foreach (var pair in base.ToKvp(index))
yield return pair;
yield return new KeyValuePair<string, string>($"src.{index}", WebDavPath.Combine("/disk", Source));
yield return new KeyValuePair<string, string>($"dst.{index}", WebDavPath.Combine("/disk", Destination));
yield return new KeyValuePair<string, string>($"force.{index}", Force ? "1" : "0");
}
}
internal class YadMoveRequestData : YadModelDataBase
{
[JsonProperty("at_version")]
public long AtVersion { get; set; }
[JsonProperty("oid")]
public string Oid { get; set; }
[JsonProperty("type")]
public string Type { get; set; }
}
internal class YadMoveRequestParams
{
[JsonProperty("src")]
public string Src { get; set; }
[JsonProperty("dst")]
public string Dst { get; set; }
[JsonProperty("force")]
public long Force { get; set; }
}
}
|
Active site mapping of amylo-alpha-1,6-glucosidase in porcine liver glycogen debranching enzyme using fluorogenic 6-O-alpha-glucosyl-maltooligosaccharides.
Glycogen debranching enzyme (GDE) has two enzymatic activities, 4-alpha-glucanotransferase and amylo-alpha-1,6-glucosidase. Products with 6-O-alpha-glucosyl structures formed from phosphorylase limit dextrin by the 4-alpha-glucanotransferase activity are hydrolyzed to glucose by the amylo-alpha-1,6-glucosidase activity. Here, we probed the active site of amylo-alpha-1,6-glucosidase in porcine liver GDE using various 6-O-alpha-glucosyl-pyridylamino (PA)-maltooligosaccharides, with structures (Glcalpha1-4)(m)(Glcalpha1-6)Glcalpha1-4(Glcalpha1-4)(n)GlcPA (GlcPA, 1-deoxy-1-[(2-pyridyl)amino]-D-glucitol residue). Fluorogenic dextrins were prepared from 6-O-alpha-glucosyl-alpha-, beta-, or gamma-cyclodextrin through partial acid hydrolysis, followed by fluorescent tagging of the reducing-end residues of the hydrolysates and separation by gel filtration and reversed-phase HPLC. Porcine liver GDE hydrolyzed dextrins with the structure Glcalpha1-4(Glcalpha1-6)Glcalpha1-4Glc to glucose and the corresponding PA-maltooligosaccharides, whereas other dextrins were not hydrolyzed. Thus, substrates must have two glucosyl residues sandwiching the isomaltosyl moiety to be hydrolyzed. The rate of hydrolysis increased as m increased and reached maximum at m = 4. The rates were the highest when n = 1 but did not vary much with changes in n. Of the dextrins examined, Glcalpha1-4Glcalpha1-4Glcalpha1-4Glcalpha1-4(Glcalpha1-6)Glcalpha1-4Glcalpha1-4GlcPA (6(3)-O-alpha-glucosyl-PA-maltoheptaose) was hydrolyzed most rapidly, suggesting that it fits the best in the amylo-alpha-1,6-glucosidase active site. It is likely that the active site accommodates 6(2)-O-alpha-glucosyl-maltohexaose and that the interactions of seven glucosyl residues with the active site allow the most rapid hydrolysis of the alpha-1,6-glucosidic linkage of the isomaltosyl moiety.
|
The clinical significance of the caloric second phase provoked by positional change in vertiginous patients.
The reversal phase of caloric nystagmus is provoked when the lateral semicircular canal in a patient is reoriented from a vertical to a horizontal plane at the cessation of the caloric first phase, which we called the provoked caloric second phase. In investigating the clinical significance of the provoked caloric second phase, we recruited 102 vertiginous patients who had measurable caloric responses in both ears but no disorders of the central nervous system. We recorded the provoked caloric second phase in 188 (92%) of 204 ears in 102 patients. The average maximum slow-phase velocity of the caloric first phase was 26.9 degrees per second, and that of the provoked caloric second phase was 5.0 degrees per second. The maximum slow-phase velocity of the provoked caloric second phase correlated with that of the foregoing caloric first phase (r = -.84). Thus, we consider that the provoked caloric second phase is influenced largely by the foregoing caloric first phase. Furthermore, in the patients who responded normally to caloric stimulation, the directional preponderance of the provoked caloric second phase correlated with the directional preponderance of optokinetic after-nystagmus (r = .64). Hence, we conclude that the provoked caloric second phase reflects central vestibular asymmetry in patients with normal peripheral vestibular function.
|
NCOA6
Nuclear receptor coactivator 6 is a protein that in humans is encoded by the NCOA6 gene.
Function
The protein encoded by this gene is a transcriptional coactivator that can interact with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has been shown to be involved in the hormone-dependent coactivation of several receptors, including prostanoid, retinoid, vitamin D3, thyroid hormone, and steroid receptors. The encoded protein may also act as a general coactivator since it has been shown to interact with some basal transcription factors, histone acetyltransferases, and methyltransferases.
Interactions
NCOA6 has been shown to interact with:
ASCL2 and
Activating transcription factor 2,
Androgen receptor,
CREB-binding protein,
DNA-PKcs,
E2F1,
EP300,
Estrogen receptor alpha,
Estrogen receptor beta,
HBXIP,
HIST2H3C,
HSF1,
Ku70,
Ku80,
Liver X receptor beta,
MLL3,
RBBP5,
Retinoblastoma protein,
Retinoic acid receptor alpha,
Retinoid X receptor alpha,
Src,
TGS1,
TUBA4A,
TUBB,
Thyroid hormone receptor alpha, and
Thyroid hormone receptor beta.
See also
Transcription coregulator
References
Further reading
External links
Category:Gene expression
Category:Transcription coregulators
Category:Human proteins
|
CCI: Devil’s Due Presents Milo Ventimiglia & Russ Cundiff
Though the panel was mainly focusing on Divide Productions’ Milo Ventimiglia and Russ Cundiff, Devil’s Due Publishing moderator and marketing director Brian Warmonth started by making a few announcements for the fans in attendance at Comic-Con International in San Diego. On the panel were Humanoids’ Pierre Spengler and Larry Hama, Josh Blaylock, Ryan Schifrin, Tres Stamos, Mark Powers and Steve Stern.
The first announcement was that Humanoids Publishing would be working with Devil’s Due on bringing over some previously non-translated European comics. The first series they will be Humanoids’ “I Am Legion” with art by “Astonishing X-Men” artist John Cassaday. While the first volume of “I Am Legion” was translated to English already, Devil’s Due plans on publishing all the remaining volumes.
Warmonth also followed up on the previous announcement that Devils’ Due would be publishing a Bionic Commando comic book based on the Capcom video game by telling the audience they were also going to be two more books based on Capcom games, “Monster Hunter” and “Dark Void.” Both titles will be making their way to comic book shops this winter.
In an announcement fresh from Brian Warmonth’s iPhone, Devil’s Due will partner with “Scream” creator Kevin Williamson on a new horror/crime thriller comic book called “Shadows” that would be premiering in spring ’09. The title has been in the works for a very long time but they had only just received confirmation on it mere moments before the panel had started.
Cover for "Hack/Slash" #15, featuring the Re-Animator
Warmonth then showed some slides and discussed some titles that people should keep an eye out on such as “Hack/Slash.” This fall, “Hack/Slash” crossovers with “Re-Animator” and will explore the origins of Cassie Hack’s family. Warmonth pointed out that not only would this story be in continuity with “Hack/Slash” but it would also be in continuity with the “Re-Animator” films as well. He also reminded fans that may have missed the “Hack/Slash” annual it was now available and included the webcomic creator Tim Seeley created for Suicide Girls (Cassie Hack is the only fictional Suicide Girl on the popular site).
Warmonth continued by talking about “The Corps,” a new book from Rick Remender and Robert Carlos coming out in October 2008. Talking about Remender, Warmonth said, “He has this fantastic series called ‘Fear Agent’ that’s not by us but he’s coming over to do another series equally as fantastic.”
Also coming out this August, “Voltron: A Legend Forged” #2, written by Josh Blaylock and artwork by Mike Bear. The story delves into the origins of Voltron. Fans of the “Halloween: Night Dance” miniseries, now available as a trade paperback, should look forward to a new “Halloween” one shot also available this August. The giant-sized issue will be a collection of new “Halloween” stories all written by Stefan Hutchinson, the writer of “Halloween: Night Dance.”
The next slide that came up was for “Mercy Sparx,” Josh Blaylock’s creator-owned property about a devil girl who is sent to hunt down fallen angels. The next slide was one for the new comic book series, “Dawn Of The Dread Force”, which is being drawn by many of the artists that worked on Dreamwave’s Transformers series and will be out this Winter.
Cover for "Hack/Slash Omnibus"
At this point, the slide for Larry Hama and R.A. Salvatore’s “Spooks: Omega Team” came up. “It’s an elite U.S. Combat team, they’re not fighting terrorists they’re fighting supernatural beings,” Hama said, “so it’s like G.I. Joe versus monsters.” Hama is looking forward to this project as it gives him the chance to do the military in a really gritty way without a lot of the restrictions he has had in the past. “If you like telepathic fish monsters with fangs in the Amazon jungle, you’ll like ‘Spooks.’”
It was then announced that Barry Josephson (“Enchanted”) was on board to produce a “Spooks” feature film and to look forward to more announcements about the film in the near future.
Stamos then introduced Steve Stern, co-creator of “Zen: Intergalactic Ninja,” who took the time to give the audience a refresher course on the origin of Zen. Created back in 1987 with Dan Cote, Zen was a genetic experiment that was deemed a failure that, instead of being destroyed, was ejected into space and raised by the Masters of Om becoming their greatest acolyte. Stern then announced that Joe Casey would be writing the new Zen book at Devil’s Due, which would have covers by such artists as Jae Lee, Sam Keith and Mike Mignola. There are also going to be some trade paperbacks collecting classic Zen comics, the first being available in November. The first trade will include such stories as “The Jewel of Forgetfulness” the first Zen story that Stern and Cote created, and “The Rawhead Saga” which has Zen up against an irradiated terrorist.
Cover for "Hack/Slash Annual" featuring the Suicide Girls
Stamos then introduced Ventimiglia and Cundiff to cheers from the audience. Ventimiglia started talking about the book “Rest” and how excited he is for the audience to get the chance to read it as he is a hard critic and he loves the book. Mark Powers, who is adapting the story of “Rest” from a screenplay, then went into detail about what the book is about, citing the main character’s “relatability” as one of the drawing points of the title. “The main character is John Barret, a very normal guy in his mid-20s or so, works in New York City, lives in New York City” Powers said. “And basically spends every waking hour working, getting to work, getting home from work. Really giving up all his hopes and dreams just to keep things going. I think everyone here will understand what that feels like.”
“What happens with John is that he becomes involved in a program that’s testing a drug so you don’t have to sleep anymore,” Powers elaborated. “Now what it basically does is [give] extra time. It’s the most valuable commodity there is in life and John is at a point in his life where he is beginning to realize that time is limited.” Of course, there is always a cost and the cost of using this drug is what is going to be explored in the comic.
Stamos then asked Ventimiglia what it was about the project that made him devote what little free time he had to working on “Rest.” Ventimiglia cited the strength of the script and, as Powers noted, the relatability of the main character as the main reasons that he wanted to see the story told. When asked about the likeness of John Barret to himself, Ventimiglia joked that he thought it looked more like his partner Russ then himself.
Art for the 99¢ debut of "Rest"
The floor was then opened up to questions from the audience. The first fan asked about the origins of “Rest” and Ventimiglia explained that it was originally a script by Mike O’Sullivan which was retooled by the Ventimiglia, Powers and Cundiff.
Another fan asked if it was still the plan to turn “Rest” into a movie or TV show. “That’s the new way of movie development nowadays, ‘Let’s make a comic and turn it into a movie,’” Ventimiglia said. “That’s always a possibility but we are never going to limit ourselves to movies or TV or digital short. I say we just make a series of commercials,” he joked, “I am very proud of my very early commercial work and I want to put this on my reel.” In the end though, Ventimiglia said that all he was interested in was making a great book.
An audience member who asked the length of the series was told that it would be five issues and then eventually collected into a trade paperback. The next question was what he would do if he didn’t have to sleep, to which Ventimiglia joked, “I think I am there right now.” On a more serious note, Ventimiglia had lots of things he would do with the extra time, including spending time with his family and loved ones.
When asked what Ventimiglia found to be the greatest challenge crossing over to the comic book world from televisionl he admitted it was just being accepted. “The show that I work on, ‘Heroes,’ we pretty much got our successes here at Comic-Con,” Ventimiglia said before turning to his father and asking him about the comic shop he used to go to back when he was ten. “For me, it’s about being accepted into the community and understanding that this isn’t vanity, this isn’t more anything than just wanting to make a great comic and contribute to the world that actually did give me a great deal of enjoyment growing up.”
Cover art for "Rest"
Another fan questioned if the interaction between the John Baret and his family and friends would be shown over the course of the “Rest” miniseries. “It’s definitely a big part of the evolution that John goes through,” Powers said.
The next question asked was how the lack of sleep would affect the characters’ dream process in “Rest.” “If you can’t sleep you can’t dream, if you can’t dream what are you living your life for?” Ventimiglia responded. Powers elaborated further that in the book you would see the characters go through what only could be described as waking nightmares and dreams.
“As the series goes on, we are kind of blurring the line between what is real and what isn’t. What’s in the real world and what’s in the dream.”
The final question for the panel was asked to Ventimiglia, as the fan was curious what his favorite part of working on the comic book was. “Honest to god, the people I get to work with” Ventimiglia said. “Russ and I are very fortunate to be in the company of everyone who works over at Devil’s Due.” Ventimiglia did add that being able to hold something in his hand that they had all made together was very cool.
|
Q:
Grunt build breaks SVG images
So I have redeveloped my portfolio website using Yeoman with the Yeoman webapp generator. It’s built using Twitter Bootstrap and Sass. Everything works fine except when I use the “grunt build” command to compress my website. When my website is recreated in the “dist” folder I noticed that most of the xml embedded SVG icons on my html pages are broken. I did a comparison with my website in the “app” folder and the SVG code is different. How do I stop grunt from compressing the SVG or how would I change it so that it does not break the SVG icons?
My Gruntfile.js
// Generated on 2014-10-14 using
// generator-webapp 0.5.0
'use strict';
// # Globbing
// for performance reasons we're only matching one level down:
// 'test/spec/{,*/}*.js'
// If you want to recursively match all subfolders, use:
// 'test/spec/**/*.js'
module.exports = function (grunt) {
// Time how long tasks take. Can help when optimizing build times
require('time-grunt')(grunt);
// Load grunt tasks automatically
require('load-grunt-tasks')(grunt);
// Configurable paths
var config = {
app: 'app',
dist: 'dist'
};
// Define the configuration for all the tasks
grunt.initConfig({
// Project settings
config: config,
// Watches files for changes and runs tasks based on the changed files
watch: {
bower: {
files: ['bower.json'],
tasks: ['wiredep']
},
js: {
files: ['<%= config.app %>/scripts/{,*/}*.js'],
tasks: ['jshint'],
options: {
livereload: true
}
},
jstest: {
files: ['test/spec/{,*/}*.js'],
tasks: ['test:watch']
},
gruntfile: {
files: ['Gruntfile.js']
},
sass: {
files: ['<%= config.app %>/styles/{,*/}*.{scss,sass}'],
tasks: ['sass:server', 'autoprefixer']
},
styles: {
files: ['<%= config.app %>/styles/{,*/}*.css'],
tasks: ['newer:copy:styles', 'autoprefixer']
},
livereload: {
options: {
livereload: '<%= connect.options.livereload %>'
},
files: [
'<%= config.app %>/{,*/}*.html',
'.tmp/styles/{,*/}*.css',
'<%= config.app %>/images/{,*/}*'
]
}
},
// The actual grunt server settings
connect: {
options: {
port: 9000,
open: true,
livereload: 35729,
// Change this to '0.0.0.0' to access the server from outside
hostname: 'localhost'
},
livereload: {
options: {
middleware: function(connect) {
return [
connect.static('.tmp'),
connect().use('/bower_components', connect.static('./bower_components')),
connect.static(config.app)
];
}
}
},
test: {
options: {
open: false,
port: 9001,
middleware: function(connect) {
return [
connect.static('.tmp'),
connect.static('test'),
connect().use('/bower_components', connect.static('./bower_components')),
connect.static(config.app)
];
}
}
},
dist: {
options: {
base: '<%= config.dist %>',
livereload: false
}
}
},
// Empties folders to start fresh
clean: {
dist: {
files: [{
dot: true,
src: [
'.tmp',
'<%= config.dist %>/*',
'!<%= config.dist %>/.git*'
]
}]
},
server: '.tmp'
},
// Make sure code styles are up to par and there are no obvious mistakes
jshint: {
options: {
jshintrc: '.jshintrc',
reporter: require('jshint-stylish')
},
all: [
'Gruntfile.js',
'<%= config.app %>/scripts/{,*/}*.js',
'!<%= config.app %>/scripts/vendor/*',
'test/spec/{,*/}*.js'
]
},
// Mocha testing framework configuration options
mocha: {
all: {
options: {
run: true,
urls: ['http://<%= connect.test.options.hostname %>:<%= connect.test.options.port %>/index.html']
}
}
},
// Compiles Sass to CSS and generates necessary files if requested
sass: {
options: {
sourcemap: true,
loadPath: 'bower_components'
},
dist: {
files: [{
expand: true,
cwd: '<%= config.app %>/styles',
src: ['*.{scss,sass}'],
dest: '.tmp/styles',
ext: '.css'
}]
},
server: {
files: [{
expand: true,
cwd: '<%= config.app %>/styles',
src: ['*.{scss,sass}'],
dest: '.tmp/styles',
ext: '.css'
}]
}
},
// Add vendor prefixed styles
autoprefixer: {
options: {
browsers: ['> 1%', 'last 2 versions', 'Firefox ESR', 'Opera 12.1']
},
dist: {
files: [{
expand: true,
cwd: '.tmp/styles/',
src: '{,*/}*.css',
dest: '.tmp/styles/'
}]
}
},
// Automatically inject Bower components into the HTML file
wiredep: {
app: {
ignorePath: /^\/|\.\.\//,
src: ['<%= config.app %>/index.html'],
exclude: ['bower_components/bootstrap-sass-official/assets/javascripts/bootstrap.js']
},
sass: {
src: ['<%= config.app %>/styles/{,*/}*.{scss,sass}'],
ignorePath: /(\.\.\/){1,2}bower_components\//
}
},
// Renames files for browser caching purposes
rev: {
dist: {
files: {
src: [
'<%= config.dist %>/scripts/{,*/}*.js',
'<%= config.dist %>/styles/{,*/}*.css',
'<%= config.dist %>/images/{,*/}*.*',
'<%= config.dist %>/styles/fonts/{,*/}*.*',
'<%= config.dist %>/*.{ico,png}'
]
}
}
},
// Reads HTML for usemin blocks to enable smart builds that automatically
// concat, minify and revision files. Creates configurations in memory so
// additional tasks can operate on them
useminPrepare: {
options: {
dest: '<%= config.dist %>'
},
html: '<%= config.app %>/index.html'
},
// Performs rewrites based on rev and the useminPrepare configuration
usemin: {
options: {
assetsDirs: ['<%= config.dist %>', '<%= config.dist %>/images']
},
html: ['<%= config.dist %>/{,*/}*.html'],
css: ['<%= config.dist %>/styles/{,*/}*.css']
},
// The following *-min tasks produce minified files in the dist folder
imagemin: {
dist: {
files: [{
expand: true,
cwd: '<%= config.app %>/images',
src: '{,*/}*.{gif,jpeg,jpg,png}',
dest: '<%= config.dist %>/images'
}]
}
},
svgmin: {
dist: {
files: [{
expand: true,
cwd: '<%= config.app %>/images',
src: '{,*/}*.svg',
dest: '<%= config.dist %>/images'
}]
}
},
htmlmin: {
dist: {
options: {
collapseBooleanAttributes: true,
collapseWhitespace: true,
conservativeCollapse: true,
removeAttributeQuotes: true,
removeCommentsFromCDATA: true,
removeEmptyAttributes: true,
removeOptionalTags: true,
removeRedundantAttributes: true,
useShortDoctype: true
},
files: [{
expand: true,
cwd: '<%= config.dist %>',
src: '{,*/}*.html',
dest: '<%= config.dist %>'
}]
}
},
// By default, your `index.html`'s <!-- Usemin block --> will take care
// of minification. These next options are pre-configured if you do not
// wish to use the Usemin blocks.
// cssmin: {
// dist: {
// files: {
// '<%= config.dist %>/styles/main.css': [
// '.tmp/styles/{,*/}*.css',
// '<%= config.app %>/styles/{,*/}*.css'
// ]
// }
// }
// },
// uglify: {
// dist: {
// files: {
// '<%= config.dist %>/scripts/scripts.js': [
// '<%= config.dist %>/scripts/scripts.js'
// ]
// }
// }
// },
// concat: {
// dist: {}
// },
// Copies remaining files to places other tasks can use
copy: {
dist: {
files: [{
expand: true,
dot: true,
cwd: '<%= config.app %>',
dest: '<%= config.dist %>',
src: [
'*.{ico,png,txt}',
'images/{,*/}*.webp',
'{,*/}*.html',
'styles/fonts/{,*/}*.*'
]
}, {
src: 'node_modules/apache-server-configs/dist/.htaccess',
dest: '<%= config.dist %>/.htaccess'
}, {
expand: true,
dot: true,
cwd: '.',
src: 'bower_components/bootstrap-sass-official/assets/fonts/bootstrap/*',
dest: '<%= config.dist %>'
}]
},
styles: {
expand: true,
dot: true,
cwd: '<%= config.app %>/styles',
dest: '.tmp/styles/',
src: '{,*/}*.css'
}
},
// Run some tasks in parallel to speed up build process
concurrent: {
server: [
'sass:server',
'copy:styles'
],
test: [
'copy:styles'
],
dist: [
'sass',
'copy:styles',
'imagemin',
'svgmin'
]
}
});
grunt.registerTask('serve', 'start the server and preview your app, --allow-remote for remote access', function (target) {
if (grunt.option('allow-remote')) {
grunt.config.set('connect.options.hostname', '0.0.0.0');
}
if (target === 'dist') {
return grunt.task.run(['build', 'connect:dist:keepalive']);
}
grunt.task.run([
'clean:server',
'wiredep',
'concurrent:server',
'autoprefixer',
'connect:livereload',
'watch'
]);
});
grunt.registerTask('server', function (target) {
grunt.log.warn('The `server` task has been deprecated. Use `grunt serve` to start a server.');
grunt.task.run([target ? ('serve:' + target) : 'serve']);
});
grunt.registerTask('test', function (target) {
if (target !== 'watch') {
grunt.task.run([
'clean:server',
'concurrent:test',
'autoprefixer'
]);
}
grunt.task.run([
'connect:test',
'mocha'
]);
});
grunt.registerTask('build', [
'clean:dist',
'wiredep',
'useminPrepare',
'concurrent:dist',
'autoprefixer',
'concat',
'cssmin',
'uglify',
'copy:dist',
'rev',
'usemin',
'htmlmin'
]);
grunt.registerTask('default', [
'newer:jshint',
'test',
'build'
]);
};
A:
There are a few issues with svgmin, for example one with removeUnknownsAndDefaults and one with collapseGroups. I disabled aforementioned plugin in my grunt task and my svg files are ok now, but it depends on your svg files and exactly what plugin is breaking them. Try the following config and check if it fixes your problem:
svgmin: {
options: {
plugins: [{
collapseGroups: false
}, {
removeUnknownsAndDefaults: false
}]
},
dist: {
files: [{
expand: true,
cwd: '<%= path.app %>/images',
src: '{,*/}*.svg',
dest: '<%= path.dist %>/images'
}]
}
}
If it doesn't and you don't want to spend time and find the svgmin plugin which causes the issues, simply remove svgmin task from concurrent:dist task but don't forget to add 'images/{,*/}*.{svg}' to copy:dist task inside src array so they get copied to dist/ folder.
|
Fitness marketers know what buzzwords make consumers believe their product is the best for a "tighter core." But c'mon, most of them just want your cash.
Save yourself the dough and use that thing you dry your dishes with for a cheap but intense core workout.
Brad Lloyd, a personal trainer in New York City, has developed a workout technique using just two dishrags. The man knows fitness; prior to his nine years of personal training experience he was a linebacker for Eastern Michigan University.
See also: How to use your local park for a kickass workout
Image: Mashable Brittany Herbert
The "rag training" moves consist of repeatedly sliding a rag with your hands or feet to stretch and contract muscles. "The result is a complete full-body strengthen workout that challenges core balance, improves flexibility and movement control by the forces acting upon the body and the rag, and helps one’s muscular toning," says Lloyd. He maintains that regular rag training can also help body posture, an important part of a strong body.
The workout is for any level of fitness. All you need is enough floor space for your height and two regular rags. It sounds simple, but this is by no means an "easy" workout.
1. Sliding Reverse Lunge
Foot on rag, slide foot back and bend your opposite knee to form a 90-degree angle between your thigh and calf, while lowering your knee toward the floor. Slide yourself upward with your thigh muscles and return back to the starting position.
Focus: Quadriceps, hamstrings Secondary: Glutes, lower back, abdominals and obliques
2. Lateral Sliding Lunge
Stand up straight with one foot on the rag and the other placed firmly on the ground. Push your hips back and slide out to your side as you lower hips and bend your other knee. Place both hands on your hips or raise your arms out in front of your chest as you descend. Keep your weight on the heel of your supporting foot.
Focus: Hip abductors, adductors Secondary: Glutes, lower back, abdominals and obliques
3. Floor Knee Tuck
Image: Mashable Brittany Herbert
Get into a pushup position with two rags under both feet, toes down. Slide your knees and feet under your body and chest until the knees cannot bend any further. Slowly straighten your knees and hips from under you back to the starting position.
Focus: Lower, upper, and transverse abdominals, obliques and lower back Secondary: Biceps, triceps and shoulders
4. Circle Knee Tucks
Get into a pushup position with two rags under both feet, toes down. Slide your knees and feet under your body and chest in a clockwise/circular motion until the knees cannot bend any further. Slowly straighten your knees and hips from under you, back to the starting position.
Focus: Hip abdutor and adductors Secondary: Gluteus, lower back, lower and transverse abdominals, obliques
5. Knee Curls (Beginner)
Lie in an upright position resting on your forearms with two rags under both feet, heels down. While planting your tailbone down, slide your feet and legs under, toward your lower back. Slowly straighten your knees knees and hips from under you, back to the starting position.
Focus: Hamstrings, gluteus Secondary: Lower back
5A. Knee Curls (Advanced)
Lie in an upright position resting on hands or forearms with your tailbone raised, holding your body up. Slide your feet and legs under towards your low back. Slowly straighten your knees knees and hips from under you back to the starting position.
Focus: Hamstrings, gluteus Secondary: Lower back
6. Saws (Beginner)
From a kneeling position, place two rags under both hands, making sure your shoulders and hips maintain a neutral alignment and arms straight. Grind into the floor with the palm of your hands and slide the rags forward as you lower your hips toward the floor until your chest reaches the floor. At that point, slide one arm in, under your chest, then the opposite arm. With both arms, push your body back into the starting position.
Focus: Shoulders, biceps, triceps Secondary: Upper and lower abdominals
6A. Saws (Intermediate)
From a kneeling position, place two rags under both hands making sure your shoulders and hips maintain a neutral alignment and arms straight. Grind into the floor with the palm of your hands and slide the rags forward as you lower your hips toward the floor until your chest reaches the floor. At that point, slide both arms in simultaneously under your chest. Repeat the cycle in a fluid motion.
Focus: Shoulders, biceps, triceps Secondary: Upper and lower abdominals
6B. Saws (Advanced)
Image: Mashable Brittany Herbert
From a pushup position, place two rags under both hands making sure your shoulders and hips maintain a neutral alignment and arms straight. Grind into the floor with the palm of your hands and slide the rags forward as you lower your hips toward the floor until your chest reaches the floor. At that point, slide both arms in simultaneously, under your chest. Repeat the cycle in a fluid motion.
Focus: Shoulders, biceps, triceps Secondary: Upper and lower abdominals
7. Chest Fly
From a pushup or kneeling position, place two rags under both hands making sure your shoulders and hips maintain a neutral alignment and arms straight. Grind into the floor with the palm of your hands and slide the rags out to the sides away from the body, keeping your arms moving out across the nipple line, allowing your hips to move towards the floor until your chest reaches the bottom. At that point, slide both arms in simultaneously, under your chest. Repeat the cycle in a fluid motion.
Focus: Shoulders, biceps, triceps Secondary: Upper and lower abdominals
8. Dynamic Chest Fly
Image: Mashable Brittany Herbert
From a pushup or kneeling position, place two rags under both hands making sure your shoulders and hips maintain a neutral alignment and arms straight. Grind into the floor with the palm of your hands and slide one rag out to the side while simultaneously sliding one away from the body up toward your head. At that point, slide both arms in simultaneously, under your chest. Repeat the cycle in a fluid motion.
For questions or to contact Brad Lloyd, see hisFacebook page or email [email protected].
Workout descriptions edited for brevity and clarity.
|
Sadio Mane is facing a spell on the sidelines after sustaining a hamstring injury on international duty, Liverpool FC can confirm.
The winger was substituted 89 minutes into Senegal's 2-0 World Cup qualifying win over the Cape Verde Islands on Saturday.
And it has now been confirmed that he picked up an injury during that fixture that could keep him out of action for up to six weeks.
Mane, whose lay-off will commence when Manchester United visit Anfield on Saturday, has scored three goals in four Premier League appearances this term.
|
Q:
Jsoup - read from an html url where code is hidden
I'm trying to using the jsoup library to get 'li' from a website. The problem is this:
If I open the source of website with CTRL+U(which is the same read by jsoup), the 'ul' tag is hidden.
if I open the code with the fuction "inspect code" of google chrome,'li' are shown.
Posting the code is not necessary; I only want to know how can access to this 'li' with jsoup or other java free libraries, Whereas in the source code(and through jsoup) these informations are hidden.
The site is https://farmaci.agenziafarmaco.gov.it/bancadatifarmaci/cerca-farmaco and try to search something(i.e. Tachi)
A:
The problem with Jsoup is that it won't handle scripts. It is just getting html as it is before the AJAX code is executed.
You can use something like HtmlUnit, which is basically a GUI-less browser. So, it can handle scripts.
You can try something like this after getting the HtmlUnit library:
String url = "https://farmaci.agenziafarmaco.gov.it/bancadatifarmaci/cerca-farmaco?search=Tachi";
try(final WebClient webClient = new WebClient()) {
final HtmlPage page = webClient.getPage(url);
final HtmlUnorderedList list = page.getHtmlElementById("ul_farm_results");
System.out.println(list.asText());
}
I couldn't check the code as the website's certificate is improperly configured and I didn't want to import it's certificate. You may want to take a look at this to resolve the certificate errors.
|
Http.sys registry settings for Windows
Summary
In Windows Server 2003 and later versions, Http.sys is the kernel mode driver that handles HTTP requests. Several registry values can be configured according to specific requirements. The table in the "More Information" section contains the following information about these registry values:
Registry key names
Default values
Valid value ranges
Registry key functions
WARNING codes (where applicable)
Note See the "WARNING Codes" section for information about potential risks when you create and configure registry values by using settings other than the default settings.
This article is intended for advanced users and assumes knowledge of the registry and of the risks that are involved when the registry is changed.
More Information
Important This section, method, or task contains steps that tell you how to modify the registry. However, serious problems might occur if you modify the registry incorrectly. Therefore, make sure that you follow these steps carefully. For added protection, back up the registry before you modify it. Then, you can restore the registry if a problem occurs. For more information about how to back up and restore the registry, click the following article number to view the article in the Microsoft Knowledge Base:
Preallocate nonpaged pool memory. By default, the HTTP service stops accepting connections when less than 20 megabytes (MB) of nonpaged pool memory is available. After you add this value to the registry, the HTTP service stops accepting connections when less than 8 MB of nonpaged pool memory is available. Setting this registry value may reduce the number of "Connections_refused" and 503 errors in the Httperr.log file.
Note This applies only to Windows Server 2003.
0
EnableNonUTF8
1
Boolean
If zero, Http.sys accepts only UTF-8-encoded URLs. If nonzero, Http.sys also accepts ANSI- or DBCS-encoded URLs in requests.
0
FavorUTF8
1
Boolean
If nonzero, Http.sys always tries to decode a URL as UTF-8 first; if that conversion fails and EnableNonUTF8 is nonzero, Http.sys then tries to decode it as ANSI or DBCS. If zero (and EnableNonUTF8 is nonzero), Http.sys tries to decode it as ANSI or DBCS; if that is not successful, it tries a UTF-8 conversion.
0
MaxBytesPerSend
65536
1-0xFFFFF (Bytes)
Overrides the TCP window size that is used by Http.sys. A higher value may enable higher download speeds in network environments that have high bandwidth and high latency.
Note This applies only to Windows Server 2003.
0
MaxConnections
MAX_ULONG
1024(1k) – 2031616 (2MB) connections
Overrides the MaxConnections calculation in the driver. This is primarily a function of memory.
1
MaxEndpoints
0
0 - 1024
The maximum number of current endpoint objects that are permitted. The default value of zero implies that the maximum is computed from available memory.
Note This applies only to Windows Server 2003.
1
MaxFieldLength
16384
64 - 65534 (64k - 2) bytes
Sets an upper limit for each header. See MaxRequestBytes. This limit translates to approximately 32k characters for a URL.
1
MaxRequestBytes
16384
256 - 16777216 (16MB) bytes
Determines the upper limit for the total size of the Request line and the headers. Its default setting is 16KB. If this value is lower than MaxFieldLength, the MaxFieldLength value is adjusted.
1
PercentUAllowed
1
Boolean
If nonzero, Http.sys accepts the %uNNNN notation in request URLs.
0
UrlSegmentMaxCount
255
0 - 16,383 segments
Maximum number of URL path segments. If zero, the count bounded by the maximum value of a ULONG.
1
UriEnableCache
1
Boolean
If nonzero, the Http.sys response and fragment cache is enabled.
0
UriMaxUriBytes
262144 (bytes)
4096(4k) – 16777216(16MB) bytes
Any response that is greater than this value is not cached in the kernel response cache.
13
UriScavengerPeriod
120 (seconds)
10 - 0xFFFFFFFF seconds
Determines the frequency of the cache scavenger. Any response or fragment that has not been accessed in the number of seconds equal to UriScavengerPeriod is flushed.
12
UrlSegmentMaxLength
260
0 - 32,766 chars
Maximum number of characters in a URL path segment (the area between the slashes in the URL). If zero, it is the length that is bounded by the maximum value of a ULONG.
1
You may experience slow performance in Internet Information Services (IIS) 6.0 when Internet Server API (ISAPI) applications or Common Gateway Interface (CGI) applications that are hosted on IIS 6.0 send responses. If you experience this issue, you can add the MaxBufferedSendBytes DWORD value to the registry.For more information about this issue, click the following article number to view the article in the Microsoft Knowledge Base:
By default, the AIA hints are not followed during chain validation when IIS is configured to use Client Certificates. This behavior is for performance and security reasons. For example, this behavior can help prevent DoS attacks. However, this behavior can also lead to unexpected certificate rejections when AIA retrieval is needed. To override this behavior, you can set the DWORD parameter CertChainCacheOnlyUrlRetrieval to 0 (zero) under the "HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\HTTPFilter\Parameters" registry key.
Not applicable
WARNING codes
0: No risks.
1: Changing this registry key is considered extremely dangerous. This key causes Http.sys to use more memory and may increase vulnerability to malicious attacks.
2: A low value may cause the cache to be flushed more frequently. If this behavior occurs, it may affect performance.
3: A low value may affect performance for static content.
Changes that are made to the registry will not take effect until you restart the HTTP service. Additionally, you may have to restart any related IIS services.
To restart the HTTP service, type and all related IIS services, follow these steps:
Click Start, click Run, type Cmd, and then click OK.
At the command prompt, type net stop http, and then press Enter.
At the command prompt, type net start http, and then press Enter.
At the command prompt, type net stop iisadmin /y, and then press Enter.
Note Any IIS services that depend on the IIS Admin Service service will also be stopped. Notice the IIS services that are stopped when you stop the IIS Admin Service service. You will restart each service in the next step.
Restart the IIS services that were stopped in step 4. To do this, type net start servicename at the command prompt and then press Enter. In the command, servicename is the name of the service that you want to restart. For example, to restart the World Wide Web Publishing Service service, type net start "World Wide Web Publishing Service", and then press Enter.
|
NRA Board Member Ted Nugent Compares Obama To A Nazi On Conspiracy Theorist's Radio Show
National Rifle Association board member Ted Nugent made inflammatory comments about President Obama and said Cubans "haven't figured out personal hygiene" during an appearance on an online radio show hosted by 9/11 truther and conspiracy theorist Pete Santilli.
Santilli, who has promoted conspiracy theories relating to the December 14 massacre at Sandy Hook Elementary School that left 20 children and six educators dead, does little to hide the fact that he is a conspiracy theorist. The recorded introduction to his radio show says that it is broadcast from "FEMA region nine" and that the show's purpose is to counter "the New World Order, the global elite and their eugenics agenda."
In an article posted on his website, Santilli shared a conspiracy theory about the Sandy Hook shooting created by "911 truth Switzerland" that the massacre was a "satanic sacrifice" and postedimages to his website that suggest the shooting was predicted by a map seen in the Batman film The Dark Knight Rises.
Here are five outrageous moments from Nugent's appearance on The Pete Santilli Show:
Nugent: Cubans "Haven't Figured Out Personal Hygiene Yet"
Discussing his lifestyle which involves abstaining from drugs and alcohol, Nugent recommended avoiding "fat chicks" and said that he would not "chew on a Cuban" because "they haven't learned personal hygiene yet":
SANTILLI: You were inducted into the National Bow Hunter's Hall of Fame, by the way.
NUGENT: Yeah, you know I didn't invent the middle finger but I did perfect it in my youth. So I know that if you believe animals have rights, I promise I will kill an extra hundred just for you. Yeah, you know, I was raised to be honest and accountable and I'm sure you are on the phone right now, Pete, with the only guy you will ever talk to that has planted thousands and thousands, tens of thousands of trees. It's annual spring ritual at the Nugent house.
You see, I never poisoned my body. My parents taught me that my gift of life is embodied in the sacred temple. So no drugs, no alcohol, no tobacco and no fat chicks. Stuff will kill you, Pete, I'm telling you, it's deadly. But I have been known to chew on a Cuban, that's a cigar. I wouldn't chew on a Cuban, they haven't figured out personal hygiene yet. But I do chew on a cigar once in a while when I shoot my machine gun around the camp fire.
Nugent Compares Obama To A Nazi
In discussing how the president "pretended to show respect and honor" when paying tribute to veterans at the Vietnam Memorial Wall, Nugent compared Obama to "a German in 1938 pretending to respect the Jews and then going home and putting on his brown shirt and forcing his neighbors onto a train to be burned to death":
SANTILLI: Do you think right now we are in the final throes of implementing communism?
NUGENT: Well, you know, let's put it in the most heartbreaking frame, shall we? And you may have never heard this before, Pete, but I want everyone to listen, even the people that might be listening that hate me and want me to shut up. Just take a deep breath and give me a second here.
The President of the United States Barack Hussein Obama went to the Vietnam Memorial Wall. He did his smoke and mirrors scam. He pretended to show respect and honor, 58,000 American warriors who died fighting communism. And then he hired, appointed and associates with communists.
If you can't see through the dishonesty and the scamming of this president with that scenario fresh in your mind, then that's literally like, I guess that would be like, I don't know, a German in 1938 pretending to respect the Jews and then going home and putting on his brown shirt and forcing his neighbors onto a train to be burned to death.
So we really have a rotten, rotten man in the White House who I am convinced hates America, hates individuality.
Nugent Wanted To "Sock" Michael Moore "In The Throat" For NRA President Interview
During a commercial break, Santilli continued to broadcast his conversation with Nugent. In the recording, Nugent can be heard saying of filmmaker Michael Moore, "the man has no soul" and added that if he would have been there when Moore interviewed then-NRA president Charlton Heston for his Bowling For Columbine documentarythat he would have "socked [Moore] in the throat."
After Santilli Suggests U.S. Is Arming Al Qaeda, Nugent Says "The Devil Got [Obama] Voted Into The Presidency"
Reacting to Santilli's claim that the government is arming Al Qaeda in Syria, Nugent claimed that "the devil got [Obama] elected" and that the president is "pure evil":
SANTILLI: Our politicians like [Republican Sens.] John McCain and Lindsay Graham and this communist-in-chief Barack Obama facilitating, supplying the Syrian rebels who are Al Qaeda. How do we stop these guys from doing this? I understand the War on Terror, going after Al Qaeda. But what do we say to all of the men and women who have given their lives trying to kill Al Qaeda and now we are supplying them. What would you say to McCain and Graham?
NUGENT: The reason the devil got him voted into the presidency, I mean I really believe the guy is just pure evil.
Nugent, who has previously compared Attorney General Eric Holder and Vice President Joe Biden to serial killer and cannibal Jeffrey Dahmer, revived the comparison during a rant that targeted Democratic politicians, current and former Obama administration officials and New York City Mayor Michael Bloomberg:
NUGENT: I've always been on the right path. The fact that the lowest forms of sub-human mongrels hate me, and I can name a few, [Minority Leader] Nancy "You Don't Have To Read This, You Need To Sign It" Pelosi, Michael "The Second Amendment Is About Deer Hunting On Weekends" Bloomberg. I mean, I could go on and on. But you look at the [Democratic Senator] Dianne Feinsteins and the Barack Obama and the gunrunning Eric Holder and the [former Secretary of State] Hillary Clinton who refused to provide basic security for heroes of the American representation in the most dangerous areas of the world. I can go on and on. The criminality of [former White House Chief of Staff] Rahm Emanual and [former White House special advisor] Van Jones and [former Treasury Secretary] Tim Geithner. I have a good idea, Pete, let's appoint a tax cheat as Secretary of Treasury. Hey good idea. Then we will hire Jeffrey Dahmer to take care of the children's playground.
|
ATLANTA--A return trip to Durham, N.C., the site of the Georgia State men's soccer team's first NCAA Tournament appearance in school history, highlights a challenging 2012 fall schedule announced on Monday.
The Panthers battle Duke, which finished last season ranked No. 29 in the final RPI standings, on Sept. 11 at 7 p.m. Later in the month, Georgia State takes on another national power from the ACC when it travels to College Park, Md., for a Sept. 24 showdown against Maryland. The Terrapins posted a 14-4-3 record, earned the No. 4 seed in the NCAA Tournament and finished the year ranked No. 9 in the final NSCAA Coaches Poll.
The Panthers kick-off their 2012 fall slate with two matches in Jacksonville, Fla. Georgia State faces Jacksonville, the alma mater of third-year head coach Brett Surrency, to open its season on Friday, Aug. 24 at 7 p.m. GSU caps the weekend with a match at North Florida at 3 p.m. on Aug. 26.
GSU opens its home schedule against Evansville University of the Missouri Valley Conference on Saturday, Sept. 1 at Panthersville. Admission to all Georgia State soccer matches is free for all fans.
Following the Duke match, GSU battles two local rivals in Georgia Southern at Panthersville (Sept. 14, 4 p.m.) and Mercer in Macon, Ga. (Sept. 16, 7 p.m.). Georgia State begins CAA play on Sept. 22 with a match at Towson (Noon). The first home CAA contest of the 2012 season takes place on Sept. 29 when the Panthers host last year's CAA champions Delaware for a 7 p.m. match.
"We definitely have a difficult fall schedule, but we also have an experienced group of players," Surrency said, "We look forward to each of the challenges this schedule presents."
In total, GSU takes on five NCAA Tournament teams from last season. Including Duke, Maryland and Delaware, Georgia State hosts Old Dominion on Wednesday, Oct. 24 at 7 p.m. and travels to Harrisonburg, Va. to play last year's No. 14 seed in James Madison (Oct. 27, 7 p.m.).
The Georgia State men's soccer team returns to the field for preseason training in early August. The team is coming off a historic season in which it set many program benchmarks, including its highest RPI ranking finish in school history at No. 36. Five newcomers join a squad that returns nine starters from the team that took the field at Duke in last year's NCAA Tournament first round matchup. Visit the men's soccer home page on www.GeorgiaStateSports.com for all the latest news as the team prepares for the 2012 campaign
|
The Offices To Go seating and desking collection is manufactured exclusively in a certified factory, and has been tested to ensure compliance with all applicable industry standards. Signature Series has an exceptional brand value, and its products forge comfort and individual styling. You can feel secure when you select an Offices To Go product.
If you're looking to buy Offices To Go products, you've come to the right place. At Wayfair Supply, we carry a large selection of desk returns and desk accessories as well as many other office, classroom, and commercial products to choose from. Shop Wayfair Supply for all your home office and business essentials. Browse through our extensive collection of Offices To Go products and you're sure to find the right style, color, material, or finish you're looking for. We also have great deals, sales, and low prices on Offices To Go items. If you're a business customer, be sure to take a look at our Premier Program for exclusive discounts and exceptional service.
Looking to buy the best Offices To Go for your office? Can’t find the right Offices To Go Office Suites, Offices To Go Dollies or Offices To Go End Tables? Wayfair Supply can help! Shop Offices To Go for sale by features like price, material and color.
Wayfair Supply offers services like 2-Day shipping and industry brand names to our commercial customers, and has prices for Offices To Go that cater to businesses of all sizes. It’s never been easier to shop for your office,
classroom or small business because now it’s all on one site – Wayfair Supply!
|
package com.tencent.mm.compatible.d;
import android.annotation.SuppressLint;
import android.bluetooth.BluetoothAdapter;
import android.content.Context;
import android.net.wifi.WifiInfo;
import android.net.wifi.WifiManager;
import android.os.Build;
import android.os.Build.VERSION;
import android.provider.Settings.Secure;
import android.telephony.TelephonyManager;
import com.tencent.mm.a.g;
import com.tencent.mm.sdk.platformtools.aa;
import com.tencent.mm.sdk.platformtools.be;
import com.tencent.mm.sdk.platformtools.v;
import java.io.BufferedReader;
import java.io.File;
import java.io.FileFilter;
import java.io.IOException;
import java.io.InputStreamReader;
import java.util.HashMap;
import java.util.Map;
import java.util.Random;
import java.util.regex.Pattern;
public final class p
{
public static n bgN = new n();
public static b bgO = new b();
public static a bgP = new a();
public static u bgQ = new u();
public static z bgR = new z();
public static s bgS = new s();
public static t bgT = new t();
public static x bgU = new x();
private static int bgV = -1;
public static j bgW = new j();
public static o bgX = new o();
public static w bgY = new w();
private static String bgZ = null;
public static String at(Context paramContext)
{
try
{
v.i("MicroMsg.DeviceInfo", "lm: getManufacturer CurrentLanguage is %s", new Object[] { com.tencent.mm.sdk.platformtools.u.jdMethod_do(paramContext) });
if ((bgT == null) || (bgTbhg == null) || (bgTbhg.size() == 0))
{
v.i("MicroMsg.DeviceInfo", "lm: getManufacturer return is %s", new Object[] { Build.MANUFACTURER });
return Build.MANUFACTURER;
}
String str = (String)bgTbhg.get(".manufacturerName." + com.tencent.mm.sdk.platformtools.u.jdMethod_do(paramContext));
v.i("MicroMsg.DeviceInfo", "lm: getManufacturer is %s", new Object[] { str });
paramContext = str;
if (be.kf(str))
{
str = (String)bgTbhg.get(".manufacturerName.en");
v.i("MicroMsg.DeviceInfo", "lm: getManufacturer is %s", new Object[] { str });
paramContext = str;
if (be.kf(str))
{
paramContext = Build.MANUFACTURER;
return paramContext;
}
}
}
catch (Exception paramContext)
{
paramContext = Build.MANUFACTURER;
}
return paramContext;
}
public static String au(Context paramContext)
{
try
{
paramContext = ((TelephonyManager)paramContext.getSystemService("phone")).getSimOperatorName();
return paramContext;
}
catch (Exception paramContext)
{
v.printErrStackTrace("MicroMsg.DeviceInfo", paramContext, "getMobileSPType", new Object[0]);
}
return "";
}
public static void dh(String paramString)
{
v.i("MicroMsg.DeviceInfo", "update deviceInfo %s", new Object[] { paramString });
if ((paramString == null) || (paramString.length() <= 0)) {}
do
{
do
{
return;
} while (paramString.hashCode() == bgV);
bgV = paramString.hashCode();
bgN.reset();
bgO.reset();
bgP.reset();
bgW.reset();
bgQ.reset();
bgR.reset();
bgY.reset();
Object localObject = bgS;
bhc = 0;
bhd = 0;
localObject = bgT;
bhf = "";
bhg = null;
bgUavj = false;
new q();
} while (!q.a(paramString, bgN, bgO, bgP, bgW, bgQ, bgR, bgY, bgS, bgT, bgU));
v.d("MicroMsg.DeviceInfo", "steve: mCameraInfo.mNeedEnhance = " + bgObfr);
}
public static String getAndroidId()
{
String str = Settings.Secure.getString(aa.getContext().getContentResolver(), "android_id");
v.i("MicroMsg.DeviceInfo", "androidid:[%s]", new Object[] { str });
return str;
}
public static String getDeviceID(Context paramContext)
{
if (paramContext == null) {
return null;
}
try
{
paramContext = (TelephonyManager)paramContext.getSystemService("phone");
if (paramContext == null) {
return null;
}
paramContext = paramContext.getDeviceId();
if (paramContext == null) {
return null;
}
paramContext = paramContext.trim();
return paramContext;
}
catch (SecurityException paramContext)
{
v.e("MicroMsg.DeviceInfo", "getDeviceId failed, security exception");
return null;
}
catch (Exception paramContext)
{
for (;;) {}
}
}
public static String getSimCountryIso()
{
Object localObject = (TelephonyManager)aa.getContext().getSystemService("phone");
if (localObject != null)
{
localObject = ((TelephonyManager)localObject).getSimCountryIso();
v.i("MicroMsg.DeviceInfo", "get isoCode:[%s]", new Object[] { localObject });
return (String)localObject;
}
return null;
}
public static String mM()
{
Object localObject = (String)k.my().get(258);
if (localObject != null) {
return (String)localObject;
}
String str = getDeviceID(aa.getContext());
localObject = str;
if (str == null) {
localObject = "1234567890ABCDEF";
}
k.my().set(258, localObject);
return (String)localObject;
}
public static String mN()
{
StringBuilder localStringBuilder;
String str;
if (bgZ == null)
{
localStringBuilder = new StringBuilder();
localStringBuilder.append(Settings.Secure.getString(aa.getContext().getContentResolver(), "android_id"));
str = (String)k.my().get(256);
if (str == null) {
break label161;
}
localStringBuilder.append(str);
str = (String)k.my().get(259);
if (str == null) {
break label178;
}
v.d("MicroMsg.DeviceInfo", "getHardWareId from file " + str);
}
for (;;)
{
localStringBuilder.append(str);
str = localStringBuilder.toString();
bgZ = "A" + g.j(str.getBytes()).substring(0, 15);
v.w("MicroMsg.DeviceInfo", "guid:%s, dev=%s", new Object[] { bgZ, str });
return bgZ;
label161:
str = mQ();
k.my().set(256, str);
break;
label178:
str = Build.MANUFACTURER + Build.MODEL + m.mF();
k.my().set(259, str);
v.d("MicroMsg.DeviceInfo", "getHardWareId " + str);
}
}
public static String mO()
{
Object localObject = (WifiManager)aa.getContext().getSystemService("wifi");
if (localObject == null) {}
for (localObject = null; localObject != null; localObject = ((WifiManager)localObject).getConnectionInfo()) {
return ((WifiInfo)localObject).getMacAddress();
}
return null;
}
public static String mP()
{
String str = null;
BluetoothAdapter localBluetoothAdapter = BluetoothAdapter.getDefaultAdapter();
if (localBluetoothAdapter != null) {
str = localBluetoothAdapter.getAddress();
}
return str;
}
private static String mQ()
{
String str1 = be.dM(aa.getContext());
String str2;
if ((str1 != null) && (str1.length() > 0))
{
str2 = ("A" + str1 + "123456789ABCDEF").substring(0, 15);
v.w("MicroMsg.DeviceInfo", "generated deviceId=" + str2);
return str2;
}
Random localRandom = new Random();
localRandom.setSeed(System.currentTimeMillis());
str1 = "A";
int i = 0;
for (;;)
{
str2 = str1;
if (i >= 15) {
break;
}
str1 = str1 + (char)(localRandom.nextInt(25) + 65);
i += 1;
}
}
public static String mR()
{
return Build.MODEL;
}
/* Error */
public static String[] mS()
{
// Byte code:
// 0: iconst_2
// 1: anewarray 154 java/lang/String
// 4: astore_3
// 5: aload_3
// 6: iconst_0
// 7: ldc -70
// 9: aastore
// 10: aload_3
// 11: iconst_1
// 12: ldc_w 391
// 15: aastore
// 16: aconst_null
// 17: astore_2
// 18: new 393 java/io/BufferedReader
// 21: dup
// 22: new 395 java/io/FileReader
// 25: dup
// 26: ldc_w 397
// 29: invokespecial 398 java/io/FileReader:<init> (Ljava/lang/String;)V
// 32: sipush 8192
// 35: invokespecial 401 java/io/BufferedReader:<init> (Ljava/io/Reader;I)V
// 38: astore_1
// 39: aload_1
// 40: invokevirtual 404 java/io/BufferedReader:readLine ()Ljava/lang/String;
// 43: invokestatic 408 com/tencent/mm/sdk/platformtools/be:li (Ljava/lang/String;)Ljava/lang/String;
// 46: ldc_w 410
// 49: invokevirtual 414 java/lang/String:split (Ljava/lang/String;)[Ljava/lang/String;
// 52: astore_2
// 53: iconst_2
// 54: istore_0
// 55: iload_0
// 56: aload_2
// 57: arraylength
// 58: if_icmpge +41 -> 99
// 61: aload_3
// 62: iconst_0
// 63: new 135 java/lang/StringBuilder
// 66: dup
// 67: invokespecial 295 java/lang/StringBuilder:<init> ()V
// 70: aload_3
// 71: iconst_0
// 72: aaload
// 73: invokevirtual 144 java/lang/StringBuilder:append (Ljava/lang/String;)Ljava/lang/StringBuilder;
// 76: aload_2
// 77: iload_0
// 78: aaload
// 79: invokevirtual 144 java/lang/StringBuilder:append (Ljava/lang/String;)Ljava/lang/StringBuilder;
// 82: ldc_w 416
// 85: invokevirtual 144 java/lang/StringBuilder:append (Ljava/lang/String;)Ljava/lang/StringBuilder;
// 88: invokevirtual 148 java/lang/StringBuilder:toString ()Ljava/lang/String;
// 91: aastore
// 92: iload_0
// 93: iconst_1
// 94: iadd
// 95: istore_0
// 96: goto -41 -> 55
// 99: aload_3
// 100: iconst_1
// 101: aload_1
// 102: invokevirtual 404 java/io/BufferedReader:readLine ()Ljava/lang/String;
// 105: invokestatic 408 com/tencent/mm/sdk/platformtools/be:li (Ljava/lang/String;)Ljava/lang/String;
// 108: ldc_w 410
// 111: invokevirtual 414 java/lang/String:split (Ljava/lang/String;)[Ljava/lang/String;
// 114: iconst_2
// 115: aaload
// 116: aastore
// 117: aload_1
// 118: invokevirtual 419 java/io/BufferedReader:close ()V
// 121: aload_3
// 122: areturn
// 123: astore_1
// 124: aconst_null
// 125: astore_1
// 126: aload_1
// 127: ifnull -6 -> 121
// 130: aload_1
// 131: invokevirtual 419 java/io/BufferedReader:close ()V
// 134: aload_3
// 135: areturn
// 136: astore_1
// 137: aload_3
// 138: areturn
// 139: astore_1
// 140: aload_2
// 141: ifnull +7 -> 148
// 144: aload_2
// 145: invokevirtual 419 java/io/BufferedReader:close ()V
// 148: aload_1
// 149: athrow
// 150: astore_1
// 151: aload_3
// 152: areturn
// 153: astore_2
// 154: goto -6 -> 148
// 157: astore_3
// 158: aload_1
// 159: astore_2
// 160: aload_3
// 161: astore_1
// 162: goto -22 -> 140
// 165: astore_2
// 166: goto -40 -> 126
// Local variable table:
// start length slot name signature
// 54 42 0 i int
// 38 80 1 localBufferedReader BufferedReader
// 123 1 1 localIOException1 IOException
// 125 6 1 localObject1 Object
// 136 1 1 localException1 Exception
// 139 10 1 localObject2 Object
// 150 9 1 localException2 Exception
// 161 1 1 localObject3 Object
// 17 128 2 arrayOfString1 String[]
// 153 1 2 localException3 Exception
// 159 1 2 localObject4 Object
// 165 1 2 localIOException2 IOException
// 4 148 3 arrayOfString2 String[]
// 157 4 3 localObject5 Object
// Exception table:
// from to target type
// 18 39 123 java/io/IOException
// 130 134 136 java/lang/Exception
// 18 39 139 finally
// 117 121 150 java/lang/Exception
// 144 148 153 java/lang/Exception
// 39 53 157 finally
// 55 92 157 finally
// 99 117 157 finally
// 39 53 165 java/io/IOException
// 55 92 165 java/io/IOException
// 99 117 165 java/io/IOException
}
public static String mT()
{
Object localObject2 = null;
try
{
BluetoothAdapter localBluetoothAdapter = BluetoothAdapter.getDefaultAdapter();
Object localObject1 = localObject2;
if (localBluetoothAdapter != null)
{
localObject1 = localObject2;
if (localBluetoothAdapter.isEnabled()) {
localObject1 = localBluetoothAdapter.getAddress();
}
}
localObject1 = be.li((String)localObject1);
return (String)localObject1;
}
catch (Exception localException)
{
v.e("MicroMsg.DeviceInfo", "getBlueToothAddress failed: %s", new Object[] { be.f(localException) });
}
return "";
}
@SuppressLint({"NewApi"})
public static String mU()
{
for (Object localObject = null;; localObject = str)
{
try
{
if (Build.VERSION.SDK_INT < 14) {
break label21;
}
str = Build.getRadioVersion();
localObject = str;
}
catch (IncompatibleClassChangeError localIncompatibleClassChangeError)
{
String str;
v.printErrStackTrace("MicroMsg.Crash", localIncompatibleClassChangeError, "May cause dvmFindCatchBlock crash!", new Object[0]);
throw ((IncompatibleClassChangeError)new IncompatibleClassChangeError("May cause dvmFindCatchBlock crash!").initCause(localIncompatibleClassChangeError));
}
catch (Throwable localThrowable)
{
label21:
for (;;) {}
}
return be.li((String)localObject);
str = Build.RADIO;
}
}
public static String mV()
{
return Build.VERSION.RELEASE;
}
public static String mW()
{
try
{
String str = be.li(((TelephonyManager)aa.getContext().getSystemService("phone")).getSubscriberId());
return str;
}
catch (Exception localException)
{
v.printErrStackTrace("MicroMsg.DeviceInfo", localException, "getPhoneIMSI", new Object[0]);
}
return "";
}
public static String mX()
{
try
{
String str = be.li(((TelephonyManager)aa.getContext().getSystemService("phone")).getSimSerialNumber());
return str;
}
catch (Exception localException)
{
v.printErrStackTrace("MicroMsg.DeviceInfo", localException, "getPhoneICCID", new Object[0]);
}
return "";
}
@SuppressLint({"NewApi"})
public static String mY()
{
String str = null;
if (Build.VERSION.SDK_INT >= 9) {
str = Build.SERIAL;
}
return be.li(str);
}
public static Map<String, String> mZ()
{
HashMap localHashMap = new HashMap();
try
{
BufferedReader localBufferedReader = new BufferedReader(new InputStreamReader(new ProcessBuilder(new String[] { "/system/bin/cat", "/proc/cpuinfo" }).start().getInputStream()));
for (;;)
{
Object localObject = localBufferedReader.readLine();
if (localObject == null) {
break;
}
if (!((String)localObject).trim().equals(""))
{
localObject = ((String)localObject).split(":");
if (localObject.length > 1) {
localHashMap.put(localObject[0].trim().toLowerCase(), localObject[1].trim());
}
}
}
localBufferedReader.close();
return localHashMap;
}
catch (IOException localIOException) {}
return localHashMap;
}
public static int na()
{
try
{
int i = new File("/sys/devices/system/cpu").listFiles(new a()).length;
return i;
}
catch (Exception localException) {}
return 1;
}
public static String nb()
{
return "android-" + Build.MODEL + "-" + Build.VERSION.SDK_INT;
}
final class a
implements FileFilter
{
public final boolean accept(File paramFile)
{
return Pattern.matches("cpu[0-9]+", paramFile.getName());
}
}
}
/* Location:
* Qualified Name: com.tencent.mm.compatible.d.p
* Java Class Version: 6 (50.0)
* JD-Core Version: 0.7.1
*/
|
Marker production by PCR amplification with primer pairs from conserved sequences of WRKY genes in chili pepper.
Despite increasing awareness of the importance of WRKY genes in plant defense signaling, the locations of these genes in the Capsicum genome have not been established. To develop WRKY-based markers, primer sequences were deduced from the conserved sequences of the DNA binding motif within the WRKY domains of tomato and pepper genes. These primers were derived from upstream and downstream parts of the conserved sequences of the three WRKY groups. Six primer combinations of each WRKY group were tested for polymorphisms between the mapping parents, C. annuum 'CM334' and C. annuum 'Chilsungcho'. DNA fragments amplified by primer pairs deduced from WRKY Group II genes revealed high levels of polymorphism. Using 32 primer pairs to amplify upstream and downstream parts of the WRKY domain of WRKY group II genes, 60 polymorphic bands were detected. Polymorphisms were not detected with primer pairs from downstream parts of WRKY group II genes. Half of these primers were subjected to F2 genotyping to construct a linkage map. Thirty of 41 markers were located evenly spaced on 20 of the 28 linkage groups, without clustering. This linkage map also consisted of 199 AFLP and 26 SSR markers. This WRKY-based marker system is a rapid and simple method for generating sequence-specific markers for plant gene families.
|
public class Solution {
String countAndSay(String prev){
char[] str = prev.toCharArray();
int p = 1;
int count = 1;
char last = str[0];
String s = "";
while(p < str.length){
if(str[p] == last){
count++;
}else{
s += "" + count + last;
last = str[p];
count = 1;
}
p++;
}
s += "" + count + last;
return s;
}
public String countAndSay(int n) {
// Note: The Solution object is instantiated only once and is reused by each test case.
String init = "1";
for(int i = 0; i < n - 1; i++){
init = countAndSay(init);
}
return init;
}
}
|
Devices that use wireless signaling are ubiquitous to contemporary life. Non-limiting examples of such (wireless) devices include cellular telephones, text messaging units, personal digital assistants (PDAs), and laptop and palmtop computers. Respective such devices typically include one or more modes of operation such as, for example, unidirectional or bidirectional voice, video and/or data communications, Internet accessibility, remote control functionality, etc.
However, such devices are dependent upon access to wireless resources (i.e., networks or infrastructure) external to the device in order for corresponding wireless functions to operate. For example, a cellular telephone requires a period of continuous signal access to a cellular network in order to initiate and maintain a call. Such external resources are, as a matter of practicality, finite in their geographic coverage range and scope of operational modes. In short, worldwide coverage for all wireless devices, everywhere that a user might want or need signal access, is not a reality.
Furthermore, various factors result in poor or non-existent signal access in areas that are otherwise proximate to wireless service infrastructure. As one example, a user might temporarily lose wireless signal access while traveling through a tunnel in a downtown area. In another example, a user is denied wireless access while stuck in traffic because other wireless users are utilizing all of the available support resources. These and other scenarios cause frustration and loss of productivity for users of wireless technology.
|
Losing memories during sleep after targeted memory reactivation.
Targeting memories during sleep opens powerful and innovative ways to influence the mind. We used targeted memory reactivation (TMR), which to date has been shown to strengthen learned episodes, to instead induce forgetting (TMR-Forget). Participants were first trained to associate the act of forgetting with an auditory forget tone. In a second, separate, task they learned object-sound-location pairings. Shortly thereafter, some of the object sounds were played during slow wave sleep, paired with the forget tone to induce forgetting. One week later, participants demonstrated lower recall of reactivated versus non-reactivated objects and impaired recognition memory and lowered confidence for the spatial location of the reactivated objects they failed to spontaneously recall. The ability to target specific episodic memories for forgetting during sleep has implications for developing novel therapeutic techniques for psychological disorders such as PTSD and phobias.
|
Manga creator Minene Sakurano announced on her blog on Friday that she is working on the manuscript for a sequel to her Guardian Angel Getten (Mamotte Shugogetten) manga. She plans to serialize the sequel with the publisher Mag Garden, and she will announce more details as they are confirmed.
Mamotte Shugogetten had caused a stir online on Monday when the King of Conte variety show used the anime version's opening song "Saa" in a skit. The incident propelled the song to #6 on the Japanese iTunes singles chart (and #1 on iTunes' anime song chart), nearly 17 years after the duo Surface originally released it. Sakurano said she was so surprised by hearing about the surge in popularity that she almost spit out the tea she was drinking.
However, Sakurano noted that she has been working on the sequel before the song "Saa" appeared on King of Conte this week.
Sakurano serialized the original manga from 1997-2000, and Gutsoon! Entertainment's Raijin Comics serialized part of the series in English. Tokyopop released the 11-volume series in North America in five omnibus volumes. Sakurano drew a six-volume sequel, Mamotte Shugogetten! Retrouvailles, starting in 2002.
The manga inspired a television anime adaptation in 1998 and an OVA in 2000.
In the story, Shichiri Tasuke recieves a gift from his traveling father: a ring like crystal from which emerges a girl named Shao Lin, the Spirit of the moon, whose purpose is to protect her master (in this case, Tasuke) from misfortune. Shao Lin, however, is quite naive and has little to no understanding of the modern world.
Update: Tokyopop did release the entire 11-volume original series, but in five omnibus volumes. Thanks, Daniel.
[Via Otakomu]
|
Introduction {#S0001}
============
It is estimated that the proportion of those aged 60 and over will double from 11% in 2000 to 22% by 2050.[@CIT0001] As a result, health care systems will face new challenges due to increased health-related problems such as neurodegenerative diseases. Dementia is the most prevalent of these.[@CIT0002] It is estimated that the number of people in Canada living with dementia will increase from approximately 400,000 to nearly 700,000 by 2031.[@CIT0003] The prevalence rate doubles approximately every 6 years from the age of 65, from 7% of those affected between 75 and 79 years of age to 40% for those aged 90 and over.[@CIT0004],[@CIT0005] In 2012, the World Health Organization declared dementia a public health priority.[@CIT0006]
Dementia is a term used to encompass many diseases that are usually chronic or progressive in nature.[@CIT0004] It is caused by neurodegeneration or a loss of cells in the brain and the rupture of important nerve connections.[@CIT0007] There are several consequences associated with dementia, including behavioral changes, a deterioration of memory and reasoning, and the loss of the ability to perform daily activities that occur more rapidly comparatively to the normal aging process.[@CIT0008] The most common form of dementia is Alzheimer's disease, which accounts for 60--70% of dementia cases.[@CIT0006]
The social and economic impacts of dementia are numerous. In 2015, it was estimated that 48.7 million people globally were living with dementia resulting in approximately US\$818 billion of care-related costs (1.09% of the global gross domestic product).[@CIT0009] It is projected that by 2030, 75 million people will have some form of dementia, with care costing nearly US\$2 trillion.[@CIT0009] Although population-level health interventions aimed at prevention are required, individual interventions are needed to ameliorate the quality of life of those already diagnosed with dementia and to possibly improve short-term cognitive function in the early stages of the disease. Evidence suggests that pharmacological interventions may have only limited benefits for reducing the decline in daily life habits and may also cause unwanted side effects.[@CIT0010] Additionally, clinical practice guidelines recommend beginning with more cost-effective behavioral or psychological interventions before initiating pharmacological interventions.[@CIT0001] Currently, the only evidence-based behavioral intervention that has shown to provide short-term improvement of cognitive function is that of physical activity.[@CIT0001],[@CIT0010]--[@CIT0012]
Tai Chi is a physical activity that also incorporates cognitive, social, and meditation components, and it is currently gaining popularity and generating much interest.[@CIT0011] It involves learning choreographed movement patterns, which require visuospatial skills, rapid information processing, and episodic memory.[@CIT0001] Tai Chi also leads to increased heart rate and respiration, which helps create a larger network of connections between neurons thus enhancing brain perfusion.[@CIT0001] Previous studies have suggested that Tai Chi is a safe and effective activity that improves physical balance and emotional well-being in older adults without disabilities.[@CIT0013],[@CIT0014] At the cognitive level, several studies suggest that Tai Chi interventions potentially provide beneficial effects, such as preserving or improving cognitive functions and reducing the risk of developing dementia in the older adult population who are without disabilities.[@CIT0005],[@CIT0011] A systematic review comparing studies of Tai Chi against regular physical activities in relation to the maintenance of cognitive ability among healthy adults suggests that Tai Chi can be more efficacious than simply physical exercise for the maintenance of global cognitive skills.[@CIT0001]
Some emerging research demonstrates the potential effectiveness of Tai Chi in providing short-term improvement in cognitive function in the early stages of dementia. Burgener et al conducted a 40-week intervention with people living with dementia (treatment group, n=24; control, n=19) to evaluate the effectiveness of a multimodal intervention.[@CIT0012] The authors concluded that interventions combining Tai Chi, cognitive therapy and participation in a support group can be effective in improving or maintaining cognitive function for people with dementia. Wayne et al conducted a systematic review to explore the effectiveness of Tai Chi on cognitive performance in adults with and without cognitive impairment, concluding that Tai Chi may enhance executive function in older adults without significant impairment; however, their sample included participants with early stages to advanced stages of dementia, and this heterogeneous group may have masked the effects for any subgroups of participants.[@CIT0011]
Given the lack of consensus on the efficacy of pharmacological approaches and the emphasis on behavioral-focused treatments in the clinical setting, there has been growing interest in behavioral interventions, such as Tai Chi. The purpose of this systematic review is to examine intervention studies using Tai Chi in the early stages of dementia to determine the effectiveness of Tai Chi to improve short-term cognitive function.
Methods {#S0002}
=======
A keyword search of electronic databases that followed the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines identified and selected articles relevant for the purpose of the study.[@CIT0015] With the assistance of a biomedical librarian, an initial search was conducted by the first author in September 2016, with an updated search conducted by the second author in December of 2018. The literature search was done in the following databases: PubMed/MEDLINE, Cumulative Index to Nursing and Allied Health Literature (CINAHL), Excerpta Medica Database (EMBASE), and Cochrane Library using the following keywords: Tai Chi OR Tai Ji OR taichi OR taiji AND Dementia\* OR Alzheimer\* OR cognition OR cognitive OR neurocognitive disorder. A secondary search strategy was also used which involved a manual search in the reference lists of selected articles. [Figure 1](#F0001){ref-type="fig"} presents a PRISMA diagram summarizing the process of article selection.[@CIT0015] The Supplementary material provides an example of a search strategy.Figure 1PRISMA diagram.
Selected articles (1) included participants in the early stages of dementia (all forms of dementia were included), beginning stages were defined by a Mini-Mental Status Exam (MMSE) score between 18 and 24 and/or a Clinical Dementia Rating (CDR) score of 0.5 or 1 (valid for at least 80% of the sample); (2) employed Tai Chi exclusively as the intervention (all forms of Tai Chi were included); (3) examined the effects of Tai Chi on cognition; and (4) were written in French or English.
An extraction table was completed in order to facilitate the comparison of different elements found in the selected articles. The table format was based on other systematic reviews of a similar topic.[@CIT0001],[@CIT0011] The information extracted from the articles included the authors, the year of publication, the country where the study took place, the study design, the sample size, participant demographic information, the nature of the control group activity (eg, other form of exercise, education material, no activity), the length and frequency of the Tai Chi intervention, and the outcome measures.
Two evaluators (first and fourth authors) independently assessed the quality of selected articles. The evaluation tool used was a version of the "Checklist for Clinical Trial Quality Assessment," a 27-item tool with a total possible score of 28 points.[@CIT0016],[@CIT0017] The assessment is divided into four sub-sections: reporting (ten items), external validity (three items), internal validity-bias (seven items), and internal validity-confounding (six items). An "excellent" score ranges from 24 to 28; "good", 19 to 23; "fair", 14 to 18; or "poor", below 14.[@CIT0017],[@CIT0018]
Results {#S0003}
=======
A total of nine studies were selected including six randomized controlled trials,[@CIT0005],[@CIT0021],[@CIT0022],[@CIT0024]--[@CIT0026] two non-randomized control trials,[@CIT0020],[@CIT0023] and one non-randomized prospective study.[@CIT0019] The average age across all 9 studies was 78 years old. The sample size for each of the studies ranged from 11 to 238 participants. The studies were conducted in five countries: Brazil (n=1),[@CIT0020] China (n=3),[@CIT0005],[@CIT0021],[@CIT0026] the United States (n=3),[@CIT0019],[@CIT0023],[@CIT0024] France (n=1),[@CIT0022] and Thailand (n=1).[@CIT0025] In seven of the studies, participants lived in the community,[@CIT0005],[@CIT0019],[@CIT0020],[@CIT0023]--[@CIT0026] while two studies focused on participants in an institutionalized environment.[@CIT0021],[@CIT0022] The duration of Tai Chi interventions varied greatly from 8 weeks to 1 year, in terms of frequency of practice (1 to 4 times a week), and style. Seven of the studies used control groups with various types of interventions, such as education, adaptive physical activity, or crafts-based exercises.[@CIT0005],[@CIT0020],[@CIT0021],[@CIT0023]--[@CIT0026] [Table 1](#T0001){ref-type="table"} presents the characteristics of each of the selected studies.Table 1Summary of included studiesAuthor/Year/CountryStudy DesignParticipantsType, frequency, and duration of interventionCognitive outcomes/Measurements^a^Results related to cognitive measures**Chan et al 2016**[@CIT0021]\
**China**RCT52 participants with MCI (determined by an MMSE score between 13--26)\
Mean age =81\
Community-dwelling\
**I/C =27/25**Intervention group: TC Qiqong (group class)\
60 minutes,\
2 times/week X 2 months\
Control group: health talk group in community center\
1 time/week X 2 months(1) Global cognitive function: MMSE; (2) Awareness of memory deficits: MIC;\
Outcomes measured at baseline, after 2 months and after 6 months,No significant difference noted in MMSE score and MIC score between both groups (T1: *p*=0.394; T2: *p*=0.219).**Chang et al 2011[@CIT0019] United States**PNCT11 participants with MCI (determined by 15≤ MMSE score ≤27; DSC ≤6; DS ≤6; Stroop Color and Word test or HVLT-R score ≤39)\
Mean age =85\
Community-DwellingIntervention group: TC sun style for arthritis (group class)\
20--40 minutes,\
2 times/week X 15 weeks(1) Global cognitive function: MMSE; (2) Working memory: DSC & DS; (3) Attention: ST-color-word; (4) Verbal learning and memory: HVLT-R;\
Outcomes measured at baseline and after 15 weeks.At 15 weeks, no significant pre-post differences in MMSE score (*p*=0.22), DSC (*p*=0.32), DS (*p*=1.08), Stroop Color and Word Test (*p*=0.4) and HVLT-R (*p*=0.36).\
At 15 weeks, significant difference in MMSE score in elders who participated in 24--29 sessions versus those who only went to 4 or less sessions (*p*\<0.05) and DSC (*p*\<0.05).**Cheng et al 2014[@CIT0026]**\
**China**RCT110 participants with MCI or early AD (determined by MMSE score between 10--24; CDR ≥0.5)\
Mean age =82\
Institutionalized\
**I/C =39/35**Intervention group: TC 12-form Yang Style or Mahjong (group class)\
60 minutes,\
3 times/week X 12 weeks\
Control group: handicraft (frequency and duration: idem)(1) Global cognitive function: MMSE; (2) Working memory: DSF, DSB & 15-word immediate recall; (3) Episodic memory: 15-word 30 min. delayed recall; (4) Semantic memory: categorical fluency;\
Outcomes measured at baseline, week 12, 24 and 36.At 24 weeks, significant difference in MMSE score (3.7 pts.) between I group (+1.5 pts.) and C group (−2.7 pts.) (95%CI: 1.4--6.0; d=0.40).\
Significant difference in DSF score between groups favoring I group over C group (0.98; 95%CI: 0.12--1.84; d =0.25).\
At all time, no significant difference between groups in DSB, 15-word immediate & 30 min. delayed recall and categorical fluency.**Deschamps et al 2009[@CIT0022]**\
**France**RCT52 participants with mild to moderate cognitive impairment\
Mean age =81\
Institutionalized\
2 interventions groups:\
TC: n=26\
CA: n=26TC intervention group: Adapted TC Yang Style (group class)\
30 minutes,\
4 times/week X 24 weeks\
CA intervention group:\
Adapted physical group activity and education on health\
30--40 minutes,\
2 times/week X 24 weeks(1) Global cognitive function: MMSE;\
Outcome measured at baseline and after 24 weeks.At 24 weeks, TC group's MMSE score remained stable (pre-test: 19.4±7.4; post-test: 21.1±6.4; *p*=0.6).\
No significant difference in score between both intervention groups (*p*=0.8).**Kasai et al 2010[@CIT0020]**\
**Brazil**NRCT26 participants (elderly women) with MCI\
Mean age =74\
Community-Dwelling\
**I/C =13/13**Intervention group: TC Chuan Yang Style (group class) and recommendation to also practice at home\
60 minutes,\
2 times/week X 6 months\
Control group: no intervention(1) Self-perception of memory: SMC; (2) Memory: RBMT; (3) Working memory: DSF; (4) Concentration capacity: DSB;\
Outcomes measured at baseline, after 3 months and after 6 months.At 6 months, significant drop in memory complaints in I group compared to C group (*p*=0.023).\
At 6 months significant increase in RBMT score in I group compared to C group (*p*=0.007).\
At 6 months, significant difference for DSF in I group compared to C group (*p*=0.031). But no significant difference in DSB score between the 2 groups (*p*=0.164).**Lam et al 2014[@CIT0005]**\
**China**RCT238 participants with amnestic MCI or CDR =0.5\
Mean age =78\
Community-dwelling\
**I/C =96/169**Intervention group: TC (4--6 weeks center-based and 46--48 weeks home-based training with DVD of TC program + monthly refresher).\
30 minutes,\
3 times/week X 1 year\
Control group: Stretching and relaxation exercises by PT &OT(1) Global severity of cognitive impairment: CDR; (2) Global cognitive function: ADAS-COG & MMSE; (3) Working memory: DSB; (4) Episodic memory: 10-min. delayed recall; (5) Semantic memory: Category verbal fluency tests;\
Outcomes measured at baseline, after 2 months and after 12 months.At 1 year, I group had better cognitive preservation than C group: 4/92 (4.3%) \[I\] VS 28/169 (16.6%) \[C\] progressed to dementia (odds ratio \[OR\] =0.28; 95%CI=0.05--0.92; *p*=0.064).\
Significant difference in score favoring I group for CDR score (*p*=0.038; 95%CI =0.63--0.99).\
At 1 year, both groups improve in ADAS-COG, DSB, Delayed recall test and category verbal fluency but no significant difference between groups was noted (*p*\>0.05).\
No significant change in MMSE score in both groups (95%CI=−0.62--1.42; *p*=0.44).**Li et al 2014[@CIT0023]**\
**United States**NRCT46 participants with MCI (determined by 20≤ MMSE score ≤25)\
Mean age =76\
Community-dwelling\
**I/C =22/24**Intervention group: Enhanced TC Chuan (group class)\
60 minutes,\
2 times/week X 14 weeks\
Control group: no interventionGlobal cognitive function: MMSE;\
Outcome measured at baseline and after 14 weeks.At 14 weeks, I group showed significant improvement on MMSE (mean =2.26, *p*\<0.001) compared to C group (mean =0.63, *p*=0.08).**Sungkarat et al 2017[@CIT0025]**\
**Thailand**RCT66 participants with MCI (meeting Peterson's criteria for diagnosing amnestic multiple-domain MCI)\
Mean age =68\
Community-dwelling\
**I/C =33/33**Intervention group: TC 10-forms style (3 weeks center-based & 12 weeks home-based with DVD of TC program)\
50 minutes,\
3 times/week X 15 weeks\
Control group: education group on cognitive impairment(1) Episodic memory: Logical Memory -- delayed recall; (2) Visuospatial ability: Block Design; (3) Executive function: DSF, DSB & TMT-B;\
Outcomes measured at baseline and after 15 weeks.At 15 weeks, scores were significantly better in I group compared to C group for the Logical Memory -- delayed recall (*p*=0.006), Block Design (*p*=0.01) and Trail Making Test -- Part B-A (*p*=0.005). No significant difference between groups for DSF and DSB (*p*=0.43).**Tsai et al 2013**[@CIT0024]\
**United States**RCT55 participants with MCI (determined by 18≤ MMSE score ≤28)\
Mean age =79\
Community-dwelling\
**I/C =28/27**Intervention group: TC Sun Style (group class)\
20--40 minutes,\
3 times/week X 20 weeks\
Control group: health and cultural information class (frequency and duration: idem)Global cognitive function: MMSE;\
Outcome measured at baseline, week 5, 9, 13, 17 and 21.At 21 weeks, significant improvement in MMSE score only in I group (*p*=0.003 \[I\] vs *p*=0.082 \[C\]).\
No significant change in difference between the 2 groups over time (*p*=0.223).[^1][^2]
Methodological quality scores ranged from 14 to 25, with an average of 20.2 out of a possible 28 points. According to the interpretation scale, two articles scored as being of "excellent" quality,[@CIT0025],[@CIT0026] five articles qualified as "good,"[@CIT0005],[@CIT0021]--[@CIT0024] and two articles qualified as "fair."[@CIT0019],[@CIT0020] None of the studies were identified as being of "poor" quality. The methodological quality of the selected studies is described in [Table 2](#T0002){ref-type="table"}.Table 2Summary of study quality and risk of biasStudyReporting\
(scored out of 11)External validity\
(scored out of 3)Internal validity -- Bias^b^\
(scored out of 7)Interval validity -- confounding (selection bias, scored out of 6)Total score\
(out of 28)Chan et al[@CIT0021]1025522Chang et al[@CIT0019],^a^7/904/60/115.6^a^Cheng et al[@CIT0026]1035524Deschamps et al[@CIT0022]925521Kasai et al[@CIT0020]705214Lam at al[@CIT0005]726520Li et al[@CIT0023]1114319Sungkarat et al[@CIT0025]1126525Tsai et al[@CIT0024]1025522[^3][^4]
Effects of tai chi on cognitive functions {#S0003-S2001}
-----------------------------------------
Similar to the reporting style for the studies reviewed, the results presented below are according to cognitive functions that were measured in the selected studies.
Global cognitive functions {#S0003-S2002}
--------------------------
Impacts on global cognitive function were estimated in seven of the studies.[@CIT0005],[@CIT0019],[@CIT0021]--[@CIT0024],[@CIT0026] All studies used the MMSE tool,[@CIT0005],[@CIT0019],[@CIT0021]--[@CIT0024],[@CIT0026] however, Lam, et al also used the Alzheimer's Disease Assessment Scale (ADAS-Cog) and the Clinical Dementia Rating (CDR).[@CIT0005] The MMSE and the CDR are tools used to screen for cognitive disorders, while the ADAS-COG is often used to evaluate the effectiveness of interventions for Alzheimer's disease.
By the end of their respective Tai Chi interventions, participants, on average, maintained or increased their scores on one or more of the cognitive functions. In four studies,[@CIT0005],[@CIT0019],[@CIT0021],[@CIT0022] MMSE performance remained stable with no significant difference in scores within and between groups. Among these studies, Chang et al was a one-group pre-post design,[@CIT0019] while the studies authored by Chan, et al[@CIT0021] Deschamps et al,[@CIT0022] and Lam et al were randomized control trials.[@CIT0005] In the latter two, the MMSE scores remained stable for the Tai Chi group and for the adapted-exercise control group. Three studies reported improvements in overall cognitive function by the end of the intervention.[@CIT0023],[@CIT0024],[@CIT0026] Of these studies, the studies by Tsai et al and Cheng et al showed significant improvement in performance in the intervention groups compared to that of the control groups (engaged in crafts and education).[@CIT0024],[@CIT0026] Lam et al[@CIT0005] who used the ADAS-COG and CDR tools, also showed an improvement in overall cognitive function after one year of intervention. This improvement, however, was present in both the intervention group and the control group who did adapted exercise. While the overall cognitive function measured with the CDR was better preserved in the Tai Chi group than in the control group, only 4.3% (n=4) of participants in the Tai Chi group, progressed to dementia as diagnosed by the DSM-IV, compared to 16.6% (n=28) of the control group after one year.[@CIT0005]
Working memory and executive function {#S0003-S2003}
-------------------------------------
The impacts of Tai Chi on working memory and executive function were reported in five studies using Digit Span Backward (DSB),[@CIT0005],[@CIT0020],[@CIT0025],[@CIT0026] Digit Symbol Coding (DSC),[@CIT0019] Digit Span Forward (DSF),[@CIT0020],[@CIT0025],[@CIT0026] 15-Word immediate recall and/or Trail Making Test -- Part B (TMT-B).[@CIT0025] The DSF and DSB tests, derived from the Wechsler Adult Intelligence Scale (WAIS), consist of storing and repeating digit sequences in reverse order immediately after hearing them.[@CIT0020] The DSC, also from the WAIS, consists of decoding symbols according to their association with numbers.[@CIT0027] The TMT-B required participants to connect alternating letters and numbers in the correct order as quickly as possible (eg, 1-A-2-B, etc.).[@CIT0025]
Varying results were reported for the effect of Tai Chi on executive function or working memory from across the wide variety of measurements. Three studies used DSB to measure this cognitive outcome.[@CIT0005],[@CIT0020],[@CIT0025] Two of these studies, those of Sungkarat et al and Cheng et al[@CIT0025],[@CIT0026] with intervention durations of 12 and 15 weeks, did not demonstrate a difference between the intervention group and the control group at the end of the interventions. On the other hand, the study conducted by Lam et al[@CIT0005] of a longer duration demonstrated an improvement in working memory after one year of intervention with the same tool. This improvement was found in both the intervention and the control group but there was no significant difference between the groups.[@CIT0005] The studies conducted by Chang et al and Cheng et al showed no significant difference between pre- and post-intervention scores for working memory,[@CIT0019],[@CIT0026] as assessed with the DSC and 15-Word immediate recall. The results for working memory were positive for two out of the three studies that used the DSF evaluation tool,[@CIT0020],[@CIT0026] while Sungkarat et al did not report a significant difference compared to their control group (education).[@CIT0025] The studies that found positive results for the DSF reported a significant difference with their control group which, in one case, was a passive control group and the other was an active control group (crafts activities).[@CIT0020],[@CIT0026] Sungkarat et al[@CIT0025] also used the TMT-B to evaluate executive function and achieved a significant improvement against its control group.
The studies' results were analyzed according to the frequency and duration of the Tai Chi intervention. The three studies offering Tai Chi sessions three times/week showed an improvement in working memory and executive function in at least one of the tests used.[@CIT0005],[@CIT0025],[@CIT0026] For these studies, the duration of Tai Chi sessions was 30, 50, and 60 mins, 3 times/week for 1 year, 15 weeks, and 12 weeks, respectively.[@CIT0005],[@CIT0025],[@CIT0026]
Verbal learning and memory {#S0003-S2004}
--------------------------
Of the five studies that measured verbal learning and memory,[@CIT0005],[@CIT0019],[@CIT0020],[@CIT0025],[@CIT0026] results suggested that Tai Chi interventions may improve performance. Three studies noted improvement for these cognitive functions,[@CIT0005],[@CIT0020],[@CIT0025] while two studies reported no effect.[@CIT0019],[@CIT0026] Verbal learning and memory were evaluated by the following tests: the Hopkins Verbal Learning Test -- Revised (HVLT-R),[@CIT0019] based on the recall of12 words 20--25 mins after being learned,[@CIT0028] the 15-Word 30-Min Delayed Recall,[@CIT0026] based on the recall of 15 words learned after 30 mins, 10-Min Delayed Recall,[@CIT0005] based on the reminder of words learned after 10 mins (number of words not mentioned in the article), the Riverhead Behavioral Memory Test (RBMT),[@CIT0020] which evaluates different tasks simulating situations of everyday life, and the Logical Memory -- Delayed Recall, which asks the participant to recount two stories as precisely as possible 30 mins after hearing them.[@CIT0025]
Sungkarat et al[@CIT0025] demonstrated a significant improvement in verbal learning and memory skills, as compared to the control group (education). This result was supported by the findings of Kasai et al who reported a significant improvement in the same cognitive functions after six months of intervention compared to a passive control group.[@CIT0020] After one year, Lam et al observed an improvement in memory in both the intervention group and control group, who practiced adapted physical exercise, but no significant difference between the two.[@CIT0005]
Self-perception of memory {#S0003-S2005}
-------------------------
The effects of Tai Chi on self-perception of memory were reported by Chan et al and Kasai et al.,[@CIT0020],[@CIT0021] with both studies indicating improvements. During their eight-week intervention, Chan et al used the Memory Inventory for Chinese Questionnaire (MIC),[@CIT0021] a 27-item evaluation administered in a semi-structured interview, observing improvements but no significant differences between the intervention and control groups.[@CIT0029] The investigation carried out by Kasai et al lasted 24 weeks and used the Subjective Memory Complaints Scale (SMC),[@CIT0020] an assessment derived from the Cambridge Examination for Mental Disorders of the Elderly (CAMDEX) and composed of ten questions.[@CIT0030] Their results suggested a significant decrease in complaints of memory loss in the control group compared to the passive control group. The Kasai et al intervention duration was three times longer (twice per week for six months) than that of Chan et al (twice per week for two months).[@CIT0020],[@CIT0021]
Attention and concentration {#S0003-S2006}
---------------------------
Chang et al and Kasai et al assessed attention and concentration using different tools.[@CIT0019],[@CIT0020] Chang et al used the Stroop Color and Word,[@CIT0019] a neuropsychological assessment to determine cognitive-interference abilities,[@CIT0031] while Kasai et al employed the DSB.[@CIT0020] The results of the studies, both of fair methodological quality, showed no effect with the practice of Tai Chi on attention and concentration.[@CIT0019],[@CIT0020]
Semantic memory {#S0003-S2007}
---------------
Two studies evaluated the effect of Tai Chi on semantic memory with the Categorical Verbal Fluency Test.[@CIT0005],[@CIT0026] This evaluation consists in saying as many words as possible in one minute according to given categories (animals, fruits, vegetables).[@CIT0026] Cheng et al,[@CIT0026] whose study was of excellent methodological quality, did not note any improvement in semantic memory after 12 weeks. Lam et al,[@CIT0005] a study of good methodological quality, noted that there was a slight improvement in semantic memory in the Tai Chi group as compared to that of participants in the adapted exercise control group after one year.
Visuospatial skills {#S0003-S2008}
-------------------
Sungkarat et al was the only study to have evaluated visuospatial skills.[@CIT0025] This study, deemed to be of excellent methodological quality, used the Block Design tool, an evaluation consisting of placing blocks to reproduce a presented model and the quantity of blocks can increase from four to nine. They noted that after 15 weeks, visuospatial skills were significantly better for the intervention group compared to the control group.[@CIT0025]
Adverse effects {#S0003-S2009}
---------------
Of the nine studies, only four studies reported considering possible adverse effects; however, no adverse effects related to Tai Chi practice were noted.[@CIT0021],[@CIT0023],[@CIT0025],[@CIT0026]
Discussion {#S0004}
==========
This systematic review was conducted to gain an appreciation of the evidence surrounding non-pharmacological Tai Chi interventions. The studies included in this review suggest positive impacts on global cognitive functions, visuospatial skills, semantic memory, verbal learning/memory, and self-perception of memory. The effects of Tai Chi on overall cognition for people with mild cognitive impairment are comparable to those control groups which engaged in exercise.[@CIT0032],[@CIT0033] The studies reviewed here affirm the potential of Tai Chi to improve short-term cognitive function in the early stages of dementia in the elderly.[@CIT0026] These results are also consistent with the systematic review of Wayne et al[@CIT0011] who concluded that there was a slight clinically significant improvement in overall cognitive function.
Contradictory results were noted across some of the studies. The differing conclusion for the positive impact of Tai Chi on semantic memory and self-perception of memory may be explained by differences in the duration of intervention.[@CIT0005],[@CIT0020],[@CIT0021],[@CIT0026] It is possible that improvement in memory or perceived improvement is noted when interventions are lengthier in duration (eg, six months or more). The mixed results regarding the effect of Tai Chi on executive function could be explained, among other things, by the multiple and complex nature of skills that this cognitive domain represents.[@CIT0034] The effect of Tai Chi appears to be most beneficial for the sub-functions of mental flexibility and immediate recall. This is consistent with the praxis of Tai Chi, which involves the recalling and planning of movements.
Tai Chi may be an effective behavioral-focused treatment to consider for therapeutic intervention in clinical practice, such as in day hospitals, day centers, or community centers. Conceptually, this makes sense given that Tai Chi incorporates cognitive and physical abilities. Taken together, the results of the studies reviewed suggest an intervention lasting at least three months with a frequency of three times per week between 30 and 60 mins per session could have a positive impact on some cognitive functions. After three months of a Tai Chi intervention, even if interrupted, benefits may be maintained for up to six to nine months post-intervention.[@CIT0026] An intervention lasting six months to one year may lead to further improvements in other cognitive functions. Practitioners may find it effective to compose intervention groups of people with cognitive difficulties, exclusively, as opposed to mixed groups. A relatively homogeneous group may allow for more tailored instruction aimed at the participants' cognitive abilities. Consistently or partially practicing Tai Chi in a group setting can further contribute to slowing cognitive decline,[@CIT0005],[@CIT0019],[@CIT0025] while potentially reducing the risk of falling by improving overall physical condition (eg, balance),[@CIT0023],[@CIT0025] promoting mental well-being, better quality of sleep,[@CIT0021] and general improvements to quality of life.[@CIT0022] Consequently, locating a Tai Chi intervention in a health or community center setting may ensure regular practice by the client and provide the added benefit of participating in a group activity. One further area of consideration when developing a Tai Chi intervention is the type of Tai Chi used. At present, to the best of our knowledge, there is not a single study that attends to the efficacy of one type of Tai Chi over another with respect to improving or maintaining cognitive functions. It is possible, however, that certain types of Tai Chi may be easier for older adults with cognitive impairments to perform.
There are limitations to this systematic review. First, it is not a meta-analysis as there few studies reported on this topic. Another limitation is the wide variety of cognitive functions evaluated in the articles. In order to provide brief and clear results, this study regrouped certain cognitive functions despite there being differences between them. Finally, the studies reviewed were limited to cognition and to gain a more comprehensive view of the potential benefits of Tai Chi it would be advantageous to include measures that capture maintenance of ability to perform activities of daily living and mobility.
Conclusion {#S0005}
==========
With an aging population that is increasing, maintaining functional autonomy of seniors will become a prominent issue. Therefore, it is important to introduce alternative activities such as Tai Chi to this population to stimulate physical, cognitive, and social skills while respecting possible physical and cognitive limitations. Tai Chi is a safe activity for the elderly, free of adverse effects, and can be practiced alongside pharmacological interventions. The studies reviewed here support the potential of Tai Chi to improve short-term cognitive function in the elderly at the onset of dementia. The practice of Tai Chi promotes the preservation of cognitive abilities including global cognitive functions, semantic memory, verbal learning/memory, self-perception of memory, and visuospatial skills in the elderly.
Disclosure {#S0006}
==========
The authors report no conflicts of interest in this work.
Supplementary material {#S0007}
======================
Example search strategy {#S0007-S2001}
-----------------------
exp Tai Ji/.(taiji or taichi or tai ji or tai chi).ab,kf,kw,ti.or 2exp Dementia/exp Cognition Disorders/exp Cognitive Therapy/exp Cognition/Neurocognitive disorders/(cognition or cognitive or neurocognition or neurocognitive or dementia\* or alzheimer\*).ab,kf,kw,ti.or 5 or 6 or 7 or 8 or 9and 10
[^1]: **Notes**: ^a^Cognitive outcomes and measurements used by the authors.
[^2]: **Abbreviations**: ADAS-COG, Alzheimer's Disease Assessment Scale -- Cognitive; AMD, Adjusted Mean Difference; C, Control Group; CA, Cognition-Action program; CDR, Clinical Dementia Rating; DAD, Disability Assessment for Dementia; DS, Digit Span; DSB, Digit Span Backward; DSC, Digit Symbol Coding; DSF: Digit Span Forward; HVLT-R, Hopkins Verbal Learning test -- Revised; I, Intervention Group; MCI, Mild Cognitive Impairment; MIC, Memory Inventory for Chinese Questionnaire; MMSE, Mini Mental Status Exam; NPI, Neuropsychiatric Inventory; NRCT, Non-Randomize Control Trial; OT, Occupational Therapy; PNCT, Prospective Non Controlled Trial; PT, Physical Therapist; RCT, Randomize Controlled Trial; RBMT, Rivermead Behavioural Memory Test; SMC, Subjective Memory Complaints Scale; ST-color-word, Stroop color and Word test; TC, Tai Chi; TMT-B, Trail Making Test -- Part B.
[^3]: **Notes**: ^a^This article was a prospective non-controlled trial for which the scores and total score were adjusted. ^b^The main outcomes considered during the evaluation of quality are only those related to cognition.
[^4]: **Abbreviations**: ADAS-Cog, Alzheimer's Disease Assessment Scale; CAMDEX, Cambridge Examination for Mental Disorders of the Elderly; CDR, Clinical Dementia Rating; CINAHL, Cumulative Index to Nursing and Allied Health Literature; DSB, Digit Span Backward; DSC, Digit Symbol Coding; DSF, Digit Span Forward; EMBASE, Excerpta Medica Database; HVLT-R, Hopkins Verbal Learning Test -- Revised; MIC, Memory Inventory for Chinese Questionnaire; MCI, Mild cognitive disorder; MMSE, Mini-Mental State Examination; PRISMA, Preferred Reporting Items for Systematic Reviews and Meta-Analyses; SMC, Subjective Memory Complaints Scale; PRISMA, Systematic Reviews and Meta-Analyses; TMT-B, Trail Making Test -- Part B; WAIS, Wechsler Adult Intelligence Scale.
|
Using computer modeling to predict and optimize separations for comprehensive two-dimensional gas chromatography.
In order to fully realize the separation power of comprehensive two-dimensional gas chromatography (GC x GC), a means of predicting and optimizing separations based on operating variables was developed. This approach initially calculates the enthalpy (DeltaH) and entropy (DeltaS) for the target compounds from experimental input data, and then uses this information to simultaneously optimize all column and runtime variables, including stationary phase composition, by comparing the performance of large numbers of simulated separations. This use of computer simulation has been shown to be a useful aid in conventional separations. It becomes almost essential for GC x GC optimization because of the large number of variables involved and their very complex interaction. Agreement between experimental and predicted values of standard test samples (Grob mix) using GC x GC separation shows that this approach is accurate. We believe that this success can be extended to more challenging mixtures resulting in optimizations that are simpler and transferable between GC x GC instruments.
|
Man, Hazel sure loves drinking out of the toilet. I used to think that was more of a dog habit, but I was wrong.
I’m not sure what the allure of it is, we give her water in her cat bowl all the time, but every chance she gets she’s up there just slurping away.
Believe it or not, Olive never drinks out of the toilet, she just jumped in that one time because you know, you only live once.
That’s why cat PSA’s would come in handy, something similar to the clips shown at the end of the G.I. Joe cartoons from the ’80s. Each one featured a certain Joe stepping in and providing useful tips on safety to misguided youths who were playing with fire, wondering off in crowds, falling out of trees, etc, etc. “So now you know, and knowing is half the battle,” was the famous catch phrase that capped off each segment.
Too bad it’s almost impossible to teach a cat anything.
|
Can I Get Pregnant with Lupus Nephritis
2013-07-04 11:01
Women with lupus nephritis may wonder how the disease will affect their chance of getting pregnant and having a healthy baby. "Can I get pregnant with lupus nephritis" is a major concerned issue for them.
Women with lupus used to be advised to avoid getting pregnant,out of fear of complications for the mother and baby.However,with medical improvement,today at least 85% of women with lupus have successful pregnancy.However,the women with active Lupus Nephritis not to get pregnant until their disease has been inactive for at least six months.
The risk factors of pregnancy for women with lupus nephritis
The following risk factors may cause relapses of lupus and cause fetal outcomes during the pregnancy.
In addition,women with lupus nephritis are recommended not to get pregnant during active period. Some researches showed that women who had active lupus nephritis when they became pregnant had poorer outcomes for their pregnancies than women who had lupus but no Kidney Disease. Premature births and fetal loss often occur those pregnant with active lupus nephritis.What’s worse,flares of lupus and other complications of kidney disease are commonly seen this part of women.
Plan pregnancy for women with lupus nephritis
Women whose lupus nephritis is in remission have much less trouble with pregnancy than those with active disease.If women plan to get pregnant, they are suggested to meet with their doctor three to months in advance. They can help change the present medicines to others which have no adverse effects on baby.
If you send us email, please leave your phone number or WhatsApp/Viber (with country code) in email so that our renal expert can communicate with you timely and directly. We will do utmost to help you solve the problems.
|
import * as path from 'path';
import * as Mocha from 'mocha';
import * as glob from 'glob';
export function run(): Promise<void> {
// Create the mocha test
const mocha = new Mocha({
ui: 'tdd',
useColors: true,
timeout: 6000
});
const testsRoot = path.resolve(__dirname, '..');
return new Promise((c, e) => {
glob('**/**.test.js', { cwd: testsRoot }, (err, files) => {
if (err) {
return e(err);
}
// Add files to the test suite
files.forEach(f => mocha.addFile(path.resolve(testsRoot, f)));
try {
// Run the mocha test
mocha.run(failures => {
if (failures > 0) {
e(new Error(`${failures} tests failed.`));
} else {
c();
}
});
} catch (err) {
e(err);
}
});
});
}
|
An evaluation of the role of identified interneurons in triggering kicks and jumps in the locust.
1. We have used intracellular recording and staining techniques to examine the importance of certain identified interneurons within the system responsible for triggering kicks and jumps in the locust, Locusta migratoria. In particular, our study focused on a pair of metathoracic interneurons called the M-neurons. These cells make strong inhibitory connections to hind-leg flexor motoneurons and are thought to play a key role in the termination of flexor activity which causes kicks and jumps to be triggered (8, 20, 24). 2. Simultaneous recordings from M-neurons and flexor motoneurons during bilateral hindleg kicks revealed that in most cases the onset of the M-neuron's high-frequency discharge coincided precisely with the start of the flexor's rapid repolarization. This result demonstrated that M's activity had the correct timing to be involved in the triggering process and so confirmed suggestions made in previous studies. At times, however, the flexor motoneurons began to repolarize slowly prior to the first spike in the M-neuron, indicating that triggering must involve other neurons and perhaps also an additional mechanism such as a reduction of flexor excitation. 3. The sufficiency and necessity of the M-neurons for triggering kicks were tested by experiments involving intracellular current injections. The application of a brief pulse of depolarizing current to an M-neuron, in order to evoke a burst of spikes in the cell prior to the time it would normally have become active, caused extension of the ipsilateral leg to be triggered prematurely but did not influence the motor program in the contralateral leg. This effect was only observed when the discharge frequency evoked artificially in the M-neuron was greater than that seen during natural performance of the behavior. Even then, the repolarization produced in the flexor motoneurons by the current pulses was not the same as occurs normally. We conclude that under natural circumstances the M-neurons, by themselves, are not sufficient to trigger kicks. 4. When the usual discharge in an M-neuron was prevented by the injection of hyperpolarizing current, both legs were still able to kick. This lack of necessity of the M-neurons confirms that additional neurons must be involved in the triggering process. The rate of repolarization of the flexor motoneurons during kicks in which M activity had been abolished was slower and more variable than is seen in normal kicks but this did not appear to alter the timing of leg extension.(ABSTRACT TRUNCATED AT 400 WORDS)
|
Q:
What is the proper way to install mysql in Ubuntu 18.04?
I wanted to install mysql on my laptop to use in projects where I need a database.
I'm confused, because I've seen some questions on this site: How to install mysql on Ubuntu 16.04
But I do not know where to find mysql.
Can you tell me the steps to follow?
Thank you.
A:
Roughly the three points which are spoken about in the other thread is correct
Install mysql-server
Better upgrade the system first:
sudo apt-get update && sudo apt-get upgrade
After the system upgrade install mysql-server
sudo apt-get install mysql-server
Create a mysql root user. Normally the system should ask you for a root user password, which will be the admin password for your DB.
If this is not the case, or you'd like to change it, the following command should be helpful.
sudo mysql_secure_installation
|
Will Trump Divert Funds From Anti-Terrorism To Close Pot Shops? Cannabis CEOs Hope Not
Julie Weed
, ContributorI cover the legal marijuana industry and its entrepreneursOpinions expressed by Forbes Contributors are their own.
Julie Weed
Cannabis-infused cookies are required to be labeled with THC content in child-proof packaging
Entrepreneurs in 29 states who have been growing, testing and selling marijuana are now wondering: will President Trump’s Attorney General really divert resources from justice department priorities like stopping terrorism and dismantling gangs, to shut down neighborhood pot shops? These businesses have been operating under the Cole Memorandum which kept the Justice Department from prosecuting marijuana companies that were operating legally under their own state laws. Attorney General Sessions announced he was rescinding that memo.
Sessions’ decision directly contradicts President Trump’s statements on the campaign trail (shown in this one minute rally video) supporting federally legal medical marijuana and supporting states’ rights to make their own decisions for other adult use.
“It goes against what over half the states and half the population of the country have voted to support,” said Jeffry Paul, Vice President & Director of Sales for Cannabiniers, a company that makes “BrewBudz,” coffee, tea and cocoa infused with cannabis.
“President Trump’s platform was about creating jobs,” Paul said, and this industry “is creating thousands and thousands of jobs.”
The decision also defies the realities on the ground. More states have been expanding marijuana legalization and are collecting hundreds of millions of dollars in cannabis tax revenues. California just opened a legal market that is expected to grow to five billion dollars in sales when it becomes fully operational. The majority of Americans approve of some form of legalization which can make the supply of the substance safer, and reduce the criminal and violent activity that can otherwise accompany it.
Charles X. Gormally and John D. Fanburg, attorneys at the New Jersey law firm Brach Eichler, are studying cannabis regulation possibilities in New Jersey. They say that Sessions’ stance is a “fraught with legal contradictions,” and likely to be more symbolic than practical. They believe their state should go ahead with careful legalization.
“There is not enough prosecutorial energy or funding to pursue the industry at this point, and Congress will never provide the resources, so at this point no Attorney General would be able to put those 29 genies back in their bottles,” said Fanburg.
Caviar Gold
Legally sold marijuana product
Still, without any details about how enforcement might be carried out, the industry is feeling a chill. “This is going to slow down investment in one of the fastest growing industries,” said Paul.
Many in the marijuana business are taking a wait and see approach, carrying on with business as usual. Laura Bianchi, Director of Cannabis, Business/Corporate Transactions and Estate Planning Departments at Scottsdale’sRose Law Group says she advises clients to keep focusing on local compliance and, “try to ignore the chaotic, political, and shock-motivated headlines which have unfortunately become the norm.”
Greg James, the publisher of cannabis business magazines Marijuana Venture and Indoor Grower remains optimistic and says he doesn’t believe federal authorities will try to rein in marijuana. He’s going ahead with a planned launch of a third magazine later this spring. It’s called Marijuana Retailer and is a trade publication aimed at the retail side of the business.
For Jose Belen Founder and CEO of Mission Zero a group aimed at ending veteran suicides, the announcement goes far beyond business concerns. Belen is a combat veteran and outspoken proponent of medical marijuana cannabis which helped him overcome the PTSD that had caused him to lose his job and home. He is part of a lawsuit aiming to remove marijuana from the list of Schedule 1 drugs. “My fear is that the hundreds of thousands, if not millions, of veterans like myself will now have to live in fear of federal reprisal,” he said.
|
Search Courses in Skin Care in USA 2017
You can usually take higher education courses if you’re 18 or older. They’re regularly taught in universities, colleges and professional institutions such as art schools or agricultural colleges - nearly all of which have their own websites. You can get a wide range of skills, for example, diplomas, bachelor degrees, foundation degrees and post-graduate degrees.
Are you passionate about your skin? Are you interested in science, health, and beauty? Then you may want to take a skin care course. This type of course may help you to gain the knowledge you need to work in this field.
The United States of America is a large country in North America, often referred to as the "USA", the "US", the "United States", "America", or simply "the States". American colleges are funded by "tuition" charged to the student, which is often quite expensive, very commonly reaching into the tens of thousands of dollars per year.
Courses
AcademicCourses
USA
Location
Study type
Study type
Pace
Pace
Beauty Schools Of America
CampusFull time320 hoursSeptember 2017USAHialeah
This Electrolysis program will prepare students to be able to work alongside doctors in the growing industry of permanent hair removal. The demand in this field has been steadily increasing since it was developed in 1875. While there are more advanced forms of hair removal, Electrolysis is still a very important method because it does not only treat all hair types with permanent results, but it is also the prerequisite to obtaining a Laser Hair Removal license.
[+]
Best Courses in Skin Care in USA 2017.
(Offered at the Hialeah & Homestead campuses)
Program Objective
To prepare students for the Florida Electrolysis Council Examination to become a licensed Electrologist.
CLOCK HOURS: 320
Program Description
This Electrolysis program will prepare students to be able to work alongside doctors in the growing industry of permanent hair removal. The demand in this field has been steadily increasing since it was developed in 1875. While there are more advanced forms of hair removal, Electrolysis is still a very important method because it does not only treat all hair types with permanent results, but it is also the prerequisite to obtaining a Laser Hair Removal license. Students receive the necessary training to remove hair from the face and body using specialized equipment and techniques.
Program Requirements
HIV110 HIV/AIDS (10 Hours)
EL101 INTRODUCTION TO ELECTROLYSIS TECHNIQUES & MODALITIES (15 Hours)
EL102 COORDINATION SKILLS WITH PROBE HOLDER & FORCEPS (5 Hours)
EL103 INSERTIONS (15 Hours)
EL104 BACTERIOLOGY (10 Hours)
EL105 SANITATION/STERILIZATION PROCEDURES (10 Hours)
EL106 BASICS OF ELECTRICITY (5 Hours)
EL107 HANDS ON EQUIPMENT GALVANIC, THERMOLYSIS, & BLEND (15 Hours)
EL108 BIOLOGY OF HAIR GROWTH (10 Hours)
EL109 INTEGUMENTARY SYSTEM (10 Hours)
EL110 SKIN ASSESSMENT (15 Hours)
EL111 ENDOCRINE SYSTEM (10 Hours)
EL112 CIRCULATORY & NERVOUS SYSTEM (10 Hours)
EL113 CLIENT ASSESSMENT (10 Hours)
EL114 CONSULTATION (20 Hours)
EL115 BUSINESS MANAGEMENT (10 Hours)
EL116 FLORIDA LAW FOR ELECTROLYSIS (10 Hours)
EL117 VISUALS/LIBRARY (10 Hours)
EL118 CLIENT PRE/POST TREATMENT (5 Hours)
EL119 GENERAL TREATMENT PROCEDURE (105 Hours)
EL120 EXAM PREPARATION (10 Hours)
Services Required
CLIENT/SKIN ASSESSMENT; PRE/POST TREATMENT (15 Services)
CONSULTATION/GENERAL TREATMENT (120 Services)
COORDINATION SKILLS (20 Services)
HANDLING EQUIPMENT, MODALITIES OF ELECTRICITY (15 Services)
REVIEW/EXAM PREPRATION (10 Services)
SANITATION/STERILAZATION (190 Services)
VISUALS/LIBRARY (10 Services)
All hours and services are those required by the Florida Department of Health (DOH).
Note: All programs are taught in a cycle. Students are able to start at any point of the cycle and still fulfill all program requirements.
Books
Electrolysis, Thermolysis and the Blend: The Principles and Practice of Permanent Hair Removal Book, Electrolysis Exam Review: An Excellent Guide for Students of Practitioners Preparing for Regulatory or National Certification Book, and The Blend Method Book.
Equipment / Materials
Students will receive a uniform, an equipment bag and an electrolysis kit with all the necessary instruments and materials to perform the required services.
Graduation
After a student completes 320 hours, services, exams and fulfills all financial obligations to the school, a certificate will be awarded.
Completion Time
Completion time depends on the number of hours the student attends weekly. Based on a 25 hour per week schedule, the normal time frame of completion would be 3 months.
Method of Payment
Tuition and fee payments may be arranged on a weekly or monthly basis. The first payment is due on the first day of class, and on the same day of every week or month thereafter.
Cost of Attendance for the entire program:
Tuition
Fees
Books & Supplies
Total
$ 2,500.00
$100.00
$ 420.00
[-]
Beauty Schools Of America
CampusFull time300 hoursSeptember 2017USAMiami Beach
The Makeup Artist and Skin Care program is designed to teach the skills and knowledge required of makeup technicians in spas, salons, and as representatives of major makeup companies. Students learn to perform complete facials and skin treatments, as well as the basics of traditional and artistic makeup. The course teaches techniques and resources to use in order to meet client needs for specific care.
[+]
(Offered at the Hialeah, Miami, Homestead & South Beach campuses)
Program Objective
To prepare students to meet the State of Florida mandated requirements to become a licensed Facial Specialist, as well as learn the basics of Makeup Artistry.
CLOCK HOURS: 300
Program Description
The Makeup Artist and Skin Care program is designed to teach the skills and knowledge required of makeup technicians in spas, salons, and as representatives of major makeup companies. Students learn to perform complete facials and skin treatments, as well as the basics of traditional and artistic makeup. The course teaches techniques and resources to use in order to meet client needs for specific care. Students receive practical, hands-on experience and learn professional business skills needed to succeed in a growing and competitive industry. Graduates possess the basic knowledge to become makeup artists, retail sales specialists, and skin care consultants.
Program Requirements
HIV104 HIV/AIDS (4 Hours)
BMU101 MAKEUP (36 Hours)
SKI101 ETHICS (2 Hours)
SKI102 PRODUCT CHEMISTRY (10 Hours)
SKI103 HAIR REMOVAL (8 Hours)
SKI104 BASICS OF ELECTRICITY (10 Hours)
SKI105 SANITATION (10 Hours)
SKI106 FLORIDA LAWS FOR SKIN (5 Hours)
SKI107 SKIN THEORY, DISEASES & DISORDERS OF THE SKIN (85 Hours)
SKI108 FACIAL TECHNIQUES & CONTRAINDICATIONS (130 Hours)
Services Required
EYELASH APPLICATION (10 Services)
FACIALS (40 Services)
HAIR REMOVAL (20 Services)
LASH & BROW TINTING (10 Services)
MAKEUP APPLICATION (10 Services)
MANUAL EXTRACTIONS (5 Services)
SET/USE/MAINTAIN ELECTRICAL DEVICES (5 Services)
SANITATION (100 Services)
All hours and services are those required by the Florida Department of Business and Professional Regulation (DBPR).
Note: All programs are taught in a cycle. Students are able to start at any point of the cycle and still fulfill all program requirements.
Books
Milady’s Standard Esthetics Fundamentals Textbook.
Equipment / Materials
Students will receive a uniform, an equipment bag, and a facial and makeup kit with all the necessary instruments and materials to perform the required services.
Graduation
After a student completes 300 hours, services, exams and fulfills all financial obligations to the school, a certificate will be awarded.
Completion Time
Completion time depends on the number of hours the student attends weekly. Based on a 25 hour per week schedule, the normal time frame of completion would be 2¾ months.
Method of Payment
Tuition and fee payments may be arranged on a weekly or monthly basis. The first payment is due on the first day of class, and on the same day of every week or month thereafter.
Cost of Attendance for the entire program:
Tuition
Fees
Books & Supplies
Total
$ 2,792.58
$100.00
$ 574.50
$3,467.08
*Overall Placement Rate: 89.17%
Note: The placement rate was calculated using the accrediting agency formula.
[-]
Beauty Schools Of America
CampusFull time650 hoursSeptember 2017USAHialeah
The Electrolysis and Laser Technician program gives the student multiple licenses so he/she can become a highly marketable employee. Students will learn basic facials, makeup artistry, and various methods of hair removal, whether it be temporary or to permanently remove hair from the face and body using specialized equipment and techniques.
[+]
Best Courses in Skin Care in USA 2017.
(Offered at the Hialeah & Homestead campuses)
Program Objective
To prepare students to meet the State of Florida mandated requirements and for the Florida Electrolysis Council Examination so they can become licensed Facial Specialist and Electrologist, as well as to prepare them for the Society for Clinical and Medical Hair removal, Inc. to become a Laser Technician.
CLOCK HOURS: 650
Program Description
The Electrolysis and Laser Technician program gives the student multiple licenses so he/she can become a highly marketable employee. Students will learn basic facials, makeup artistry, and various methods of hair removal, whether it be temporary or to permanently remove hair from the face and body using specialized equipment and techniques. This program will prepare you with the knowledge to work in clinics, day spas, health spas and spa resorts or salons among other settings.
Program Requirements
HIV104 HIV/AIDS (4 Hours)
HIV110 HIV/AIDS (10 Hours)
BMU101 MAKEUP (36 Hours)
EL101 INTRODUCTION TO ELECTROLYSIS TECHNIQUES & MODALITIES (15 Hours)
EL102 COORDINATION SKILLS WITH PROBE HOLDER & FORCEPS (5 Hours)
EL103 INSERTIONS (15 Hours)
EL104 BACTERIOLOGY (10 Hours)
EL105 SANITATION/STERILIZATION PROCEDURES (10 Hours)
EL106 BASICS OF ELECTRICITY (5 Hours)
EL107 HANDS ON EQUIPMENT GALVANIC, THERMOLYSIS, & BLEND (15 Hours)
EL108 BIOLOGY OF HAIR GROWTH (10 Hours)
EL109 INTEGUMENTARY SYSTEM (10 Hours)
EL110 SKIN ASSESSMENT (15 Hours)
EL111 ENDOCRINE SYSTEM (10 Hours)
EL112 CIRCULATORY & NERVOUS SYSTEM (10 Hours)
EL113 CLIENT ASSESSMENT (10 Hours)
EL114 CONSULTATION (20 Hours)
EL115 BUSINESS MANAGEMENT (10 Hours)
EL116 FLORIDA LAW FOR ELECTROLYSIS (10 Hours)
EL117 VISUALS/LIBRARY (10 Hours)
EL118 CLIENT PRE/POST TREATMENT (5 Hours)
EL119 GENERAL TREATMENT PROCEDURE (105 Hours)
EL120 EXAM PREPARATION (10 Hours)
LA101 LASER (30 Hours)
SKI101 ETHICS (2 Hours)
SKI102 PRODUCT CHEMISTRY (10 hours)
SKI103 HAIR REMOVAL (8 Hours)
SKI104 BASICS OF ELECTRICITY (10 Hours)
SKI105 SANITATION (10 Hours)
SKI106 FLORIDA LAWS FOR SKIN (5 Hours)
SKI107 SKIN THEORY, DISEASES & DISORDERS OF THE SKIN (85 Hours)
SKI108 FACIAL TECHNIQUES & CONTRAINDICATIONS (130 Hours)
Services Required
EYELASH APPLICATION (10 Services)
FACIALS (40 Services)
HAIR REMOVAL (20 Services)
LASH & BROW TINTING (10 Services)
MAKEUP APPLICATION (10 Services)
MANUAL EXTRACTIONS (5 Services)
SET/USE/MAINTAIN ELECTRICAL DEVICES (5 Services)
SANITATION (100 Services)
COORDINATION SKILLS (20 Services)
HANDLING EQUIPMENT, MODALITIES OF ELECTRICITY (15 Services)
CLIENT/SKIN ASSESSMENT; PRE/POST TREATMENT (15 Services)
VISUALS/LIBRARY (10 Services)
REVIEW/EXAM PREPRATION (10 Services)
CONSULTATION/GENERAL TREATMENT (120 Services)
LASER - LEG/UNDERARM/BIKINI/FACE (5 Services)
SANITATION/STERILAZATION (195 Services)
All hours and services are those required by the Florida Department of Business and Professional Regulation (DBPR) & Florida Department of Health (DOH).
Note: All programs are taught in a cycle. Students are able to start at any point of the cycle and still fulfill all program requirements.
Books
Milady’s Standard Esthetician Fundamental; Electrolysis, Thermolysis and the Blend: The Principles and Practice of Permanent Hair Removal; and Electrolysis Exam Review: An Excellent Guide for Students or Practitioners Preparing for Regulatory or National Certification Exam books.
Equipment / Materials
Students will receive a uniform, an equipment bag, and kits with all the necessary instruments and materials to perform the required services.
Graduation
After a student completes 650 hours, services, exams and fulfills all financial obligations to the school, a certificate will be awarded.
Completion Time
Completion time depends on the number of hours the student attends weekly. Based on a 25 hour per week schedule, the normal time frame of completion would be 6 months.
Method of Payment
Tuition and fee payments may be arranged on a weekly or monthly basis. The first payment is due on the first day of class, and on the same day of every week or month thereafter.
Gainful Employment
The Higher Education Act of 1965 requires proprietary and vocational colleges to provide an eligible program of training to prepare students for Gainful Employment. Below you will find information for related occupations listed for Full Specialist with Salon Management. The web link will provide information for tasks, knowledge, skills, abilities, work activities, work context, job zone, education, interests, work styles, work values, related occupations, wages and employment trends, other sources and additional information. Also included is the on-time graduation rate, tuition, fees, room and board, books and supplies, job placement rate, and median loan debt incurred.
CIP Code: 12.0404
CIP Description: Electrolysis and Laser Technician
A program that prepares individuals to permanently remove hair from the human scalp, face, and body using specialized charged solid needle probes, and to function as licensed electrologists and electrolysis technicians. Includes instruction in direct current electrolysis, alternating current/high frequency thermolysis, blend/dual modality treatments, equipment theory and operation, safety and sanitation, client evaluation and care, laws and regulations, and business practices.
SOC Code: 39-5094
SOC Description: Skin Care Specialist
http://www.onetonline.org/link/summary/39-5094.00
SOC Code: 39-1021
SOC Description: First-Line Supervisors/Managers of Personal Service Workers
http://www.onetonline.org/link/summary/39-1021.00
SOC Code: 39-1021
SOC Description: Spa Managers
http://www.onetonline.org/link/summary/39-1021.01
SOC Code: 25-1194
SOC Description: Vocational Educational Teachers/Postsecondary
http://www.onetonline.org/link/summary/25-1194.00
Cost of Attendance for the entire program:
Tuition
Fees
Books & Supplies
Total
$ 7,587.32
$100.00
$ 994.50
$ 8,681.82
Room & Board
Total with Room & Board
$ 7,427.00
$ 16,108.82
Overall Placement Rate: N/A – NEW
On-time Graduation Rate: N/A – NEW
Note: This is a new program and placement and on-time graduation rates have not been calculated.
[-]
Beauty Schools Of America
CampusFull time900 hoursSeptember 2017USAMiami Beach
The Comprehensive Facial and Makeup program is designed for students to achieve the highest quality skills in the field of Skin Care and the creative techniques that are demanded of today’s Makeup Artists. This course combines two disciplines to equip students with the knowledge, skills and attitude to work in a wide range of capacities throughout the beauty and health industry.
[+]
(Offered at the Hialeah, Miami, Homestead & South Beach campuses)
Program Objective
To prepare students to meet the State of Florida mandated requirements to become a licensed Facial Specialist, as well as a professional Makeup Artist. To help students build their confidence and prepare them for the real world.
CLOCK HOURS: 900
Program Description
The Comprehensive Facial and Makeup program is designed for students to achieve the highest quality skills in the field of Skin Care and the creative techniques that are demanded of today’s Makeup Artists. This course combines two disciplines to equip students with the knowledge, skills and attitude to work in a wide range of capacities throughout the beauty and health industry. Students will develop proficiencies in skin care, makeup beauty secrets that all professional Makeup Artists and Skin Care Specialists should know. Students undergo extensive classroom and practical training and will have the opportunity to use their skin care skills in a real life spa setting; ensuring they are fully prepared to enter the job market with the skill and confidence of a professional. They will also have the chance to build a portfolio in order to showcase their work and have an advantage when looking for work in this competitive field.
Program Requirements
HIV104 HIV/AIDS (4 Hours)
BMU101 MAKEUP (36 Hours)
CMU101 FACIAL MAKEUP (15 Hours)
CMU102 COMPLETE MAKEUP (20 Hours)
CMU103 INDUSTRY MAKEUP (40 Hours)
CMU104 VINTAGE MAKEUP (25 Hours)
CMU105 AIRBRUSH MAKEUP (25 Hours)
CMU106 AVANT-GARDE MAKEUP (15 Hours)
CMU107 FACE & BODY ART (36 Hours)
CMU108 SPECIAL EFFECTS (55 Hours)
CMU109 CAREERS AS A MAKEUP ARTIST (5 Hours)
SKI101 ETHICS (2 Hours)
SKI102 PRODUCT CHEMISTRY (10 Hours)
SKI103 HAIR REMOVAL (8 Hours)
SKI104 BASICS OF ELECTRICITY (10 Hours)
SKI105 SANITATION (14 Hours)
SKI106 FLORIDA LAWS FOR SKIN (5 Hours)
SKI107 SKIN THEORY, DISEASES & DISORDERS OF THE SKIN (85 Hours)
SKI108 FACIAL TECHNIQUES & CONTRAINDICATIONS (130 Hours)
SKI109 ADVANCED FACIAL TECHNIQUES (30 Hours)
SKI110 ADVANCED FACIAL DEVICES (30 Hours)
SKI111 ALTERNATIVE THERAPIES (30 Hours)
SKI112 AYURVEDA THEORY & TREATMENTS (30 Hours)
SKI113 BOTANICALS & AROMATHERAPY (30 Hours)
SKI114 ADVANCED SKINCARE MASSAGE(30 Hours)
SKI115 SPA TREATMENTS (30 HOURS)
SKI116 SALON & SPA MANAGEMENT (150 HOURS)
Services Required
AIRBRUSH MAKEUP (5 Services)
AVANT-GARDE MAKEUP (3 Services)
CAREER AS A MAKEUP ARTIST (1 Service)
COMPLETE MAKEUP (4 Services)
FACE & BODY ART (7 Services)
FACIAL MAKEUP (3 Services)
INDUSTRY MAKEUP (8 Services)
SPECIAL EFFECTS MAKEUP (11 Services)
VINTAGE MAKEUP (5 Services)
EYELASH APPLICATION (10 Services)
FACIALS (40 Services)
HAIR REMOVAL (20 Services)
LASH & BROW TINTING (10 Services)
MAKEUP APPLICATION (10 Services)
MANUAL EXTRACTIONS (5 Services)
SET/USE/MAINTAIN ELECTRICAL DEVICES (5 Services)
ADVANCED HAIR DEVICES (10 Services)
ADVANCED HAIR REMOVAL (10 Services)
SANITATION (120 Services)
All hours and services are those required by the Florida Department of Business and Professional Regulation (DBPR).
Note: All programs are taught in a cycle. Students are able to start at any point of the cycle and still fulfill all program requirements.
Books
Milady’s Standard Esthetics Fundamentals Textbook and the BSA Comprehensive Makeup book.
Equipment / Materials
Students will receive a uniform, an equipment bag, a facial and makeup kit with all the necessary instruments and materials to perform the required services.
Graduation
After a student completes 900 hours, services, exams and fulfills all financial obligations to the school, a certificate will be awarded.
Completion Time
Completion time depends on the number of hours the student attends weekly. Based on a 25 hour per week schedule, the normal time frame of completion would be 8 months.
Method of Payment
Tuition and fee payments may be arranged on a weekly or monthly basis. The first payment is due on the first day of class, and on the same day of every week or month thereafter. Federal Financial Aid is available for those who qualify.
Gainful Employment
The Higher Education Act of 1965 requires proprietary and vocational colleges to provide an eligible program of training to prepare students for Gainful Employment. Below you will find information for related occupations listed for Comprehensive Facial and Makeup. The web link will provide information for tasks, knowledge, skills, abilities, work activities, work context, job zone, education, interests, work styles, work values, related occupations, wages and employment trends, other sources and additional information. Also included is the on-time graduation rate, tuition, fees, room and board, books and supplies, job placement rate, and median loan debt incurred.
CIP Code: 12.0406
CIP Description: Makeup Artist Specialist
Comprehensive Facial and Makeup includes occupations such as Skin Care Specialists and Makeup Artists.
SOC Code: 39-5094
SOC Description: Skin Care Specialists
http://www.onetonline.org/link/summary/39-5094.00
SOC Code: 39-5091
SOC Description: Makeup Artists, Theatrical and Performance
http://www.onetonline.org/link/summary/39-5091.00
Cost of Attendance for the entire program:
Tuition
Fees
Books & Supplies
Total
$ 12,272.00
$100.00
$ 574.50
$ 12,946.50
Room & Board
Total with Room & Board
$ 9,549.00
$22,495.50
Overall Placement Rate: 84.88%
On-time Graduation Rate: 70%
Note: The placement rate was calculated using the accrediting agency formula.
Students borrowing for the Comprehensive Facial and Make-Up program have a median loan total indebtedness of $8576.00. Monthly payments for the Direct Loan program can start at $50.00. To calculate your monthly repayment amount for your total student loan borrowed you can access www.finaid.org/calculators.
Median Loan Debt for Private Educational Loans after graduation: N/A
Median Loan Debt for Institutional Loan debt after graduation: N/A
[-]
|
American Labor Party (1932)
The American Labor Party was the final name of a De Leonist splinter group in the US in the early 1930s. The ALP had split from the Industrial Union League, which in turn had split from the Socialist Labor Party in the late 1920s.
The leader of the organization was Joseph Brandon, who had been a founding member of the IUL. Brandon insisted that a socialist industrial union had to be created before a party could be established. He was expelled from the IUL in April 1932. Brandon took a few sympathizers and formed the Industrial Union Alliance. When, by the summer of 1933, it became clear that the IUL would turn itself into a political party Brandon tried to reunify with them and changed his organizations name to the Industrial Union Party on June 11. The Industrial Union League changed its name to the Industrial Union Party on June 14, and filed an injunction against the Brandon faction from using the name. In the New York Supreme Court case Brandon v. Brandon the court sided with the majority group. On October 5 the Brandon group filed a slate of candidates for the November 7 New York municipal election as the "Indus Union". Joseph Brandon was nominated for mayor, Julian Diamond for City Controller, and Harold Leby for president of the Board of Aldermen. Later the name seemed to change to the Industrial Labor party. However, Joseph V. McKee and his Recovery party brought a suit before the New York City Board of Elections and tried to get several minor parties off the ballot, including the Socialist Labor and regular Industrial Union tickets. Brandon's ticket was the only one to be removed.
By December 10 the group had apparently settled on the name American Labor Party and taken up headquarters at 149 East 42nd street. On January 21 a "Daniel De Leon Forum" was held at the same location when Brandon debated Howard Y. Williams on the efficacy of a Farmer-Labor Party. Brandon debated Jay Bambrick at this same "forum" on February 18. The relationship between this "forum" and the American Labor Party is unclear, but it had at least two events without Brandon: James Oneal give a talk on early American labor thinkers that Christmas Eve, and heard a lecture on the NRA by James Greenhut on March 4, 1935. On June 28, 1935 Brandon gave a talk on the "Policy of the American Labor Party" at the "Industrial Workers School" at 94 Fifth Avenue.
The Industrial Union Party itself largely ignored Brandon thereafter, except ridiculing him for his numerous changes of position and line as "Zig-Zag" Brandon.
The party published nine issues of a monthly periodical American Labor Bulletin until September 1934. This was changed to Labor Power in October 1934, but continued the same numbering. The last known issue was numbered Vol. II #6 June 1935.
Sources
Publications
Joseph Brandon Workers Party vs. Socialist Labor Party New York: Socialist Labor Party, 1925 Arm & hammer pamphlets #8
Joseph Brandon Ethics and principles of unionism Bronx, N.Y. : Industrial Union League, 1929
Joseph Brandon Technocracy or democracy; which shall govern our industries? Hollis, N.Y., C.A. Baker, 1933
Joseph Brandon Industrial union alliance: manifesto. New York : The Author, 1933
American Labor Party Labor and state capitalism New York: Labor Party, 1934
American Labor Party Socialism--the basis for happiness. New York, N.Y. 1934
American Labor Party Way out of the depression New York, N.Y. 1934
Category:Political parties established in 1932
Category:Defunct socialist parties in the United States
Category:Political parties disestablished in 1935
Category:Defunct DeLeonist parties in the United States
Category:1932 establishments in the United States
Category:1935 disestablishments in the United States
|
6.31.7 CR16 Function Attributes
These function attributes are supported by the CR16 back end:
interrupt
Use this attribute to indicate that the specified function is an interrupt handler. The compiler generates function entry and exit sequences suitable for use in an interrupt handler when this attribute is present.
|
Business model: Most Costco members don't shop at Costco all that much In many ways, its business model isn't what you think it is.
Daniel B. Kline | The Motley Fool
Show Caption Hide Caption This new Costco hack gets you into the club without paying With their exclusive offers and membership fees, some grocery stores seem more like a New York nightclub. If you don’t know someone on the inside, you’re not getting in. Josh King has the story (@abridgetoland).
Costco (NASDAQ: COST) markets itself as a warehouse club where, in exchange for a membership fee, consumers get access to a variety of food, merchandise and services at discounted prices.
Of course, the company does offer those things, but that's not really the chain's business model. In many ways, Costco operates like a gym. It sells memberships knowing that many of its members won't show up. It's not upset if they do — and it takes care of its members who spend the most — but, in reality, it only needs customers to see the value of joining, not actually have them do any shopping.
How does the gym model work?
Discount gym chains such as Planet Fitness (NYSE: PLNT) actually market to people the company knows won't show up. That's why the chain's average gym has 6,500 members while only about 300 could be accommodated at any given time, NPR's All Things Considered reported in December 2014.
Essentially, when many people join a gym, they do so with the best of intentions. They want to be healthier and get into better shape. Even as they rarely or never go, they stay members because the idea that they will someday become regulars.
The gym doesn't need to serve that audience. Instead, it can focus on a smaller group of dedicated customers who work out most days and keep them happy, while also showing less engaged members that the whole enterprise does work, which keeps them from quitting.
Costco's business works the same way. Members are lured in by the prospect of saving money, and even if they don't take advantage, they renew because they intend to in the future.
The chain makes about 75% of its profits from membership fees, and a big piece of the remaining 25% comes from its best customers who spend much more than the average member. Like a gym, the warehouse club makes money whether people come in or not, and its sales are just icing on the cake.
More: Toys R Us may file for bankruptcy before the holidays: Report
More: Future of payments: Are digital wallets doomed to fail?
More: Report: Walgreens' deal to buy half of Rite Aid's stores near approval
How does Costco make its money?
The chain uses low prices to entice people to pay either $60 for its basic "Gold Star" membership or $120 for an Executive membership, which gives members 2% cash back on eligible purchases until they earn $1,000 back. Either membership gets people in the door to the warehouse club, but Costco knows that only Executive members are likely to take significant advantage of its low prices.
During the chain's earnings calls each quarter, CFO Richard Galanti notes the growth in Executive memberships. He then points out that about one-third of its customers pay the higher price to join, but that they account for two-thirds of sales.
Costco closed Q3 with 18.3 million Executive members who generated roughly $20 billion of its $28.2 billion total sales, excluding membership fees. Its 37.8 million Gold Star members accounted for only about $8 billion.
That's rough math, but it shows a clear disparity between the warehouse club's two classes of members. Even though the figures aren't exact, the data shows that during Q3, Gold Star members spent about $211 each, while Executive members averaged $1,092.
Nordstrom’s new store won’t sell clothes It will instead offer personal stylists, manicures and beer.
It's about memberships
Costco isn't selling goods and services. It's using those things to get people to buy memberships. Gold Star members shop at the chain often enough to see the value of renewing, but probably not often enough to make remaining a member worth their while.
In theory, that's a danger for the chain, but just as consumers will pay $10 a month to maintain the illusion that they might visit Planet Fitness, they're willing to do the same with the warehouse club. Costco offers the promise of spending less money, and for a large percentage of its audience, that's enough to keep them hooked.
Daniel B. Kline has no position in any of the stocks mentioned. The Motley Fool recommends Costco Wholesale and Planet Fitness. The Motley Fool has a disclosure policy.
The Motley Fool is a USA TODAY content partner offering financial news, analysis and commentary designed to help people take control of their financial lives. Its content is produced independently of USA TODAY.
Offer from the Motley Fool: 10 stocks we like better than Costco Wholesale
When investing geniuses David and Tom Gardner have a stock tip, it can pay to listen. After all, the newsletter they have run for over a decade, Motley Fool Stock Advisor, has tripled the market.*
David and Tom just revealed what they believe are the 10 best stocks for investors to buy right now... and Costco Wholesale wasn't one of them! That's right — they think these 10 stocks are even better buys.
Click here to learn about these picks!
*Stock Advisor returns as of September 5, 2017
|
Zuckerberg: I want to cure all diseases this century (2016) - JumpCrisscross
http://www.cnbc.com/2016/04/27/zuckerberg-i-want-to-cure-all-diseases-this-century.html
======
tabeth
Three questions here: 1\. Has he cured even one? 2\. Cure them for whom? 3\.
How much is a cure?
I would argue that with proper utilization of the world's technology today and
proper incentives of the world's behavior, most incidence of disease could be
eradicated now. For example, fast food for example leads to heart disease [1]
I believe it's easier to make fast food extremely expensive to the point where
no one would want to eat it and consequently there will be a significant
decrease in the occurrence of heart disease, compared to curing heart disease.
There are MANY examples of things like this.
[1]
[https://www.heart.org/HEARTORG/HealthyLiving/HealthyEating/D...](https://www.heart.org/HEARTORG/HealthyLiving/HealthyEating/DiningOut/Eating-
Fast-Food_UCM_301473_Article.jsp)
|
Q:
Datetime conversion error when deploying a SQL script through NANT
Right, this is winding me up and has baffled the finest minds in our organisation, so I thought I'd put it to the community here.
He have a NANT build script which performs a build of a local development environment. This includes file copying dll registering and (SQL Server 2000) database building.
The problem I am getting with the database build section.
The database build is seemingly working on every workstation on which it is run, except for one.
The NANT build script files off a number of scripts:
Drop existing database
Create new database
Create logins/users
Add core tables and data
Add programatic entities.
These are standard TSQL statements which can be provided, but I'm omitting them presently due to their size.
When completing step 3 and moving onto step 4 it reports the following error:
[sql] 6 records affected
[echo] Loading core data...
[sql] Changed database context to 'OurDatabase'.
[sql] SQL Error: The statement has been terminated.
[sql] The conversion of a char data type to a datetime data type resulted in an out-of-range datetime value.
[sql] Statement: USE OurDatabase
[sql] -- data inserts for table OurTable
[sql] INSERT INTO OurTable(Field1, Field2) VALUES ('Val1', 'Val2')
....
Here is a the nant build step that is casing the problem:
<sql connstring="${sql.connectionstring}"
transaction="false"
delimiter="GO"
delimstyle="Line"
batch="false"
print="false"
source="${svn.temp.directory}sql\isapi\coredata.sql"
verbose="false" />
The SQL script itself starts like:
USE ISAPI_Security
-- data inserts for table AE_AuditType
INSERT INTO OurTable(Field1, Field2) VALUES ('Val1', 'Val2')
....
Later on there are some date/time fields that are populated, however when the SQL Scripts are run manually there are no reported errors.
What baffles me is that the error message above seems to imply that the datetime conversion error is occuring on the execution of the use OurDatabase statement, which stuck me as hihgly implausible.
Does anyone have any explanation of this in any way?
A:
Martin's suggestion in the comments to my question resolved the issue
The default language was set to 'British English' when I just needed 'English'. I was able to configure this by accessing the user properties through management studio.
|
---
abstract: |
The interpretation of future precise experiments on atomic parity violation in terms of parameters of the Standard Model could be hampered by uncertainties in the atomic and nuclear structure. While the former can be overcome by measurement in a series of isotopes, the nuclear structure requires knowledge of the neutron density. We use the nuclear Hartree–Fock method, which includes deformation effects, to calculate the proton and neutron densities in $^{125}$Cs – $^{139}$Cs. We argue that the good agreement with the experimental charge radii, binding energies, and ground state spins signifies that the phenomenological nuclear force and the method of calculation that we use is adequate. Based on this agreement, and on calculations involving different effective interactions, we estimate the uncertainties in the differences of the neutron radii $\delta
\langle r^2 \rangle_{N,N'}$ and conclude that they cause uncertainties in the ratio of weak charges, the quantities determined in the atomic parity nonconservation experiments, of less than $10^{-3}$. Such an uncertainty is smaller than the anticipated experimental error.
author:
- 'B. Q. Chen'
- 'P. Vogel'
---
Atomic parity nonconservation and neutron radii in cesium isotopes
W. K. Kellogg Radiation Laboratory, 106–38\
California Institute of Technology, Pasadena, CA 91125
Norman Bridge Laboratory of Physics, 161–33\
California Institute of Technology, Pasadena, CA 91125
INTRODUCTION
============
Precision studies of electroweak phenomena provide very important tests of the $SU(2)_L \times U(1)$ Standard Electroweak Model. The measurement of the parity nonconserving (PNC) components of the atomic transitions belongs to this class. It offers a unique opportunity for testing the electroweak radiative corrections at the one loop level, and, possibly, to search for new physics beyond the standard model [@Lan; @Mar].
The PNC effects in atoms are caused by the $\gamma, Z^0$ interference in the electron–nucleus interaction. The dominant contribution comes from the coupling of the axial electronic current to the vector nuclear current. (The interaction of the electronic vector current with the nuclear axial current is weaker in heavy atoms, and can be eliminated by summing over the PNC effects in the resolved hyperfine components of the atomic transitions. The hyperfine dependent effect, which also includes the nuclear anapole moment, is of interest in its own right [@Khr; @Hax], but is not considered hereafter.) Since the vector current is conserved, atomic PNC essentially measures the electroweak coupling of the elementary quarks.
At the present time, PNC measurements in stable $^{133}$Cs atoms have $\pm$2% experimental uncertainty [@Wie1]. (An earlier experiment in Cs was performed by Bouchiat [*et al.*]{} [@Bouch]; the studies of PNC effects in atoms have been reviewed by Commins [@Com] and Telegdi [@Tel].) However, improvement by an order of magnitude in the experimental accuracy is anticipated and a possibility of measuring PNC effects in unstable cesium and francium isotopes has been discussed [@Wie2]. At this level, two issues must be resolved before an interpretation of the PNC data in terms of the fundamental electroweak couplings is possible. The atomic theory, even in its presently most sophisticated form [@Sap; @Flam], introduces about $\pm$1% uncertainty. Moreover, the small but non–negligible effects of nuclear size [@For; @Poll] must be addressed. This latter problem is the main topic of the present work.
Atomic PNC is governed by the effective bound electron–nucleus interaction (when taking only the part that remains after averaging over the hyperfine components) of the form $$H_{PNC} = \frac{G_F}{2\sqrt{2}} \int [ -N\rho_n ({\bf r })
+ Z (1 - 4 \sin^2 \theta_W ) \rho_p ({\bf r }) ] \times
\psi_e^{\dagger} \gamma_5 \psi_e d^3r ~,$$ where the proton and neutron densities $\rho_{p,n}({\bf r })$ are normalized to unity, and we have assumed the Standard Model nucleon couplings $$C_{1p} \equiv 2C_{1u} + C_{1d}
= \frac{1}{2} (1 - 4 \sin^2 \theta_W ) ~,$$ $$C_{1n} \equiv C_{1d} + 2C_{1u} = - \frac{1}{2} ~.$$ The electron part in Eq. (1) can be parametrized as [@For; @Poll] $$\rho_5 (r) \equiv
\psi_p^{\dagger} \gamma_5 \psi_s = C(Z){\cal N}(Z,R)f(r) ~,$$ where $C(Z)$ contains all atomic structure effects for a point nucleus, ${\cal N}$ is a precisely calculable normalization factor, and $f(r)$ describes the spatial variation (normalized such that $f(0) = 1$). It is the integrals $$q_{n,p} = \int f(r) \rho_{p,n}({\bf r })d^3r \label{qf}$$ that determine the effect of the proton and neutron distributions on the PNC observables.
The formfactors $f(r)$ can be calculated to the order $(Z\alpha)^2$ for a sharp nuclear surface of radius $R$ [@For; @Poll], $$f(r) \simeq 1 - \frac{1}{2} (Z\alpha)^2 [(r/R)^2 -
\frac{1}{5}(r/R)^4 ] ~. \label{ff}$$ For a diffuse nuclear surface numerical evaluation of $f(r)$ is necessary (see below). However, the coefficients at $\langle r^2
\rangle$ and $\langle r^4 \rangle$ remain numerically of the order $(Z\alpha)^2$ and depend only weakly on the exact shape of $\rho_{p,n}({\bf r})$. In addition, since the electric potential near the nucleus is very strong, one can safely neglect atomic binding energies in the evaluation of $f(r)$. Below we will separate the effects of the finite nuclear size (i.e., effects related to the deviations of $q_{n,p}$ from unity); these terms will be represented by a nuclear structure correction to the weak charge.
Taking the matrix element of $H_{PNC}$, one obtains $$\langle i| H_{PNC} |j \rangle
= \frac{G_F}{2\sqrt{2}}C(Z){\cal N}[ Q_W(N,Z) + Q_W^{nuc} (N,Z)] ~,$$ where $Q_W(N,Z)$, the quantity of primary interest from the point of view of testing the Standard Model, is the “weak charge.” In the Standard Model, with couplings (2) and (3), the weak charge is $$Q_W = -N + Z(1 - 4\sin^2\theta_W) ~. \label{Qweak}$$ The nuclear structure correction $Q_W^{nuc}(N,Z)$ describes the part of the PNC effect that is caused by the finite nuclear size. In the same approximation as Eq. (8) above $$Q_W^{nuc} = -N(q_n - 1) + Z(1 - 4\sin^2\theta_W)(q_p - 1) ~,
\label{Qnuc}$$ where $q_{n,p}$ are the integrals of $f(r)$ defined above. (Nuclear structure also affects the normalization factor ${\cal N}$, which is, however, determined by the known nuclear charge distribution [@For; @Poll].)
In a measurement that involves several isotopes of the same element, ratios of the PNC effects depend essentially only on the ratio of the weak charges and the corresponding nuclear–structure corrections $Q_W(N,Z) + Q_W^{nuc}(N,Z)$. (The dependence ${\cal N}$ on the neutron number $N$ will not be considered here.) The ratios of the nuclear–structure corrected weak charges, in turn, depend, to a good approximation, only on the [*differences*]{} $\Delta q_n$ of the neutron distributions in the corresponding isotopes. The uncertainties in these quantities, or equivalently, in the differences of the neutron mean square radii $\delta(\Delta \langle
r^2 \rangle_{N,N'})$, then ultimately limit the accuracy with which the fundamental parameters, such as $\sin^2 \theta_W$, can be determined.
It is the purpose of this work to evaluate quantities $q_{n,p}$ for a number of cesium isotopes, which might be used in future high–precision PNC experiments [@Wie2]. Moreover, we estimate the uncertainty in these quantities, respectively in their differences, since they represent the ultimate limitations for the interpretation of the PNC measurements.
In section II we describe the nuclear Hartree–Fock calculations that we performed. In section III we compare the calculated binding energies, ground state spins and charge radii with the experiment. There we also discuss how corrections for the zero–point vibrational motion can be estimated and added. From the spread between the results obtained with two different successful effective Skyrme forces, and from the pattern of deviations between the calculated and measured isotope shifts in the charge radii, we then estimate the uncertainties in the corresponding differences of the neutron radii. Finally, in section IV, we calculate the nuclear–structure corrections to the weak charges $Q_W^{nuc}(Z=55,N=72-84)$ and their uncertainties and discuss the corresponding limiting uncertainties in the determination of the fundamental parameters of the Standard Model. (Our notation follows that of Ref. [@Poll]. Others, e.g., Ref. [@Sap] do not explicitly separate the nuclear structure dependent effects. We believe that such a separation is very useful, since, as stated above, $f(r)$ in Eq. (\[ff\]) and hence also $q_{n,p}$, Eq. (\[qf\]), are essentially independent of atomic structure.)
NUCLEAR HARTREE–FOCK CALCULATION
================================
As demonstrated by numerous calculations, the microscopic description of nuclear ground state properties by means of the Hartree–Fock (HF) method with an effective Skyrme force–like interaction is remarkably successful [@QF78; @BF85]. The few adjustable parameters in the Skyrme force are chosen to fit the various bulk properties (energy per nucleon, compressibility modulus, symmetry energy, etc.), and properties of several doubly magic nuclei (binding energies, charge radii, etc.) [@VB72]. The two most popular sets of Skyrme parameters, namely Skyrme III and SkyrmeM$^*$ have been successfully employed to describe the properties of nuclei in several regions of the periodic table [@BF75; @BQ82]. Below we show only a few formulae essential to the basic understanding of the numerical calculation that we performed; details can be found in the quoted references.
The generalized Skyrme force (including all possible spin–exchange terms and zero–range density–dependent interaction) can be written as, $$\begin{aligned}
V_s = & & t_0 ( 1 + x_0 {P_\sigma}) \delta + {1\over2} t_1 ( 1 + x_1
{P_\sigma})
({\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi k}}^2 \delta +
\delta {{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi k}}}'^2) +
t_2 (1 + x_2) {P_\sigma} {{\hbox{\font\twelvebi=cmmib10 at 12pt
\twelvebi k}}} \cdot
\delta {{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi k}}}'
\nonumber\\
& & + { 1 \over 6} t_3 \rho^{\alpha} \delta +
i W({\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char 27}}_1 +
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char 27}}_2) \cdot
{{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi k}}} \times \delta
{{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi k}}}' ~, \label{SF}\end{aligned}$$ where $t_{0-3}, x_{0-2}$ and $W$ are the adjustable parameters, and $\delta \equiv \delta({\bf r - r'})$.
Because we are dealing with odd–A nuclei, the unpaired nucleon introduces terms that break time–reversal symmetry in the HF functional. When the spin degrees of freedom are taken into account, the breaking of time reversal symmetry leads to a rather complicated functional [@EB75; @BF87]. The total energy $E$, which is minimized in the HF method, can be written as a space integral of a local energy density $$E = \int {\cal H}({{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi
r}}}) d^3 {{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi r}}} ~,$$ with $$\begin{aligned}
{\cal H}({\bf r}) = & &{\hbar^2 \over 2 m } \tau +
B_1 \rho^2 + B_2 (\rho_n^2 + \rho_p^2) + B_3 (\rho \tau -
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi j}}^2) +
B_4 ( \rho_n \tau_n - {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi
j}}_n^2 + \rho_p \tau_p - {\hbox{\font\twelvebi=cmmib10 at 12pt
\twelvebi j}}_p^2)
\nonumber \\
& & + B_5 \rho \Delta \rho + B_6 (\rho_n \Delta \rho_n + \rho_p
\Delta \rho_p) +
B_7 \rho^{2+\alpha} + B_8 \rho^{\alpha} (\rho_n^2 + \rho_p^2)
\nonumber \\
& & + B_9 (\rho {\hbox{\font\twelvebs=cmbsy10 at 12pt \twelvebs\char
"072}} \cdot {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi J}} +
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi j}} \cdot
{\hbox{\font\twelvebs=cmbsy10 at 12pt \twelvebs \char "072}} \times
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char 26}} + \rho_n
{\hbox{\font\twelvebs=cmbsy10 at 12pt \twelvebs \char "072}} \cdot
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi J}}_n +
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi j}}_n \cdot
{\hbox{\font\twelvebs=cmbsy10 at 12pt \twelvebs \char "072}}
\times {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char 26}}_n
+ \rho_p {\hbox{\font\twelvebs=cmbsy10 at 12pt \twelvebs \char "072}}
\cdot {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi J}}_p +
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi j}}_p \cdot
{\hbox{\font\twelvebs=cmbsy10 at 12pt \twelvebs \char "072}} \times
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char 26}}_p)
\nonumber \\
& & + B_{10} {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char
26}}^2 + B_{11} ({\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi
\char 26}}_n^2 + {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi
\char 26}}_p^2) + B_{12}
\rho^{\alpha}
{\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char 26}}^2 + B_{13}
\rho^{\alpha} ({\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char
26}}_n^2 + {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi \char
26}}_p^2) +
E_C ~. \label{HFD}\end{aligned}$$ For complete expressions of the Coulomb energy $E_C$ and the coefficients $B_i ( i = 1, \dots , 13 )$ see Ref. [@BF87], where the dependence on Skyrme force parameters in Eq. (\[SF\]) is given. The mass densities $\rho_\tau$, kinetic density $\tau_\tau$, current density ${\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi j}}_\tau$, spin–orbit density ${\hbox{\font\twelvebs=cmbsy10 at 12pt \twelvebs
\char "072}} \cdot {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi
J}}_\tau$ and vector density ${\hbox{\font\twelvebi=cmmib10 at 12pt
\twelvebi \char 26}}_\tau (\tau = {n, p})$ in Eq. (\[HFD\]) can, in turn, be expressed in terms of the single–particle wave functions $\Phi_k$. The variation of $E$ with respect to $\Phi_k^*({\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi r}},
\sigma)$ defines the one–body Hartree–Fock hamiltonian $h$ [@BF87].
In the following we will use the mass densities $\rho_\tau$, which can be expressed as $$\rho({\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi r}}) =
\sum_{k,\sigma} v_k^2 | \Phi_k({\hbox{\font\twelvebi=cmmib10 at 12pt
\twelvebi r}}, \sigma)|^2 ~.$$ Here $\Phi_k({\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi r}},
\sigma)$ denotes the component of the $k$th single–nucleon wave function with spin ${1\over2} \sigma (\sigma = \pm 1)$ along the $z$ direction, and $v_k^2$ are the BCS occupation factors (see below). The expressions for the other densities are again given in Ref. [@BF87].
The mean square proton and neutron radii are given by the usual formulae $$r^2_\tau = \int r^2 \rho_\tau({\hbox{\font\twelvebi=cmmib10 at 12pt
\twelvebi r}}) d^3 {\hbox{\font\twelvebi=cmmib10 at 12pt \twelvebi
r}} ~.$$
In this work, two discrete symmetries, namely parity and $z$–signature, are imposed on the wave functions [@BF85; @BF87]. The complete description of a wave function requires four real functions corresponding to the real, imaginary, spin–up and spin–down parts of $\Phi_k$ [@BF87].
The numerical approximation to the HF energy $E$ is obtained by a discretization of the configuration space on a three–dimensional rectangular mesh. The mesh size $\Delta x$ is the same in the three directions and the abscissae of the mesh points are ${1\over2} (2 n
+ 1) \Delta x$. In this work, $\Delta x$ is $0.8~\hbox{fm}$, and the mesh size is $16 \times 16 \times 16$. The numerical procedure is described in detail in Ref. [@BF85].
Pairing correlations need to be included in a realistic description of medium and heavy nuclei. We choose to describe pairing between identical nucleons within the BCS formalism using a constant strength seniority force [@BF85]. In the usual BCS scheme, the paired states are assumed to be the two time–reversed orbitals $\Phi_k$ and $\Phi_{\hat k}$. Although time reversal symmetry is broken in our calculations of odd–A nuclei, the time–reversal breaking terms in the functional generated by the unpaired odd nucleon are very small compared to the time–reversal conserving terms so that the time reversal symmetry is still approximately good. In our calculation we define the pairing partner $\Phi_{\hat
k}$ of state $\Phi_k$ to be the eigenstate of $h$ whose overlap with $\hat T \Phi_k$ is maximal ($\hat T$ is the time–reversal operator). Because the single particle orbital occupied by the unpaired nucleon and its signature partner do not contribute to the pairing energy, we introduce blocking in our code to prevent these two orbitals from participating in pairing and force their BCS occupation numbers to be $1$ and $0$, respectively.
As some of the cesium isotopes considered here are deformed, it is very important to take the deformation degrees of freedom into account. The method of solving the HF+BCS equations by discretization of the wave functions on a rectangular mesh allows any type of even multipole deformation. The deformation energy curves are obtained by a constraint on the mass quadrupole tensor $Q_{ij} = (3 x_i x_j - r^2
\delta_{ij})$. The two discrete symmetries of the wave functions $\Phi_k$ ensure that the principal axes of inertia lie along the coordinate axes. The quadrupole tensor is, therefore, diagonal and its principal values $Q_i$ can be expressed in terms of two quantities $Q_0$ and $\gamma$ as $$Q_i = Q_0 \cos(\gamma + i {2 \over 3} \pi ), \quad i = 1, 2, 3 ~,$$ where $Q_0$ and $\gamma$ satisfy the inequalities $$Q_0 \ge 0, \quad 0 \le \gamma \le {2 \over 3} \pi ~.$$ The values of the three constraints $Q_i$ were computed from the desired values of $Q_0$ and $\gamma$ and inserted in a quadratic constraint functional added to the variational energy, according to the method described in Ref. [@FQ73]. In the calculations described below, we constrain the nuclear shape to be axially symmetric ($\gamma = 0$).
COMPARISON WITH EXPERIMENT
==========================
In Fig. 1 we show the potential energy curves for $^{125}$Cs – $^{139}$Cs. According to our calculations with SkyrmeIII (SkmIII) and SkyrmeM\* (SkM\*) forces the lighter cesium isotopes $N \leq 76$ are deformed. For SkmIII such an assignment is able to explain the observed ground state spins of $\frac{1}{2}^+$ for $N = 70 - 74$ and $\frac{5}{2}^+$ for $N = 76$. For SkM\* the mean field proton states $g_{7/2}$ and $d_{5/2}$ are interchanged and therefore the ground state spin assignments for the deformed cesium isotopes are not correct. (This turns out not to be a very crucial problem.) Binding energies and shifts $\delta r_{p,n}^2$ and $\delta r_{p,n}^4$ calculated with the SkM\* and SkmIII interactions are shown in Tables I and II. The binding energies agree in both cases with the experimental values with largest deviation of 4 MeV out of about 1000 MeV of total binding energy.
The comparison between the measured and calculated isotope shifts is illustrated in Figs. 2 and 3 as a series of successively better approximations. First, the crosses, connected by dashed lines to guide eyes, show the isotope shifts for spherical nuclei. The agreement with experiment is not very good even though the spherical calculation correctly predicts that the slope of the dependence $\delta r_p^2(A)$ is about half of the slope expected from the simple relation $R = r_0 A^{1/3}$. This means that, on average, the neutron–proton interaction we use has the correct magnitude.
Next, the equilibrium deformation for the lighter cesium isotopes is included (open squares), leading to a much better agreement. Further improvement is achieved when the effect of zero–point quadrupole vibrational motion is taken into account. It is well known that the mean square radius of a vibrating nucleus is increased by [@BMI] $$\langle r^2 \rangle_{\beta} = \langle r^2 \rangle_0 ( 1 +
\frac{5}{4\pi} \langle \beta^2 \rangle ) ~. \label{rb}$$ We include this effect of the shape fluctuations using the quantities $\langle \beta^2 \rangle$ extracted from the measured transition matrix elements $B(E2,0^+ \rightarrow 2^+)$ and the relation $$\langle \beta^2 \rangle = B(E2,0^+ \rightarrow 2^+)
[3 Z R_0^2 / 4 \pi ]^{-2} ~.$$ We take the average $B(E2)$ of the corresponding Xe and Ba isotopes with neutron numbers $N=78-84$ and correct the radii of $^{133}$Cs–$^{139}$Cs accordingly, as shown in Figs. 2 and 3. Thus, further improvement in the comparison with the measured isotope shifts results. (For $N=84$ the $B(E2)$ values are not known. We use instead the empirical relation between the energy of the lowest $2^+$ state and the deformation parameter $B(E2)$ [@Ram].) This correction results in changes in $r^2$ of 0.2124 fm$^2$ in $^{133}$Cs, 0.1325 fm$^2$ in $^{135}$Cs, 0.0724 fm$^2$ in $^{137}$Cs, and 0.1263 fm$^2$ in $^{139}$Cs.
In a fully consistent calculation, one should make a similar correction for the deformed cesium isotopes as well. Since the corresponding $B(E2)$ values for the vibrational states are not known, and the corrections are expected to be small, we do not make them. Instead, we somewhat arbitrarily assume that the zero–point motion correction is the same as in the semimagic $^{137}$Cs. We believe this explains the somewhat poorer agreement in the deformed cesium isotopes.
Even though the quadrupole $2^+$ states contribute most to the mean square radius via Eq. (\[rb\]), other vibrational states, e.g., the octupole $3^-$ and the giant resonances, contribute as well; however, all such states not only have smaller collective amplitudes but, even more importantly, vary more smoothly with the atomic mass (or neutron number) than the $2^+$ states, and hence their contribution to the shifts $\delta r^2$ should be correspondingly smaller.
Altogether, the error in the shift $\delta r_p^2$ is at most 0.2 fm$^2$, and appears to be independent of the change in the neutron number $\Delta N$. Thus, for the following considerations we assign an uncertainty in the relative value of $\delta r_p^2$ of 0.2 fm$^2$. Very little is known experimentally about the moments $r_p^4$. Quite conservatively, we assume that the uncertainty in $\delta r_p^4$ is $\langle r_p^2 \rangle \times \Delta r_p^2 \simeq$ 5 fm$^4$.
Before turning our attention to the neutron radii, it is worthwhile to make a brief comment about the comparison with $absolute$ values of $\langle r_p^2 \rangle$ and $\langle r_p^4 \rangle$. Experimentally, muonic x–ray energies for the stable $^{133}$Cs have been fitted to the Fermi distribution with the halfway radius $c$ = 5.85 fm, surface thickness $t$ = 1.82 fm [@Eng; @Wu], and $\langle r_p^2 \rangle$ = 23.04 fm$^2$. Such a Fermi distribution gives $\langle r_p^4 \rangle$ = 673 fm$^4$. Our HF calculation corrected for zero–point vibrational motion with $\langle \beta^2
\rangle$ = 0.024, as described above, gives $\langle r_p^2
\rangle_{HF}$ = 23.27 fm$^2$ for SkmIII and 22.69 fm$^2$ for SkM\* interaction, both quite close to the experimental value. The calculated $\langle r_p^4 \rangle$ moments (not corrected for the zero–point motion) are 671(SkmIII) and 652(SkM\*) fm$^4$. We see, therefore, that the calculation is quite successful in the absolute radii (and even surface thicknesses), in particular for the SkmIII interaction (which gives also the correct ground state spin).
The calculated shifts in the neutron radii $\delta r_n^2$ and $\delta
r_n^2$ are listed in Tables I (SkM\*) and II (SkmIII) and the quantities $\delta r_n^2$ corrected for the effect of zero–point vibrational motion are displayed in Fig. 4. Several comments about these are in order. First, the slope of the dependence of $\delta
r_n^2 (A)$ for spherical configurations is correspondingly steeper than the slope following from $R = r_0 A^{1/3}$. That is obviously a correct result; the combination of a smaller slope in the proton radii and a larger slope in the neutron radii when neutrons are added is necessary to maintain on average the $R = r_0 A^{1/3}$ relation. Second, the HF calculations imply that the proton and neutron distributions have essentially identical deformations. This agrees with the general conclusion about the isoscalar character of low–frequency collective modes in nuclei (see, e.g., Ref. [@BMII]). Thus, we accept this result and do not assign any additional uncertainty to the possible difference in the deformation of protons and neutrons. Finally, for the same reason, we use the same $B(E2)$ values, and the $\langle \beta^2 \rangle$ extracted from them, to correct the neutron radii using Eq. (\[rb\]). Assuming all of the above, we assign [*identical*]{} uncertainties to the neutron shifts $\delta r_n^2$ and the proton shifts $\delta r_p^2$, and similarly to the fourth moments $\delta r_{n,p}^4$.
Very little reliable experimental information on neutron distribution in nuclei is available. In Ref. [@GNO], data from pionic atoms are analyzed. The corresponding best fit for neutron mean square radii agrees very well with the HF results quoted there. The nearest nucleus to cesium in Ref. [@GNO] is $^{142}$Ce. Scaling it with $A^{2/3}$ one arrives at $\langle r_n^2 \rangle$ = 24.7 fm$^2$ for $^{133}$Cs, somewhat larger than our calculated values 23.7 and 24.0 for SkM\* and SkmIII, respectively. In Ref. [@Sap], the theoretical neutron density of Brack [*et al.*]{} [@Brack] with $\langle r_n^2 \rangle$ = 23.5 fm$^2$, was used. That value, presumably obtained by interpolation from the values obtained by the HF method using the SkM\* interaction, is, not surprisingly, quite close to our calculated values. This limited comparison suggests that the absolute radii $\langle r_n^2 \rangle$ have uncertainties of about 1 fm$^2$. The uncertainty in the shifts $\delta r_n^2$ should be substantially smaller, and our estimated error of 0.2 fm$^2$ does not seem unreasonable.
In Ref. [@Poll] the uncertainty in the integrals $q_{n,p}$ was estimated from the spread of the calculated values with a wide variety of interactions. Some of the interactions employed in [@Poll] give better agreement for known quantities (charge radii, binding energies, etc.) than others. We chose to use only the two most successful interactions. The spread in the calculated shifts $\delta r_{p,n}^2$ for these two interactions is less than our postulated error of 0.2 fm$^2$.
Pollock [*et al.*]{} [@Poll] also argue that the isovector surface term $(\rho_p - \rho_n) \nabla^2 (\rho_p - \rho_n)$ in the Skyrme Lagrangian is poorly determined and may affect the neutron skin significantly, without affecting most bulk nuclear properties. We tested this claim by modifying simultaneously the coefficients $B_5 \rightarrow B_5(1+x)$ and $B_6 \rightarrow B_6-2B_5x$ in Eq. (\[HFD\]). We find that when we vary $x$ (i.e., the relative strength of the isovector surface term) from +0.3 to -0.3 the proton radius $\langle r_p^2 \rangle$ changes indeed very little (about 0.06 fm$^2$) and the neutron radius changes somewhat more (by about 0.1 fm$^2$, still less than our estimated error). However, the binding energy changes by about 5 MeV, more than the largest discrepancy between the theory and experiment. Thus, we do not think that the uncertainty in this particular coefficient of the Skyrme force alters our conclusions.
ESTIMATED UNCERTAINTIES IN PNC EFFECTS
======================================
The nuclear structure effects are governed by the coefficients $q_{n,p}$, Eq. (\[qf\]), which in turn involve integrals of the formfactors $f(r)$, Eq. (\[ff\]). The function $f(r)$ is slowly varying over the nuclear volume, and may be accurately approximated by a power series $$f(r) = 1 + f_2 \times r^2 + f_4 \times r^4 ~,$$ and, therefore, $$q_{n,p} = 1 + f_2 \times \langle r_{n,p}^2 \rangle +
f_4 \times \langle r_{n,p}^4 \rangle ~.$$
For a sharp nuclear surface density distribution the only relevant parameter is the nuclear radius $R$ and $\langle r^{2n} \rangle =
3/(2n+3)R^{2n}$. Using the experimental $\langle r^2 \rangle$ = 23.04 fm$^2$ for $^{133}$Cs [@Eng], we find from Eq. (\[ff\]) $$f(r) = 1 - 2.10 \times 10^{-3} r^2
+ 1.09 \times 10^{-5} r^4 ~,$$ where the distance is measured in fermis. If, instead, we solve numerically the Dirac equation for the $s_{1/2}$ and $p_{1/2}$ bound electron states in the field of the finite size diffuse surface nucleus, we obtain the coefficients $f_2 (f_4)$ of $-2.31\times10^{-3} (1.21\times10^{-5})$ when we use the standard surface thickness parameter $t=2.25$ fm, and $-2.267\times10^{-3}
(1.157\times10^{-5})$ when we use the surface thickness adjusted so that the nuclear density parametrized by the two–parameter Fermi distribution resembles as closely as possible the Hartree–Fock charge density in $^{133}$Cs.
The expansion coefficients $f_2, f_4$ depend, primarily, on the mean square charge radius. To take this dependence into account, we use for $^{133}$Cs the $f_2$ and $f_4$ above, and for the other isotopes, we use the same surface thickness parameter $(t=1.82)$ and adjust the halfway radius in such a way that the experimental $<r_p^2>$ are correctly reproduced.
It is easy now to evaluate the uncertainty in the factors $q_{n,p}$ given the coefficients $f_2, f_4$ and our estimates of the uncertainties in $\langle r^2 \rangle$ and $\langle r^4 \rangle$. Substituting the corresponding values, we find that the uncertainty is $\delta q_{n,p}$ = 4.6$\times$10$^{-4}$, caused almost entirely by the uncertainty in the mean square radii $\langle r_{n,p}^2
\rangle$. This uncertainty represents about 1% of the deviations of $q_{n,p}$ values from unity.
Before evaluating the nuclear structure corrections $Q_W^{nuc}(N,Z)$ we have to consider the effect of the intrinsic nucleon structure. Following [@Poll] we use $$q_{p,n}^{int} = \int d^3{\bf r} \frac{1}{6}
\langle r^2 \rangle_{int,(p,n)}^w f(r)
\nabla^2 \rho_{p,n}/Q_{p,n}^w ~,$$ where $\langle r^2 \rangle_{int}^w$ are the nucleon weak radii, and $Q_{p,n}^w$ are the nucleon weak charges. Neglecting the “strangeness radius” of the nucleon, and using the fitted two–parameter Fermi density distribution, we find $$q_p^{int} = -0.00290, ~~ q_n^{int} = -0.00102 ~,$$ very close to the sharp nuclear surface values of Pollock [*et al.*]{} [@Poll]. The above intrinsic nucleon structure corrections are small, but not negligible. More importantly, they are independent of the nuclear structure, and cancel out in the differences $\Delta
q_{n,p}$.
The quantities 100$\times$($q_n$-1) and 100$\times$($q_p$-1) are listed in Table III for all cesium isotopes and for the two Skyrme interactions we consider. One can see that they vary by about 4% for neutrons and are essentially constant for protons when the neutron number increases from $N$ = 70 to 84. The variation with $N$ is essentially identical for the two forces, while the small difference between the $q_{n,p}$ values calculated with the two forces reflects the difference in the [*absolute*]{} values of radii for the two interactions.
The weak charges $Q_W(N,Z)$ and the nuclear structure corrections $Q_W^{nuc}(N,Z)$ in Table III are radiatively corrected. Thus, instead of the formulae (\[Qweak\]), (\[Qnuc\]) we use $$Q_W(N,Z) = 0.9857 \times [-N + Z(1 - 4.012\bar{x})] ~,~
\bar{x} = 0.2323 + 0.00365S ~,$$ following [@Mar]. Here $S$ is the parameter characterizing the isospin–conserving “new” quantum loop corrections [@PT]. Also, $$Q_W^{nuc}(N,Z) = 0.9857 \times [-N(q_n - 1) +
Z(1 - 4.012\bar{x})(q_p - 1)] ~.$$ These quantities, evaluated for $S = 0$, are shown in Table III. The assumed uncertainty in the shifts of the mean square radii, and consequently in the changes in factors $q_{n,p}$ results in the relative uncertainty $\delta Q_W/Q_W$ of 5$\times$10$^{-4}$. That uncertainty, therefore, represents the “ultimate” nuclear structure limitation on the tests of the Standard Model in the atomic PNC experiments involving several isotopes.
In the atomic PNC experiments involving a [*single*]{} isotope, the uncertainty in the neutron mean square radius is larger, and 1 fm$^2$ appears to be a reasonable choice. Thus, from nuclear structure alone, the weak charge in a single isotope has relative uncertainty of about 2.5$\times$10$^{-3}$, perhaps comparable to the best envisioned measurements, but considerably smaller then the present uncertainty associated with the [*atomic*]{} structure.
Suppose now that in an experiment involving several cesium isotopes one is able to determine the ratio $$R(N',N) = \frac{Q_W(N',Z)+Q_W^{nuc}(N',Z)}{Q_W(N,Z)+
Q_W^{nuc}(N,Z)}$$ with some relative uncertainty $\delta R/R$. To a (reasonable) first approximation $$R(N',N) \approx \frac{Q_W(N',Z)}{Q_W(N,Z)}\times[1
+ q_n(N') - q_n(N)] ~.$$ Thus, we see that nuclear structure contributes to the uncertainty of $R$ at the level of roughly 7$\times$10$^{-4}$, where we added the individual errors in quadrature. This uncertainty is much smaller than the anticipated experimental error.
In such a measurement, therefore, the uncertainty in $\bar{x}$ will be $$\frac{\delta \bar{x}}{\bar{x}} \approx \frac{\delta R}{R}\times
\frac{NN'}{Z\Delta N} \approx 8\frac{\delta R}{R}~,$$ (see also [@Mar; @Poll]) where the last factor is evaluated for $N',N$ = 70, 84. The above equation illustrates the obvious advantage of using isotopes with large $\Delta N$. Also, by performing the measurement with several isotope pairs, one can further decrease the uncertainty $\delta \bar{x}$. On the other hand, the uncertainty in the important parameter $S$ is determined from the relation $\delta
\bar{x} = 0.00365\delta S$, and thus $$\delta S \approx \frac{\delta R}{R}\times
\frac{NN'}{0.014Z\Delta N} ~.$$
In conclusion, we have evaluated the nuclear structure corrections to the weak charges for a series of cesium isotopes, and estimated their uncertainties. We concluded that the imperfect knowledge of the neutron distribution in cesium isotopes does not represent in the foreseeable future a limitation on the accuracy with which the Standard Model could be tested in the atomic PNC experiments. We would like to thank C. Wieman and D. Vieira whose discussion of the proposed experiments inspired the work described here. This research was performed in part using the Intel Touchstone Delta System operated by Caltech on behalf of the Concurrent Supercomputing Consortium. This work was supported in part by the U.S. Department of Energy under Contract \#DE–F603–88ER–40397, and by the National Science Foundation, Grant No. PHY90–13248.
P. Langacker, M.-X. Luo, and A. K. Mann, Rev. Mod. Phys. [**64**]{}, 87 (1992). W. Marciano and J. Rosner, Phys. Rev. Lett. [**65**]{}, 2963 (1990). V. V. Flambaum, I. B. Khriplovich, and O. P. Sushkov, Phys. Lett. [**146B**]{}, 367 (1984). W. C. Haxton, E. M. Henley, and M. J. Musolf, Phys. Rev. Lett. [**63**]{}, 949 (1989). M. C. Noecker, B. P. Masterson, and C. Wieman, Phys. Rev. Lett. [**61**]{}, 310 (1988). M. A. Bouchiat [*et al.*]{}, Phys. Lett. [**117B**]{}, 358 (1982); [**134B**]{}, 463 (1984); J. Phys. (Paris) [**47**]{}, 1709 (1986). E. D. Commins, Phys. Scr. [**36**]{}, 468 (1987). V. L. Telegdi, in [*Fundamental Symmetries in Nuclei and Particles*]{}, eds. H. Henrikson and P. Vogel (World Scientific, Singapore, 1990). C. Wieman, C. Monroe, and E. A. Cornell, in [*Laser Spectroscopy X*]{}, eds. M. Ducloy, E. Jacobino, and G. Camy (World Scientific, Singapore, 1991). S. A. Blundell, W. R. Johnson, and J. Sapirstein, Phys. Rev. Lett. [**65**]{}, 1411 (1990). V. Dzuba, V. Flambaum, and O. Sushkov, Phys. Lett. [**141A**]{}, 147 (1989). E. N. Fortson, Y. Pang, and L. Wilets, Phys. Rev. Lett. [**65**]{}, 2857 (1990). S. J. Pollock, E. N. Fortson, and L. Wilets, Phys. Rev. [**C46**]{}, 2587 (1992). P. Quentin and H. Flocard, Ann. Rev. Nucl. Part. Sci. [**28**]{}, 523 (1978). P. Bonche, H. Flocard, P.-H. Heenen, S. J. Krieger, and M. S. Weiss, Nucl. Phys. [**A443**]{}, 39 (1985). D. Vautherin and D. M Brink, Phys. Rev. [**C5**]{}, 626 (1972). P. Bonche, H. Flocard, and P.-H. Heenen, Nucl. Phys. [**A523**]{}, 300 (1991). M. Beiner, H. Flocard, Nguyen Van Giai, and P. Quentin, Nucl. Phys. [**A238**]{}, 29 (1975). J. Bartel, P. Quentin, M. Brack, C. Guet, and H. B. Hakansson, Nucl. Phys. [**A386**]{}, 79 (1982). Y. Engel, D. M. Brink, K. Goeke, S. J. Krieger, and D. Vautherin, Nucl. Phys. [**A249**]{}, 215 (1975). P. Bonche, H. Flocard, and P.-H. Heenen, Nucl. Phys. [**A467**]{}, 115 (1987). H. Flocard, P. Quentin, A. K. Kerman, and D. Vautherin, Nucl. Phys. [**A203**]{}, 433 (1973). A. Bohr and B. R. Mottelson, in [*Nuclear Structure, Vol. I*]{} (Benjamin, Reading, 1975) p. 164. S. Raman, C. W. Nestor, and K. H. Bhatt, Phys. Rev. [**C37**]{}, 805 (1988). R. Engfer [*et al.*]{}, ADNDT [**14**]{}, 509 (1974). W. Y. Lee [*et al.*]{}, Phys. Rev. Lett. [**23**]{}, 648 (1969). A. Bohr and B. R. Mottelson, in [*Nuclear Structure, Vol. II*]{} (Benjamin, Reading, 1975) p. 383. C. Garcia–Recio, J. Nieves, and E. Oset, Nucl. Phys. [**A547**]{}, 473 (1992). M. Brack, C. Guet, and H.-B. Hakansson, Phys. Rep. [**123**]{}, 275 (1975). M. E. Peskin and T. Takeuchi, Phys. Rev. Lett. [**65**]{}, 964 (1990). C. Thibault [*et al.*]{}, Nucl. Phys. [**A367**]{}, 1 (1981).
---- --------- ------------------------ --------- --------- --------- -------- --------- --------- ---------
N B B$_{\hbox{\small HF}}$
70 1049.98 1045.82 -0.1517 -0.0899 -0.4445 7.987 -0.6803 -1.0787 -31.126
72 1068.25 1064.38 -0.0985 -0.0348 -0.3285 8.836 -0.4603 -0.7931 -19.563
74 1085.66 1082.15 -0.0561 -0.0199 -0.2161 6.247 -0.2927 -0.5186 -11.931
76 1102.37 1099.36 -0.0141 0.0090 -0.1070 4.306 -0.1253 -0.2544 -4.538
78 1118.52 1117.69 0.0000 0.0000 0.0000 0.000 0.0000 0.0000 0.000
80 1134.24 1135.71 0.0250 0.1054 0.1054 4.872 0.2454 0.2454 14.025
82 1149.27 1152.18 0.0821 0.2531 0.2531 9.658 0.5132 0.5132 28.754
84 1159.57 1164.16 0.3604 0.3394 0.3394 17.820 0.8866 0.8866 59.902
---- --------- ------------------------ --------- --------- --------- -------- --------- --------- ---------
: Results of the Hartree–Fock calculations with the SkM\* interactions. The experimental binding energies and isotope shifts $\delta \langle r_p^2 \rangle$ are also listed for comparison. (The binding energies are in MeV, all radial moments in fm.) The experimental isotope shifts are from Ref. [@Thi], normalized to the stable isotope $^{133}$Cs.[]{data-label="Tab. 1"}
---- --------- ------------------------ --------- --------- --------- -------- --------- --------- ---------
N B B$_{\hbox{\small HF}}$
70 1049.98 1047.12 -0.1517 -0.1322 -0.5097 7.670 -0.5484 -1.0265 -24.683
72 1068.25 1065.52 -0.0985 -0.1015 -0.3813 6.023 -0.4141 -0.7592 -18.954
74 1085.66 1083.44 -0.0561 -0.0440 -0.2536 6.317 -0.2526 -0.4991 -11.388
76 1102.37 1100.62 -0.0141 -0.0096 -0.1265 3.117 -0.1096 -0.2461 -5.198
78 1118.52 1118.01 0.0000 0.0000 0.0000 0.000 0.0000 0.0000 0.000
80 1134.24 1134.75 0.0250 0.1254 0.1254 6.530 0.2392 0.2392 14.634
82 1149.27 1153.20 0.0821 0.2508 0.2508 13.124 0.4721 0.4721 29.191
84 1159.57 1161.94 0.3604 0.4120 0.4120 22.346 0.8674 0.8674 59.984
---- --------- ------------------------ --------- --------- --------- -------- --------- --------- ---------
: Results of the Hartree–Fock calculations with the SkmIII interactions. The experimental binding energies and isotope shifts $\delta \langle r_p^2 \rangle$ are also listed for comparison. (The binding energies are in MeV, all radial moments in fm.) The experimental isotope shifts are from Ref. [@Thi], normalized to the stable isotope $^{133}$Cs.[]{data-label="Tab. 2"}
---- ------------ ------------------ --------- --------- ------------------ --------- --------
N $Q_W(N,Z)$ $Q_W^{nuc}(N,Z)$ $q_n$-1 $q_p$-1 $Q_W^{nuc}(N,Z)$ $q_n$-1
70 -65.312 2.967 -4.55 -4.64 3.015 -4.62 -4.74
72 -67.283 3.077 -4.58 -4.64 3.118 -4.64 -4.74
74 -69.254 3.184 -4.60 -4.64 3.225 -4.66 -4.75
76 -71.226 3.291 -4.62 -4.64 3.330 -4.68 -4.75
78 -73.197 3.422 -4.68 -4.68 3.458 -4.73 -4.79
80 -75.169 3.528 -4.69 -4.67 3.564 -4.74 -4.79
82 -77.140 3.638 -4.71 -4.68 3.669 -4.76 -4.79
84 -79.112 3.745 -4.73 -4.66 3.780 -4.78 -4.78
---- ------------ ------------------ --------- --------- ------------------ --------- --------
: The radiatively corrected weak charges $Q_W(N,Z)$, nuclear structure corrections $Q_W^{nuc}(N,Z)$, and the quantities $q_n$-1, $q_p$-1 (the factors ($q_{p,n}$-1) contain the intrinsic nucleon structure correction, and are multiplied by 100 for easier display) calculated with the SkM\* and SkmIII interactions, and with the vibrational corrections described in the text.[]{data-label="Tab. 3"}
|
Protein synthesis in cells infected by murine hepatitis viruses JHM and A59: tryptic peptide analysis.
The structural and intracellular proteins of the murine hepatitis viruses MHV-JHM and MHV-A59 were studied by tryptic peptide mapping. The results demonstrated that the virions contained three distinct proteins: the two related chains of the E2 complex, the nucleocapsid protein and the heterogeneous E1 complex. Five distinct virus-specific proteins were synthesized by infected cells. Three of the five intracellular proteins contained tryptic-peptides with properties similar to the three structural proteins. Models describing the evolution of the proteins are proposed. Although the pathogenic properties of MHV-JHM and MHV-A59 differ greatly, the tryptic peptide maps of the corresponding proteins of these MHV strains were remarkably similar.
|
You are here
Transfers
Contact Us
St. Mary Plaza
3701 Avenue D
Scottsbluff, NE69361
United States
308-630-1155
A student desiring transfer to Regional West Medical Center School of Radiologic Technology must have all pertinent information and previous educational records (including college and radiography program transcripts) sent to the program director prior to any determination of acceptance.
Students transferring into the program must complete the application form. References submitted must include his or her current program director and at least one of the clinical instructors from the former program.
A transfer shall be approved on an individual basis with emphasis on performance and references. Courses with grades of 80 percent or better shall be deemed as transferable into the program. Grades lower than 80 percent in the radiography program courses will require remedial training and retesting in those areas by the student.
The Educational Advisory Committee shall meet to determine whether to accept the student into the program.
Acceptance shall also be dependent on the number of students in the current cohort and availability of vacant positions within the program. The acceptance of a transfer student shall be subject to the limits of class size as determined by JRCERT.
If accepted into the program, the student will need to have appropriate background checks, pre-admittance drug testing performed, and submit required immunization records prior to admission. The student transferring into the program shall comply with the program and sponsoring institution policies and pay tuition appropriate for the term enrolled.
The student will be placed into the appropriate year of training dependent on previous classes. Generally, if the student has completed Anatomy and Positioning, he or she will be placed in the second year class.
The transfer student must meet Regional West Medical Center School of Radiologic Technology requirements, including all classes or their equivalents, prior to graduation. This shall include requirements for clinical education courses.
A student who wishes to transfer out of the Regional West Medical Center School of Radiologic Technology program should contact the program director about transfer of grades and other needed materials. Grades will be sent to colleges or universities only upon written request by the student.
|
RT News - August 14, 2017 (17:00 MSK)
Published time: 14 Aug, 2017 15:28
RT News - August 14, 2017 (17:00 MSK)
Hundreds are reportedly dead after a mudslide in Sierra Leone - with many still trapped following the disaster. Clashes break out between protesters and police in the U.S. city of Seattle, during rival pro-free speech and anti-hate marches. It comes a day after violence at a white nationalist rally in Virginia. Children are being reunited with their relatives, after RT's campaign to bring home Russian-speaking orphans of Islamic State followers in Iraq.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.