text
stringlengths 8
5.77M
|
|---|
Today, the U.S. House of Representatives approved Congresswoman Jaime Herrera Beutler’s legislative effort to prevent aquatic invasive species from infiltrating the Columbia River ecosystem.
“I’m pleased Congress passed my legislation to protect the Columbia River Basin from invasive species that, if they spread here, would have a $500 million cost to our region,” said Jaime. “Prevention is the first line of defense, and this legislative solution represents the cheapest and most effective tool to use against invasive species.
“I’m also encouraged by the other benefits to Southwest Washington in the overall water infrastructure package, including steady, dedicated funding to maintain the waterways and ports that are lifelines for our region’s economy.”
Jaime’s anti-invasive species initiative is part of the final version of the Water Resources Development Act of 2017 (WRDA) that represents a bipartisan agreement between the U.S. House and Senate. Watercraft inspection stations intercept thousands of boats from all over the country to inspect for invasive mussels and decontaminate them. More information about Jaime’s effort is available here.
Dedicated Funding for Southwest Washington Ports
The WRDA bill also provides funding for maintenance and improvements to Southwest Washington ports by phasing in full use of the Harbor Maintenance Trust Fund -- money collected for harbor and channel operations maintenance and dredging. Jaime has consistently fought to ensure that 10% of the Harbor Maintenance Trust Fund will be set aside for small ports like those in Pacific and Wahkiakum Counties, and along the Columbia River.
|
Tuberculosis in wildlife (review).
The cases of tuberculosis in wild animals of different systematic groups recorded and published in the world literature since the time of discovery of the agent of tuberculosis have been presented. The epizootiology, routes of dissemination of the infection, clinical manifestations and some other characteristics accounting for the present status of tuberculosis in wild animals have been described.
|
Q:
Could someone please explain these notes on Möbius maps to me?
Suppose $M(z)={az+b\over cz+d}$ is a Möbius map. Then $M'(z)={ad-bc\over (cz+d)^2}$, which is $\neq 0$ for $z\neq -{d\over c}$ or $\infty$. So we can say that $M$ is conformal at these points, so far so good. But what about $z= -{d\over c}$ or $\infty$? I am guessing that it is conformal at $z= -{d\over c}$ because $M'$ is not zero and is not conformal at $\infty$? However in Proposition 2.3 in these notes it is said that Möbius maps are conformal on the entire $\mathbb C \cup \{\infty\}$. I don't understand the rationale behind that. Thank you!
A:
The point $z=\infty$ of the extended $z$-plane has a local $z'$-coordinate system associated with it where the point $z=\infty$ corresponds to $z'=0$ and the coordinate variables $z$ and $z'$ are otherwise related via $z={1\over z'}$ resp. $z'={1\over z}$.
Let's look at the behavior of $M$ near $z=\infty$. To this end we express $M$ in terms of the other coordinate $z'$, resulting in the expression
$$\tilde M(z'):=M\bigl({1\over z'}\bigr)={bz' + a\over d z' +c}\ ,$$
which obviously behaves in the expected way near $z'=0$ (assuming $c\ne 0$).
To account for the other exceptional point $z_0:=-{d\over c}$ (assuming $c\ne 0$) we have to use the proper coordinate variable $w'={1\over w}$ near $M(z_0)=\infty$. This means we should express the image point $M(z)$ for $z$ near $z_0$ by means of its $w'$-coordinate:
$$w'={1\over w}={1\over M(z)}={cz + d \over a z+b}=:\hat M(z)\ .$$
For $z$ near $z_0$ the resulting expression $\hat M(z)$ behaves in the expected way, as $ad-bc\ne0$ by assumption.
|
IDT - High Definition Audio Codecs(SP39671)Download (ftp)SP41616 Download(ftp)Download and install the driver(do this to extract driver files), you will get the error while installing.Perform the below steps to fix the issue.1. Click on Start and select Run. Now type devmgmt.msc and press enter.2. Right click on "Audio device on High Definition Audio Bus" and click Update driver.3. Select "Install from a list or specific location".4. Click Next. Then select "Don't search, I will choose the driver to install".5. Click Next and then select "Sound, video and game controller" from the list.6. Click Next and then click Have Disk.7. Click Browse C:\swsetup\SP39671 folder and select the .inf file and click open and Continue with the onscreen instructions. Manually install Audio Drivers.
|
Marni's smartly pleated A-line skirt will never go out of style. This wool-crepe design is lined in satin at the front to ensure it sits smoothly. Wear yours with an embellished sweater, or be inspired by the runway and add a tailored jacket.
|
On This Day In Judy Garland’s Life And Career – August 13
“There never was a voice with quite the lilt to it that Judy Garland’s has.” – Uncredited photo caption 1950
August 13, 1937: The first MGM “preview” of a Judy Garland film too place at the Village Theater in Westwood, California with the preview of Broadway Melody of 1937. Technically it was really a Robert Taylor & Eleanor Powell film in which Judy was a supporting player, but we all know how film history now views it.
At this preview was the president of Decca Records, Jack Kapp, who had flown in to see the film. That night in his suite at the Beverly Hills Hotel, he drew up what would become Judy Garland’s very first recording contract.
August 13, 1938: Judy makes the cover of the Swedish “Hela Världen” magazine.
August 13, 1938: This movie tie-in for used cards and Love Finds Andy Hardy which makes sense because the plotline of the film revolves around Andy Hardy’s quest to get his used car (and fend off the girls, of course!).
August 13, 1938: Here’s a notice about the casting of Gale Sondergaard as the Wicked Witch of the West in The Wizard of Oz. The idea of Sondergaard as a glamorous witch went as far as the costume test phase before it was decided that the Witch should be the traditional crone.
August 13, 1939: Here’s an article about the origins of the Oz story and some of the advances and achievements in makeup and effects that brought the story to life with “living actors.” The third clipping is another shorter article focusing on the achievements of the color photography.
August 13, 1939: Judy and Mickey Rooney were just in Hartford, Connecticut (August 11), for a one day only appearance and, according to this obviously posed and fabricated article, found time to edit the Sunday Parade newspaper magazine insert! In reality, the duo gave four performances between showings of the film (Lady of the Tropics starring Hedy Lamarr and Robert Taylor) and left for Bridgeport, Connecticut at 10 p.m.
August 13, 1939: Two more behind-the-scenes articles about the men who made The Wizard of Oz. The first is an article about the songwriters of The Wizard of Oz, Harold Arlen (music) and E.Y. “Yip” Harburg (lyrics) that touches on the fact that the songs are part of the plot. The second is an article attributed to film’s producer Mervyn LeRoy about the difficulties in making the film.
August 13, 1940: Judy continued filming scenes for Little Nellie Kelly on the “Interior Kelly Flat” set. Time called: 9 a.m.; dismissed 6:17 p.m. Judy had taken a break from filming for two days of retakes on Strike Up The Band. MGM sure got their money’s worth!
Photo: A publicity still featuring Judy with costars George Murphy and Douglas McPhail.
August 13, 1941: Judy and her mom, Ethel, posed for these MGM “mother/daughter” portraits. Judy is wearing her “How About You” costume from Babes on Broadway which she was currently filming. Judy was due on the Babes on Broadway set at 3 p.m.; time dismissed: 6:40 p.m. The assistant director’s notes state that “Judy was ill in the morning.” Since Judy’s in costume, hair, and makeup, she probably had to take a break to head over to the photo studios for these pictures.
August 13, 1944: Judy appeared on the NBC Radio show “Your All-time Hit Parade.” She performed “I May Be Wrong” and “Over the Rainbow,” both with Tommy Dorsey and His Orchestra.
August 13, 1945: The world premiere of Ziegfeld Follies took place in Boston, Massachusetts. This premiere was a roadshow premiere meaning that the film played limited engagements in limited theaters. Judy filmed her sequence in July 1944 after completing her work on Meet Me In St. Louis. The film went into general release on April 8, 1946, at which time it had been renamed Ziegfeld Follies of 1946 and the segments and flow of the film had been changed more often than not due to the mediocre responses to the roadshow engagements. Judy and new husband Vincente Minnelli were in New York on their honeymoon and traveled to Boston to attend the premiere.
August 13, 1946: Judy participated in a radio broadcast celebrating the 100th anniversary of the raising of the American flag over Los Angeles. Nothing is known about this broadcast aside from the radio listings that give the stars involved, including George Jessel, Frank Sinatra, Margaret O’Brien, Bob Hope, Meredith Willson and his Orchestra, and Los Angeles Mayor Fletcher Bowron.
August 13, 1950: Judy’s vacation in Lake Tahoe was cut short, according to this article. It states that she was going to stop in Lake Tahoe before heading home to Los Angeles. Whatever the “unfinished business at home” was it must not have been too pressing. Judy didn’t return to Los Angeles until over a month later on September 18th.
Meanwhile, Summer Stock was opening around the country and proving to be a hit in spite of the recent negative press that Judy had received. Judy’s fans (and the critics) came to Judy’s defense in droves.
August 13, 1951: This is the day on which Sid Luft allegedly was walking down Broadway in New York when he got the idea for Judy to play the Palace Theater. The engagement – originally scheduled for four weeks, but ultimately extended to nineteen weeks – was announced on August 28. Sid definitely moved fast to put the deal together. He had also been thinking of a concert tour that would include Carnegie Hall and the Winter Garden Theater. Judy would, eventually, play both venues during her famous “Concert Years” (that new era of her life and career began with this Palace engagement, after the initial run at the Palladium in England).
August 13, 1954: The third and final installment in Emily Belser’s series “The Judy Garland Story.”
Star Plans to Stay In Top Ranks After Long Uphill BattleGarland Plays a Grown Up Woman for First Time on Screen, in New Picture
A new and exultant Judy Garland plans to stay on top of the Hollywood heap. AT the same time she plans to be the best wife in movietown to Sid Luft, the man who gave her confidence to make her great comeback in a town that kicked, criticized and fired her.
Sid, who follows band leader David Rose and Director Vincente Minnelli in Judy’s wifely affections, refused to admit the 31-year-old actress is making a “comeback.”
“I don’t get angry when people say she’s making a comeback,” he says, “I just contradict them. A comeback in my book is when you’ve been knocked out of the box office. That has never happened to Judy. She’s still box office. I say she’s just been taking a ‘rest.'”
But Judy herself feels slightly differently. “Starting uphill again,” she admits, “takes a lot of blind belief in yourself and reckless courage. You have to say the heck with everything and make up your mind you’re not going back whether they want you or not.”
“Sure, MGM fired me four years ago. I hadn’t been feeling well. I was in ill health and I was tired. I had one picture after another and they were making be diet too much and too often.”
She added: “They said I wasn’t dependable. I guess I wasn’t, but I was ill. I had a reason.”
It was following this that Judy became despondent and attempted suicide. A friend said at the time: “Judy doesn’t know whether she wants to live or not. We can’t be sure if she’ll try again to kill herself. We hope not, but to avoid taking any chances we are giving her a regular schedule of sedatives.”
But Judy bounced back like the trouper she is and shortly afterward scored a sensational artistic success at the London Palladium and again at the Palace Theater in New York. Thus she could well be tagged, “The Comeback Kid.”
She said she opened at the Palladium because she “needed the money.” “I was broke,” she confesses now, “so I decided to try the stage.”
She was received with wild enthusiasm both at the Palladium and the Palace and her fans wept with joy at her triumph and her courage.
Many of her so-called “friends” deserted her when she needed them most, but Judy accepted this philosophically. She says: “No one has a lot of real friends; just a lot of pseudo, fair-weather pals. A lot of mine disappeared when the going was rough, but there were a few who stuck – real, true-blues.”
Sid Luft is the “true-blue” who gets most of the credit in Judy’s book.
“He is the person who brought me back,” she said. “Sid kept telling me I was good. I guess you have to have an inner belief in your own talent if not in yourself!”
Judy’s new film, “A Star Is Born,” is expected to prove the Garland girl still has what it takes. She has three hours and five minutes in which to show the world that a gal can bite the dust and come back up fighting.
“I don’t know what I’ll do next,” Judy commented. “I think I’d like to do a play if the right one comes along. In the meantime, it’s wonderful to be free to do as I please, not to be under contract to anyone. I never want to sign another contract as long as I live.”
Although she plays a grownup woman for the first time on the screen in her new; just finished film, there still remains some of the wide-eyed charm that won Judy and Oscar for her performance in “The Wizard of Oz” when she was only 14.
“I’m glad to be a grownup at the last,” she laughed, “it’s about time – I’m old enough!”
August 13, 1967: Judy was currently enjoying great success at The Palace in New York when this fun photo essay about her recent (July 10 – 15) triumph at the Camden County Music Fair in Haddonfield, New Jersey, was published as part of the “Pictures” section of the Sunday Edition of the St. Louis Post Dispatch. Click on the images to read the introduction and the captions.
August 13, 1989: Here’s an ad for the wonderful book “The Wizard of Oz – The Official 50th Anniversary Pictorial History” written by John Fricke, Jay Scarfone, and William Stillman. The latter two authors have written several more fantastic Oz books since this one, and now have a new book coming up on October 1st, “The Road To Oz.”
August 13, 2013: Warner Home Video announced the bilingual version of their 75th Anniversary boxed set edition of The Wizard of Oz. The standard boxed set and other editions were first announced on June 4, 2013, in anticipation of the film’s anniversary a full year later.
|
Error bars indicate 95% confidence intervals. To convert high-density lipoprotein, low-density lipoprotein (LDL), non–high-density lipoprotein cholesterol, and total cholesterol to mmol/L, multiply by 0.0259; triglycerides to mmol/L, 0.0113. Because 5 participants did not complete all 3 diets, between-diet differences are not identical to corresponding differences that can be estimated from Table 5.
Table 1. Nutrient Targets and Average Daily Servings of Foods by Diet at 2100 kcal
Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults. Executive summary of the third report of the national cholesterol education program (NCEP) expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (Adult Treatment Panel III). JAMA. 2001;285:2486-2497CrossrefGoogle Scholar
Conclusion In the setting of a healthful diet, partial substitution of carbohydrate with either protein or monounsaturated fat can further lower blood pressure, improve lipid levels, and reduce estimated cardiovascular risk.
Despite widespread consensus that a reduced intake of saturated fat lowers cardiovascular disease (CVD) risk, the optimal type of macronutrient (protein, unsaturated fat, or carbohydrate) that should replace saturated fat is uncertain. In the absence of convincing evidence that favors one macronutrient, reports from the Institute of Medicine1 and the Adult Treatment Panel III2 concluded that a wide range of macronutrients is acceptable.
Two major goals of dietary recommendations are to lower blood pressure and improve serum lipids, 2 of the primary determinants of CVD risk. A persuasive body of evidence has implicated several aspects of diet in the etiology of elevated blood pressure. Early research documented the adverse effects of increased salt, insufficient potassium, elevated weight, and excess alcohol intake, and the beneficial effects of vegetarian dietary patterns.3,4 Subsequently, in the Dietary Approaches to Stop Hypertension (DASH) trials,5,6 a carbohydrate-rich diet that emphasizes fruits, vegetables, and low-fat dairy products and that is reduced in saturated fat, total fat, and cholesterol, substantially lowered blood pressure.
The carbohydrate-rich diet used in the DASH trials, commonly termed the DASH diet, is currently advocated in several scientific reports and guidelines, including the report of the 2005 Dietary Guidelines Scientific Advisory Committee.7 This diet meets the major nutrient recommendations established by the Institute of Medicine.8 In addition to lowering blood pressure, the DASH diet lowers low-density lipoprotein (LDL) cholesterol.9,10 However, this diet also reduces high-density lipoprotein (HDL) cholesterol, which is inversely associated with CVD risk,2 and has no effect on triglycerides, which is directly associated with CVD risk.11 Whether partial replacement of carbohydrate with either unsaturated fat or protein can improve blood pressure and lipid risk factors is uncertain.
Some leading authorities have recommended diets rich in monounsaturated fats as a means to reduce CVD risk.12 Such diets typically lower triglycerides and raise HDL cholesterol, but their effects on blood pressure have received scant attention. An expanding body of evidence suggests that diets rich in protein, particularly protein from plants, lower blood pressure13-16 and reduce CVD risk.17,18 In small feeding studies, increased protein intake from mixed sources had favorable effects on lipids.19-21
In this setting, we conducted a randomized trial to compare the effects on blood pressure and serum lipids of 3 healthful diets, each reduced in saturated fat: a carbohydrate-rich diet, similar to the DASH diet; a diet rich in protein, approximately half from plant sources; and a diet rich in unsaturated fat, predominantly monounsaturated fat.
Methods
The Optimal Macronutrient Intake Trial to Prevent Heart Disease (OmniHeart) was an investigator-initiated, National Heart, Lung, and Blood Institute–funded feeding study with a randomized, 3-period crossover design.22 Two clinical centers (Johns Hopkins Medical Institutions and Brigham and Women’s Hospital) and a coordinating unit at Brigham and Women’s Hospital conducted the trial. Institutional review boards at each center and an independent data and safety monitoring board approved the protocol and monitored the trial. Each participant provided written informed consent.
Participants
Trial participants were generally healthy adults, aged 30 years and older, with a systolic blood pressure of 120 to 159 mm Hg or a diastolic blood pressure of 80 to 99 mm Hg. This range includes individuals with prehypertension (systolic, 120-139 mm Hg or diastolic, 80-89 mm Hg) and stage 1 hypertension (systolic, 140-159 mm Hg or diastolic, 90-99 mm Hg). Prehypertensive individuals are a group at high risk of developing hypertension and CVD, justifying special attempts to lower blood pressure.23
Major exclusion criteria were diabetes, active or prior CVD, LDL cholesterol greater than 220 mg/dL (>5.70 mmol/L), fasting triglycerides greater than 750 mg/dL (>8.48 mmol/L), weight more than 350 lb (>159 kg), taking medications that affect blood pressure or blood lipid levels, unwillingness to stop taking vitamin and mineral supplements, and alcoholic beverage intake of more than 14 drinks per week. Mass mailing of brochures and advertisements were primary recruitment strategies. Because of the disproportionate burden of CVD in African Americans, a recruitment goal was to achieve a cohort that was about 50% African American. Race and ethnicity were self-reported. The first participants began the protocol in April 2003; the last participants ended the study in June 2005.
Participant Flow
During 3 screening visits, eligibility was ascertained and baseline data were collected. After a 6-day run-in period, in which participants ate 2 days of meals from each study diet, they were randomly assigned to 1 of 6 sequences of the 3 diets. Randomization assignments were generated centrally by a computer program and were stratified by clinic. At each clinical center, an unblinded staff member opened a sealed, opaque envelope with the randomized diet sequence. Each feeding period lasted 6 weeks. A washout period of 2 to 4 weeks separated the feeding periods. During the washout, participants ate their own food.
Study Diets
Table 1 displays the nutrient targets for each diet and the average estimated servings per day of foods for the 2100-kcal version of the diets. Table 2 displays a sample, 1-day set of meals. The primary distinguishing feature of the 3 diets is their macronutrient composition. By design, each diet was reduced in saturated fat, cholesterol, and sodium, and rich in fruits, vegetables, fiber, potassium, and other minerals at recommended levels.7
The carbohydrate diet used in this trial is similar to the DASH diet, except that the carbohydrate intake of the DASH diet was 55% of kcal vs 58% of kcal in the carbohydrate diet and the protein intake of the DASH diet was 18% of kcal vs 15% of kcal in the carbohydrate diet. The protein intake was reduced to 15% of kcal to achieve a 10% of kcal contrast with the protein diet. Approximately two thirds of the increase in protein from the carbohydrate to the protein diets came from plants (legumes, grains, nuts, and seeds). However, sources of protein were varied and also included meat, poultry, egg product substitutes, and dairy products. The protein diet included some soy products, but the amount was low, on average just 7.3 g per day. The unsaturated fat diet emphasized monounsaturated fat. This diet included olive, canola, and safflower oils, as well as a variety of nuts and seeds, to meet its target fatty acid distributions. The type of carbohydrate in each diet was similar, as indicated by the total dietary glycemic index (68 in carbohydrate diet, 71 in the protein diet, and 75 in unsaturated fat diet, relative to the white bread index).24
Controlled Feeding
A 7-day menu cycle at 5 caloric levels (1600, 2100, 2600, 3100, and 3600 kcal) was developed for each diet. Menus were designed using commonly available foods. Throughout the feeding periods, participants were provided all of their food, which was prepared in research kitchens. On each weekday, participants ate their main meal on-site. All other meals were consumed off-site. Participants were instructed to drink no more than 3 caffeinated beverages and no more than 2 alcoholic beverages per day. Weight was measured each weekday and was kept stable by adjusting caloric levels, by adding 100-kcal cookies with the nutrient content of the assigned diet, or both. The goal was to keep weight within 2% of their baseline weight. Participants were advised to maintain their same level of exercise and alcohol consumption as before the trial. For each day of controlled feeding, participants completed a diary in which they indicated whether they ate any nonstudy foods and whether they did not eat all study foods.
Measurements
Participants and personnel involved in collection of outcome data were masked to diet sequence. Blood pressure was measured at each screening visit and at 1 visit during the run-in period. During each feeding period, blood pressure was measured at one visit each week during the first 4 weeks and at 5 visits during the last 10 days (at least 2 visits during the final 5 days). At each visit, 3 readings were obtained in the seated position by trained and certified observers. Blood pressure was determined by the OMRON HEM-907 device (Omron Healthcare Inc, Bannockburn, Ill) for persons requiring a normal adult or large adult cuff and from the SpaceLabs 90207 device (Space Labs Inc, Redmond, Wash) for persons requiring a thigh cuff. Both devices have been validated.25,26 Baseline blood pressure was the average of all measurements obtained during the 3 screening visits. End-of-period blood pressure was the average of all readings obtained during the 5 visits over the last 10 days of each period.
Blood samples after an 8- to 12-hour fast were collected during a screening visit and at weeks 4 and 6 of each feeding period. Measurements obtained at 4 weeks were compared with values at 6 weeks to determine whether a steady state had been reached. Blood samples were collected and then centrifuged. The resulting serum was frozen at –70°C and shipped in batches to the Core Laboratory for Clinical Studies (Washington University School of Medicine, St Louis, Mo). Conventional enzymatic assays were used to measure total triglycerides, total cholesterol, and HDL cholesterol levels. Low-density lipoprotein cholesterol levels were estimated by the Friedewald equation for specimens with a triglyceride concentration below 400 mg/dL (10.36 mmol/L).27 Non–high-density lipoprotein cholesterol levels were calculated as the difference between total cholesterol and HDL cholesterol levels.
Twenty-four-hour urine collections were obtained at baseline prior to feeding and once during the last 2 weeks of each feeding period. At the end of each feeding period, participants completed a self-administered, 15-item symptom checklist and a physical activity questionnaire.
Analytic Considerations
Of primary interest were the contrasts between the carbohydrate and protein diets and between the carbohydrate and unsaturated fat diets. The contrast between the protein and unsaturated fat diets was of secondary interest. Systolic blood pressure and LDL cholesterol were coprimary outcomes. Diastolic blood pressure, triglycerides, and HDL cholesterol were secondary outcomes, and total cholesterol and non-HDL cholesterol were other prespecified outcomes. For each outcome, both overall and in subgroups, between-diet differences in end-of-period measurements were used to perform paired t tests of the hypothesis that the mean between-diet difference was 0. In each analysis, statistical significance was defined by P<.05 (2-sided) without adjustment for multiple comparisons. There was no evidence of differential carryover effects between diets.28 Protocol-specified subgroups included sex, race, and subgroups defined by baseline levels above and below conventional diagnostic thresholds. In addition to between-diet differences, mean (95% confidence interval [CI]) change from baseline to the end of the feeding period are reported. Primary analyses were performed using SAS version 8 (SAS Institute Inc, Cary, NC).
The primary results of this crossover trial derive from an analysis of efficacy on a per protocol basis. Participants qualified for inclusion in the primary analyses if they had measurements of both blood pressure and lipid levels in at least 2 of the 3 diet periods. For these analyses, no imputation of missing data occurred. Sensitivity analyses were performed to understand the impact of missing data and to verify that parametric methods were appropriate. Missing data, that is, between-diet differences in outcomes, were replaced with 0 or with differences from model-based multiple imputation.29 Nonparametric (Wilcoxon rank-based and permutation-based) tests were also performed. Analysis of covariance was used to assess the effects of weight change on trial outcomes.
To estimate the overall effects of risk factor changes, we calculated the average 10-year risk of coronary heart disease (CHD) at baseline and in each diet by applying individual level data to the Framingham risk equation30 and the Prospective Cardiovascular Munster (PROCAM) risk equation.31
Twenty-six persons dropped out prior to outcome ascertainment in the second period (19 during the first and 7 during the second period, Figure 1). These 26 persons were evenly distributed across diets (10 in the carbohydrate, 7 in the protein, and 9 in the unsaturated fat diets). One participant while assigned to the protein diet died after surgery; his death was unrelated to the study. A total of 164 persons completed at least 2 feeding periods (Table 3); 159 completed all 3 periods.
Adherence. Participants consumed each diet for an average of 41 days (Table 4). According to participant self-reports, adherence was high, ie, all study food was consumed and no nonstudy food was eaten on 95% to 96% of person-days on each diet. From run-in to the end of the first period, weight fell by an average of about 1 kg. However, mean end-of-period weights were similar across the 3 diets, as was mean energy intake, alcohol beverage intake, physical activity and urinary excretion of sodium, potassium and phosphorus. Mean urine urea nitrogen, reflecting protein intake, was highest on the protein diet.
Outcomes. Changes From Baseline. Compared with baseline, systolic and diastolic blood pressure and levels of LDL, total, and HDL cholesterol were lower on each diet (Table 5). High-density lipoprotein cholesterol levels decreased from baseline on the carbohydrate and protein diets but were unchanged on the unsaturated fat diet. Compared with baseline, triglyceride levels were lower on the protein and unsaturated fat diets but not on the carbohydrate diet.
Blood Pressure. Compared with the carbohydrate diet, both the protein and unsaturated fat diets significantly lowered systolic and diastolic blood pressure in all participants and in those who were hypertensive. In prehypertensive participants, the protein and the unsaturated fat diets each lowered blood pressure similarly, but blood pressure reductions were statistically significant only for the protein diet. Of the 32 persons who were hypertensive at baseline, 12 (38%) remained hypertensive on the carbohydrate, 7 (22%) on the protein, and 6 (19%) on the unsaturated fat diets.
Lipids. The protein diet but not the unsaturated fat diet significantly lowered LDL cholesterol levels compared with the carbohydrate diet. The protein diet significantly reduced HDL cholesterol levels compared with the carbohydrate and the unsaturated fat diets, whereas the unsaturated fat diet significantly increased HDL cholesterol levels compared with the carbohydrate diet. Compared with the carbohydrate diet, both the protein and the unsaturated fat diets significantly lowered triglyceride, total cholesterol, and non-HDL cholesterol levels. The protein diet also lowered triglyceride and total cholesterol levels compared with the unsaturated fat diet.
Compared with baseline, the 10-year risk of CHD was lower on each study diet by 16.1% to 21.0%, as estimated from the Framingham risk equation (Table 6). Compared with the carbohydrate diet, both the protein and the unsaturated fat diets further lowered CHD risk. Risk reductions, as estimated from the PROCAM equation, were greater than corresponding estimates from the Framingham equation, which did not include triglycerides as an independent variable.
Symptoms
From a 15-symptom checklist, there were statistically significant between-diet differences in 3 symptoms. Poor appetite was reported by 17 (10%) of participants on protein, 6 (4%) on the carbohydrate, and 5 (3%) on the unsaturated fat diets; bloating or fullness was reported by 19 (12%) of participants on protein and 9 (6%) on both the carbohydrate and unsaturated fat diets; and dry mouth was reported by 10 (6%) on the protein, 5 (3%) on the carbohydrate, and 11 (7%) on the unsaturated fat diets.
Comment
Results from this trial build on findings of our earlier research, which documented the beneficial effects of the DASH diet on blood pressure and LDL cholesterol levels.5,6,9,10 In OmniHeart, a diet that partially replaced carbohydrates with protein, about half from plant sources, lowered blood pressure, LDL cholesterol levels, and triglyceride levels, as well as HDL cholesterol levels among adults with prehypertension or stage 1 hypertension. A diet that partially replaced carbohydrates with unsaturated fat, predominantly monounsaturated fat, lowered blood pressure and triglyceride levels and increased HDL cholesterol levels cholesterol but had no significant effect on LDL cholesterol levels. Estimated CHD risk was similar on the protein and unsaturated fat diets and lower than that of the carbohydrate diet.
OmniHeart results extend previous observations on the effects of protein and unsaturated fat on blood pressure. Evidence from the International Study of Macronutrients and Blood Pressure (INTERMAP)16 and other observational studies suggested an inverse association between protein intake, particularly from plant sources, and blood pressure; however, trial results were inconsistent.13,14 Two recent trials documented that increased protein intake from soy supplements, replacing carbohydrate, lowers blood pressure.15,32,33 Results from OmniHeart indicate that protein mainly from nonsoy sources also reduces blood pressure in both prehypertensive and hypertensive individuals. A few observational studies and small trials suggested that increased monounsaturated fat should lower blood pressure,34-36 and OmniHeart results confirm these preliminary findings.
Animal studies and a few small trials in humans have suggested that increased sugar consumption raises blood pressure.37,38 Both the protein and the unsaturated fat diets lowered blood pressure to a similar extent. Hence, it is possible that a reduced intake of carbohydrate, rather than an increased intake of protein or monounsaturated fat, is the dietary factor that lowers blood pressure. Previous studies have tested the blood pressure effects of sugars rather than starch or foods rich in low-glycemic index carbohydrate. The glycemic index in the 3 diets used in OmniHeart is considered moderate (range, 68-75). Because the glycemic index influences the metabolic effects of dietary carbohydrate,39 there is a need for additional research that explores the effects of different types of carbohydrate on blood pressure.
Previous lipid research has focused on the effects of different types of protein rather than different levels. In OmniHeart, the protein diet lowered LDL cholesterol, triglyceride, and HDL cholesterol levels compared with the carbohydrate diet. These findings are consistent with a series of small trials19-21 that documented that replacement of carbohydrate with protein from mixed sources, providing about 25% of kcal from protein, lowered total cholesterol, LDL cholesterol, and triglyceride levels. In OmniHeart, the small reduction in HDL cholesterol levels from the protein diet (2.6% vs carbohydrate; 4.7% vs unsaturated fat) is unexpected, whereas the carbohydrate diet showed its well-established HDL cholesterol–lowering effects compared with fat.40
It is well-known that replacement of carbohydrate with dietary fat lowers triglyceride levels.40 In OmniHeart, the protein diet substantially lowered serum triglycerides compared with the carbohydrate diet. Because the protein diet reduced serum triglycerides to a greater extent than did the unsaturated fat diet, protein may have a direct triglyceride-lowering effect beyond that of replacing carbohydrate, a nutrient that increases triglyceride concentrations. These novel effects of dietary protein on lipid risk factors merit further study.
The fact that each study diet provided recommended levels of saturated fat, cholesterol, fiber, fruits, vegetables, sodium, potassium, and other minerals has implications for the interpretation of trial results. We did not test an unhealthful control diet because previous trials documented the benefits of the DASH diet, which is similar to the carbohydrate diet. However, inferences on the effects of the OmniHeart diets, relative to a typical diet in the United States, can be drawn from changes from baseline when participants were eating their own diets. These observed changes, while often substantial, should be interpreted cautiously because they are subject to regression to the mean. Because there were exclusion criteria for low blood pressure but not for low lipid levels, the phenomenon of regression to the mean likely affected the magnitude of blood pressure change from baseline more so than the magnitude of corresponding lipid changes.
Still, the effects of the carbohydrate diet, net of baseline, and the effects of the DASH diet tested in 2 other feeding studies5,6,9,10 appeared similar. The magnitude of blood pressure and LDL cholesterol reduction from the DASH diet and the carbohydrate diet were nearly identical (systolic blood pressure, 6 mm Hg vs 8 mm Hg; LDL cholesterol 11 mg/dL [0.28 mmol/L] for both), whereas HDL cholesterol levels decreased more from the DASH diet than the carbohydrate diet (3.8 vs 1.4 mg/dL [0.10 vs 0.04 mmol/L]).5,9 Factors that might have lowered blood pressure from baseline are reduced sodium intake, increased potassium intake, and other aspects of the DASH diet from which the study diets were formulated. Given these considerations, changes from baseline in OmniHeart are likely to be real and indicate major benefits from all 3 diets.
As a feeding study, OmniHeart has several strengths. The trial achieved high rates of dietary adherence as evidenced by self-report and objective measurements. Follow-up data collection was virtually complete. Second, the trial controlled weight and held constant other potential confounders. Third, results should be widely applicable to the US population. The study population was large and demographically heterogeneous. The blood pressure inclusion criteria were broad; more than 50% of US adults (>100 million in the United States) have blood pressure in this range.41 By using commonly available food products, typically no more than moderately priced, the trial tested diets that the general population could afford and adopt.
The trial also has limitations. The duration of feeding on each diet was brief, just 6 weeks. Still, the effects of dietary interventions on risk factors tend to persist as long as adherence is maintained.42,43 Second, the trial did not adjust for multiple comparisons, an actively debated issue.44 However, our main results are robust even at a significance level corresponding to strict Bonferroni adjustment with 4 comparisons (P <.0125), reflecting 2 primary between-diet contrasts and 2 primary outcomes). Third, trial outcomes were CVD risk factors, not clinical events. Nevertheless, in longitudinal observational studies, substitution of carbohydrates with increased protein intake from plants is associated with reduced risk of CVD.17,18 Likewise, an increased intake of monounsaturated fat has been associated with reduced CVD and total mortality.45 These results from observational studies corroborate our findings in which CHD risk, as estimated from the Framingham and PROCAM risk equations, was lower on all 3 diets compared with baseline and lower on the protein and the unsaturated fat diets compared with the carbohydrate diet.
Despite the fact that the majority of participants were overweight, the trial was an isocaloric feeding study in which weight was held constant. As an isocaloric feeding study, OmniHeart has the advantage of comparing the effects of different macronutrient profiles without the confounding effects of weight loss. Whether the study diets, as consumed by free-living persons, might also affect weight is uncertain. Worldwide, most lean populations traditionally consume diets that are high in complex carbohydrate and low in fat. However, emerging evidence suggests that hypocaloric diets that are either high in protein46 or monounsaturated fat47 might facilitate weight loss. Hence, overweight persons who adopt either the protein or the unsaturated fat diets should consume hypocaloric versions to concomitantly lose weight.
Results from OmniHeart have important implications. First, our results provide strong evidence that, in addition to salt, potassium, weight, alcohol, and the DASH diet, macronutrients also affect blood pressure. Second, the DASH diet, as tested in this trial, can be improved; partial substitution of carbohydrates with protein, about half from plant sources, or with unsaturated fat, predominantly monounsaturated fat, has beneficial effects on blood pressure and serum lipid levels. Third, the magnitude of effects have both public health and clinical importance. The blood pressure reductions and improved lipid profiles should reduce CVD risk in the general population2,23 and mitigate the need for drug therapy in persons with risk factor levels above treatment thresholds.
In conclusion, in the setting of recommended levels of saturated fat, cholesterol, fiber, fruit, vegetables, and minerals, diets that partially replace carbohydrates with protein or monounsaturated fat can further lower blood pressure, improve lipid risk factors, and reduce CVD risk.
Funding/Support: Funding for this study was provided through grants HL67098, DK63214, HL68712, and RR02635 from the National Institutes of Health. The following companies donated food: The Almond Board, International Tree Nut Council, Olivio Premium Products Inc, and The Peanut Institute.
Role of the Sponsor: The sponsor contributed to the design of the study, interpretation of data, and review of the manuscript. The sponsor also provided administrative support.
Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults. Executive summary of the third report of the national cholesterol education program (NCEP) expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (Adult Treatment Panel III). JAMA. 2001;285:2486-2497CrossrefGoogle Scholar
|
Special counsel Robert Mueller will investigate the business dealings of President Donald Trump's son-in-law Jared Kushner. Mueller's investigation is still in a relatively early phase, and it is still unclear whether Kushner will face criminal charges once it's complete. The news comes as the Justice Department continues its investigation into Russian interference in last year's presidential election. According to Peter Carr, a spokesman for Mueller, “the Special Counsel’s Office has undertaken stringent controls to prohibit unauthorized disclosures and will deal severely with any member who engages in this conduct.”
Kushner has faced increased scrutiny after a report surfaced that he met with both Sergey Kislyak, the Russian ambassador to the United States, and Sergey Gorkov, the head of a state-owned Russian development bank, to discuss issues including sanctions. During his meeting with Kislyak, he purportedly suggested establishing a secure communications line between Trump officials and the Kremlin at a Russian diplomatic facility. The meeting occurred as Kushner's company sought to finance its $1.8 billion purchase of an office building on Fifth Avenue in New York, and could, The Washington Post reports, "raise questions about whether Kushner’s personal financial interests were colliding with his impending role as a public official."
Jamie Gorelick, an attorney for Kushner, said any scrutiny of Kushner's business dealings would be "standard practice."
“We do not know what this report refers to,” Gorelick wrote in an email. “It would be standard practice for the Special Counsel to examine financial records to look for anything related to Russia. Mr. Kushner previously volunteered to share with Congress what he knows about Russia-related matters. He will do the same if he is contacted in connection with any other inquiry.”
Kushner has agreed to discuss his Russian contacts with the Senate Intelligence Committee, which is conducting its own investigation into Russian interference. A date has not yet been set.
Mueller is also investigating Trump for obstruction of justice. The president took to Twitter to discredit reports that he is being investigated for collusion.
Both Trump and Vice President Mike Pence have hired outside counsel to represent them in the special counsel's Russia investigation.
|
Sheshatshiu Innu First Nation
The Sheshatshiu Innu First Nation is located in the province of Newfoundland and Labrador, Canada. This First Nations band government is centred on the community of Sheshatshiu.
The current chief of the Sheshatshiu Innu First Nation is Engene Hart, who succeeded Andrew Penashue in 2015. The First Nation has a registered population of 1,805 people as of September 2019.
References
External links
Government of Canada's Department of Indian and Northern Affairs First Nation profile
Category:Innu
|
Some great news to start the week: California Governor Schwarzenegger has, er, terminated the practice of tail docking dairy cows. Last night he signed a bill outlawing the practice.
Being a dairy cow still sucks, but at least millions of California cows will now be spared the cruelty of having their tails severed. And the bill’s passage will undoubtedly put pressure on other top dairy states to follow suit. The bill takes effect in January. (Via Fearing.) Link to coverage in the Central Valley Business Times, and to the HSUS press release.
|
---
abstract: 'In many atomically thin materials their optical absorption is dominated by excitonic transitions. It was recently found that optical selection rules in these materials are influenced by the band topology near the valleys. We propose that gate-controlled band ordering in a single atomic monolayer, through changes in the valley winding number and excitonic transitions, can be probed in helicity-resolved absorption and photoluminescence. This predicted tunable band topology is confirmed by combining an effective Hamiltonian and a Bethe-Salpeter equation for an accurate description of excitons, with first-principles calculations suggesting its realization in Sb-based monolayers.'
author:
- Gaofeng Xu
- Tong Zhou
- Benedikt Scharf
- Igor Žutić
title: Optically Probing Tunable Band Topology in Atomic Monolayers
---
Since Dirac’s magnetic monopoles [@Dirac1931:PRS], the use of topological quantum numbers has grown significantly and for decades has successfully elucidated fascinating condensed-mater phenomena [@Thouless:1988]. Unlike extensive transport measurements of topological states, starting with quantum Hall effects [@Klitzing1980:PRL; @Tsui1982:PRL], considerably less is known about optically probing tunable band topologies in electronic materials. We suggest that can be changed based on: (i) advances in atomically-thin van der Waals (vdW) materials [@Ajayan2016:PT; @Reis2017:S] and (ii) realizing that in some of them the formation of excitons, bound electron-hole pairs, also reflects the underlying topological properties [@Zhang2018:PRL; @Cao2018:PRL].
Guided by the spin-orbit coupling (SOC)-driven topological band inversion in HgTe/CdTe quantum wells [@Konig2007:S], we seek suitable SOC in atomic monolayers (MLs) for a tunable band topology [@Ajayan2016:PT; @Reis2017:S]. While graphene has motivated important advances [@Kane2005:PRL; @Kane2005:PRL2], its weak SOC and a negligible gap $\sim$40 $\mu$eV [@Sichau2019:PRL] make its topological properties very fragile. In the opposite limit, ML Bi on a SiC substrate has a strong SOC with a huge topological gap ($\sim0.8$ eV) [@Reis2017:S], but its indirect gap is unlikely to support excitons and its large characteristic energies make altering the band ordering very challenging.
![(a) Schematic setup. The linearly polarized (LP) probe light yields a response of definite helicity, $\sigma^{\pm}$, that depends on the electric field, $\mathcal{E}$. (b) Bands at the K/K’ valleys. The K’-valley conduction band ordering and the winding numbers, $w_{1,2}$, change when $\mathcal{E}$ exceeds a critical value, $\mathcal{E}_c$. []{data-label="fig:Scheme"}](Figure1.pdf){width="8.6cm"}
Instead of these extreme cases, we expect that MLs with intermediate SOC strengths and a direct band gap are more promising. A tunable band topology could be experimentally probed by a change in optical selection rules, as a consequence of the change in the relevant topological numbers. We propose how to realize that in Fig. \[fig:Scheme\] where the band structure of the monolayer is changed through the interplay between magnetic proximity effects and electrostatic gating.
The connection between band topology and optical selection rules was recently established for chiral fermions [@Zhang2018:PRL; @Cao2018:PRL], such as graphene-based systems and transition-metal dichalcogenides (TMDs), where the winding number [@Asboth:2016] characterizing the topology of Bloch bands directly modifies the allowed optical transitions and the excitonic properties. As in the generalization of semiclassical equations of motion to include Berry-phase effects [@Xiao2010:RMP], recognizing the importance of winding numbers in the optical response opens novel opportunities.
Unlike previous work on the role of winding numbers on excitons from chiral fermions [@Zhang2018:PRL; @Cao2018:PRL], we consider breaking time-reversal symmetry in proximitized MLs [@Zutic2019:MT] and therefore explicitly include valley and spin degrees of freedom [@Xu2014:NP; @Klinovaja2013:PRB]. This provides a direct connection between the helicity-resolved response and the band topology, established both from the single-particle Hamiltonian and with an accurate inclusion of Coulomb interaction in a Bethe-Salpeter equation. Furthermore, we identify how a gate-controlled conduction band inversion could be implemented in realistic ML materials.
Some ML vdW materials, such as TMDs, are known for their optical properties dominated by excitons with large binding energies (up to $\sim0.5$ eV) and efficient light emission [@Wang2018:RMP; @Mak2010:PRL]. Gradually, it is becoming understood that their difference from extensive work on excitons in conventional semiconductors is not simply a much larger binding energy, but rather that Berry-phase effects [@Garate2011:PRB; @Zhou2015:PRL; @Srivastava2015:PRL; @Wu2017:PRL; @Culcer2017:PRB] and collective excitations can play an important role in the optical response [@VanTuan2017:PRX; @VanTuan2019:PRB]. While we focus on the influence of tunable band topology on excitons, which are absent within the single-particle picture, for an initial characterization of promising materials systems supporting topological states, a single-particle effective Hamiltonian can still offer useful guidance. Group V-based MLs [@Zhang2018:CRC; @Gui2019:JMCA], provide a suitable platform for topological states since the very large SOC and indirect gap of Bi-based MLs [@Reis2017:S] could be altered by considering lighter elements. Specifically, a Sb-based ML, antimonene, could support both a smaller SOC and a direct gap [@Note:SM] and has been experimentally realized [@Ji2016:NC; @Shao2018:NL].
![Band-edge energies as a function of the staggered potential at the (a) $K$ and (b) $K'$ valleys. Helicity-resolved absorption spectra for both valleys when (c) $\mathcal{E}<\mathcal{E}_c$ ($U=10$ meV) and (d) $\mathcal{E}>\mathcal{E}_c$ ($U=80$ meV). At $K'$, the band crossing leads to a change of the winding number, and thus to a change in helicity for the lowest $1s$ exciton absorption peak.[]{data-label="fig:EnergiesAbsorption"}](Figure2.pdf){width="8.6cm"}
We consider the setup in Fig. \[fig:Scheme\](a), a group-V ML deposited on a substrate magnetized along $\hat{\bm{z}}$, with an applied out-of-plane electric field, $\mathcal{E}$. The ML contains A, B sublattices and $K$/$K'$ valleys, at which a low-energy effective Hamiltonian can be constructed. The Hilbert space $\{ | \phi_{A,\tau}^{\uparrow}\rangle, |\phi_{B,\tau}^{\uparrow}\rangle, |\phi_{A,\tau}^{\downarrow}\rangle, |\phi_{B,\tau}^{\downarrow} \rangle\}$ is given with basis functions using $p_{x,y}$ orbitals $|\phi_{A, \tau} \rangle=|- i \tau p_x^A + p_y^A \rangle $, $|\phi_{B, \tau} \rangle =| i \tau p_x^B + p_y^B \rangle$, and $\tau=\pm 1$ are $K$/$K'$ valley indices. The effective Hamiltonian, $H=H_0 + H_{ex} + H_U + H_R$, has contributions from the group-V ML, exchange, staggered potential, and Rashba spin-orbit coupling (SOC) [@Dominguez2018:PRB]. In $H_0$ for the planar ML [@Zhou2015:NL; @Zhou2016:PRB; @Zhou2018:npjQM; @Song2014:NPGAM], $$\begin{aligned}
H_0= \hbar v_F( k_x \sigma_x \tau_z+k_y \sigma_y ) + \lambda_{SO} \sigma_z S_z \tau_z,\end{aligned}$$ $k_{x,y}$ are momenta measured from $K$/$K'$, $\lambda_{SO}$ is the effective on-site SOC, $\sigma_i$, $\tau_z$ and $S_z$ denote Pauli matrices for the orbital, valley, and spin degrees of freedom, respectively. A staggered exchange field induced in the ML arises from the magnetic proximity effect or atomic doping and leads to a term, $$H_{ex}= M_A S_z (1+\sigma_z)/2+ M_B S_z (1-\sigma_z)/2,
\label{eq:ex}$$
[where]{} $M_A$ ($M_B$) is the exchange field for the A (B) sublattice. The magnitude of the staggered potential due to the broken inversion symmetry in the ML, $H_U = U \sigma_z$ can be controlled by the electric field, while Rashba SOC is $H_R=3\lambda_R(\sigma_x S_y \tau_z-\sigma_y S_x)$[@Dominguez2018:PRB].
After a unitary transformation, $H$ becomes
$$\begin{aligned}
\tilde H_{\tau} =
\begin{bmatrix}
E_1^{\tau} & \tau \cos \theta_{\tau} \hbar v_F k_{-\tau} & -i \sin \theta_{\tau} \hbar v_F k_- & 0 \\
\tau \cos \theta_{\tau} \hbar v_F k_{+\tau} & E_2^{\tau} & 0 & -i\sin \theta_{\tau} \hbar v_F k_- \\
i \sin \theta_{\tau} \hbar v_F k_+ & 0 & E_3^{\tau} &-\tau \cos \theta_{\tau} \hbar v_F k_{-\tau} \\
0 & i\sin \theta_{\tau} \hbar v_F k_+ &-\tau \cos \theta_{\tau} \hbar v_F k_{+\tau} & E_4^{\tau}
\end{bmatrix}, \end{aligned}$$
where $\theta_{\tau}=(1/2)\cos^{-1} \left[(\bar M - \tau U)/\sqrt{(\bar M - \tau U)^2+36\lambda_R^2}\right]$, $k_{\pm} = k_x \pm i k_y$, $k_{\pm\tau} = k_x \pm i \tau k_y$. The conduction and valence band (CB, VB) edges at $K$ are $E_{1, 4} = \lambda_{SO} \pm U \pm M_{A, B}$, $E_{2, 3} = - \lambda_{SO}- \Delta M \pm \sqrt{(U-\bar M)^2+36\lambda_R^2}$, while at $K'$ they are $E_{2, 3}'=\lambda_{SO}\mp U \pm M_{B, A}$, $E_{1,4}'$ $= - \lambda_{SO}+\Delta M \pm\sqrt{(U+\bar M )^2+36\lambda_R^2}$, with $\bar M = (M_A+M_B)/2$ and $\Delta M = (M_A-M_B)/2$.
Figures 2(a) and (b) reveal that this explicit dependence of the band-edge energies on the staggered potential is inequivalent in the two valleys, such that we can reach a critical $U_c=\bar M$ for the CB crossing at $K'$, just as depicted in Fig. 1(b). This valley asymmetry is the result of the nonzero $U$ and $\Delta M$, where $U$ can be directly controlled by the $\mathcal{E}$-field: at $\mathcal{E}=\mathcal{E}_c$ there is CB reversal at $K'$ for electrical control of the winding number.
Since the pair of bands with smallest gap has the largest contribution to the lowest-energy exciton, we apply Löwdin’s perturbation theory [@Winkler:2003] and downfold $\tilde{H}_{\tau}$ to the lower CB and upper VB. In the regimes (I): $0<U<\bar M$, and (II): $U>\bar M$, the downfolded $\tilde{H}_{\tau}$ at the $K'$ valley, up to the linear order in $k$, is given by $$\tilde H_{K'}^{(I)} = \begin{bmatrix}
E_3' & i \sin \theta_+ \hbar v_F k_+ \\
-i \sin \theta_+ \hbar v_F k_- & E_1'
\end{bmatrix}, \\$$ $$\tilde H_{K'}^{(II)} =
\begin{bmatrix}
E_2' & -\cos \theta'_+ \hbar v_F k_- \\
-\cos \theta_+' \hbar v_F k_+ & E_1'
\end{bmatrix},$$ revealing the CB reversal at $U_c =\bar M$. In contrast, there is no CB reversal at the $K$ valley, $$\tilde H_K^{(I)}=
\begin{bmatrix}
E_4 & i \sin \theta_{-} \hbar v_F k_+ \\
- i \sin \theta_{-} \hbar v_F k_- & E_2
\end{bmatrix},$$ such that $\tilde{H}_K^{(II)}$ has the same form as $\tilde{H}_K^{(I)}$.
The downfolded $\tilde{H}_{\tau}$ has the same form [@Note:SM] as the chiral fermion model [@Zhang2018:PRL] and we can readily identify the corresponding winding numbers, $w$. Unlike the unchanged $K$-valley winding number, the change of the band topology at the $K'$ valley in regimes (I) and (II) results both in a change of the winding number and the excitonic optical selection rules. Specifically, the excitons with angular quantum number $m$ are bright (optically allowed) for helicity $\sigma^{\pm}$ if $m=w\mp 1 + n N$ [@Zhang2018:PRL; @Cao2018:PRL], where $n$ is an integer and $N$ the degree of discrete rotational symmetry of the crystal lattice. Therefore, the change of winding number from $w=1$ to $-1$ in the $K'$ valley transforms the series of bright excitons with respect to the helicity of light. For example, the $1s$ exciton ($m=0$) is bright under $\sigma^+$ when $w=1$; if $w=-1$, it is instead bright under $\sigma^-$.
So far, we have performed a single-particle analysis, from which implications on the exciton optical selection are made. Below, we verify these predictions and take into account many-body effects by numerically solving the Bethe-Salpeter equation (BSE) [@Rohlfing2000:PRB; @Wu2015:PRB; @Scharf2016:PRB; @Note:SM; @Scharf2017:PRL] to explain experimentally detectable findings, $$[\Omega^{\tau}_{S} -\epsilon^\tau_c({\mathbf{k}})+\epsilon^\tau_v({\mathbf{k}})] \mathcal{A}^{S\tau}_{vc{\mathbf{k}}} =\sum\limits_{v'c'{\mathbf{k}}'}\mathcal{K}^{\tau}_{vc{\mathbf{k}},v'c'{\mathbf{k}}'}\mathcal{A}^{S\tau}_{v'c'{\mathbf{k}}'},
\label{eq:BSE}$$ where $\Omega^{\tau}_{S}$ is the energy of the exciton state $\ket{\Psi^{\tau}_{S}}=\sum_{vc{\mathbf{k}}}\mathcal{A}^{S\tau}_{vc{\mathbf{k}}}\hat{c}^\dagger_{\tau c{\mathbf{k}}}\hat{c}_{\tau v{\mathbf{k}}}\ket{\mathrm{GS}}$ [@footnote:BSE] with the coefficients $\mathcal{A}^{S\tau}_{vc{\mathbf{k}}}$, the creation (annihilation) operator of an electron in a CB $c$ (VB $v$) $\hat{c}^\dagger_{\tau c{\mathbf{k}}}$ ($\hat{c}_{\tau v{\mathbf{k}}}$) in the valley $\tau$, and the ground state $\ket{\mathrm{GS}}$ with fully occupied VBs and unoccupied CBs. $\epsilon^\tau_n({\mathbf{k}})$ with the band index $n=c(v)$ describes the eigenenergies of the single-particle Hamiltonian, $H_{\tau} \eta^{\tau}_{n{\mathbf{k}}}=\epsilon^\tau_n({\mathbf{k}}) \eta^{\tau}_{n{\mathbf{k}}}$, with the eigenstates $\eta^{\tau}_{n{\mathbf{k}}}$. The interaction kernel $\mathcal{K}^{\tau}_{vc{\mathbf{k}},v'c'{\mathbf{k}}'}$ accounts for the Coulomb interaction between electrons in the ML, determined from the dielectric environment [@Keldysh1979:JETP; @Cudazzo2011:PRB; @Scharf2019:JPCM; @Note:SM]. This framework also allows for an inclusion of the magnetic proximity effects on excitons [@Scharf2017:PRL], which can be crucial, but are absent from the common single-particle description.
The optical response is described by the absorption $$\alpha(\omega)=\frac{4e^2\pi^2}{c \: \omega}\frac{1}{A}\sum\limits_{S\tau}\left|\sum\limits_{vc{\mathbf{k}}} v_\pm ({\mathbf{k}}) \mathcal{A}^{S\tau}_{vc{\mathbf{k}}}\right|^2\delta(\hbar\omega-\Omega^{\tau}_{S}),
\label{eq:absorption}$$ where $\omega$ and $c$ are the frequency and speed of light, $A$ the 2D unit area, and the velocity matrix elements are $v_{\pm} ({\mathbf{k}}) = \langle v {\mathbf{k}} | \hat v_{\pm} | c {\mathbf{k}} \rangle$ for helicities $\sigma^{\pm}$, with $ \hat v_{\pm} = \hat v_x \pm i \hat v_y$, and $\hat v_{x, y} = \partial H/\partial(\hbar k_{x, y})$. The absorption in Figs. \[fig:EnergiesAbsorption\](c) and (d) confirms a striking gate-controlled helicity reversal, anticipated from the single-particle picture. Remarkably, by changing $\mathcal{E}<\mathcal{E}_c$ (at $U=10$ meV) to $\mathcal{E}>\mathcal{E}_c$ (at $U=80$ meV), we see a helicity reversal of the lowest 1s exciton peak from positive ($\sigma^+$) to negative ($\sigma^-$), using realistic parameters discussed further in Ref. [@Note:SM]. Alternatively, the photoluminescence ($\sigma^+$ or $\sigma^-$), dominated by the 1s exciton due to relaxation, is also gate-controllable \[Fig. \[fig:Scheme\](a)\], reflecting the changing band topology.
To illustrate the ${\mathbf{k}}$-space band topology, in Fig. \[fig:Texture\] we plot the interband matrix elements of $\hat v_{\pm} ({\mathbf{k}})$ for $U< U_c$ and $U>U_c$ at the $K'$ valley. Each complex matrix element is visualized as a vector with its origin located at ${\mathbf{k}}$. These matrix elements are not physical observables and have an arbitrary phase, just as the eigenstates $|v {\mathbf{k}} \rangle$ and $|c {\mathbf{k}} \rangle$. To avoid such phase ambiguity and obtain meaningful patterns, we chose a specific gauge [@Note:SM].
![Winding patterns of the interband matrix elements of the velocity operators $v_{\pm} ({\mathbf{k}})$ at the $K'$ valley with the $K'$ point at the origin. The real (imaginary) part of $v_{\pm}({{\mathbf{k}}})$ is given along the horizontal (vertical) direction. (a) $v_+ ({\mathbf{k}})$ and (b) $v_- ({\mathbf{k}})$ for $\mathcal{E}<\mathcal{E}_c$. (c) $v_+ ({\mathbf{k}})$ and (d) $v_- ({\mathbf{k}})$ for $\mathcal{E}>\mathcal{E}_c$.[]{data-label="fig:Texture"}](Figure3.pdf){width="8.6cm"}
The change of winding number from $w=1$ ($\mathcal{E}<\mathcal{E}_c$) to $w=-1$ ($\mathcal{E}>\mathcal{E}_c$) is accompanied by a change of winding patterns, which are also consistent with the analytical analysis of the two-band model: $v_{\pm} ({\mathbf{k}}) \propto \exp(-i (w\mp 1) \phi_{{\mathbf{k}}})$, where $\phi_{{\mathbf{k}}}$ is the angle between ${\mathbf{k}}$ and the $x$-axis [@Zhang2018:PRL]. Since the system has a rotational symmetry ignoring crystal field effects, the envelope function of an exciton can be formally written as $\mathcal{A}_{vc{\mathbf{k}}} = f_m (|{\mathbf{k}}|) e^{i m \phi_{{\mathbf{k}}}}$, containing a radial part $f_m (|{\mathbf{k}}|)$ and an angular part with an angular quantum number $m$. Thus, the oscillator strength of the optical transition to an exciton state with angular quantum number $m$ can be expressed as, $$\begin{aligned}
O_{\pm}^m \propto \left| \sum_{{\mathbf{k}}} f_m (|{\mathbf{k}}|) e^{i m \phi_{{\mathbf{k}}}} v_{\pm} ({\mathbf{k}}) \right|^2, \end{aligned}$$ which determines the contribution of this particular excitation to the absorption in Eq. (\[eq:absorption\]). To have a nonzero integral and thus a bright exciton, the angular part of the integral has to vanish, i.e., the phase winding of the velocity matrix element has to be canceled by the angular part of the exciton envelope function. Since $f_m (|{\mathbf{k}}|)$ is localized around ${\mathbf{k}} =0$ (Wannier excitons), we can estimate the oscillator strength and thus the brightness of a specific exciton state with angular quantum number $m$ based on the winding patterns of $v_{\pm} ({\mathbf{k}})$.
When $\mathcal{E}<\mathcal{E}_c$, $v_+({\mathbf{k}})$ is nearly uniform in the vicinity of the $K'$ point (${\mathbf{k}} =0$). Therefore, the angular part of the integral vanishes for $m=0$, which means that $s$ excitons are bright under $\sigma^+$ light. However, $v_-({\mathbf{k}})$ winds clockwise twice around the $K'$ point through any counter clockwise contour enclosing the $K'$ point, which implies bright $d$ excitons ($m=2$) under $\sigma^-$ light. In contrast, when $\mathcal{E}>\mathcal{E}_c$, $v_-({\mathbf{k}})$ has uniform phases and therefore supports bright $s$ excitons ($m=0$) under $\sigma^-$. Additionally, $v_+({\mathbf{k}})$ winds counterclockwise twice around the $K'$ point, indicating bright $d$ excitons ($m=-2$) under $\sigma^+$. These findings agree with our single-particle analysis as well as the BSE results in Figs. \[fig:EnergiesAbsorption\](c) and (d).
To explore the experimental feasibility of our proposal we use first-principles calculations and seek realistic materials. Recently, ML Sb has been successfully synthesized and characterized [@Ji2016:NC; @Shao2018:NL]. Fully hydrogenated Sb (SbH) ML was found to be a two-dimensional quantum spin Hall insulator with a giant direct topological gap of 410 meV, while retaining a stable structure up to 400 K, revealing its potential as a platform for room-temperature quantum devices [@Song2014:NPGAM]. The desired staggered exchange field in our model can be induced to ML SbH either through proximity effects from magnetic substrates (e.g., LaFeO$_3$) [@Zhou2016:PRB] or doping of magnetic atoms (W, Cr, and Mn) [@Zhou2015:NL], which can lead to interesting valley-polarized topological states [@Zhou2015:NL; @Zhou2016:PRB; @Zhou2018:npjQM].
Motivated by these studies, we focus on W-doped ML SbH. Its fully relaxed geometric structure is shown in Fig. \[fig:Structure\](a). To demonstrate the manipulation of this system by the electric field, we show in Figs. \[fig:Structure\](b)-(d) first-principles calculations for the evolution of the electronic band structure under different applied $\mathcal{E}$ [@Note:SM]. At $\mathcal{E}=0$, Fig. \[fig:Structure\](b) reveals a desirable direct topological gap of $\sim 180$ meV. For $\mathcal{E}$ applied along the $\hat{\bm{z}}$-direction, the energy gap between the two CBs at $K'$ reduces and closes at $\mathcal{E}= 2$ V/nm \[Fig. \[fig:Structure\](c)\]. For even larger $\mathcal{E}$ [@note:gate], as shown in Fig. \[fig:Structure\](d), such a gap between the two CBs reopens, leading to a change of the $K'$ winding number. The corresponding band inversion and change of band topology indicate that W-doped ML SbH is indeed a good candidate to observe our predictions.
![(a) Hexagonal structure of a W-doped ML SbH and the corresponding electronic structure for the electrical field $\mathcal{E}$: (b) smaller ($0$ V/nm), (c) equal ($2$ V/nm), and (d) greater ($4$ V/nm) than the critical value $\mathcal{E}_c$, displaying a CB inversion in the $K'$ valley (highlighted by rectangles).[]{data-label="fig:Structure"}](Figure4.pdf){width="8.6cm"}
To generalize considerations from this work, it would be interesting to examine how the influence of tunable band topology on optical selection rules can be extended to other materials systems, beyond chiral fermions.
While we have focused on magnetically-doped MLs, our predictions could instead employ magnetic proximity-modified excitonic transitions. This approach could also be studied using the Bethe-Salpeter equation [@Scharf2017:PRL] for considering atomically-thin magnetic substrates [@Zollner2019:PRB; @Shayan2019:NL]. The advantage of magnetic proximity effects over applying a magnetic field to remove the valley degeneracy is their relative magnitude [@Zutic2019:MT; @Qi2015:PRB; @Zhao2017:NN; @Zhong2017:SA], exceeding a modest Zeeman splitting from typical $g$-factors in MLs [@Srivastava2015:NP; @MacNeill2015:PRL; @Stier2016:NC; @Plechinger2016:NL]. Electrically-tunable magnetic proximity effects in MLs [@Lazi2016:PRB; @Xu2018:NC; @Cortes2019:PRL; @Zhao2019:2DM; @Zollner2019:NJP; @Tao2019:PRB] could reduce the critical electric field to alter the band topology. In particular, it would be desirable to implement a fast electrical reversal of helicity as an element of the suggested ML-based spin-lasers [@Lee2014:APL], which could exceed the performance of the best conventional counterparts [@Lindemann2019:N], without spin-polarized carriers.
This work was mainly supported by the U.S. DOE, Office of Science BES, Award No. DE-SC0004890. B.S. was supported by the German Research Foundation (DFG) through SFB 1170 Project-ID 258499086 and the Würzburg-Dresden Cluster of Excellence on Complexity and Topology in Quantum Matter – *ct.qmat* (EXC 2147, Project-ID 39085490) and by the ENB Graduate School on Topological Insulators. Computational work was supported by the UB CCR.
[99]{}
P. A. M. Dirac, Quantized Singularities of Electromagnetic Field, Proc. Roc. Soc. London [**133**]{}, 60 (1931).
D. J. Thouless, [*Topological Quantum Numbers in Nonrelativistic Physics*]{}, (World Scientific, 1988).
K. von Klitzing, G. Dorda, and M. Pepper New Method for High-Accuracy Determination of the Fine-Structure Constant Based on Quantum Hall Resistance Phys. Rev. Lett. [**45**]{}, 494 (1980).
D. C. Tsui, H. L. St[ö]{}rmer, and A. C. Gossard, Two Dimensional Magnetotransport in the Extreme Quantum Limit, Phys. Rev. Lett. [**48**]{}, 1559 (1982).
P. Ajayan, P. Kim, and K. Banerjee, Two-Dimensional van der Waals Materials, Phys. Today [**9**]{}, 38 (2016).
F. Reis, G. Li, L. Dudy, M. Bauernfeind, S. Glass, W. Hanke, R. Thomale, J. Sch[ä]{}fer, and R. Claessen, Bismuthene on a SiC substrate: A Candidate for a High-Temperature Quantum Spin Hall Material, Science [**357**]{}, 287 (2017).
X. Zhang, W.-Y. Shan, and D. Xiao, Optical Selection Rule of Excitons in Gapped Chiral Fermion Systems, Phys. Rev. Lett. [**120**]{}, 077401 (2018).
T. Cao, M. Wu, and S. G. Louie, Unifying Optical Selection Rules for Excitons in Two Dimensions: Band Topology and Winding Numbers, Phys. Rev. Lett. [**120**]{}, 087402 (2018).
M. K[ö]{}nig, S. Wiedmann, C. Br[ü]{}ne, A. Roth, H. Buhmann, L. W. Molenkamp, X.-L. Qi, and S.-C. Zhang, Quantum Spin Hall Insulator State in HgTe Quantum Wells, Science [**318**]{}, 766 (2007).
C. L. Kane and E. J. Mele, Quantum Spin Hall Effect in Graphene, Phys. Rev. Lett. [**95**]{}, 226801 (2005).
C. L. Kane and E. J. Mele, $Z_2$ Topological Order and the Quantum Spin Hall Effect, Phys. Rev. Lett. [**95**]{}, 146802 (2005).
J. Sichau, M. Prada, T. Anlauf, T. J. Lyon, B. Bosnjak, L. Tiemann, and R. H. Blick, Resonance Microwave Measurements of an Intrinsic Spin-Orbit Coupling Gap in Graphene: A Possible Indication of a Topological State, Phys. Rev. Lett. [**122**]{}, 046403 (2019).
J. K. Asb[ó]{}th, L. Oroszl[á]{}ny, and A. P[á]{}lyi, A Short Course on Topological Insulators, [*Springer, Heidelberg, 2016*]{}.
Di Xiao, M.-C. Chang, and Q. Niu, Berry Phase Effects on Electronic Properties, Rev. Mod. Phys. [**82**]{}, 1959 (2010).
I. Žutić, A. Matos-Abiague, B. Scharf, H. Dery, and K. Belashchenko, Proximitized Materials, Mater. Today [**22**]{}, 85 (2019).
X. Xu, W. Yao, and T. F. Heinz, Spin and Pseudospins in Layer Transition Metal Dichalcogenides, Nat. Phys. [**10**]{}, 343 (2014).
J. Klinovaja and D. Loss, Spintronics in MoS$_2$ Monolayer Quantum Wires, Phys. Rev. B [**88**]{}, 075404 (2013).
G. Wang, A. Chernikov, M. M. Glazov, T. F. Heinz, X. Marie, T. Amand, and B. Urbaszek, Colloquium: Excitons in Atomically Thin Transition Metal Dichalcogenides, Rev. Mod. Phys. [**90**]{}, 021001 (2018).
K. F. Mak, C. Lee, J. Hone, J. Shan, and T. F. Heinz, Atomically Thin MoS$_2$: A New Direct-Gap Semiconductor, Phys. Rev. Lett. [**105**]{}, 136805 (2010).
I. Garate and M. Franz, Excitons and Optical Absorption on the Surface of a Strong Topological Insulator with a Magnetic Energy Gap, Phys. Rev. B [**84**]{}, 045403 (2011).
J. Zhou, W.-Y. Shan, W. Yao, and D. Xiao, Berry Phase Modification to the Energy Spectrum of Excitons, Phys. Rev. Lett. [**115**]{}, 166803 (2015).
A. Srivastava and A. Imamo[ǧ]{}lu, Signatures of Bloch-Band Geometry on Excitons: Nonhydrogenic Spectra in Transition-Metal Dichalcogenides, Phys. Rev. Lett. [**115**]{}, 166802 (2015).
F. Wu, T. Lovorn, and A. H. MacDonald, Topological Exciton Bands in Moir[é]{} Heterojunctions, Phys. Rev. Lett. [**118**]{}, 147401 (2017).
D. Culcer, A. Sekine, and A. H. MacDonald, Inter-band Coherence Response to Electric Fields in Crystals: Berry-Phase Contributions and Disorder Effects, Phys. Rev. B [**96**]{}, 035106 (2017).
D. [Van Tuan]{}, B. Scharf, I. Žutić, and H. Dery, Marrying Excitons and Plasmons in Monolayer Transition-Metal Dichalcogenides, Phys. Rev. X [**7**]{}, 041040 (2017).
D. [Van Tuan]{}, B. Scharf, and Z. Wang, J. Shan, K. F. Mak, I. [Žutić]{}, and H. Dery, Probing Many-Body Interactions in Monolayer Transition-Metal Dichalcogenides, Phys. Rev. B [**99**]{}, 085301 (2019).
S. Zhang, S. Guo, Z. Chen, Y. Wang, H. Gao, J. G[ó]{}mez-Herrero, P. Ares, F. Zamora, Z. Zhu, and H. Zeng, Recent Progress in 2D Group-VA Semiconductors: From Theory to Experiment, Chem. Soc. Rev. [**47**]{}, 982 (2018).
R. Gui, H. Jin, Y. Sun, X. Jiang, and Z. Sun, Two-Dimensional Group-VA Nanomaterials Beyond Black Phosphorus: Synthetic Methods, Properties, Functional Nanostructures and Applications, J. Mater. Chem. A [**7**]{}, 25712 (2019).
See Supplemental Material for a discussion on electronic structure of bismuthene and antimonene, the gapped chiral fermion model and the associated winding number, the screening potential, the gauge choice, and computational details on the BSE and first-principles calculations.
J. Ji, X. Song, J. Liu, Z. Yan, C. Huo, S. Zhang, M. Su, L. Liao, W. Wang, Z. Ni, Y. Hao, and H. Zeng, Two-Dimensional Antimonene Single Crystals Grown by van der Waals Epitaxy, Nat. Commun. [**7**]{}, 13352 (2016).
Y. Shao, Z.-L. Liu, C. Cheng, Xu Wu, H. Liu, C. Liu, J.-O. Wang, S.-Y. Zhu, Y.-Q. Wang, D.-X. Shi, K. Ibrahim, J.-T. Sun, Y.-L. Wang, H.-J. Gao, Epitaxial Growth of Flat Antimonene Monolayer: A New Honeycomb Analogue of Graphene, Nano Lett. [**18**]{}, 2133 (2018).
F. Dominguez, B. Scharf, G. Li, J. Schäfer, R. Claessen, W. Hanke, R. Thomale, and E. M. Hankiewicz, Testing Topological Protection of Edge States in Hexagonal Quantum Spin Hall Candidate Materials, Phys. Rev. B [**98**]{}, 161407(R) (2018).
T. Zhou, J. Zhang, Y. Xue, B. Zhao, H. Zhang, H. Jiang, and Z. Yang, Quantum Spin-Quantum Anomalous Hall Effect with Tunable Edge States in Sb Monolayer-Based Heterostructures, Phys. Rev. B [**94**]{}, 235449 (2016).
T. Zhou, J. Zhang, B. Zhao, H. Zhang, and Z. Yang, Quantum Spin-Quantum Anomalous Hall Insulators and Topological Transitions in Functionalized Sb(111) Monolayers, Nano Lett. [**15**]{}, 5149 (2015).
Z. Song, C.-C. Liu, J. Yang, J. Han, M. Ye, B. Fu, Y. Yang, Q. Niu, J. Lu, and Y. Yao, Quantum Spin Hall Insulators and Quantum Valley Hall Insulators of BiX/SbX (X=H, F, Cl and Br) Monolayers with a Record Bulk Band Gap, NPG Asia Mater. [**6**]{}, e147 (2014).
T. Zhou, J. Zhang, H. Jiang, I. Žutić, and Z. Yang, Giant Spin-Valley Polarization and Multiple Hall Effects in Functionalized Bismuth Monolayers, npj Quant. Mater. [**3**]{}, 39 (2018).
R. Winkler, [*Spin-Orbit Coupling Effects in Two-Dimensional Electron and Hole Systems*]{} (Springer, Berlin, 2003).
M. Rohlfing and S. G. Louie, Electron-Hole Excitations and Optical Spectra from First Principles, Phys. Rev. B [**62**]{}, 4927 (2000).
F. Wu, F. Qu, and A. H. MacDonald, Exciton Band Structure of Monolayer MoS$_2$, Phys. Rev. B [**91**]{}, 075310 (2015).
B. Scharf, T. Frank, M. Gmitra, J. Fabian, I. Žutić, and V. Perebeinos, Excitonic Stark Effect in MoS$_2$ Monolayers, Phys. Rev. B [**94**]{}, 245434 (2016).
B. Scharf, G. Xu, A. Matos-Abiague, and I. Žutić, Magnetic Proximity Effects in Transition-Metal Dichalcogenides: Converting Excitons, Phys. Rev. Lett. [**119**]{}, 127403 (2017).
We do not include intervalley scattering processes. H. Dery, Theory of Intervalley Coulomb Interactions in Monolayer Transition-Metal Dichalcogenides, Phys. Rev. B [**94**]{}, 075421 (2016).
L. V. Keldysh, Coulomb Interaction in Thin Semiconductor and Semimetal Films, JETP Lett. [**29**]{}, 658 (1979).
P. Cudazzo, I. V. Tokatly, and A. Rubio, Dielectric Screening in Two-Dimensional Insulators: Implications for Excitonic and Impurity States in Graphane, Phys. Rev. B [**84**]{}, 085406 (2011).
B. Scharf, D. [Van Tuan]{}, I. [Žutić]{}, and H. Dery", Dynamical Screening in Monolayer Transition-Metal Dichalcogenides and its Manifestation in the Exciton Spectrum, J. Phys.: Cond. Matter [**31**]{}, 203001 (2019).
Such values have been experimentally attainable for a while. J. Mannhart, J. Str[ö]{}bel, J. G. Bednorz, and Ch. Gerber, Large Electric Field Effects in YBa$_2$Cu$_3$O${7-\delta}$ Films Containing Weak Links Appl. Phys. Lett. [**62**]{}, 630 (1993); A. F. Hebard, A. T. Fiory, and R. Eick, Experimental Considerations in the Quest for a Thin-Film Superconducting Field-Effect Transistor, IEEE Trans. Magn. [**23**]{}, 1279 (1987).
K. Zollner, P. E. Faria Junior, and J. Fabian, Proximity Exchange Effects in MoSe$_2$ and WSe$_2$ Heterostructures with CrI$_3$: Twist Angle, Layer, and Gate Dependence, Phys. Rev. B [**100**]{}, 085128 (2019).
K. Shayan, Na Liu, A. Cupo, Y. Ma, Y. Luo, V. Meunier, S. Strauf, Magnetic Proximity Coupling of Quantum Emitters in WSe$_2$ to van der Waals Ferromagnets Nano Lett. [**19**]{}, 7301 (2019).
J. Qi, X. Li, Q. Niu, and J. Feng, Giant and Tunable Valley Degeneracy Splitting in MoTe$_2$, Phys. Rev. B [**92**]{}, 121403 (2015).
C. Zhao, T. Norden, P. Zhao, Y. Cheng, P. Zhang, F. Sun, P. Taheri, J. Wang, Y. Yang, T. Scrace, K. Kang, S. Yang, G. Miao, R. Sabirianov, G. Kioseoglou, A. Petrou, and H. Zeng, Enhanced valley splitting in monolayer WSe$_2 $ due to Magnetic Exchange Field, Nat. Nanotechnol. [**12**]{}, 757 (2017).
D. Zhong, K. L. Seyler, X. Linpeng, R. Cheng, N. Sivadas, B. Huang, E. Schmidgall, T. Taniguchi, K. Watanabe, M. A. McGuire, W. Yao, D. Xiao, K.-M. C. Fu, and X. Xu, van der Waals Engineering of Ferromagnetic Semiconductor Heterostructures for Spin and Valleytronics, Sci. Adv. 3, e1603113 (2017).
A. Srivastava, M. Sidler, A. V. Allain, D. S. Lembke, A. Kis, and A. Imamoglu, Valley Zeeman Effect in Elementary Optical Excitations of Monolayer WSe$_2$, Nat. Phys. [**11**]{}, 141 (2015).
D. MacNeill, C. Heikes, K. F. Mak, Z. Anderson, A. Kormanyos, V. Zolyomi, J. Park, and D. C. Ralph, Breaking of Valley Degeneracy by Magnetic Field in Monolayer MoSe$_2$, Phys. Rev. Lett. [**114**]{}, 037401 (2015).
A. V. Stier, K. M. McCreary, B. T. Jonker, J. Kono, and S. A. Crooker, Exciton Diamagnetic Shifts and Valley Zeeman Effects in Monolayer WS$_2$ and MoS$_2$ to 65 Tesla, Nat. Commun. [**7**]{}, 10643 (2016).
G. Plechinger, P. Nagler, A. Arora, A. Granados del [Á]{}guila, M.V. Ballottin, T. Frank, P. Steinleitner, M. Gmitra, J. Fabian, P. C. M. Christianen, R. Bratschitsch, C. Sch[ü]{}ller, and T. Korn, Excitonic Valley Effects in Monolayer WS$_2$ under High Magnetic Fields, Nano Lett. [**16**]{}, 7899 (2016).
P. Lazić, K. D. Belashchenko, and I. Žutić, Effective Gating and Tunable Magnetic Proximity Effects in Two-Dimensional Heterostructures, Phys. Rev. B [**93**]{}, 241401(R) (2016).
J. Xu, S. Singh, J. Katoch, G. Wu, T. Zhu, I. Žutić, and R. K. Kawakami, Spin Inversion in Graphene Spin Valves by Gate-Tunable Magnetic Proximity Effect at One-Dimensional Contacts, Nat. Commun. [**9**]{}, 2869 (2018).
N. Cort[é]{}s, O. [Á]{}valos-Ovando, L. Rosales, P. A. Orellana, and S. E. Ulloa, Tunable Spin-Polarized Edge Currents in Proximitized Transition Metal Dichalcogenides, Phys. Rev. Lett. [**122**]{}, 086401 (2019).
B. Zhao, D. Khokhriakov, B. Karpiak, A. M. Hoque, L. Xu, L. Shen, Y. P. Feng, X. Xu, Y. Jiang, and S. P. Dash, Electrically Controlled Spin-Switch and Evolution of Hanle Spin Precession in Graphene, 2D Mater. [**6**]{}, 035042 (2019).
K. Zollner, M. Gmitra, and J. Fabian, Electrically Tunable Exchange Splitting in Bilayer Graphene on Monolayer Cr$_2$X$_2$Te$_6$ with X=Ge, Si, and Sn, New. J. Phys. [**20**]{}, 073007 (2018).
L. L. Tao and E. Y. Tsymbal, Two-Dimensional Spin-Valley Locking Spin Valve, Phys. Rev. B [**100**]{}, 161110(R) (2019).
J. Lee, S. Bearden, E. Wasner, and I. Žutić, Spin-Lasers: From Threshold Reduction to Large-Signal Analysis, Appl. Phys. Lett. [**105**]{}, 042411 (2014).
M. Lindemann, G. Xu, T. Pusch, R. Michalzik, M. R. Hofmann, I. [Žutić]{}, and N. C. Gerhardt, Ultrafast Spin-Lasers, Nature [**568**]{}, 212 (2019).
|
Gift from the heart
9-year-old makes touching donation for family in need
Greenfield 9-year-old Nicholas Merzi donated money he earned doing chores to the Landis family of Jaffrey, which lost its home in a hourse fire on June 6. (Courtesy)
GREENFIELD — Since the Landis family of Jaffrey lost its home in a house fire on June 6, donations from the community have been pouring in, but it is the donation of a small bag of pennies, nickels, dimes and quarters from 9-year-old Nicholas Merzi that has touched the hearts of so many.
Nicholas said Thursday that he earned the pocket change doing chores around the house.
"I heard about it and I thought, 'Oh this is not cool.' And mom said they lost everything and it really came to me that they need some money," he said.
Nicholas' mom, Laura Merzi, said she heard about the call for donations through an online yard sale group she belongs to through Facebook.
Crystal Bechard, the assistant manager at Hubert's clothing store in Peterborough, had posted the request for donations after a member of the Landis family came in with her 18-month-old daughter to shop for clothing.
On June 6 an explosion and fire destroyed the Sanders Road home of Hugh and Terry Landis, their two sons, their daughter-in-law and 18-month-old granddaughter, displacing the family of six.
Bechard was helping the mother shop for her 18-month-old when she learned they had lost everything in a fire.
Hubert's was able to help the family by donating some outfits to the little girl, Bechard said. The store and employees started coordinating donations from the community.
On Sunday, after driving to several communities throughout Cheshire and Hillsborough counties to pick up donated items, Bechard returned to Hubert's in Peterborough to meet Merzi in the parking lot. Merzi was bringing items from her home.
Nicholas jumped out of the car and handed Bechard the bag of change, she said.
Merzi said she was at home gathering items for the family when Nicholas asked what she was doing.
"He has a two-year-old sister and I don't know if that triggered anything," Merzi said. "He got all his change, wrote a note and put it in with all the donations. I told him I was proud. I don't believe I even read the note."
Bechard said she didn't read the note till she got home that day and when she did it brought tears to her eyes.
"I hope that this is enough money to buy some food, water, or even a bar of soap. Hope all's well and happy. This is all the money I erned in one year! Use the money wissly. Love Nicholas Merzi," he wrote in the note.She was so moved, Bechard took a photo of the note the way it came, inside the bag of change, and posted it to the Ellen DeGeneres Facebook page.Since then the post has received over 2,600 likes, over 200 comments and has been shared nearly 500 times.
"It's just touching people from all over the place," Bechard said. "It was even shared in a different language yesterday."
"We've become celebrities," Merzi said. "It's unbelievable what people are saying. We certainly didn't expect all the attention from it. It was just a nice thing for him to do and makes me very proud."
Bechard said she is not surprised so many people are touched by the gesture.
"No one else can say they gave everything they have," she said.
Nicholas said part of him did hesitate before he gave, but said he was shocked by what happened to the family.
"I felt really proud of myself and it's funny because half of my brain said, 'I don't want to give the money' and the other half of my brain said, 'Do it,' so I did it anyway," he said.
His mom said she hopes all the attention draws awareness to the very real need of the Landis family.
"I hope that all this attention brings to light the true issue that these people lost their house," she said.
Bechard said Hubert's in Peterborough is still collecting donations and is working to coordinate with other efforts in the community to provide for the Landis family.
A friend of the family, Cassie Cleverly of Dublin, is also collecting donations.
Mona Adisa Brooks is also accepting donations at her art gallery, Trumpet, in Peterborough.
Route 119 Storage in Rindge is donating a storage unit for the family to use and money jars are on the Hubert's counter as well as the counter at River Street Market in Jaffrey.
|
Fabian Schär stiess im Sommer 2012 vom FC Wil 1900, für den er ab dem achten Lebensjahr gespielt hatte und im Jahre 2009 in die 1. Mannschaft aufgestiegen war, nach Basel.
Der 23-jährige Internationale wurde schnell zu einer wichtigen Teamstütze, bestritt im nationalen sowie internationalen Wettbewerb bisher 113 Pflichtspiele und konnte dabei 15 Tore erzielen. Schär gewann dabei mit dem FCB dreimal in Folge die Schweizer Meisterschaft und hat am kommenden Sonntag die Möglichkeit, erstmals auch den Schweizer Cup zu gewinnen.
Für die Schweizer A-Nationalmannschaft lief Schär bis heute zwölf Mal auf – er schoss fünf Tore für die Auswahl von Trainer Vladimir Petkovic. Schär ist seit der Saison 2004/2005 und damit seit rund zehn Jahren bereits der 20. Spieler, der vom FC Basel 1893 in die 1. Bundesliga nach Deutschland wechselt.
Fabian Schär äusserte sich folgendermassen zu seinem Tansfer: „Ich freue mich sehr auf die neue Herausforderung bei der TSG 1899 Hoffenheim. Bis zu meinem Start in der Bundesliga haben aber der Cupfinal vom kommenden Sonntag sowie die Länderspiele gegen Liechtenstein und Litauen oberste Priorität.“
Der FC Basel 1893 bedankt sich bei Fabian Schär für seinen Einsatz für Rotblau und wünscht ihm in der Bundesliga alles Gute und viel Erfolg!
|
Bridgewater, N.J. • President Donald Trump on Sunday acknowledged that the 2016 Trump Tower meeting between a Kremlin-connected lawyer and his son was to collect information about his political opponent, casting new light on a moment central to the special counsel’s Russia probe.
Trump, amid a series of searing tweets sent from his New Jersey golf club, tore into two of his favorite targets, the news media and Robert Mueller’s ongoing investigation into possible links between the president’s campaign and Russia. Trump unleashed particularly fury at reports that he was anxious about the Trump Tower meeting attended by Donald Trump Jr. and other senior campaign officials.
“Fake News reporting, a complete fabrication, that I am concerned about the meeting my wonderful son, Donald, had in Trump Tower,” Trump wrote. “This was a meeting to get information on an opponent, totally legal and done all the time in politics - and it went nowhere. I did not know about it!”
But 13 months ago, Trump gave a far different explanation for the meeting. A July 2017 statement dictated by the president read: “We primarily discussed a program about the adoption of Russian children that was active and popular with American families years ago.”
But since then, the story about the meeting has changed several times, eventually forced by the discovery of emails between the president’s eldest son and an intermediary from the Russian government offering damaging information about Trump’s opponent, Hillary Clinton. Betraying no surprise or misgivings about the offer from a hostile foreign power, Trump Jr. replied: “If it’s what you say I love it especially later in the summer.”
Sunday’s tweet was Trump’s clearest statement yet on the purpose of the meeting, which has become a focal point of Mueller’s investigation even as the president and his lawyers try to downplay its significance and pummel the Mueller probe with attacks. On Sunday, Trump again suggested without evidence that Mueller was biased against him, declaring, “This is the most one sided Witch Hunt in the history of our country.”
And as Trump and his allies have tried to discredit the probe, a new talking point has emerged: that even if that meeting was held to collect damaging information, none was provided and “collusion” — Trump’s go-to description of what Mueller is investigating — never occurred.
“The question is what law, statute or rule or regulation has been violated, and nobody has pointed to one,” said Jay Sekulow, one of Trump’s attorneys, on ABC’s “This Week.”
But legal experts have pointed out several possible criminal charges, including conspiracy against the United States and aiding and abetting a conspiracy. And despite Trump’s public Twitter denial, the president has expressed worry that his son may face legal exposure even as he believes he did nothing wrong, according to three people close to the White House familiar with the president’s thinking but not authorized to speak publicly about private conversations.
Sekulow acknowledged that the public explanation for the meeting has changed but insisted that the White House has been very clear with the special counsel’s office. He said he was not aware of Trump Jr. facing any legal exposure.
“I don’t represent Don Jr.,” Sekulow said, “but I will tell you I have no knowledge at all of Don Jr. being told that he’s a target of any investigation, and I have no knowledge of him being interviewed by the special counsel.”
Trump's days of private anger spilled out into public with the Twitter outburst, which comes at a perilous time for the president.
A decision about whether he sits for an interview with Mueller may also occur in the coming weeks, according to another one of his attorneys, Rudy Giuliani. Trump has seethed against what he feels are trumped-up charges against his former campaign chairman, Paul Manafort, whose trial began last week and provided a visible reminder of Mueller's work.
And he raged against the media's obsession with his links to Russia and the status of Michael Cohen, his former fixer, who is under federal investigation in New York. Cohen has indicated that he would tell prosecutors that Trump knew about the Trump Tower meeting ahead of time.
Despite a show of force from his national security team this week as a warning against future Russian election meddling, Trump again deemed the matter a “hoax” this week. And at a trio of rallies, he escalated his already vitriolic rhetoric toward the media, savaging the press for unflattering coverage and, he feels, bias.
“The Fake News hates me saying that they are the Enemy of the People only because they know it’s TRUE,” Trump tweeted Sunday. “I am providing a great service by explaining this to the American People. They purposely cause great division & distrust. They can also cause War! They are very dangerous & sick!”
The fusillade of tweets came from Bedminster, Trump's golf course, where he is ensconced in a property that bears his name at every turn and is less checked in by staffers. It was at the New Jersey golf club where a brooding Trump has unleashed other inflammatory attacks and where, in spring 2017, he made the final decision to fire FBI Director James Comey, the move that triggered the Russia probe.
Trump was joined for his Saturday rally in Ohio by former White House communications director Hope Hicks, who departed the administration earlier this year. Her unannounced presence raised some eyebrows as Hicks has been interviewed by Mueller and was part of the team of staffers that helped draft the original statement on the Trump Tower meeting.
|
Frangollo
Frangollo is a Canarian dessert dish, made from milk, millet or maize flour, lemon, eggs, sugar, butter, raisins, almonds, and cinnamon. Many variations exist, for example replacing the milk with water, or adding aniseed.
See also
Canarian cuisine
List of desserts
External links
Recipe
Alternative recipe
Category:Desserts
Category:Spanish cuisine
|
Gently apply around eye area until cream disappears. Use twice daily. A transient warming or tingling sensation may occur. If uncomfortable, reduce usage of the applicable product or products to every other day until skin adjusts.
Exuviance Age Reverse Eye Contour has a combination of super potent peptides, gentle Polyhydroxy Acids and caffeine to create a firmer, more lifted, contoured look for the eye and reduces puffiness and the appearance of crow’s feet. In a clinical study, participants noticed dramatic, visible results after 4 weeks of twice daily use*:
This site is published by NeoStrata Company, Inc. which is solely responsible for its contents. This website is intended for visitors from the United States. If you reside outside of the United States, you can click here for information about product availability in your country.
|
An important unresolved area of pediatric research involves the role of various viral agents in the etiology of acute gastroenteritis. Although the importance of rotaviruses is firmly established, the role of other viruses such as the astroviruses and caliciviruses has not been resolved. The goal of this project is to place these viruses in perspective with regard to their relative contribution to various forms of acute gastroenteritis in infants and young children. The availability of stool and serum specimens from several large-scale pediatric studies places us in the enviable position of being able to address these issues. Two major studies provide the focus of this project. One is a longitudinal study (1955-1969) at Junior Village, a welfare institution for homeless but otherwise normal children, and the other a cross-sectional study (1974-1991) of children hospitalized with gastroenteritis at Children's Hospital National Medical Center, Washington, DC. Our goal in the Junior Village studies has been to investigate the natural history of calicivirus and astrovirus infections in a longitudinal setting, whereas the Children's Hospital study provides materials that should allow us to determine the importance of calicivirus and astrovirus as agents of severe gastroenteritis requiring admission to the hospital. There is evidence from several studies including this one that the Norwalk viruses (now classified as caliciviruses) and astroviruses both cause infection in infants but, as yet, their importance as etiologic agents of severe gastroenteritis is not certain. This type of information must be obtained before priorities for vaccine development can be set.
|
/* Copyright 2010, University Corporation for Atmospheric Research. See
COPYRIGHT file for copying and redistribution conditions. */
/**
* @file @internal This file is part of netcdf-4, a netCDF-like
* interface for HDF5, or a HDF5 backend for netCDF, depending on your
* point of view.
*
* This file contains macros and prototyes relating to logging.
*
* @author Ed Hartnett
*/
#ifndef _NCLOGGING_
#define _NCLOGGING_
#include <stdlib.h>
#include <assert.h>
#ifdef LOGGING
/* To log something... */
void nc_log(int severity, const char *fmt, ...);
void nc_log_hdf5(void);
#define LOG(e) nc_log e
/* To log based on error code, and set retval. */
#define BAIL2(e) \
do { \
retval = e; \
LOG((0, "file %s, line %d.\n%s", __FILE__, __LINE__, nc_strerror(e))); \
nc_log_hdf5(); \
} while (0)
/* To set retval and jump to exit, without logging error message. */
#define BAIL_QUIET(e) \
do { \
retval = e; \
goto exit; \
} while (0)
#else /* LOGGING */
/* These definitions will be used unless LOGGING is defined. */
#define LOG(e)
#define BAIL2(e) \
do { \
retval = e; \
} while (0)
#define BAIL_QUIET BAIL
#ifdef USE_NETCDF_4
#ifndef ENABLE_SET_LOG_LEVEL
/* Define away any calls to nc_set_log_level(), if its not enabled. */
#define nc_set_log_level(e)
#endif /* ENABLE_SET_LOG_LEVEL */
#endif
#endif /* LOGGING */
/* To log an error message (if 'LOGGING' is defined), set retval, and jump to exit. */
#define BAIL(e) \
do { \
BAIL2(e); \
goto exit; \
} while (0)
#endif /* _NCLOGGING_ */
|
Q:
Positioning two div on the same height and position
I have two div, first has width 30% of parent div, second has 70%. Both have different height. Code below displays me screen like at left side.
<div id="parent">
<div id="div1">...</div>
<div id="div2">...</div>
</div>
I want to get screen like right side. Both divs are on the same level, and have equal height, which is equals height of longer div. What should I write in my CSS code?
CSS file:
#parent {
}
#div1 {
width: 30%;
}
#div2 {
width: 70%;
}
A:
Set the value of one (or both) of your div's to float: left. This causes any content to wrap around the object and the object sits on the left of the content.
#div1{
float: left
}
http://www.w3schools.com/cssref/pr_class_float.asp
|
The dilemmas of experiential teaching: toward an interpretive approach.
Continuing education in nursing uses the experience of the learner as a basis for the examination of practice issues. The unique and personal nature of this experimental learning is, however, particularly problematic where assessment of the learner or the course is required. This article offers part of the findings from an evaluative, ethnomethodological study into the reflections of learners attending an experiential course in communication in palliative care. In the part of the study described here, the critical perceptions of three learners following one experiential exercise are compared with the stated aims of the facilitators and their subsequent actions. The analysis uses the conceptual framework of Schön's reflection-in-action. It is suggested that an interpretive approach toward teaching in the experiential domain may lead to a more relevant assessment of learning.
|
Continuation of Dual Antiplatelet Therapy in a Patient with a Coronary Artery Stent with Dengue Hemorrhagic Fever: A Clinical Conundrum.
Severe thrombocytopenia with impairment of the activity of platelets and impairment of blood clotting occurs in dengue hemorrhagic fever (DHF). Continuation of dual antiplatelet therapy in such patients can result in life-threatening hemorrhages. On the other hand, withholding of antiplatelets in a patient undergone coronary stenting lately can lead to stent thrombosis, resulting in myocardial infarctions and sudden cardiac death. There are no guidelines on management of DHF in patients with coronary stents. Here, we discuss about several divergent factors that need to be considered and balanced when managing such patients. We describe a case as an example to illustrate how we balanced the risk of serious bleeding versus the risk of stent thrombosis successfully according to evolution of the disease process, by temporary withholding of antiplatelets in such a patient.
|
Danny @ Oldham is the boy for Villa – An open letter to Paul Lambert.
Dear Paul,
I know things have improved on the points front at Villa of late but I just had to drop you a line, and perhaps assist in some small way your efforts to continue the team’s resurgence, particularly in light of Sunday’s injuries.
Twice recently I have been to games at Oldham Athletic and had the good fortune to witness some excellent football from one of your players currently on loan there, Daniel Johnson. It would seem to any observer that the young man does not figure in your immediate plans, hence him being loaned out. Obviously your scouting system will be keeping tabs on Daniel while he gets some much needed match time and experience playing with and against seasoned pros in League One rather than in the nicey, nicey surrounds of the Under 21 League.
Only five minutes into his début against Crawley, Daniel gave notice of what the Latics fans could expect from him and what he could bring to Villa when you recall him or his loan spell ends. He scored a goal that immediately marked him out as one to watch. Picking the ball up about twenty yards short of the Crawley penalty area Daniel set off on the kind of mazy run that terrifies defenders and excites fans. Using both feet, at speed, he went past three defenders so effortlessly that they might as well have still been on the team coach. Then from a narrow angle he fired across the keeper into the far side of the net.
Yes, of course, it was League One opposition but it was the polished way Daniel set his mind on a dribble that would get him into a scoring position, that made everyone at the ground sit up and take notice. Not to mention that he saw as such well ahead of team mates and opponents alike.
For the rest of that game, and last Saturday’s FA Cup exit to Doncaster, what struck me, as much as the longest dreadlocks since Bob Marley, (not to mention three goals in three games), was the fact Daniel Johnson is not a “one-trick pony”.
He contributed to Oldham’s efforts in all aspects of the game and in all areas. Despite weighing just 67 kilos soaking wet he put in some hefty tackles, rode a few, and was the ever available link between Latics’ defence and attack.
He carried the game to the opposition, from his own penalty area, as well as being support for the front players. He was able to switch the focus of attack from flank to flank and from box to box. His passing was as one might expect from a player who belongs to a Premier League club and on top of all that is the added bonus of a real goal threat.
With the lack of Villa goals recently and the injuries sustained by Tom Cleverley and Ashley Westwood maybe Daniel Johnson could be the able assistant to Christian Benteke that might just see him recapture the confidence and goals that were such a delight last season.
And I haven’t even mentioned similarity to that Brazilian fellow, Ronaldinho.
Yours sincerely
Brian
Brian’s fact: Oldham Athletic`s ground is the second highest in the nation, only the Hawthorns is higher, 552 feet above sea level as opposed to the almost tropical 526 endured by home fans at what used to be Boundary Park but is now Sports Direct.Com Park
|
Hong Kong, Southeast Asian nations sign free-trade pact
Hong Kong signed a free-trade agreement and an investment deal Sunday with the Association of Southeast Asian Nations in pacts that it said are a vote against protectionism elsewhere.
ASEAN officials said the free-trade agreement they signed with Hong Kong in Manila is the sixth such deal forged by the 10-nation bloc after concluding similar pacts with China, Japan, South Korea, India, Australia and New Zealand.
Continue Reading Below
The Philippines is hosting an annual summit of ASEAN heads of state with Asian and Western leaders that opens Monday.
Hong Kong Commerce Secretary Edward Yau Tang-wah said the new free-trade accord is "a loud and clear vote from all of us here for freer and more open trade" amid protectionist tendencies in other parts of the world.
He said ASEAN is Hong Kong's second-largest merchandise trading partner and fourth-largest partner in services trade "but the best is yet to come," with the agreements expected to fuel new investment opportunities and boost trade flows.
Philippine Trade Secretary Ramon Lopez, this year's chairman of the ASEAN Economic Ministers, said the signing of the two agreements marks the commitment toward shared prosperity and inclusive growth in the region.
"We send a strong message to the world of our outward oriented drive and economic resolve toward cooperation," he said.
|
Dimitar Berbatov says fellow former Tottenham star Gareth Bale has become the "whipping boy" at Real Madrid and may well be better off leaving the Bernabéu.
"If you don't feel appreciated, you have to move on"
"Bale seems to get the blame for everything that goes wrong at Real Madrid, which is unfair," Berbatov said in a column for betting firm Betfair this week. "If you look at his stats - 12 goals in 30 appearances this season - he is still performing, but he is the whipping boy for some reason.
"And, as a player, if you don't feel appreciated, then you have to move on."
Spurs unlikely to be able to afford Bale, says Berbatov
Discussing the possibility of the 'Cardiff Express' returning to Spurs, who sold him to Madrid in a 101-million-euro deal in 2013, Berbatov was doubtful that the Premier League club have the financial muscle to make such a switch happen.
"It's a question of money first of course - I'm not sure Spurs can afford over £100m on a player," the Bulgarian said. "But Bale is a world-class talent who could play for anyone and it would be great to see him back."
|
Q:
How would i choose a random image from a directory? Python
My program's goal is to take a random png image and places it against another random image. So far i have it so it gets the image, pastes it onto another, and saves it and would like to get it to be random.
from PIL import Image
from PIL import ImageFilter
France = Image.open(r"C:\Users\Epicd\Desktop\Fortnite\France.png")
FranceRGB = France.convert('RGB')
Crimson_Scout = Image.open(r"C:\Users\Epicd\Desktop\Fortnite\Crimson_Scout.png")
FranceRGB.paste(Crimson_Scout, box=(1,1), mask=Crimson_Scout)
FranceRGB.save(r"C:\Users\Epicd\Desktop\Fortnite\Pain1.png")
A:
The easiest way to do this would be to list the files in a directory, and choose randomly from the given paths. Something like this:
import os
import random
random.choice(os.listdir("/path/to/dir"))
It would probably be smart to add in some logic to ensure you are filtering out directories, and only accepting files with specific extension (pbg, jpg, etc)
|
A 20-year-old man who was playing basketball in Bedford-Stuyvesant was shot three times in broad daylight Sunday as residents were outside barbecuing across the street, police sources said. The victim,...
|
LSO, Haitink, Pires: Mozart and Bruckner. Barbican 14 June 2011
A last minute soloist substitution is rarely a good omen. This evening's LSO concert looked like a sure-fire hit, with Murray Perahia's Schumann Concerto in the first half and Haitink’s Bruckner Four in the second. But Maria João Pires performing Mozart's 27th Concerto seemed like a potentially disappointing second best, and so it proved.
Perhaps the circumstances worked against this performance, or at least my enjoyment of it. As the four-square and indistinct opening phrases of the Mozart began, my mind was still filled with thoughts of those sublime modulations of the Schumann and the what Perahia might have made of all those delicious piano figurations.
Even so, the performance of the Mozart that followed was uninspired by any standards. Pires gave us all the notes, but without life or passion. The orchestra followed suit, and perhaps Haitink is to blame for keeping the woodwind soloists under too much control. Form and formality have their place in Mozart performance, but in this one that is all we got. The absolute precision of the playing is worthy of mention, Pires' passage work in particular, and the tight ensemble of the strings. Technically speaking, it was a perfect performance – but in the worst possible sense.
The second half was a different story. Haitink is well known for his Bruckner, and this performance of the Fourth Symphony was up there with his best work. There is a fine line in this music between individuality and affectation. In my opinion, that is a line Rattle crossed when he conducted the Ninth with the LSO earlier this year, but Haitink has an uncanny ability to stay right on the edge without ever taking anything to undue excess.
He is known for his slow tempos, but the outer movements here were surprisingly fast. Again, not so fast as to take the reading to extremes, but brisker than average. The inner movements showed more of his trademark breadth, and the whole of the Andante and the Trio of the Scherzo were both characterised by slower tempos, filled out with opulent orchestral textures.
But whatever speeds Haitink chooses, his subtle and fluid sense of rubato always keeps the music alive. The opening of the finale offers a brief glimpse into the inner workings of Haitink's Bruckner. The cellos and basses play detached crotchets for about 40 bars, making the subtle increase in tempo and volume explicit. But even here the effect is so gradual that you have to listen hard for it. Less subtle, but just as effective, are the points at which a thundering climax comes to an abrupt halt. Then Haitink holds the pregnant pause for just exactly the right duration, and then a wind or horn soloist, or sometimes pizzicato strings enter, their new tempo pre-formed in Haitink's mind and providing the ideal refreshment for the musical palette, genius!
The orchestral playing was again superb, but in this half inspired as well. The control of the brass sound in the climaxes was particularly impressive. More impressive, in fact, than the brass in the Chicago Symphony performance of the Seventh Symphony that Haitink conducted at the Festival Hall a few years ago. All the woodwind solos were vibrant and free, even when they were also articulaing one of Haitink's gradual tempo changes. The ensemble of the strings was again of the highest possible order, as was the beauty of the string tone. In short, the Bruckner received a perfect performance – in the best possible sense.
Gavin Dixon
The concert will be repeated on Thursday 16 June, when it will be broadcast live on BBC Radio 3.
No comments:
Post a Comment
.
Gavin Dixon is a writer, journalist, editor and blogger specialising in classical music. He writes reviews and articles for a number of publications and websites. Gavin has a PhD on the Symphonies of Alfred Schnittke and is currently a Visiting Research Fellow at Goldsmiths, University of London. He is also a member of the editorial team behind the ‘Alfred Schnittke Collected Works’ edition, which recently began publication in St Petersburg. More information on Gavin’s writing activities can be found at his website: www.gavindixon.info
|
The present invention relates to a production scheduling method of and a production scheduling apparatus for planning a production program of products.
The following will discuss a production scheduling method of prior art. It is now supposed that the number of different products is defined as A, the name of each product is defined as i and the number of processes to be executed for producing each product i is defined as N(i) (which varies with the type of each product i). According to a production scheduling method of prior art, there is prepared a production program in which after the jth process of each product i, i.e., each process P(i,j) (i=1, . . . , A, j=1, . . . . , N(i)-1) has been finished, each subsequent process P(i, j+1) of each product i is executed.
The production program prepared by the production scheduling method of prior art, is arranged to instruct to execute invariably each subsequent process P(i, j+1) after completion of each process P(i,j). Accordingly, even though a defect has been found on a product i as a result of the inspection conducted after completion of the process P(i,j), the subsequent process P(i, j+1) is executed on the product i. This disadvantageously lowers the production yield, thus increasing the production cost.
According to the production scheduling method of prior art, the production cost of each product, the delivery delay term of each product, each system standby term and the like are not taken into consideration. This disadvantageously produces an increase in production cost, a delay in delivery term and an increase in system standby term.
|
In vitro response of rat pleural mesothelial cells to talc samples in genotoxicity assays (sister chromatid exchanges and DNA repair).
The genotoxicity of three samples of talc has been determined using in vitro cell systems previously developed for testing asbestos fibres. The talc samples used consisted of particles of respirable size in order to test the effect of particles likely to be deposited in the lung. Genotoxicity was tested in cultures of rat pleural mesothelial cells (RPMC) using genotoxicity assays for unscheduled DNA synthesis (UDS) and sister chromatid exchanges (SCEs). The effects were compared with those obtained with negative controls (attapulgite and anatase) and positive controls (chrysotile and crocidolite asbestos). In contrast to asbestos, none of the talc samples, nor the negative controls, induced enhancement of UDS or SCEs in treated cultures in comparison with the untreated cultures.
|
U.S. Immigration and Customs Enforcement (ICE) is holding in detention more than 52,000 migrants across the country, according to an agency official. It’s reportedly the highest amount in the agency’s history.
As of Monday, ICE was holding 52,398 migrants — 998 of which are family units — in detention, BuzzFeed News reports.
“This is an avoidable humanitarian crisis manufactured by the Trump administration’s harsh policies, which are driven by the president’s extreme rhetoric and distorted assessments of the migrant population,” Kevin Landy, the head of ICE’s Office of Detention Policy and Planning during the Obama administration, told BuzzFeed.
ADVERTISEMENT
Two weeks ago, the total stood at more than 49,000 detained migrants, according to BuzzFeed. In March, The Daily Beast reported the total surpassed 50,000 for the first time ever.
Earlier this year, ICE asked for 52,000 detention beds, but in February, Congress limited the agency to an average daily population of 45,000 until the end of fiscal 2019.
The Refugee and Immigrant Center for Education and Legal Services, a Texas nonprofit that offers free and low-cost legal services to immigrants and refugees, was one of many to condemn the announcement on Twitter.
|
Somatostatin-like peptide and regeneration capacities in planarians.
The presence of a neuropeptide immunologically related to somatostatin (SRIF) has been investigated in the neurosecretory cells of two regenerating planarian species (Dugesia lugubris and Dendrocoelum lacteum). A correlation has been shown between the discharge of the SRIF-like-immunoreactive cells during the first hours after amputation and the capacity to regenerate, and between the persistence of numerous positive cells and the lack of regeneration. These results suggest that somatostatin might play a regulatory (inhibitory) role on the cellular proliferation which leads to the blastema edification.
|
Incomplete penetrance of CRX gene for autosomal dominant form of cone-rod dystrophy.
Purpose: Cone-rod dystrophy (CRD) is an inherited retinal dystrophy that is transmitted via different modes of inheritance. Mutations in more than 30 genes have been identified to cause the disease. We aimed to investigate the genetic agents of two unrelated cone-rod dystrophy affected Iranian families with autosomal recessive inheritance patterns. Methods: Whole-exome sequencing (WES) was performed for identification of the disease-causing mutations in the probands of both families. The candidate mutations were further confirmed by Sanger sequencing. Samples from five available members of each family were then sequenced for the mutations present in the probands. Comprehensive ocular examinations for all members of the families carrying the mutations were completed by ophthalmologists. Results: We identified a novel premature stop codon c.310C>T in CRX gene in heterozygote form in two symptomatic and two non-symptomatic members of one family (family-A), and a known CRX mutation c.122G>A in homozygote form in another (family B). c.122G>A has been reported to cause late-onset autosomal dominant form of the disease in previous studies. However, the middle-aged heterozygous carriers of the mutation in this family showed normal phenotype. Conclusion: The CRX gene has been previously linked to the autosomal dominant form of cone-rod dystrophy. We report incomplete penetrance of CRX gene for autosomal dominant form of the disease. Incomplete penetrance of the mutations may be partly caused by the influence of other genes in the complex genetic network underlying retinal regulation.
|
Public Notices
Your right to know
INCORPORATEDVILLAGE OFMASSAPEQUA PARKNASSAU COUNTY,NEW YORKNOTICE IS HEREBY GIVEN pursuant to the provision of the State of NewYork, that a Public Hearingwill be held by the ZoningBoard of Appeals in the Incorporated Village of Massapequa Park on Wednesday,December 7, 2016 at 8:00PM in the Village Hall, 151Front Street, MassapequaPark, New York 11762 forthe following purposes:Case No. 3986 To considerthe variance applicationof Mr. and Mrs. RichardMaione, 363 Pittsburg Avenue, Massapequa Park, NY11762 to maintain in thefront yard six (6) ft. to four(4) ft. solid fencing and tomaintain an existing rearyard shed ALL in violationof Village Code.Such proposals are in violation of Village Codes; Chapter 345-40(A) Fences andSimilar Obstructions whichstates: Only allowed a four(4) ft. open picket in frontyard and allowed a six (6) ft.solid fence only in line withor behind front foundation.Existing six (6) ft. to four(4) ft. solid fencing starts atfront foundation line andruns along west propertyline dropping down to four(4) ft. which ends approximately three (3) ft. fromsidewalk. Chapter 345-43Sheds which states: Side andrear yard setbacks must begreater or equal to two (2)ft. Existing shed located inthe NW corner of rear yardis approximately four (4)inches from west propertyline and less than two (2) ft.to north property line.Case No. 3987 To considerthe variance application ofMr. and Mrs. Joseph Campisi, 64 Violet Street, Massapequa Park, NY 11762 tomaintain the following; frontwood deck and portico, rearsunroom, bath addition andshed in violation of VillageCode.Such proposal is in violationof Village Code Chapter345-28(C) Lot and Building Area which states: In aresidential district the maximum lot coverage permittedshall be 30%. Existing lotcoverage is 35.8% Chapter345-43(D) Sheds whichstates: Any shed as definedby this section shall have avertical height of not morethan nine (9) ft. Existingsheds height is 10’ -3” to topof ridge.Case No. 3988 To consider
the variance application ofMrs. Christina Monahan, 47Strully Drive, MassapequaPark, NY 11762 to maintaina four (4) ft. solid fence atopa retaining wall in violationof Village Code.Such proposal violates Village Code Chapters 345-40(A), 345-40(F) whichstates:345-40(A)Erection restricted. Noperson shall erect in anyresidential district of anyVillage a solid fence, such asbut not limited to a basketweave type fence, a solidboard fence or any syntheticor metal solid fence that isgreater than six (6) ft. inheight or is before the fronthouse setback; nor shallthere be erected in suchzone any fence more than 48inches in height, exceptingin the rear of the front lineof the house, in which casethe same shall be not morethan six (6) ft.345-40(F)The height of a fence shallbe measured from the natural grade of the property atall points along the fencerun. The height of the fenceshall be the highest point ofthe fence measured at thenatural grade. Man-madeberms, retaining walls andother structures shall notbe considered part of thenatural grade.Existing four (4) ft. fence sitsatop a 19-inch-tall retaining wall approximately 63inches above natural gradewhich is setback 47 inchesfrom the inner sidewalk lineand runs along equidistantfrom east property line.Case No. 3989 To considerthe variance application ofMr. and Mrs. Andrew Harrington, 211 Pacific Street,Massapequa Park, NY 11762to install a basement egresswindow well in the frontyard in violation of VillageCode.Such proposal violates Village Code Chapter 345-30(D) Permitted Structuresin Front Yards which states:The following items arepermissible encroachments;a portico, porch and a temporary storage container.Proposed egress windowwell would project 3.7 ft.from front foundation andextend across foundation5.8 ft.Case No. 3990 To considerthe variance application ofMr. and Mrs. Kevin Cirrito,21 Lincoln Avenue, Massapequa Park, NY 11762to maintain a four (4) ft.solid fence before the frontfoundation in violation of
Village CodeSuch proposal violates Village Code Chapter 345-40(A) Fences and SimilarObstructions which states:Erection restricted. Noperson shall erect in anyresidential district of theVillage a solid fence, such asbut not limited to a basketweave type fence, a solidboard fence or any syntheticor metal solid fence that isgreater than six (6) ft. inheight or is before the fronthouse setback; nor shallthere be erected in suchzone any fence more than 48inches in height, exceptingin the rear of the front lineof the house, in which casethe same shall be not morethan six (6) ft.Existing four (4) ft. solidfence starts at the front foundation line and extends tothe front property line withlast section of fences scalloped
down to a three (3) ft.tall section.By order of the ZoningBoard of AppealsNovember 18, 20161x 11/23/16 #762-POST
on July 14, 2016. I, the undersigned Referee will sell atpublic auction, in the Calendar Control Part (CCP)Courtroom of the SupremeCourt, 100 Supreme CourtDrive, Mineola, New York11501 on the 6th Day of December, 2016 at 11:30 a.m.All that certain plot, piece orparcel of land, situate, lyingand being at Massapequa,Town of Oyster Bay, Countyof Nassau and State of NewYork.Premises known as 58 NewHampshire Ave.,Massapequa, (Town ofOyster Bay) NY 11758.(Section: 52., Block: 138,Lot: 42, 43 & 44)Approximate amount of lien$409,363.77 plus interestand costs.Premises will be sold subjectto provisions of filed judgment and terms of sale.Index No. 14-003660. JanineLynam, Esq., Referee.Davidson Fink LLPAttorney(s) for Plaintiff28 East Main Street, Suite1700Rochester, NY 14614-1990Tel. 585/760-8218Dated: October 3, 20164x 11/23/16 #741-POST
Pursuant to judgment offoreclosure and sale grantedherein on or about September 22, 2016, I will sell atPublic Auction to the highest bidder at the CalendarControl Part (CCP) Courtroom of the Supreme Court,100 Supreme Court Drive,Mineola, NY 11501.On December 20, 2016at 11:30 am.Premises known as 127Forest Avenue, Massapequa,NY 11758Section: 65 Block: 135Lot: 302-305ALL that certain plot, pieceor parcel of land, with thebuildings and improvementsthereon erected, situate,lying and being at Massapequa, Town of OysterBay, County of Nassau andState of New York knownand designated as and byLots Nos. 302 to 305 bothinclusive in Block G on acertain map entitled, “Mapof Shoreville Park, AdditionNo. 1 Amending Block No19 and 20 of Shoreville Park,Property of Ogontz RealtyCo., situate in Massapequa,Long Island, New York, surveyed June 1933 by Baldwin& Cornelius Co., Inc., CivilEngineers and Surveyors,Freeport, Long Island, andfiled in the Nassau CountyClerk`s Office on June 28,1933 as Old Map No. 810,New Map No 882.As more particularly described in the judgment offoreclosure and sale.Sold subject to all of theterms and conditions contained in said judgment andterms of sale.Approximate amount ofjudgment $631,647.63 plusinterest and costs.INDEX NO. 6859/09Christine M. Grillo,Esq., Referee4X 12/7/16 #752-POST
Notice is hereby given that alicense, number 1298426 forbeer, wine and liquor has
been applied for by the undersigned to sell beer, wineand liquor at retail under the Alcoholic BeverageControl Law at One Jericho Turnpike, Jericho, NY11753, County of Nassau, foron premises consumptionat Americana RestaurantCorp, One Jericho Turnpike,Jericho, NY 11753.2x 11/23/16 #756-POST
SUPREME COURT -COUNTY OF NASSAUU.S. BANK NATIONAL ASSOCIATION, AS TRUSTEEFOR LEHMAN BROTHERS SMALL BALANCECOMMERCIAL MORTGAGE PASS-THROUGHCERTIFICATES, SERIES2007-1, Plaintiff -against-5460 MERRICK ROAD,LLC, et al Defendant(s).Pursuant to a Judgment ofForeclosure and Sale datedSeptember 6, 2016 and entered herein, Francis Moroney, Esq., the undersignedReferee will sell at publicauction at (CCP) CalendarControl Part Court Room ofthe Nassau Supreme Court,100 Supreme Court Dr.,Mineola, NY on December20, 2016 at 11:30 a.m. premises situate, lying and beingat Massapequa, Town ofOyster Bay, County of Nassau and State of New York,which said lots are boundedand described as follows:BEGINNING at a point inthe southerly side of Merrick Road, distant 260.00feet westerly from the cornerformed by the intersectionof the southerly side of Merrick Road with the westerlyside of East Shore Drive;being a plot 100.00 feet by60.00 feet by 100.00 feet by60.00 feet.Said premises known as5460 MERRICK ROAD,MASSAPEQUA, NYApproximate amount of lien$745,575.80 plus interest &costs.Premises will be sold subjectto provisions of filed Judgment and Terms of Sale.Index Number000327/2013.FRANCIS K. MORONEY,ESQ., RefereeDorf & Nelson LLPAttorney(s) for Plaintiff555 Theodore Fremd Avenue, Rye, NY 10580{* Massapequa Post*}4x 12/7/16 #757-POST
Notice is hereby giventhat the fiscal affairs of thePlainedge Union Free School
District for the period beginning on July 1, 2015 andending on June 30, 2016,have been examined by anindependent public accountand have been filed in myoffice where it is available asa public record for inspection by all interested persons. Pursuant to Section35 of the General MunicipalLaw, the governing board ofthe Plainedge Union FreeSchool District may, in itsdiscretion prepare a writtenresponse to the report of external audit or managementletter by independent publicaccount and file any suchresponse in my office as apublic record for inspectionby all interested persons.Dated: November 14, 2016
Notice is hereby given that alicense, number 1298438 forbeer and wine has been applied for by the undersignedto sell beer and wine at retailunder the Alcoholic Beverage Control Law at 414 Jerusalem Ave, Hicksville, NY11801, County of Nassau, foron premises consumptionat Monaco’s Hicksville Inc,414 Jerusalem Ave, Hicksville, NY 11801.2x 11/30/16 #760-POST
SUPPLEMENTALSUMMONSSTATE OF NEW YORKSUPREME COURT,COUNTY OF NASSAUINDEX NUMBER:14-012258DATE FILED:December 31, 2016CHRISTIANA TRUST, ADIVISION OF WILMINGTON SAVINGS FUND SOCIETY FSB, AS TRUSTEE,as Trustee of Knoxville 2012Trust, by 21st MORTGAGECORPORATION, as Servicing Agent of the Knoxville2012 Trust,-againstMICHAEL PODLOFSKY;“ THE STANLEY PODLOFSKY ESTATE DEFENDANTS” (said last namebeing fictitious, it being theintention of the plaintiffto designate thereby anyand all persons or entitiesnot specifically named andjoined as a party defendantherein who are the heirs atlaw, next of kin, distributees,executors, administrators,trustees, legatees, assignors,lienors, creditors and successors in interest of StanleyPodlofsky, deceased, andgenerally all persons having or claiming under, byor through the said StanleyPodlofsky, deceased, or under by or through any distributee or heir at law of thesaid Stanley Podlofsky, deceased, by purchase, inheritance, lien or otherwise, anyright, title or interest in andto the property described inthe Complaint herein, andthe respective husbands orwidowers, wives and widowsof said person(s), if any, all ofwhose names are unknownto plaintiff); THE PEOPLEOF THE STATE OF NEWYORK - OFFICE OF THEMEDICAID INSPECTORGENERAL/HEALTHMANAGEMENT SYSTEMS,INC.; NASSAU COUNTY DEPARTMENT OFSOCIAL SERVICES; THEPEOPLE OF THE STATEOF NEW YORK - DEPARTMENT OF TAXATIONAND FINANCE; UNITEDSTATES OF AMERICAobo DEPARTMENT OFTREASURY - INTERNALREVENUE SERVICE;and “JOHN/JANE DOE4” through “JOHN/JANEDOE 10” (said last six namesbeing fictitious, it beingthe intention of plaintiff todesignate any and all othertenants, occupants or otherpersons or entities having or
claiming an interest in thereal property which is thesubject of this action, whoseidentity is not presentlyknown to plaintiff),Defendants. _____TO THE ABOVE-NAMEDDEFENDANTS: YOU AREHEREBY SUMMONED toanswer the amended complaint in the above actionand to serve a copy of youranswer on the plaintiff ’sattorneys within twenty(20) days after the serviceof this summons, exclusive of the day of service,or within thirty (30) daysafter completion of servicewhere service is made inany other manner than bypersonal delivery withinthe State of New York. TheUnited States of America,if designated as a defendantin this action, may answeror appear within sixty (60)days of service hereof. Incase of your failure to appearor answer, judgment will betaken against you by defaultfor the relief demanded inthe amended complaint.Nassau is designated as theplace of trial. The basis ofvenue is the location of themortgaged premises in thisaction at 80 Sycamore Street,Town of Oyster Bay, in theCounty of Nassau, State ofNew York.NOTICEYOU ARE IN DANGER OFLOSING YOUR HOME Ifyou do not respond to thissummons and complaint byserving a copy of the answeron the attorney for the mortgage company who filedthis foreclosure proceedingagainst you and filing theanswer with the court, adefault judgment may beentered and you can loseyour home.Speak to an attorney or goto the court where your caseis pending for further information on how to answerthe summons and protectyour property.Sending a payment to yourmortgage company will notstop this foreclosure action.YOU MUST RESPONDBY SERVING A COPY OFTHE ANSWER ON THEATTORNEY FOR THEPLAINTIFF (MORTGAGECOMPANY) AND FILINGTHE ANSWER WITH THECOURT.ORDER AUTHORIZINGSERVICE: The foregoingSupplemental Summons isserved upon you pursuantto an order of the Supreme
Court of the State of NewYork, County of Nassau(Hon. Thomas A. Adams),dated the 21st day ofOctober, 2016.NATURE OF ACTIONAND RELIEF SOUGHT:The object of this actionis to foreclose a mortgagelien upon and against thepremises in Nassau County,New York located at, andcommonly known as 80Sycamore Street, Town ofOyster Bay, New York (TaxMap No. 57-193-92 & 93)and the fixtures, improvements, appurtenances andpersonalty thereon andthereto (the “MortgagedPremises”), more particularly described in that certain mortgage executed byStanley Podlofsky to Green-Point Mortgage Funding,Inc. to secure the paymentof the sum of $372,000.00,which mortgage is datedAugust 31, 2006 and recorded in the Nassau CountyClerk’s Office on November13, 2006 in Liber M31199of Mortgages at Page 516(the “Mortgage”). The reliefsought in this action is a Final Judgment of Foreclosureand Sale, directing the saleof the Mortgaged Premisesto satisfy the debt securedby the Mortgage.HELP FOR HOMEOWNERS IN FORECLOSURENEW YORK STATE LAWREQUIRES THAT WESEND YOU THIS NOTICEABOUT THE FORECLOSURE PROCESS. PLEASEREAD IT CAREFULLY.SUMMONS AND COMPLAINT YOU ARE IN DANGER OFLOSING YOUR HOME. IFYOU FAIL TO RESPONDTO THE SUMMONS ANDCOMPLAINT IN THISFORECLOSURE ACTION,YOU MAY LOSE YOURHOME. PLEASE READTHE SUMMONS ANDCOMPLAINT CAREFULLY. YOU SHOULD IMMEDIATELY CONTACTAN ATTORNEY OR YOURLOCAL LEGAL AID OFFICE TO OBTAIN ADVICEON HOW TO PROTECTYOURSELF.SOURCES OF INFORMATION AND ASSISTANCE.The state encourages youto become informed aboutyour options in foreclosure.In addition to seeking assistance from an attorneyor legal aid office, there aregovernment agencies andnon-profit organizations
that you may contact forinformation about possibleoptions, including trying towork with your lender during this process.To locate an entity near you,you may call the toll-free helpline maintained by the NewYork State Banking Department at 1-877-BANK-NYS(1-877- 226-5697) or visitthe department’s website atWWW.BANKING.STATE.NY.US. FORECLOSURERESCUE SCAMS. Be carefulof people who approach youwith offers to “save” yourhome. There are individuals who watch for notices offoreclosure actions in orderto unfairly profit from ahomeowner’s distress. Youshould be extremely carefulabout any such promisesand any suggestions thatyou pay them a fee or signover your deed. State lawrequires anyone offeringsuch services for profit toenter into a contract whichfully describes the servicesthey will perform and feesthey will charge, and whichprohibits them from takingany money from you untilthey have completed all suchpromised services.DATED: October 11, 2016CARTER, CONBOY, CASE,BLACKMORE, MALONEY& LAIRD, P.C.MICHAEL J. CATALFIMO,ESQ.Attorneys For Plaintiff20 Corporate WoodsBoulevardAlbany, New York12211-2362(518) 465-3484THIS IS AN ATTEMPTTO COLLECT A DEBT.ANY INFORMATION OBTAINED WILL BE USEDFOR THAT PURPOSE4x 11/23/16 #735-POST
PUBLIC HEARINGCALENDARNOTICE OF PUBLIC MEETING BY THE ZONINGBOARD OF APPEALSPursuant to the provisionsof Chapter 246, ArticleIII, Section 246-18-E of theCode of the Town of OysterBay, notice is hereby giventhat the Zoning Board ofAppeals has scheduled apublic meeting, which willtake place in the Town HallMeeting Room, Audrey Avenue, Oyster Bay, New York,on DECEMBER 1, 2016, at7:00 P. M., to consider thefollowing appeals:BY ORDER OF THE ZONING BOARD OF APPEALS
|
Article content
An international observer mission has set down in Ottawa to monitor and report on the federal election — including whether controversial changes to Canada’s election law help or hurt the democratic process.
The six-person mission, deployed by the Organization for Security and Co-operation in Europe (OSCE), is the first to monitor a Canadian election in nearly a decade. It was prompted by widespread concern inside Canada over recent changes introduced by the Conservative government’s controversial Fair Elections Act.
We apologize, but this video has failed to load.
tap here to see other videos from our team. Try refreshing your browser, or Observers arrive to monitor federal vote under changes to election law Back to video
“The legislative framework is a key part of any election process. It’s the rules of the game,” said mission leader Hannah Roberts, a British national who has monitored elections in 30 countries.
“As we know, there have been some changes here in Canada, and there are different views about those changes. So our job is in part to come and look at that legal framework and be looking at how it works in practice, to see what issues come up.”
|
In the present day as electronic devices and other devices are increasingly scaled to smaller dimensions, techniques for patterning substrates becomes increasingly challenging. For both planar devices such as planar transistor devices, as well as three dimensional devices, such a three dimensional memory devices, deep trenches or other deep structures may be used in the fabrication process. In order to from a deep trench or deep via or similar structure in a substrate, a patterned mask material may be used in portions of the substrate to be protected while etching of the substrate takes place where mask material is absent. The mask material may subsequently be removed once the substrate is etched to a target depth.
Devices such as vertical NAND (VNAND) memory devices (“NAND” refers to a negative- and logic gate) and dynamic random access memory (DRAM) devices may employ trenches or vias having etch depths of more than one micrometer, for example. Because etching of the substrate may also entail etching of the mask material, in order to preserve at least a portion of the mask for the complete etch process, the mask thickness may be similar to the etch depth in some cases. This situation is especially the case for common mask materials based at least in part on carbon. For example, so called hard mask materials having a similar etch rate to the substrate may be employed for etching a trench having a depth on the order of one micrometer. Additionally, the hard mask pattern features may have a high aspect ratio, meaning the height of the mask feature may be greater than the width of the mask feature, at least along one width direction. In some cases, an aspect ratio (height/width) of the mask feature may approach 10:1 or may be greater. A consequence of etch processing using such relatively thick masks may include faceting and clogging of the mask features during etching, bowing of an underlying etch feature in the substrate, or tapering of the etch feature in the substrate. The final patterned trench, via or other structure in the substrate may deviate from a target shape, such as a vertical trench.
Forming a patterned hard mask using a material having a relatively lower etch rate may in principle reduce the total thickness of the hard mask used in an etch process. A drawback is that patterning techniques to form a hard mask are impractical using effective hard mask materials such as Al2O3, having a very low etch rate for etches used to etch silicon for example.
With respect to these and other considerations the present embodiments are provided.
|
Computing and networking techniques and technologies are gradually penetrating into every aspect of health care and medical practice. Many believe that important benefits can be achieved with the marriage of these two areas, including the delivery of high-quality health care at lower cost. Electronic health (e-Health) has become a very important area of focus and activity in multiple domains, such as health promotion, health care and maintenance, public health, medical science, health service, data management, image processing, telecommunication, wireless network, and operational research. The purpose of the special issue is to provide a high quality exposure to advances and experiences in e-Health related topics and to stir interest in advancing e-Health to the next level.
The call for papers for this special issue attracted numerous exciting responses from the research community. Submissions covered diverse areas of interests. Unfortunately, space limitations allowed only nine papers to be selected for inclusion in this special issue, after extensive peer review. In the following paragraphs, we briefly introduce the nine accepted papers.
Health information technology plays an important role in supporting decision making, health care delivery, and management of health services. Many sociotechnical factors affect physicians\' adoption and implementation of health information systems. Having conducted semistructured interviews with 26 physicians from nine medical clinics in Alberta, Canada, D. A. Ludwick and John Doucette present a discussion of the barriers to implementing health information systems in a fee-for-service environment in their paper entitled "Primary care physicians\' experience with Electronic Medical Records."
A potential obstacle impairing the adoption of health information systems might be simply that developed systems do not meet user needs. A. Shaban-Nejad et al. examined system requirement management in their paper "Managing Requirement Volatility in an Ontology-Driven Clinical Laboratory Information Management System (LIMS) Using Category Theory."
Security and privacy are important requirements for health information systems. For example, patients\' privacy is protected by law in many countries. In Anastasios Fragopoulos et al. paper entitled "Context Aware Security for Pervasive Healthcare Architectures Utilizing MPEG-21 IPMP Components," MPEG-21 intellectual property management and protection components are used to achieve protection of transmitted medical information and enhance patient privacy.
Abdulmutalib Masaud-Wahaishi and Hamada Ghenniwa present an information brokering architecture that supports privacy-based information gathering in healthcare in their paper entitled "Agent-Oriented Privacy-Based Information Brokering Architecture for Healthcare Environments." In their proposed architecture, a brokering service is modeled as an agent with a specific architecture and interaction protocol appropriate to serve various requests.
Agent technology is gaining momentum in modeling and developing complex software systems. The next paper discusses major features and benefits of an agent-based approach to enhance a hospital laboratory legacy information system. This paper entitled "Enhancing E-Health Information Systems with Agent Technology" is contributed by Minh Tuan Nguyen et al.
The next two papers heavily focus on roles of communications and networking aspects in e-Health systems. In their paper entitled "An adaptive Source-Channel Coding with Feedback for Progressive Transmission of Medical Images," Jen-Lung Lo et al. studied source-channel coding problem with the consideration of characteristics of medical images.
IEEE 802.15.4 standard specifies the physical layer and the media access control layer for wireless personal area networks with low data rate and low power consumption. It forms the basis for many body sensor networks. IEEE 802.11 standards are the most widely adopted wireless local area network (LAN) standards. Jelena Misic and Xuemin (Sherman) Shen modeled an interconnected network consisting of IEEE 802.15.4 body sensor networks and IEEE 802.11 wireless LANs. Their paper is entitled "Delay Analysis of GTS Bridging between IEEE 802.15.4 and IEEE 802.11 Networks for Healthcare Applications."
The last two papers provide us with the examples of e-Health systems at work. C. Quantin et al. show that it is possible to set up a continuous and exhaustive recording system for linked perinatal data to assess the quality of care on a regional scale in their paper entitled "Using discharge abstracts to evaluate a regional perinatal network: assessment of the linkage procedure of anonymous data---using discharge abstracts to evaluate a regional perinatal network."
Jean-François Lesesve and Richard Garand demonstrate one of the first approaches to the use of telehematology for the quality control of diagnosis using the GOELAMS Chronic Lymphocytic Leukaemia 98 trial. Their paper "Evaluation of a Telemedicine System for the Transmission of Morpho/Immunological Data Aiming at the Inclusion of Patients in a Therapeutic Trial" details their experience and the benefits arising from the use of telehematology in clinical practice.
In summary, this special issue includes papers that span diverse areas of interests including system development, security and privacy, actual effect of e-Health in practice, as well as technological foundations. It was our honor to receive submissions from many authors. Without our unselfish reviewers, who provided us with extensive and constructive reviews, it would not be possible to run a special issue of such broad scope. Last, but not least, the publishing staff have worked diligently with us on this special issue. We are, therefore, indebted to all the authors, the reviewers, and publishing staff. We would like to express our sincere gratitude to them all.
*Hui Chen* *Hui Chen* *Arnauld Nicogossian* *Arnauld Nicogossian* *Silas Olsson* *Silas Olsson* *Azhar Rafiq* *Azhar Rafiq* *Max E. Stachura* *Max E. Stachura* *Mamoru Watanabe* *Mamoru Watanabe* *Pamela Whitten* *Pamela Whitten* *Yang Xiao* *Yang Xiao*
|
Assessment of HIV-1 screening test sensitivities using serially diluted positive sera can give misleading results.
Three FDA licensed HIV-1 viral lysate and two nonlicensed recombinant antigen assays were used to evaluate six serially diluted plasma samples and 2 highly characterized seroconversion series. The sensitivity as measured by serial dilution did not necessarily correlate with the sensitivity as measured by seroconversion performance with the lysate and the recombinant assays. It is concluded that national licensing agencies should arrange to share seroconversion panels to evaluate accurately the sensitivity of new HIV-1 screening tests.
|
Q:
TRS/TS vs RCA cable?
I have to purchase an instrument, that its output (mono) can be either 1/4 TS or RCA.
The device signal goes to a preamp (If I'll go for the RCA version, the cable will be RCA to TS).
My question is:
Signal Quality: Are there any signal quality differences between these two types?
Durability and maintenance: Does any of them tend to be more durable than the other one?
TS:
RCA:
A:
1/4" TS/TRS is a far superior interconnect than RCA/phono in every way, except size.
If you have to choose an output for an instrument, it should be 1/4" if at all possible.
1/4" TS cables are more robust, much more easily repairable, and are used throughout the professional audio industry.
RCA cables were invented (by RCA) for use in consumer electronics, because they look less intimidating (I guess). Most mixers have a pair of in/outs to use with a tape deck for recording, but everything else is going to be 1/4" (or XLR).
A:
Signal Quality - there shouldn't be any difference in signal quality between a good RCA cable and a good 1/4" cable, as long as the connector and jack are making good electrical contact.
The problem lies in making good electrical contact. As NReilingh states, RCA plugs were designed for consumer electronics and probably also minimal cost. Our modern 1/4" cables are an evolution of the old phone exchange patchboard plugs. These plugs were designed to make good contact over many repeated plug/unplug cycles. The shield on RCA plugs tends to flare out after repeated use, eventually resulting in very poor connections.
|
Three questions for the U.S. about Jerusalem
There are three issues relating to the U.S. stance toward Jerusalem to which Robert Pines' article usefully draws attention ("U.S. must recognizeIsrael'scapital," Aug. 15).
The first is whether the U.S. government considers Jerusalem to be part of Israel. The second is whether the U.S. regards Jerusalem as Israel's capital. The third is whether the U.S. government wishes to locate its embassy in Jerusalem.
It would be consistent with congressional and public sentiment, and with the comments of previous U.S. presidents, for President Barack Obama to publicly and explicitly declare that Jerusalem is part of Israel and that he was instructing the State Department and other government agencies to make their policies reflect that reality.
It would also be helpful if President Obama were to declare — as did both he and President Bill Clinton as candidates — that Jerusalem is the capital of Israel. If the U.S. government is unwilling to make these two unequivocal statements, there is little reason to expect other friendly governments will.
The question of relocating the U.S. embassy to Jerusalem is a separate matter. But while it might be desirable as well, the government's reluctance to move its embassy should not excuse it from doing the first two things.
|
The evolution of StarCraft: an in-depth history
Ever wonder what StarCraft would have been like if the Zerg were invincible? …
Do you remember the good old days when a proper zerg rush was what separated the men from the boys? Still living those days? StarCraft Legacy has an in-depth account on StarCraft's rich history. And really, what better topic could there be for my inaugural post as the new OT writer than to spotlight the development history of one of the most popular and long-standing RTS games of all time?
With the recent release of the Burning Crusade expansion, World of Warcraft has taken the spotlight as Blizzard's prime creation. However, the now-archaic StarCraft still remains one of the company's most notable productions. In an age of PC gaming when the RTS was king, "Warcraft in Space" became one of the most dominant forces in gaming culture.
StarCraft Legacy's feature, which covers the history of StarCraft from its early alpha stages all the way through its final expansion, Brood War, is a virtual treasure trove of history and art work. Each section documents the development process and public showing of the game while providing screenshots that illustrate how the game evolved over time. Despite being the success that it is, StarCraft's beginnings were far more humble than many would have believed: the article recounts a time when a budding developer named Blizzard stumbled over the development process of their would-be legendary project. Given the now titanic status of the successful MMO developer, it's interesting to relive a time when Blizzard was still an up-and-comer to the scene.
Morever, the article mentions some interesting alterations that were made during the fine-tuning of the game: stuff that even the hardest of hardcore StarCraft fiends might not be aware of. These include all kinds of tasty tidbits, such as a certain long-lost skill from Brood War that unbalanced the game:
... Valkyrie had a spell called "Afterburner" which would substantially increase its speed. This was later removed due to cheese tactics where players would use it to fly into a Zerg base, kill all the Overlords, and fly out again.
Though the article was written way back in 2004, the sheer amount of history held within it is sure to impress even the most diehard of fans. In fact, even non-fans may be interested in checking this out; if nothing else, it will provide you an insight into the history of one of the cornerstones of PC gaming. And hey, who knows, maybe if enough people take interest in the mythical gaming gem of yore, we might actually find out if there's any future in the StarCraft name. StarCraft 2? World of StarCraft? Gives us something, Blizzard! Anything!
|
Blogging the Human Genome
The nasty fight between scientists that resulted in the sequencing of the human genome.
James Watson and Francis Crick made DNA famous in 1953 with their elegant double helix model. However beloved, though, the double helix revealed nothing about how DNA actually makes proteins—which is kind of the whole point of DNA. To understand protein production, scientists actually had to shift focus to RNA, DNA’s chemical cousin. Soon after illuminating the structure of DNA, in fact, Watson and Crick joined a fledgling scientific group called the RNA Tie Club.
Physicist George Gamow founded the club in 1954. Although a physicist moonlighting in biology might sound odd—Gamow studied radioactivity and Big Bang theory by day—other carpetbagging physicists like Richard Feynman joined as well. RNA not only offered an intellectual challenge, but many physicists were appalled by their field’s role in creating nuclear bombs. Physics seemed life-destroying, biology life-restoring. Overall, 24 scientists joined the Tie Club—one for each amino acid, plus four honorary members, for each DNA base. Club members sported green wool ties with an RNA strand embroidered in gold silk, which cost $4 from a haberdasher in Los Angeles. Club stationery read, “Do or die, or don’t try.”
By the early 1960s Tie Club members and other scientists had puzzled out how DNA and RNA could make proteins, and had confirmed that the same basic DNA-to-RNA-to-protein process ran every living thing on earth: guinea pigs, E. coli, frogs, tulips, slime molds, U.S. Congressmen, whatever. But again, knowing how the process worked in general told biologists only so much: They’d discovered how to build proteins in general, but not what kinds of proteins a life form actually did build. For that, they had to start sequencing genes—that is, determining the order of a creature’s As, Cs, Gs, and Ts.
Advertisement
Early sequencing attempts attracted only the bravest scientists, for they had to endure truly staggering amounts of boredom. In the 1970s, British biologist Frederick Sanger, already a Nobel laureate, finally developed a usable, three-step method to sequence DNA. I won’t go into the gritty details (you can get your fingernails dirty here), but Sanger had to tally the sequence by hand, one letter at a time. His first full genome, the 5,400 bases and 11 genes of the virus φ-X174, so impressed his colleagues that Sanger won a second Nobel in 1980. Not bad for someone who once confessed he could never have attended Cambridge University “if my parents had not been fairly rich.”
Though it wowed them, Sanger’s work also deflated some colleagues. He’d taken years to sequence the few thousand bases of a virus, which isn’t even technically alive. Even the lowliest bacteria have millions of bases, making the labor thousands of times harder. In the mid-1980s, two biologists in California automated Sanger’s method with lasers and computers, which made large-scale sequencing more plausible. But it was still a heck of a leap to the 3 billion letters in the human genome.
Everything changed in the early 1990s, when a neuroscientist at the National Institutes of Health got fed up with chromosome 19. He was looking for a few brain genes on it, and after two years of ungodly tedium picking through a 100,000-letter stretch, he threw up his hands. There has got to be, decided that neuroscientist, Craig Venter, a better way.
There was. Venter had heard about a method to quickly identify some of the RNA that cells use to make proteins. While cruising above the Pacific Ocean at 38,000 feet one night, returning from Japan, Venter sat up in his chair with an even better idea. Again, to make proteins, cells first transcribe DNA into RNA. So by capturing and reading that RNA, Venter realized he could then reverse-transcribe it and determine what the original DNA sequence must have been. This method had some technical limitations, but at least Venter could find most genes quickly. By automating the technique, he cut down the price for detecting each gene from around $50,000 to $20, and within a few years he’d claimed discovery of a whopping 2,700 human genes.
Venter’s method caused immediate controversy. (He had a talent for that.) The U.S. government’s Human Genome Project—an effort to sequence all human DNA—had recently rumbled to life, and the HGP didn’t appreciate being scooped by an upstart. One observer basically called Venter a rotten cheat, comparing his gene-detecting shortcut to Sir Edmund Hillary taking a helicopter up Mount Everest.* While testifying in a U.S. Senate hearing on the HGP, James Watson, the project’s first leader, dismissed Venter’s operation—with Venter sitting right there—as something that “could be run by monkeys.” Rhetoric aside, scientists harped on Venter because they thought his shortcuts would produce a sloppy, incomplete outline of the human genome—a charge that continued to dog Venter in later years.
Venter left his government job for the private sector not long afterward, then flung a gauntlet at the HGP by proposing to sequence the entire human genome himself, way faster and way cheaper. (When announcing his plans, Venter reportedly told HGP leaders that they still could find important work to do. Like sequencing mice genes.) The ensuing genome war, and the whole multidecade, multibillion-dollar HGP saga, occupies a chapter in my new book, and I came to believe that it’s as much a morality tale as a scientific one. If you ask a biologist about the HGP, in fact, you can get a pretty good handle on her values. Does she admire the HGP government scientists as selfless and steadfast, or dismiss them as stumbling bureaucrats? Does she praise Venter’s challenge as heroic rebellion, or condemn it as self-aggrandizement? Does she think the project succeeded or harp on its disappointments? Like any epic story, the sequencing of the human genome can support multiple readings.
Regardless of what you think, Venter’s challenge—and the HGP’s rousing response—led to a veritable avalanche of DNA data, data that has uncovered whole hosts of lost stories about human history. Blitzkrieg sequencing made modern genetics, and we have the tedium of tiny chromosome 19 to thank.
Correction, July 11, 2012: This article originally misspelled Sir Edmund Hillary's last name. (Return to the corrected sentence.)
|
This question is for ilovejedd, vlad59 , chaley or anyone else who is interested in templates...
Earlier in this thread it was suggested that it would be possible to create a new template that would make this PHP catalog OPDS 1.1 compatible. I would like to have this. I started thinking about how I would go about it and I got stuck when I realized I would like my catalog to be both browsable threw the web AND searchable with an ereader device using OPDS. Calibre2opds achieves this by generating html for the website and creating xml for the opds catalog.
How could we achieve this using this PHP scipt and the smarty templates?
|
On The Thin Sea Ice ,Jump into the Freezing Water
Sandefjord in Norway
Guys skate on the ice and jump into the freezing water
I hope they know what they are doing
Filmed at the United Namløs Island in Sandefjord,January 2011.
|
No in vitro synergistic effect of bedaquiline combined with fluoroquinolones, linezolid, and clofazimine against extensively drug-resistant tuberculosis.
We explored the potential synergistic effect of bedaquiline (BDQ) combined with moxifloxacin (MFX), gatifloxacin (GAT), clofazimine (CLO), and linezolid (LZD) for treatment of extensively drug-resistant tuberculosis (XDR-TB). Of 191 XDR-TB isolates, 20 exhibiting minimal inhibitory concentration (MIC) values ≥0.063 μg/mL for BDQ were selected to study potential synergistic, additive, or antagonistic drug effects using a checkerboard assay. Antagonism occurred in 14 (70.0%), 0 (0.0%), 13 (65.0%), and 4 (20.0%) XDR-TB isolates for BDQ-MFX, BDQ-GAT, BDQ-LZD, and BDQ-CLO combinations, respectively. Our in vitro data demonstrate no observed synergistic effects against XDR-TB for drug combinations that included BDQ in combination with MFX, GAT, LZD, or CLO.
|
Exercise and the onset of disability in later life.
This study was to examine whether overall physical activity levels, and different types of earlier sporting activities, are associated with the onset of locomotor disability in early older age. A longitudinal analysis of a general population cohort of British men and women born in the early 1930s was conducted. Measures of overall activity levels at age 58 did not show a relationship with locomotor disability 5-6 years later. Swimming was the only sporting activity to show any strong evidence of a protective association with later locomotor disability. The promotion of swimming in adulthood could play a role in the prevention of locomotor disability and aid people's ability to follow active living health promotion guidelines in late mid-life and early old-age.
|
The impact of immunosuppressive therapy on an early quantitative NK cell reconstitution after allogeneic haematopoietic cell transplantation.
The goal of this study was to examine the impact of various immunosuppressive regimens on an early NK cell recovery following haematopoietic cell transplantation (alloHCT). The number of peripheral blood NK cells was analysed with the use of flow cytometry on day +30 (+/-2) after alloHCT from an HLA identical sibling (n=43) or an unrelated (n=34) donor. Patients receiving prednisolone as a prophylaxis of acute graft-versus-host disease had lower number of NK cells compared to those not given steroids prophylactically (110(10-694) vs. 212(33-890) x 10(6)/L, p = 0.005). In contrast, administration of anti-thymocyte globulin (ATG) (7.5-15 mg/kg) as a part of preparative regimen was not found to influence the NK cell recovery. Similarly, no effect on the number of peripheral blood NK cells was observed with regard to other analysed factors: cell dose, type of myeloablative conditioning, source of stem cells, patient and donor characteristics, number of post-transplant methotrexate doses. Immunosuppressive therapy may affect NK cell recovery following alloHCT. Since NK cells are considered a potential tool for cellular therapy of haematological malignancies, our findings should be taken into account when planning this kind of treatment in the context of allotransplantation.
|
Portable digital computers rely on rechargeable DC batteries to provide the electrical power necessary for operation. When the computer is powered on for processing operation, but allowed to remain idle, the battery continues nonetheless to supply current to all the components of the computer, including the central processing unit (CPU), memory, the chipset (e.g. the Southbridge) and the display of the computer. If the user fails to turn off the computer, the battery continues to supply full current and, eventually, becomes drained of the stored electrical power. The foregoing action leads to more frequent charging of the battery, and reduces the utility and usability of the computer system.
To reduce battery drain under such circumstances, a power management technique was previously introduced for portable computers, called the “sleep” mode. Typically, portable computers based on the INTEL X86 CPU and associated chip set, referred to as “PC's”, include multiple sleep modes (e.g. states of sleep mode). The multiple sleep modes enable the portable computer, when left idle, to selectively power down the components and devices of the computer in stages, although the main power remains on. With the computer spending an increasing amount of time idling, the computer progresses through increasingly deeper and deeper stages of sleep mode (and hence, greater reductions in power consumption). One of the deepest of those modes is characterized by all of the devices, including the CPU, but excepting the main memory (RAM) and the Southbridge chip, being powered down. This latter mode is typically referred to as “Suspend to RAM” (“STR”) or as “Power-on-Suspend” (“POS”) or like terms. In the STR condition power consumption is dramatically reduced and offers the greatest power reduction short of that power reduction obtained by turning off every component of the computer, the latter being referred to as “suspend to disk”, essentially completely shutting down the computer.
The sleep modes in the PC are defined and controlled by the operating system software, such as familiar Windows 9X, Unix, Linux and the like, in conjunction with the system BIOS of the computer. When in STR, the Southbridge portion of the chip set, which is responsible for power management of the PC, continues to monitor the keyboard and mouse (and/or resume key) of the PC for any user activity, signifying an end to the computer idle condition.
When the user later returns to perform computing and observes the computer is in a sleep mode, the user operates a “resume” key (or any key of the keyboard) or the like. That action initiates a chain of events in the computer transparent to the user, that restores full power to the CPU; and the computer recovers quickly. Return from the upper stages of the sleep mode recovers more quickly than recovery from the STR stage, the deepest stage after the Suspend to Disk stage, the latter recovery procedure being referred to as a “resume from STR”.
Of particular convenience, the user may immediately resume computing at the precise location in any application program that was active in the computer at the time the computer entered the sleep mode. To reach that point from the STR stage of sleep mode, the CPU processes a number of steps of the “boot-up” routine for the computer; steps that typically occur in a manner transparent to the user. The computer is able to resume where it left off, because, prior to entering STR, the computer preserved the complete state of all software applications and of all components and devices, including the CPU, in a memory that remained powered up during the “sleep”.
For the power management technique of sleep mode, the CPU and the external memory (DRAM) are independently supplied with power, that is, are located in separate power domains. In the deepest sleep mode, STR, power is removed from the CPU (and other electronic components of the computer, such as the display), while maintaining the DRAM memory and the Southbridge chip under power. The application programs and the state of those application programs (e.g. the CPU “context”) is preserved by transferring the state information to the DRAM.
In processing operation, the CPU executes application programs by continuously modifying both its internal state and memory contents according to the instructions of the program. The internal CPU memory of the X86 system resides in the same power domain as the CPU. Thus, whenever the CPU is powered down, such as for an STR procedure, the internal memory is also powered down, and normally results in the loss of that CPU context. In order for the CPU of the X86 system to resume processing of an application program on Resume from STR, the processor must at that time at least “know” the state of the program on entering STR. Before entering STR, the CPU executes an instruction (of the power management software) that saves the CPU context at a well defined location in external memory, such as the DRAM memory. That context information subsumes the state of the operating system and the state of the application program. By maintaining power to the DRAM during STR, the state information of the program is preserved, and is available for use later upon a Resume from STR.
Once the resume button is pressed and is detected by the Southbridge chip, power is reapplied to the CPU, which commences its start-up routines. The CPU processes the normal boot-up routine stored in the ROM of the BIOS chip. That boot up procedure initializes the internal registers of the CPU and flushes its caches, thereby establishing a baseline state for the CPU. The process takes a noticeable time in which to complete. However, prior to loading the operating system, such as Windows 9x, the routine checks to determine if the boot-up procedure is a “power up reset” as occurs upon initially powering up the computer, or instead is a Resume from STR. When the routine detects the latter condition, the computer “knows” that the state of the operating system software, any application program, and the corresponding CPU context already resides in the external memory (DRAM). The CPU then completes the boot-up procedure by restoring the device states, and, with a special instruction, finally restores the CPU context from the external memory. Thereafter, the CPU is able to simply proceed with executing the next application program instruction exactly where the CPU left off when entering STR.
In a stage of sleep mode that lies one stage above the STR stage, the penultimate stage (e.g. the pre-STR stage) referred to as “deep sleep”, existing operating systems issue an instruction to remove the system clock from the CPU, but to maintain the CPU powered up, continuing to consume battery power. The removal of the system clock reduces power consumption also, but that is not as great a reduction as when power is removed from the CPU, such as during STR. Without clock signals being applied, the CPU is no longer able to process (as would consume additional current), but maintains system context in the associated internal registers of the CPU. That context is not lost and is not required to be saved to external memory as is the case in entering the STR stage. As an advantage, the invention powers down the CPU in all sleep modes and preserves the CPU context, saving additional power.
Accordingly, an object of the invention is to reduce the power consumption of a computer during periods in which the computer is idle, providing a more effective sleep mode.
Another object of the invention is to promote the pre-STR stage of sleep mode in existing power management systems to the STR stage, creating an “Instant STR”, and reduce the time required by the computer system to return from that stage, ideally providing a Resume from STR that appears instantaneous.
And, a related object of the invention is to replace on-the-fly a CPU context maintaining sleep mode of existing computer systems that is governed by the operating system with a substitute sleep mode that affords a lower power consumption and remains transparent to the software.
|
See Also
Announcing the publication of a new Governance Manual for Primary Schools 2015- 2019, Minister for Education and Skills, Jan O’Sullivan TD, thanked the many thousands of volunteers across the country, including thousands of parents, who have served on primary school Boards of Management over the last four years.
Elections will be arranged by individual schools over the coming weeks for appointments to new Boards of Management that will take up office from 1st December next.
The Board of Management structure has been in place for 40 years and each term of office sees thousands of volunteers help with the running and organisation of the over 3,100 primary schools in Ireland. There are generally eight members per Board, two of whom are parent representatives. Membership is designed to reflect all the different interests in the school community (patron, parents, teachers and wider community).
The Governance manual being launched today sets out the various rules regarding the composition and operation of Boards, and provides a helpful overview of the role of the Board. A new element included in this manual is provision to allow schools to operate a “shared governance arrangement” on a voluntary and pilot basis during the forthcoming four year term.
Minister O’Sullivan said: “I would like to thank the volunteers who have contributed enormously to the management and operation of our schools. I very much recognise and appreciate the commitment they have shown to ensuring that schools are managed so as to provide all pupils with the best possible education.
“In order to achieve this objective, Boards must have a very clear understanding of their governance role and responsibilities and must be fully aware of the importance of good communications with the community. This Manual will greatly help Board members with their role.”
“For the first time, this manual sets out a mechanism under which schools can elect 12 members to serve as the boards of management for two schools. While such boards will still be required to maintain separate accounts and minutes, and to hold separate meetings (which may be held consecutively), this is the first time that these rules make provision for schools to pilot a shared governance arrangement. We will arrange for ongoing review of the pilot in consultation with the relevant stakeholders which may result in changes being identified in future years that would allow for shared governance to become a more embedded feature of the school landscape.
“Appropriate training for Board members is hugely important for successfully managing a school, and I am grateful to the various management bodies for their provision of training, advice and guidance to Boards of Management. I am also very pleased that my Department is supporting an increased focus on the use of online training to facilitate the delivery of training modules for each Board member.”
Comments
No documents found
Submit a comment
Please respect the terms of use of our discussion boards. Full terms here . Email addresses are never displayed, but they are required to confirm your comments. When you submit your comment, you'll be sent a link to confirm it.
|
Well this message is just saying that it cant assure you that stack trace is reliable.
Apparently the problem is within Chipmunk library and It seems like you are testing your game in release mode.
Since you are having BAD_ACCESS error it is likely to be a deallocation problem, try use instruments to see why it happens. Also, look through chipmunk topics on both this and spritebuilder forums and see how common problems are being solved with adding some flags like -fno-fast-math or something.
But my guess is that it is either bug inside Chipmunk or you messed up somewhere with deallocation.
|
The five children of Johnny Cash have issued a statement about the right-wing violence in Charlottesville that makes it pretty damn clear that not only would the music legend have been opposed to all this white supremacist bullshit, but that the stormtrooper wannabes of the so-called “alt-right” are a “poison.”
The Cash kids—Rosanne, Cindy, Tara, Kathy, and John—were compelled to speak out against the mob of bigots who gathered last week to protest the removal of a Confederate monument at the University Of Virginia after learning that one of them was filmed wearing a T-shirt with Johnny Cash’s name on it. (If you can stomach it, you might be able to spy the racist in Vice’s documentary about the Charlottesville “rally,” which was attended by many armed white supremacist thugs.) They’re “sickened by the association” with those neo-Nazis, who “are poison in our society, and an insult to every American hero who wore a uniform to fight the Nazis in WWII. Several men in the extended Cash family were among those who served with honor.”
The Cashes describe their father as a man “whose heart beat with the rhythm of love and social justice,” who received humanitarian awards from organizations like the Jewish National Fund, B’nai Brith, and the United Nations. Together with June Carter Cash, the artist worked with and donated to the SOS Children’s Villages from 1973 until the time of their deaths. The statement goes on: “To any who claim supremacy over other human beings, to any who believe in racial or religious hierarchy: we are not you. Our father, as a person, icon, or symbol, is not you. We ask that the Cash name be kept far away from destructive and hateful ideology.”
|
The chat room was abuzz with word that Wegmans, though not in Delaware, is building a store in Concordville, which is close enough to the northern part of the state to attract customers and appease fans.
Linda Horton Bacon wrote on the page that she started the website because she and her husband were tired of driving long distances to get to the Wegmans in Downingtown or Malverne, Pa.
"Six years ago we had no hope of having a Wegmans close by, now we do," Bacon posted. "While we may not have had any influence on Wegmans choosing a site closer to us, we at least have each other to share the excitement with!!!!"
The store's popularity has spurred comment and speculation that Wegmans is stepping up its building plans. There are 81 Wegmans now in operation. The company opened its first store outside New York state in 1993.
Wegmans spokesperson Jo Natale said Monday that the company is not in a growth spurt, but is pursuing an expansion strategy — two or three new stores a year — that has been in place for years.
The idea, Natale said, is to continue to open new stores in six East Coast states — New York, Massachusetts, Pennsylvania, New Jersey, Virginia and Maryland. Most of the states are in regions dominated by a large city, including Boston, Washington, D.C. and Philadelphia.
The company's current strategy is to expand outside New York state but within the other states.
One reason, Natale said, is that Wegman's distribution network — an extensive list of suppliers of everything from milk to exotic cheeses — is an eastern seaboard phenomenon. Opening stores in Chicago or St. Louis extends that network too far, she indicated.
In 2015, stores are scheduled to open in Alexandria, Va. near Washington; Westwood, Mass, near Boston; and in Concordville, Pa., which will attract shoppers from Chadds Ford, Philadelphia and northern Delaware.
In 2016, Natale said three stores in Virginia, two in New Jersey and one in Massachusetts are being contemplated. She said it was too soon to say which of these stores will come on line first.
Also, the company doing major store renovations in Perinton and on Transit Road in the Buffalo area.
|
Acquired cutis laxa in a 55-year-old female with multiple myeloma and serologic evidence of systemic lupus erythematosus.
Cutis laxa (CL) is a rare connective tissue disorder characterized by loosely hanging skin folds. Histopathology reveals degenerative changes in the dermal elastic fibers, although loss of elastin can also occur in alveolar walls, blood vessels, and other organs. The coexistence of autoimmune diseases and monoclonal gammopathies is rare but well documented in the literature. Here we report an unusual case of cutis laxa (CL) preceding the development of serologic evidence of systemic lupus erythematosus (SLE) and a diagnosis of multiple myeloma (MM) by seven and eleven years respectively.
|
Anthony Scaramucci leaves role as US White House communications director after ten days
Tuesday, August 1, 2017
United States president Donald Trump dismissed Anthony Scaramucci from his role as White House communications director yesterday. Scaramucci had only held the position for ten days but had already received criticism after a profanity-laced phone call to a reporter from The New Yorker. President Trump forced Scaramucci’s resignation after his new Chief of Staff, General John Kelly, made the decision, The New York Times reported. General Kelly replaced Reince Priebus who resigned on Friday.
Sarah Huckabee Sanders, White House Press Secretary, released a statement after Scaramucci’s dismissal. She said, “Anthony Scaramucci will be leaving his role as White House Communications Director. Mr. Scaramucci felt it was best to give chief of staff John Kelly a clean slate and the ability to build his own team. We wish him all the best.”
Scaramucci was criticised after an on-the-record phone call with New Yorker reporter Ryan Lizza. Scaramucci contacted Lizza after it was reported he was at dinner with Fox News host Sean Hannity and Bill Shine, a former executive also for Fox News. In the phone call, he demanded Lizza reveal who leaked the details of the dinner and suspected Reince Priebus was responsible. He said, “Reince is a fucking paranoid schizophrenic, a paranoiac”. He went on to mimic Priebus by saying, “Let me leak the fucking thing and see if I can cock block these people the way I cock blocked Scaramucci for six months.” In the same phone call he also criticised White House strategist Steve Bannon. He was quoted as saying, “I’m not Steve Bannon, I’m not trying to suck my own cock”.
Huckabee Sanders commented on the phone call in her statement saying, “The President certainly felt that Anthony’s comments were inappropriate for someone in that position and he didn’t want to burden Gen. Kelly also with that line of succession”.
It has been confirmed Scaramucci was not reassigned within the administration. In his resignation Scaramucci reportedly requested to be redeployed to the US’s Export-Import Bank as chief strategy officer. He was previously vice president and chief strategy officer at the Export-Import Bank.
Scaramucci was the third communications director of Trump’s presidency. Michael Dubke resigned from the position in May while former Press Secretary Sean Spicer assumed some of the role.
Before joining the White House, Scaramucci was a Wall Street financier and founded SkyBridge Capital, an investment firm. Though not always a supporter of President Trump, he later advised him during last year’s US presidential campaign. In 2012, he was the national finance co-chair for the presidential campaign of Mitt Romney. Before aligning himself with Trump, he fundraised for the GOP primary campaigns of both Scott Walker and Jeb Bush.
This entry was posted
on Monday, September 11th, 2017 at 1:17 am
and is filed under Uncategorized.
You can follow any responses to this entry through the RSS 2.0 feed.
Responses are currently closed, but you can trackback from your own site.
|
/**
* Copyright (c) 2016-present, RxJava Contributors.
*
* Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in
* compliance with the License. You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software distributed under the License is
* distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See
* the License for the specific language governing permissions and limitations under the License.
*/
package io.reactivex.observable.internal.observers;
import java.util.concurrent.atomic.AtomicReference;
import io.reactivex.common.*;
import io.reactivex.common.exceptions.*;
import io.reactivex.common.functions.BiConsumer;
import io.reactivex.common.internal.disposables.DisposableHelper;
import io.reactivex.observable.SingleObserver;
public final class BiConsumerSingleObserver<T>
extends AtomicReference<Disposable>
implements SingleObserver<T>, Disposable {
private static final long serialVersionUID = 4943102778943297569L;
final BiConsumer<? super T, ? super Throwable> onCallback;
public BiConsumerSingleObserver(BiConsumer<? super T, ? super Throwable> onCallback) {
this.onCallback = onCallback;
}
@Override
public void onError(Throwable e) {
try {
lazySet(DisposableHelper.DISPOSED);
onCallback.accept(null, e);
} catch (Throwable ex) {
Exceptions.throwIfFatal(ex);
RxJavaCommonPlugins.onError(new CompositeException(e, ex));
}
}
@Override
public void onSubscribe(Disposable d) {
DisposableHelper.setOnce(this, d);
}
@Override
public void onSuccess(T value) {
try {
lazySet(DisposableHelper.DISPOSED);
onCallback.accept(value, null);
} catch (Throwable ex) {
Exceptions.throwIfFatal(ex);
RxJavaCommonPlugins.onError(ex);
}
}
@Override
public void dispose() {
DisposableHelper.dispose(this);
}
@Override
public boolean isDisposed() {
return get() == DisposableHelper.DISPOSED;
}
}
|
Q:
What is the C# equivalent of R's SEXP type?
I would like to call a method in a dll that returns a variable of type 'SEXP' from C#. What is the equivalent of type 'SEXP' in C# or how can I declare a SEXP variable in C#.
Thanks in advance.
A:
I strongly suggest you use the package https://www.nuget.org/packages/R.NET.Community in your C# project, and you may want to clone or fork R.NET from https://github.com/jmp75/rdotnet to get code examples.
R.NET has all the interop glue code for R's SEXP already available, in C#
For instance in R.NET/REngine.cs
public SymbolicExpression GetSymbol(string name, REnvironment environment)
The glue code closer to the interop with C is under R.NET/Internals. R.NET uses delegates (Internals/Delegates.cs) to perform PInvoke. Not a compulsory approach, but less cruft code than traditional PInvoke.
REngine inherits from a class to facilitate PInvoke
public class UnmanagedDll
You will find an example how to wrap and call native libraries at https://github.com/jmp75/dynamic-interop-dll
|
Eosinophilic esophagitis (EoE) is an inflammatory condition of the esophagus, thought to be caused by food allergy, and characterized by the presence of eosinophils within the esophageal mucosa. Even though it is a relatively new disease, EoE is now recognized to be common in both adult and pediatric populations and rapidly rising in incidence. Patients with EoE can experience a variety of upper GI symptoms, ranging from dysphagia to food impaction. Experts fear that if left untreated, EoE may lead to esophageal fibrosis and stricture formation. It is therefore currently recommended that this disease be treated until the symptoms and the eosinophilic infiltrate have resolved. EoE therapy options include corticosteroids and aggressive dietary restriction followed by gradual food reintroduction. While both treatments are effective, EoE returns following cessation of corticosteroids and numerous attempts at food reintroduction are needed to arrive at a diet that provides a good quality of life. As a result, management of EoE patients involves frequent follow up to monitor the patient's clinical and histopathologic response to changes in steroid dosing and/or diet. This strategy is arduous for patients and their families, and costly, as multiple endoscopy sessions must be conducted over time to procure esophageal biopsies and monitor eosinophil counts. We have developed a new technology called spectrally-encoded confocal microscopy (SECM), that is capable of being incorporated into a small-diameter probe and can rapidly obtain depth-resolved microscopic image data over large epithelial areas in vivo. Originally developed to evaluate dysplasia and cancer of the esophagus, we have recently discovered that this imaging modality can also see esophageal eosinophils with a high degree of contrast. Much of the inconvenience and nearly half of the cost of endoscopy is a consequence of patient sedation that is required to perform the endoscopic procedure. In this proposal we will advance the SECM technology so that it can be used to monitor esophageal eosinophils without requiring sedation, endoscopy, or excisional biopsy. We will accomplish this task by developing small, flexible transnasal SECM probe that can be routinely inserted into the esophagus in the outpatient setting. In conjunction with a new high-speed SECM system, this device will automatically image a large portion of the esophagus and count eosinophils. Once the device has been constructed, validation studies will be conducted to demonstrate that the accuracy of this device is comparable to that of endoscopic biopsy. The end product of this research will be an esophageal eosinophil monitoring tool that is less expensive and far better tolerated than the current standard of care. Beyond its immediate clinical impact, this technology can also be used in future investigational studies to expand our knowledge of EoE and other diseases such as asthma that are characterized by tissue eosinophilia.
|
The content of this site is protected by Copyscape. Please do not use any of the site's content without the express permission of the author. For more information, click on the banner below.
Sleep
Apnea Symptoms: Could You Have It, Too?
Sleep apnea symptoms
should not be ignored, as the condition can
pose a great threat to your health. It is being researched all over the
world, and there is more and more knowledge about all the serious side
effects the disorder brings with it.
There are two forms of sleep apnea: central
sleep apnea and
obstructive
sleep apnea. Combinations of the two can occur. The most frequent
type is obstructive sleep apnea, and is caused, as the
name suggests,
by an obstruction in the airways during sleep. These obstructions can
be caused by a variety of factors such as facial shape, being obese or
overweight, alcohol consumption and much more.
Although
the condition is mostly found in adults, especially men, it can also be
diagnosed
in children. Sleep apnea can be temporary, for example in
cases where it is caused by enlarged polyps or tonsils or obesity. The
severity the condition varies a lot from patient to patient, and can be
worsened by
external factors such as colds, stress, etc.
Sleep
apnea in itself is not a dangerous condition, however, it is proven to
have
a negative effect of the cardiovascular system, and thus make the risk
of related diseases much higher. It is completely certain
that no
matter what, the condition lowers overall well being of the sufferer,
and makes their everyday life more difficult.
As we said before, it is
very important to seek treatment for sleep apnea, if you suspect that
you're suffering from the condition. Snoring, although it can be
incredibly bothersome, is much, much more common than sleep apnea, but
also the most common
symptom of the illness.
Snoring
caused by sleep apnea is often accompanied by quiet
periods of up to 60 seconds, in which the sleeper
unsuccessfully tries to
draw in air. Most people who have experienced sleeping next to a person
with sleep apnea have heard the grunts, gasps and snorts associated
with
the condition.
Not
until the sleeper wakes up is air allowed through,
and as apneas occur hundreds of times during the night, it is hard for
sufferers to get a good night’s sleep. Sleep
apnea and dizziness,
fatigue
and lethargy are also commonly linked together.
These
are subjective and thus very hard to measure, however, it is possible
to observe different reaction patterns, showing that a person does
not react with sufficient alertness in certain situations. Tendencies
to sleep in monotonous or undesirable situations, i.e. at meetings and
when watching a movie, can also be one of the clearsigns
of sleep apnea.
Even
if a patient does not experience falling asleep as described
above, he or she may experience a lowered
ability to focus in situations
without physical activity or other stimulation. Many describe
performing
their daily tasks completely on auto-pilot, and not remembering how
they
did it afterwards.
Often
times, the people around the patient are best at describing the
symptoms, mainly because people with sleep
apnea most often have no
recollection of their attacks, and are not at
all aware of having woken up. However, it is also often easier for
friends and family to detect changes in a person’s behavior, i.e.
whether they are different in mental state: grumpy, forgetful etc.
Other
symptoms include:
Waking up at
night for no apparent
reason
Increased need
to urinate during the
night
Moderate
concentration and memory issues
A feeling of
never being fully rested,
even after many hours of sleep
Less
frequent symptoms include:
Irritability,
depression
caused by sleep apnea: not getting
sufficient sleep can be very damaging to mental health, and make it
much more difficult to face everyday life.
If
you have experienced one or more of the above sleep apnea symptoms
and think you may have sleep apnea, you should visit a doctor to
get
diagnosed and determine the correct treatment.
Obstructive sleep apnea refers to conditions where the apnea is caused
by obstructions in the upper airway and pharynx. This caused the flow
of air to the lungs is lessened/stops due to resistance in these
areas, i.e. because the soft palate falls back during sleep and hinders
airflow.
Central sleep apnea is another type of sleep apnea that is caused by
conditions in the brain, and also causes the flow of air to the lungs
to be lessened or stopped for a short period.
No matter what type of apnea you have, it is a stressful condition for
your body. It is normal for the blood
pressure and pulse to fall during
the night, but in people with sleep apnea these do not fall
while they
are sleeping. Sufferers often do not reach the deep phase of the
non-REM part of the normal
sleep cycle.
Connections
between diabetes
and sleep apnea, as well as between sleep
apnea and high blood pressure, have been determined. If a patient is
not treated for these conditions, sleep apnea can become much more
severe and bring along with it very serious side effects.
The most efficient way to diagnose sleep apnea is to measure brain
activity, breathing, and oxygen saturation in the blood.
The latter is the most simple test to do, and normally only requires
that the patient sleeps with a “clamp”
on his finger.
Cases
of the type
of sleep apnea in which the oxygen saturation decreases can easily be
diagnosed with this type of test, while it is useless for other types
of the condition.
There are other methods to determine sleep apnea that look for various
factors, using measurements of a patients breathing during sleep.
Others measure sleep
position and restlessness during the night. One of
the most common ways to determine the correct treatment for sleep apnea
is to count the number of apneas a patient has during the night. These
can last for 10-60
seconds and can occur 300-600
times during the night.
Useful Links:
For more information about how sleep apnea can have a strain on the heart, be sure to visit the website of the Cardiomyopathy Association. It's better to catch the symptoms early, and for that you need a complete picture.
|
Followers
Wednesday, December 7, 2011
Not All Pinks are Created Equal
I decided that once I started working in a salon I would do something fun with my hair. I did a block color and have a triangle of pink on the top of my head with the rest of my hair being black. I love it. I do not, however, love the upkeep. It's just a nightmare!!!
I get my roots bleached every six weeks (I normally have well over an inch of growth by that point) and I have to re-dye the pink every two weeks.
I was using Manic Panic's Hot Hot Pink, which left it a nice vibrant HOT pink. I love it and may wind up going back to that color.
I decided I wanted to try Pravana's Wild Orchid shade today. I loved the results I saw from this at the various hair shows and I figured my hair would be just as vibrant.
Here's the before shot:
You can see where the ends go orange, but the roots are VERY bright.
...and the after shot. It's not an outside shot, and the only lighting I had where I could take a self portrait was the super warm bulbs in the salon bathroom... It's not as vibrant as I normally like my hair to be. I'm hoping this is just because of how late it was when I finally decided to put the color in.
I'll be making sure to take some shots in outdoor lighting as soon as possible... I'll also give you guys an update in two weeks to see just how much this has washed out as opposed to the Manic Panic.
2 comments:
I think it's fantastic! I WISH I could do something as daring as this. I'd put in deep purple streaks.... But the whole bleaching my hair thing... It took me forever to get my hair back to the health it was before I had kids. I'm afraid to do that now.
Ugh. I really wish you were back in Jersey. I'd have you doing my dye jobs in a heartbeat. (BTW, this is Deanne. I forgot I had a blog on here. LOL. I really should redo that damned thing.)
Aww thanks babe! Yea once you bleach your hair, there's no going back until you grow it out. Luckily enough, since I am in the salon, I can do regular deep conditioning treatments. I do them every three weeks or so, which is definitely helping. Plus I use some pretty heavy duty stuff at home. It takes a lot of work, but the end result is worth it.
ANIMAL!!
About The Artist
I'm just your ordinary girl who is following her dream. I've always wanted to be a stylist and have been obsessed with all things beauty for as long as I can remember. This blog will showcase various looks, both hair and makeup, as well as reviewing various hair and makeup products. I hope to spread education as well as inspiration.
If you have any questions, requests, or would just like to chat, please feel free to e-mail me at [email protected]
|
Q:
need help in database integrity
I need help executing a bat file from asp.net 2.0 and c++.
How to import runtime Sql Server2000 data into Oracle 9i?
How to manage project?
A:
Oracle and SQL can talk replication/subscriptions. Otherwise you can use standard SSIS/ETL methods such as BCP, SQLLDR, etc.
|
Tuesday, 25 November 2014
Bio-Accelerator 360°™
Overview
Bio-Accelerator
360°™ is an advanced ‘plug and play’ MBBR (Moving bed bio Reactor)
waste water treatment system featuring the submerged bio media. The
Bio-Accelerator 360°™ is engineered to provide a high quality effluent,
treated to pollution control board standards and suitable for a variety
of reuse applications.
On the contrary to Pre assembled
and modular STP, above ground On-site Bio-Accelerator 360°™ Sewage
Treatment plant is flexible is design and construction.
All tanks are built in concert and equipment installation is done on-site.
MBBR -Moving Bed Bio Reactor Latest Technology for STP
Working Principal
The
heart of the Bio-Accelerator 360°™ is design of aeration tank and
bio-media as it removes organic impurities through a biological process.
The biological process involves growing millions of bacteria that eat
up organic impurities. Thousands of Virgin PP media pieces provide
larger surface area for quick bacterial growth. Bacteria get attached to
the surface of media-piece sand gets detached after attaining mass and
age, giving room to other bacteria to grow at the surface of the media.
Continuous
and right supply of air through Diffusers provides mobility to the
media and the sewage, for accelerated biological growth of bacteria… and
provides vital oxygen for bacterial growth. The Accelerator 360°™
technology ensures that Food and Mass Ratio is continuously maintained
uninterruptedly throughout the process for desired level of Mixed Liquor
Suspended Solids (MLSS) which is critical for subsequent processes.
The
mixed-liquor largely free of organic impurities, with controlled levels
of BOD and COD, overflows to the next chamber for settling and
filtration process.
And all institution and industrial premises
which have laundry water facilities. We at Shubham provided optimum use
of treated laundry water with economical and innovative technologies.
Tuesday, 18 November 2014
Sewage treatment plant in Gujarat – India
We at Shubham, Manufacturer – Supplier Sewage Treatment Plant
,we offer variety of sewage treatment plant from conventional to
innovative technology and modular to onsite treatment plant as per
customer’s relevance and area availability as in Ahmedabad, Surat,
Rajkot, Baroda, Gujarat and across the India.
Shubham Inc.has expanded its foray into Water and Sewage Water Treatment Plants. Shubham‘s product range mainly split into two market vertical Water Treatment & Waste water Treatment.
What Is Sewage Treatment Plant ?
Sewage treatment Plant is the process of removing
contaminants from wastewater, including household sewage and runoff. It
includes physical, chemical, and biological processes to remove
physical, chemical and biological contaminants. Its objective is to
produce an environmentally safe fluid waste stream and a solid waste
suitable for disposal or reuse. With suitable technology, it is possible
to re-use sewage effluent for drinking water, although this is usually
only done in places with limited water supplies such as Ahmedabad
Gujarat, India.
We use the best-in-class technology and cutting-edge tools to foster
high-quality, sustainable, community-level water supply projects in
Gujarat, India across the Ahmedabad, Surat, Rajkot and Baroda.
Sewage Treatment Plant
The Sewage Treatment Plant process is similar to the way that a
Septic Tank works but mechanical components provide a process to help
break down solids to produce a cleaner, more environmentally friendly
effluent.
Combined sewage contain various biological impurities, are fed into
the primary settlement tank where solids and liquids separate and the
liquor flows into the aeration chamber. In the chamber, a surface
aerator or diffuser aerator infuse air and oxygen to the waste and
encourages good bacteria to digest the organic matter, breaking it down
and purifying it.As it leaves
the final chamber known as the settling chamber, the effluent is
typically 95% clean and ready for discharge into local watercourses,
ditches or land drainage systems, subject to consent by the Environment
Agency.
We at Shubham, Supplier Sewage Treatment Plant,we
offer variety of sewage treatment plant from conventional to innovative
technology and modular to onsite treatment plant as per customer’s
relevance and area availability as in Ahmedabad, Surat, Rajkot, Baroda,
Gujarat and across the India.
Modular Sewage treatment Plant
Shubham’s(MD series) of Modular sewage treatment Plant
is a closed steel module with three chambers — aeration, settling and
discharge-disinfection. Each chamber features the necessary access and
inspection registers.This modular construction allows the increase of the processing capacity by placing more plants in parallel.All
the instruments and control elements of the plant are housed inside an
anti-vandal cabinet. These plants do not generate noise &odors due
to their closed modular construction. Thedesign of these plants allows
installation in a single day.
Onsite – Above Ground
Onsite wastewater treatment is becoming the preferred treatment
method over centralized treatment plants.Shubham’s(AG Series) of onsite
above ground sewage treatment plantis a single-built concrete module
contains aeration, settling and disinfection chambers inside in a closed
concrete pit.
This concrete construction does not have any limitation of flow and
capacity and can be built from 10 KL to 2 MLD. Separate plant room is
constructed to house all the instruments and control elements. These
plants has low life cycle cost and provide flexibility to build tanks in
shape and dimension.
Onsite above ground STP Eliminates the long distance transport of
wastewater to treatment plants and purified water back to the point of
origin
Onsite – Under Ground
Land constraint in developing cities has always been problematic mainly due to the vertical growth, high population and density.It
constantly faces the challenge of planning their land use to overcome
their land constraints for developing infrastructure facilities in
limited area.
Shubham’s(UG Series)of Onsite below ground Sewage Treatment Plant
is an effective solution, where space is major concern for any
developer and Infrastructure Company. We provide customize solution and
design for maximum use of land with the effective treatment of domestic
sewage.
Our below ground sewage treatment plant can be built below the road,
basement & parking area, gardening and consume only unused area of
total land.
|
1. Field of the Invention
The present invention relates to a light emitting display device in which light emitting elements constituting pixels are actively driven for example by TFTs (Thin Film Transistors) and in particular to a light emitting display device which can effectively restrain intensity non-uniformity among respective pixels which occurs due to variations in characteristics of light emission drive transistors that give drive current to the respective light emitting elements.
2. Description of the Related Art
Demand for a display panel which has a high definition image display function and which can realize a thin shape and low power consumption has increased due to popularity of cellular telephones, personal digital assistants (PDAS), and the like, and conventionally a liquid crystal display panel has been adopted in many products as the one which meets the needs thereof. Meanwhile, these days a self light emitting display panel utilizing an organic EL element whose characteristic as a self light emitting type display element is best used has been manufactured, and this have attracted attention as a next generation display panel in place of the conventional liquid crystal display panel. A background thereof is that by employing, in a light emission functional layer of the element, an organic compound which enables an excellent light emission characteristic to be expected, a high efficiency and a long life which can be equal to practical use have been advanced.
The organic EL element is constructed by laminating a transparent electrode for example by ITO, a light emission functional layer, and a metallic electrode one by one basically on a transparent substrate such as glass or the like. The light emission functional layer may be a single layer of an organic light emitting layer, or a double layer structure composed of an organic positive hole transport layer and an organic light emitting layer, or a triple layer structure composed of an organic positive hole transport layer, an organic light emitting layer, and an organic electron transport layer, or a multilayer structure in which an injection layer of electron or positive hole is inserted into an appropriate portion among these layers.
The organic EL element can be electrically replaced by a structure composed of a light emitting component having a diode characteristic and a parasitic capacitance component which is connected in parallel to this light emitting component, and thus the organic EL element can be said to be a capacitive light emitting element. When a light emission drive voltage is applied to this organic EL element, at first, electrical charges corresponding to the electric capacity of this element flow into the electrode as a displacement current and are accumulated. It can be considered that when the drive voltage then exceeds a determined voltage (light emission threshold voltage=Vth) peculiar to this element, current begins to flow from one electrode (anode side of the diode component) to an organic layer constituting the light emitting layer so that the element emits light at an intensity proportional to this current.
As a display panel employing such organic EL elements, a passive matrix type display panel in which EL elements are simply arranged in a matrix pattern and an active matrix type display panel in which active elements for example constituted by TFTs are added to respective EL elements arranged in a matrix pattern have been proposed. The latter active matrix type display panel can realize low power consumption compared to the former passive matrix type display panel and has a characteristic that crosstalk among pixels is small, whereby it is particularly suitable for a high definition display constituting a large screen.
FIG. 1 shows an example of a circuit structure corresponding to one pixel 10 in an active matrix type display panel already proposed. The circuit structure of the pixel 10 shown in this FIG. 1 shows an example in which a lighting drive method called the SES (Simultaneous Erasing Scan) method which realizes time division gradation expression is adopted.
In the structure of this pixel 10, a data signal Vdata corresponding to a video signal supplied from a data driver 11 is supplied to source S of a scan selection transistor, that is, a data write transistor Tr2, via a data line arranged in a display panel. A data write signal Write is supplied from a scan driver 12 to the gate G of the data write transistor Tr2 via a scan selection line.
The drain D of the data write transistor Tr2 is connected to gate G of a light emission drive transistor Tr1 and to one terminal of a light emission maintaining capacitor C1. The source S of the light emission drive transistor Tr1 is connected to the other terminal of the capacitor C1 and to an anode side drive power source Va. Further, the drain D of the light emission drive transistor Tr1 is connected to anode terminal of an organic EL element E1 provided as a light emitting element, and cathode terminal of this organic EL element E1 is connected to a cathode side drive power source Vc.
The pixel structure shown in FIG. 1 is provided with an erase transistor Tr3, and an erase signal Erase is supplied from an erase driver 13 to the gate of this erase transistor Tr3 via an erase signal line. The source S and drain D of the erase transistor Tr3 are connected to end portions of the light emission maintaining capacitor C1, respectively.
In the pixel 10 shown in FIG. 1, only the light emission drive transistor Tr1 is constituted by p-channel type TFT, and other transistors are constituted by n-channel type TFTs. A large number of the pixels 10 of the above-described structure are arranged in a matrix pattern in a row direction and a column direction to construct the display panel.
In the structure of the pixel 10 shown in FIG. 1, an ON voltage Write as a scan signal is supplied from the scan driver 12 to the gate of the data write transistor Tr2 during an address period. Thus, current corresponding to the data signal Vdata supplied from the data driver 11 flows in the light emission maintaining capacitor C1 via the source and drain of the data write transistor Tr2 so that the capacitor C1 is charged. Its charge voltage is supplied to the gate of the light emission drive transistor Tr1, and the transistor Tr1 allows drain current Id corresponding to a gate-to-source voltage (Vgs) which is based on the gate voltage thereof and on the drive power source Va supplied to the source to flow in the EL element E1, whereby the EL element E1 emits light.
When the gate of the data write transistor Tr2 becomes an OFF voltage after the address period elapses, the transistor Tr2 becomes in a so-called cut-off state. However, the gate voltage of the light emission drive transistor Tr1 is maintained by electrical charges accumulated in the capacitor C1, and thus drive current to the EL element E1 is retained. Accordingly, a lighting state of the EL element E1 which corresponds to the data signal Vdata can be continued until a period to a next address operation (for example, a next one frame period or a next one subframe period).
Meanwhile, in the middle of the lighting period of the EL element E1 (for example, in the middle of one frame period or one subframe period), the erase signal Erase which turns the erase transistor Tr3 on is supplied from the erase driver 13. In the case where this erase transistor Tr3 is turned on, electrical charges charged in the capacitor C1 are erased (charged) instantly, and as a result, the, light emission drive transistor Tr1 becomes in the cut-off state, whereby the EL element E1 is instantly extinguished.
In other words, by controlling output timing of the gate-on voltage supplied from the erase driver 13, the lighting period of the EL element E1 for example during one frame or one subframe period is controlled, and thus multi-gradation expression can be realized. The structure of a pixel provided with the erase transistor Tr3 in addition to the data write transistor Tr2 and the light emission drive transistor Tr1 as described above is disclosed in the following Japanese Patent Application Laid-open No. 2001-343933.
In many of these types of light emitting elements represented by the organic EL element have a current dependency that the light emission intensity is determined in response to the drive current. Meanwhile, regarding the light emission drive transistor employed in the above-described pixel structure, variations occurs in the characteristic of drain current Id with respect to the gate-to-source voltage Vgs, particularly in the characteristic of the gate-to-source voltage Vgs, that is, of the threshold, at which the drain current Id begins to flow. Thus, even though the same level of data signal Vdata is supplied, variations in light emission intensities occur among pixels.
Such variations in light emission intensities among pixels allow, particularly when an animation image and the like is reproduced, a vague stripe pattern or a phenomenon resembling flicker to be generated, thereby causing a problem that display quality is considerably degraded. Thus, in order to solve the problem, it is necessary to make the characteristic of TFTs formed in a display panel uniform, and regarding this, conventionally, various discussions and developments have been carried out. However, regarding this, there exist a number of technical problems including a problem of selection of a semiconductor material or other materials, a problem of a manufacturing process, a problem of a manufacturing environment, and the like, and it is difficult to pursue a fundamental solution.
|
There have been no confirmed reports of adverse or allergic reactions in connection with the mislabeled nuggets.
The recall involved 12-oz. packages of “Perdue Fun Shapes Chicken Breast Nuggets” with a “Use By” date of “MAR 11 2019” and lot codes 17009010 – 19009010. The products were shipped to stores in New Jersey and a dozen other states along the East Coast.
The problem was discovered when a retail store notified the company of an incorrect label.
Earlier this month, Perdue recalled over 68,000 pounds of frozen SimplySmart Organics nuggets, after several bags were found to have wood inside.
Perdue frozen chicken nugget recall in Jan 2019 (usda.gov)
Consumers with questions about either recall can contact Perdue Consumer Care at (877) 727-3447.
|
Is America a Christian nation? Some Christians eagerly point to the word “Creator” in the Declaration of Independence (1776) as evidence:
We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty and the pursuit of Happiness.
Who is this “Creator”? Is it Yahweh, the Christian god? Is it a placeholder into which you can imagine any god so that Muslims can imagine Allah or Hindus can imagine Brahma?
No—the opening sentence clarifies: it’s not Yahweh but “Nature’s God.” At the time, this phrase was understood as the deist god of Enlightenment philosophers like Spinoza and Voltaire. Deism was popular in Revolutionary America, and Franklin, Jefferson, Washington, and other founding fathers were either deists or inspired by the movement. Deism imagines a hands-off god, a creator who, once the clock is built and wound up, leaves it to tick by itself.
The role of this “Creator” is clarified in the Declaration:
Governments are instituted among Men, deriving their just powers from the consent of the governed.
In other words, the Creator has no role in government. We’ve turned our back on the divine right of kings, where the king was God’s representative who served at God’s pleasure. God isn’t the foundation on which authority rests. No—it’s the consent of the governed. The buck stops here, which is very empowering.
Remember that the purpose of the Declaration was to inform Britain that the colonies wanted to become independent. When government becomes abusive, the recourse isn’t to appeal to God:
Whenever any Form of Government becomes destructive of these ends, it is the Right of the People to alter or to abolish it, and to institute new Government, laying its foundation on such principles and organizing its powers in such form, as to them shall seem most likely to effect their Safety and Happiness.
Again, we see that the government rules at the pleasure of the people, not God.
While the Declaration of Independence doesn’t give Christians what they may imagine it does—an acknowledgement of the existence of the Christian god and his sovereignty over this country—this exercise is largely irrelevant. The Declaration isn’t the supreme law of the United States. That’s the Constitution, and it’s secular. Like the Declaration, it makes clear where the buck stops. In huge letters, it begins, We the People.
Watch out for Christian revisionist historians bringing up the Declaration. They’d bring up the Constitution, the document that actually matters, if they could. But they know they can’t, and that’s the white flag of surrender.
I think of myself as a militant agnostic:
I don’t know, and you don’t either.
— Michael Shermer
(This is a modified version of a post that originally appeared 2/10/12.)
Photo credit: Wikimedia
|
Self-described socialist and Democratic presidential candidate Bernie Sanders has a record of being remarkably supportive of the Second Amendment.
(Remarkable because he’s a favorite among progressives.)
Considering the leftward movement of the Democratic party and their avid support for all sorts of gun control, this could be a potential problem for Sanders.
In the wake of the Charleston shootings, Sanders was asked about gun control, and despite the president’s latest push, he was very cautious in his response. CNN reports:
Two days after a white man walked into a historically black church in Charleston, South Carolina, and killed nine people, the Vermont senator and presidential candidate took a cautious approach on gun control Friday when speaking with reporters after an event in Las Vegas. “I think the people of Vermont understand that guns in Vermont are different than guns in Chicago or guns in Los Angeles,” Sanders said, telling the assembled journalists that he thinks “it is wrong” when people are “in some cases suicidal and in some cases homicidal” are “still being able to purchase guns.” Sanders, saying his home state of Vermont has “zero gun control,” acknowledged that different parts of the country have different outlooks on guns. “I think we need to have as serious conversation about that,” Sanders said. “I think rural America needs to understand what urban America feels. Urban America needs to understand the culture of rural America. But I think together we have got to go forward to make certain that people who should not be having these weapons do not have them.” When CNN tried to follow up with Sanders about how he would handle guns differently than President Barack Obama, the independent senator rejected the question. “I will talk about guns at some length,” he said, “but not right now.”
Vermont loves their guns, as do the majority of Americans, and Sanders’ record on gun control, while mixed, has often been quite strong. Hot Air reports:
If Sanders has a weak spot in his armor in terms of pleasing his liberal base, it’s the gun question. Given his many other socialist positions that might come as a surprise, but Sanders’ own voting record on Second Amendment rights is shockingly moderate, or at least it was until quite recently. In 2009 he voted to allow guns in checked baggage on Amtrak trains. Two years before that he voted to prohibit funding for international organizations and agreements that would restrict US citizens’ gun rights. And in 2005 he voted for a ban on nuisance lawsuits against gun manufacturers. He currently has an “F” rating with the NRA, but in years past it has been higher. (Though never a full A rating.)
His current “F” rating with the NRA is probably due to his support for a variety of gun control attempts, including the gun control legislation that was pushed after Sandy Hook.
The progressives over at Slate are not impressed. From the “Bernie Sanders, Gun Nut” article (tag line: “He supported the most reprehensible pro-gun legislation in recent memory”):
When Vermont Sen. Bernie Sanders jumped into the 2016 presidential race, he was widely hailed as a far-left socialist who would appeal to the liberal wing of the Democratic Party. A liberal challenge to Hillary Clinton, said Politico. True progressives’ liberal alternative, trumpeted FiveThirtyEight. But before liberal Democrats flock to Sanders, they should remember that the Vermont senator stands firmly to Clinton’s right on one issue of overwhelming importance to the Democratic base: gun control. During his time in Congress, Sanders opposed several moderate gun control bills. He also supported the most odious NRA–backed law in recent memory—one that may block Sandy Hook families from winning a lawsuit against the manufacturer of the gun used to massacre their children.
Watch him on MSNBC (if you simply can’t abide listening to Chris Hayes, click to :17):
|
Angunnguaq Larsen
Angunnguaq Larsen is a Greenlandic actor.
Larsen plays Mikael in Nuummioq, Greenland's first feature film.
In the 2010 Danish series Borgen, Larsen played the fictitious Prime Minister of Greenland Jens Enok Berthelsen.
Filmography
2009 – Nuummioq
2009 – Hinnarik Sinnattunilu
2010 – Eksperimentet
2010 – Borgen
2011 – Qaqqat Alanngui
References
External links
Category:Greenlandic male actors
Category:Living people
Category:Year of birth missing (living people)
|
A former federal inspector has urged regulators to shut down California’s last remaining nuclear power plant until it can be determined whether the facility can stand up to an earthquake off the Central Coast.
Diablo Canyon is California’s sole remaining nuclear plant.
Michael Peck, former senior resident inspector at Diablo Canyon, made his case to the U.S. Nuclear Regulatory Commission in a confidential July 2013 document, a copy of which was released Monday by the environmental group Friends of the Earth.
The document was first reported by the Associated Press.
Peck argued that it is unsafe to continue running Diable Canyon without evaluating whether it can withstand quakes from nearby faults that are now believed to be capable of producing more ground shaking than was known when the plant was built and licensed.
Allowing it to continue operating “challenges the presumption of nuclear safety,” Peck wrote.
A new fault -- known as the Shoreline fault -- was discovered just offshore from the plant in 2008. Federal regulators concluded that the plant’s current design would be able to stand up to any earthquakes the fault might produce.
Peck argued that the plant’s license needs to be amended in light of the new earthquake information. He also took issue with the methodology used to analyze earthquake risks at the plant in the past.
Damon Moglen, senior strategic advisor with the environmental group, said Peck is “the canary in the coal mine, warning us of a possible catastrophe at Diablo Canyon before it’s too late.”
Nuclear Regulatory Commission spokeswoman Lara Uselding said the agency stands by its conclusion that the plant would safely withstand an earthquake.
She said the agency “encourages and welcomes differing opinions” from its staff and is still reviewing Peck’s concerns, but has not issued a final response.
Blair Jones, a spokesman for plant operator Pacific Gas & Electric, said the plant “was built to withstand the largest potential earthquakes in our region.” The plant was retrofitted in the 1970s after the nearby Hosgri fault was discovered, he said.
That retrofit set the plant up to withstand the amount of ground shaking that could be produced by three other nearby faults, Jones said.
Dave Lochbaum, director of the nuclear safety project at the Union of Concerned Scientists, said his group agrees that the methodology used to analyze earthquake risks at the plant was flawed, although he stopped short of calling for it to be shut down.
He pointed out that the plant will be making safety fixes in any case, as a result of the Fukushima Daiichi nuclear disaster in Japan.
“We hold out some hope that the Fukushima fixes will lead to the fixes needed at Diablo Canyon,” he said.
California’s other nuclear plant, San Onofre, on the coast near San Clemente, was shut down for good last year as a result of faulty equipment that led to a small release of radioactive steam and a heated regulatory battle over the plant’s license. Friends of the Earth pushed to keep that plant shuttered.
|
Of the eight vulnerabilities, six were rated "critical," one "high" and one "low" in Mozilla's four-step ranking system. The six critical bugs are in Firefox's garbage collection routine, in the PNG libraries used by the browser, and in the layout and JavaScript engines
|
Legal To Use Aerials For Realtors
“Every Aerial Photo or Video taken from a drone that is used to promote a Real Estate listing MUST be taken by a ‘Licensed Commercial UAS Pilot’!”
Some Background – Many Realtors have a friend who owns a drone or maybe even
own one themselves. They are showing up under family Christmas trees more every year and they take incredible photos and videos. It is hard to imagine not using these incredible aerial perspective images to reveal this usually breathtaking “Money Shot” of your listings as buyers do a double-take every time they see one.
Fortunately, for the do-it-yourself-er, Congress has flat-out told the FAA that they may NOT regulate to drone hobbyists their using drones for fun and personal use as long as those hobbyist have registered their Drones with the FAA and that the hobbyist operate in unregulated airspace and follow certain rules of the airways.Unfortunately, the second you use an aerial photo or video to help sell your listing, even in unregulated airspace, you are no longer a hobbyist. You have just stepped into the role of a Licensed Commercial UAS Pilot.
M.R.E.C. – This “Commercial” activity is strictly prohibited by the FAA and the Missouri Real Estate Commission forbids Realtors from breaking any rule of the FAA and such action could land a Realtor on the Missouri Real Estate Commission Disciplinary Action’s page. Realtors may risk license suspension and/or fines by the Real Estate Commission for such activity. Realtor’s are also putting their Broker at risk legally. It’s just not worth risking your career. The FAA even uses an anonymous hotline for anyone who wants to report you. Even I get calls, but I am a Commercial UAS Pilot and my FAA License covers it. Always use a “Licensed Commercial Drone (UAS) Pilot, who has been approved and licensed by the FAA to perform the commercial activity. Questions? Contact Victor Today.
Caution when hiring a photographer – Many drone pilots have an FAA Registration like the white image to the right but that is not the same as the license shown below in blue. Registering a drone is actually a requirement that everyone including hobbyists must complete and is only a means for the FAA to determine ownership in case of a mishap or a drone is found involved in a crash. If the pilot does not carry “on their person” a current license, then they may not work for you. It is 100% illegal.
An actual license looks like this and the Drone Pilot in Command (yes…that is an actual FAA term) must be present and carrying it on their person or you as a Realtor may find yourself in hot water.
In a notice interpreting the special rule governing model aircraft, the FAA explicitly stated that “a Realtor using a model aircraft to photograph a property that he/she is trying to sell and using the photos in the property’s real estate listing is not engaged in a hobby or recreation…..Realtors and other commercial drone operators are subject to all existing FAA regulations, as well as future rule-making action,” the FAA said.
Did you know?
Click to enlarge
The FAA has provided you a live interactive Map at http://knowbeforeyoufly.org/air-space-map/ that will tell you where you can and cannot fly as a Drone Hobbyist. The areas in Solid Orange and Orange Stripes are restricted or controlled airspace. Did you know that basically all of Springfield Missouri is off limits? The solid Orange circles are 10 miles wide with an airport in the middle and your drone may not legally leave the ground inside any of these circles. The orange dashed areas are usually Hospital Emergency Heliports. You are required by the FAA to stay out of all these areas. Do people fly their drones there? Yes, a lot. Should you as a Realtor risk it? As a Realtor adhering to the Realtor’s Code Of Ethics, you already know the answer to that question…No!
Licensed UAS Pilots go through extensive and rigorous training to understand airport flight patterns, weather, emergency procedures, etc. and can also communicate with Air Traffic Control (ATC) for obtaining clearance to operate inside these controlled areas. Basically we are “pilots” who fly a plane or drone from a ground station. Even certified and licensed pilots of “manned” aircraft can not enter these airspaces without clearance. Why would it be different for drones? Plus many other areas are restricted and need clearance or in some cases an FAA Waiver to enter those Restricted Areas. As a UAS pilot, we can alert you if your property is within a restricted airspace requiring basic tower clearance or a FAA Waiver. We can then obtain these Waivers as well as gain the Air Traffic Control clearance where Hobbyist will be denied access.
Don’t Worry…Be Happy!
Victor Schultz is a FAA Licensed Commercial UAS Pilot and carries insurance on the flights with $1,000,000 in coverage.
We can operate in Uncontrolled airspace as well as gain the required clearance for controlled areas and if needed even gain authorization to operate in restricted airspace. If your listing is within 5 miles of an airport, you may not even raise your personal drone in the air 1 foot whereas we can legally.
What makes all this even better is that aerials are “included” on every tour!
The other guys charge a separate fee “just for the aerials” which can run a couple hundred dollars or even more. Why pay extra for that and not personally know your 3rd party Pilot and then worry if they are even licensed and/or insured. With us, you will know your pilot because he is also your main photographer.
Are there other licensed drone pilots out there? Of Course! Why choose me? I have personally photographed over 2.5 Billion dollars in Residential Real Estate since 2002 as a Florida Realtor/Tour Provider. Yes, I have the experience to capture your listing with jaw-dropping effect.
We even Photoshop images to green up the grass during the brown months and always fix overcast days with outstanding and vivid skies so you can get those photos into the MLS right away!
Normally, I am the first phone call you make as you walk out of a listing appointment. Having the photos, especially incredible photos, is vital from the first moment you enter your listing into the MLS. Do not add a generic photo and then change it out a week later after all the other Realtors see the listing. The greatest advantage is that first week. Contact Us immediately after you receive a listing agreement.
We include aerial photos and even video clips free of charge as part of our Complete Marketing Packages starting at just $159.00 a property. It is an incredible value and an easy decision.
Stop paying for Aerials and stop risking your License. We are The “Safe and Legal”, Professional and Skilled Solution to your photo and video Real Estate marketing needs!
|
WASHINGTON (AP) — The House voted Thursday to reauthorize a 25-year-old law that helps victims of domestic and sexual violence, despite complaints by Republicans that Democrats were politicizing the popular law by expanding gun control.
The bill to reauthorize the Violence Against Women Act includes a provision making it easier to take away guns from violent offenders even if they are not a spouse or domestic partner. The amendment closes the so-called “boyfriend loophole” by barring those convicted of abusing, assaulting or stalking a current or former dating partner from owning a firearm.
Supporters said the measure was crucial to protect women in the United States, who die from gun violence at rates far higher than other high-income countries. But the National Rifle Association and some Republicans called the measure a political trap intended to portray gun-rights supporters as anti-women.
The House approved the bill, 263-158, sending it to the Senate.
Louisiana Rep. Steve Scalise, the second-ranking House Republican, accused Speaker Nancy Pelosi of intentionally allowing the domestic violence law to expire in February despite bipartisan support for extending it.
“Nancy Pelosi forced it to expire so she could use women as part of some political leverage,” Scalise said at a news conference Thursday. He accused Pelosi, D-Calif., of trying to “use different groups of people as pawns in her political game.”
Pelosi said the gun-control provisions were “common-sense reforms that will save lives and that no one should object to.”
Noting past Republican support for the law, Pelosi said, “There should be nothing partisan or political about ending the scourge of domestic violence and sexual assault, which one in three women faces today.”
ASSOCIATED PRESS Speaker of the House Nancy Pelosi, D-Calif., joined at left by House Judiciary Committee Chairman Jerrold Nadler, D-N.Y., speaks about plans to reauthorize the VAWA at the Capitol in Washington, Thursday, March 7, 2019.
A spokeswoman for the NRA said the group “opposes domestic violence and all violent crime” and spends millions of dollars every year teaching Americans how to safely use firearms for self-defense.
“The gun control lobby and anti-gun politicians are intentionally politicizing the Violence Against Women Act as a smoke screen to push their gun control agenda,” said NRA spokeswoman Jennifer Baker, who called the actions of Democratic leaders “appalling.”
The NRA feels so strongly about the gun-control provision that it is evaluating the domestic violence law as a “key vote” that will help determine whether it will back a member a Congress for re-election.
Robin Lloyd, managing director of a gun-control group founded by former Rep. Gabby Giffords, said up to half of all domestic violence victims are abused by a dating partner, rather than a spouse or live-in boyfriend.
Lloyd called the gun-control amendment “truly a life-saving provision,” adding that gaps in federal law allowing abusers and stalkers to obtain guns are “a key driver of the staggering levels of lethal violence against women in the U.S.” An estimated 4.5 million women have been threatened with a gun by an intimate partner, and nearly 1 million women alive today have been shot, or shot at, by an intimate partner, Lloyd said.
Under current federal law, those convicted of domestic abuse can lose their guns if they are currently or formerly married to their victim, live with the victim, have a child together or are a victim’s parent or guardian. The proposed amendment would extend the provision to stalkers and current or former dating partners.
If lawmakers are trying to save lives, “Why would you not close a simple loophole that says if someone has been convicted of domestic violence or stalking that they not have access to a gun?” asked Rep. Debbie Dingell, D-Mich.
Dingell, who recalls hiding in a closet from her gun-wielding, mentally ill father, said she knows what it’s like to live in a home where someone “can snap at a minute’s notice and suddenly the gun is pointed at your mother or pointed at you.”
She disputed claims that the amendment was intended to embarrass or “trap” gun-rights supporters or portray them as anti-women. “Sometimes things are as simple as this: I know that fear. I know that terror, and I just want to save another family from going though that terror,” she said.
Democrats defeated a proposal by Rep. Elise Stefanik, R-N.Y., to extend the current law for a year.
“Ending violence against women should not be partisan, but unfortunately House Democrats have politicized it,” Stefanik said as House Republicans cheered. “Scoring political points” should not be prioritized over saving the lives of women and children, she said.
|
/*
1-1000 // framework
1001-1200 // login server
1201-1300 // center server
1301-1400 // hall server
3000-10000 // game server
10000-20000 //client <-> server
//packet:{
// "head":{
// "mcmd":1,
// "scmd:":1,
// "remoteAddress":"127.0.0.1",
// "seqNo":0
// },
// "body": {
// //as your wish
// }
//}
center server
//
// serverInfo:{
// name
// type
// ip
// port
// activeTime
// serverNo
// ext
// }
*/
module.exports = {
HEART_BEAT:1,
LOGIN:1001,
SUB_LOGIN_ACCOUNT:1, //帐号登录
SUB_LOGIN_PHONE:2, //手机登录
SUB_LOGIN_VISITOR:3, //游客登录
CENTER:1201,
SUB_CENTER_UPDATE:1, //向中央服务器上报状态
SUB_CENTER_GET:2, //从中央服务器获取对应的服务列表
SUB_CENTER_PLAYER_OL, //玩家登陆,玩家退出游戏也是这个状态
SUB_CENTER_PLAYER_PL, //玩家游戏中
HALL:1301,
SUB_HALL_GAME_LIST:1, //游戏列表
SUB_GAME_SERVER_LIST:2, //游戏服务列表
GAME:1401,
SUB_GAME_CREATE_ROOM:1, //创建房间
SUB_GAME_ENTER_ROOM:2, //进入房间
SUB_GAME_LEAVE_ROOM:3, //退出房间
SUB_GAME_DISMISS_ROOM:4, //解散房间
SUB_GAME_DESK_SIT_DOWN:5, //坐下
SUB_GAME_DESK_READY:6, //准备
SUB_GAME_DESK_STAND_UP:7, //起立
SUB_GAME_DESK_OPE_CARD:8, //操作牌
SUB_GAME_DESK_WIN:9, //胡牌
SUB_GAME_REENTER_ROOM:10, //断线重进房间
SUB_GAME_QUERY_PLAYER_INFO:11, //查询玩家游戏状态
SUB_GAME_DESK_WATCH:12, //观战
SUB_GAME_KICK_PLAYER:1, //房主踢人
EVENT_OUT_CARD:1,
EVENT_PASS_CARD:2,
};
|
Unless otherwise indicated herein, the approaches described in this section are not prior art to the claims in this application and are not admitted to be prior art by inclusion in this section.
Embodiments relate to computer user interfaces, and in particular, to user interfaces providing decision support in complex problem environments. Specifically, an individual working to solve a business problem may often seek to perform tasks such as investigating extended cause-and-effect relationships, gathering context-related information, and/or comparing and validating possible solution paths.
For example in an in-house production scenario, a material planner (MRP Controller Role) may face complex problems affecting different finished end products, intermediates, and/or starting materials. To address shortages, the ERP planner may seek to explore different possible opportunities available both within and outside of a particular business entity. Examples of such options can include but are not limited to, rescheduling of production orders, creating new supplies, and collaborating with a purchaser.
Conventionally, the material planner may be forced to manually validate and compare the various problem solution options in terms of feasibility and possible consequences (e.g. follow-up problems on the component level or capacity issues). This process of evaluating options can be roughly compared with a chess game, where the player considers a next move and tries to calculate (simulate) its consequences mentally.
In attempting to manually perform this evaluation, the material planner may lack an overview of the context of the problem, and also the cause-and-effect relationships of the possible options. Typically, the material planner may be forced to gather the related information by hand, navigating step-by-step through several levels of details involving the creation of off-line notes and extra communication that may not be recorded or reproducible.
A lack of transparency/reproducibility during such critical decision making processes, may leads to inefficiency/time loss, mental stress, and degradation of overall productivity. Also, the lack of an established procedure may lead to potentially suboptimal or even incorrect decisions being made.
|
A composite video signal generally contains programming information and at least two other components: (1) luminance information (grayscale information generally sufficient to make a black and white image in substantially fall detail); and (2) chrominance information (coloration information). The luminance and chrominance information may partially share the same range of frequencies. Various electronic devices such as televisions and video cassette recorders generally contain a filter or other architecture for separating the luminance and chrominance information. In analog electronic devices, separation of luminance and chrominance information may be achieved using, in ascending order of typical desirability, a one-dimensional (“horizontal”) comb filter, a two-dimensional (“vertical”) comb filter, or a three-dimensional (“temporal”) comb filter.
Two-dimensional comb filters may enable substantial elimination of hanging dots by adaptively switching between horizontal and vertical comb filters based upon the content of a scene, for example. Three-dimensional comb filters may enable temporal comb filtering involving successive frames. Three-dimensional comb filters may, in some cases, achieve essentially perfect separation of luminance and chrominance information, eliminating substantially all dot crawl and rainbow swirls for stationary subject matter and may perform at least as well as two-dimensional comb filters for the rest of the image. Thus, it may be desirable to maximize use of a three-dimensional comb filter. In general, however, three-dimensional comb filters may achieve the best results when used for still frames or for those portions of consecutive frames not affected by motion or change of scene because there may be some loss of quality, such as dot crawl or hanging dots, as the subject moves from one frame to the next. If there is subject motion, comb filter logic, such as a motion detector, may sense the existence of motion and switch from use of a three-dimensional comb filter to use of the less-desirable two-dimensional comb filter.
|
Alarmed that the gun used in a mass shooting in Gilroy was bought legally in Nevada, two dozen California legislators on Wednesday asked their counterparts in the neighboring state to meet this fall to discuss strengthening restrictions on firearms.
The unusual proposal was made in a letter to Nevada Assembly Speaker Jason Frierson, who is a Democrat, and the Democrat-controlled Legislature just weeks after a 19-year-old resident of that state opened fire at the Gilroy Garlic Festival in Northern California, killing three people and wounding 13.
“While California has enacted numerous gun safety measures, this tragedy underscores the need for California to work closely with neighboring states to close loopholes and advance common-sense gun safety measures,” said the letter signed by 27 Democratic legislators, including Assembly members Jesse Gabriel of Encino, Reggie Jones-Sawyer of Los Angeles and Buffy Wicks of Oakland.
Gunman Santino William Legan bought the semiautomatic rifle legally in Nevada less than three weeks before the July 28 attack. The weapon, which authorities describe as a military-style AK-47, cannot be legally purchased in California or imported into the state, California Atty. Gen. Xavier Becerra said.
California also bans the sale or possession of ammunition magazines capable of holding more than 10 rounds, but authorities said Legan, who the coroner says killed himself during a gun battle with police, had a 75-round drum magazine and five 40-round magazines.
Gabriel said there are two California laws he would like to see adopted in Nevada that would have blocked the Gilroy shooter — a ban on assault weapons and a prohibition on selling guns to anyone younger than 21.
“This shooting in Gilroy was a reminder that lax gun laws in other states impact our safety here in California,” Gabriel said.
The federal Bureau of Alcohol, Tobacco, Firearms and Explosives traced 1,554 guns recovered in California in 2017 to original purchases in Nevada, with many of them found at crime scenes, confiscated from criminals or found unclaimed.
Nevada’s Frierson said Wednesday that he is open to talking to his counterparts in California.
“I welcome collaboration on gun safety issues with colleagues from other states,” he said. He cited “great strides” made by Nevada this year in adopting legislation.
“Sadly, gun violence is an epidemic across the country, and I believe the best way to ensure we are fully addressing this as a country is by addressing it holistically at the local, state and federal level,” he said.
Republican Nevada Assemblyman Tom Roberts of Las Vegas said he is also willing to talk to California lawmakers about gun issues, but he wants to make sure it is not a limited discussion.
“I just hope that the discussion includes stakeholders on both sides of the issue and includes legislators from both parties,” Roberts said. “In addition, I would hope that the discussion would include other measures that focus on the entirety of the problem and not just guns.”
The letter from California lawmakers supports Nevada’s recent passage of gun control legislation, including Senate Bill 143, which mandates background checks for private-party gun sales. The measure was signed into law in February by Gov. Steve Sisolak, a Democrat.
“However, we believe that much more can be done to prevent gun violence and ensure the safety of both Nevada and California residents,” the letter from California lawmakers said.
Sisolak said in a statement Tuesday that he has supported other measures, including a “red flag” law that removes guns from people deemed to pose a public threat, and he has said he would like to see additional gun safety measures in Nevada.
“I’m proud that we passed common-sense reforms that keep guns out of the hands of those who wish to do harm,” he said. “I will continue working with law enforcement, elected and community leaders, and subject-matter experts to explore different ways we can keep Nevadans safe.”
On Tuesday, Sisolak and California Gov. Gavin Newsom attended a conservation meeting at Lake Tahoe with leaders from California and Nevada. Newsom said just after the Gilroy shooting that he wanted to talk to Sisolak about gun issues, but they had not connected. His office did not respond to a request for comment on whether the two governors have since talked about gun issues, including at Tuesday’s event.
The California legislators wrote that cooperation between states is needed “especially as congressional Republicans continue to block common-sense gun safety legislation.”
California has worked out cooperative agreements with other states in the past on other issues. Former Gov. Jerry Brown signed agreements to align California’s clean energy policies with those of Oregon, Washington and British Columbia. The pacts set nonbinding goals.
The idea of a two-state summit has the backing of California Assembly Speaker Anthony Rendon (D-Lakewood), and the authors of the letter said they hope other states also improve cooperation on gun control.
“This summit would be an excellent opportunity to demonstrate groundbreaking, state-level coordination that could serve as a model for other states across the United States,” the legislators said.
|
The Pac-12 has decided not to move forward with any 9 a.m. PT kickoffs this season, but is open to revisiting the idea in the future, a conference spokesman confirmed Wednesday.
Andrew Walker, the Pac-12's vice president for public affairs, said schools needed more time to plan for any potential earlier kickoff slot.
"Our interested schools need more lead time for discussions with all relevant stakeholders," Walker said. "There is interest from Fox and there is interest from some of our schools, but need more time to plan properly."
At Pac-12 media day last month, commissioner Larry Scott said the conference had held preliminary discussions about the potential for playing a couple of league games in that time slot as early as this season. Scott cited fan frustration with late-night kickoffs and the exposure for the Pac-12 in new markets as reasons to consider the change.
Several coaches, including UCLA's Chip Kelly, Utah's Kyle Whittingham and Cal's Justin Wilcox, all expressed an interest in playing an early game when the idea was raised last month.
Multiple schools expressed interest in continuing to explore the concept for 2020, according to Walker.
|
And the rookie back-up surgeon had to step in to perform this very risky open heart surgery. Amazingly, the rookie surgeon performed the surgery without a single misstep, not only saving her patient’s life but drastically improving his quality of life. She was promoted to chief surgeon, the youngest in the history of the hospital. Meanwhile, Dr. Tonin lost everything. He climbed into a bottle of vodka and never left. Now the only surgery he performs is on frozen pizzas he gets at the gas station.
But the truth of the matter is that Gabby lives this way because she’s the key witness in a grizzly serial murder investigation & was placed into witness protection. She tries to make friends, but it’s difficult because she can’t tell anyone who she *really* is or what she knows. This is killing her, as her mind is heavily burdened by what she’s seen, the pain she’s witnessed. So she keeps her life simple, because she fears any deviation from routine would send her tumbling into insanity.
He believed personalities could be changed with suggestions most minimal.
He hypnotized patients of varying ages
He’d implant ideas with secret phrases,
But he didn’t know how powerful his suggestions were, and several of his patients began ferociously scribbling numerical codes and constantly muttering the same phrase in Aramaic. The numbers were the exact coordinates for the lost temple of Skraal-Kalkhor, and the Aramaic phrase woke up Gruül, an ancient demigod whose thirst for blood & destruction cannot, and will not, be slaked. All hail Gruül, the Death-Bringer.
Until one day he contracted salmonella from eating an undercooked muffin and it’s raw contents. He spent hours – days, even – by a toilet, expelling every ounce of fluid he had into the porcelain palace, until there was nothing left. He continued to dry heave for a solid week until, finally, his abdominal muscles tore in half from the strain. He’s in a wheelchair now. He can no longer eat solid foods, especially muffins.
Rufus Johnson loved his ice cream.
He’d eat it for every meal, and every snack in between.
One day, he woke from a sleep so sound,
To find he’d ballooned to 500 pounds.
This realization was short-lived, however, when the shock of his weight caused him to have a MASSIVE heart attack. Doctors tried to save him, but the defibrillators couldn’t make it through all the fat, and by the time they were able to cut through the fat down to his heart, he’d been dead for 2 hours.
Johnny Kilutis was kind of a dork,
So he bought a sports car with lots of torque.
He’d always floor it – the tires would burn,
But he found he could not handle the turns,
And his car flipped at 107 MPH & rolled over 27 times into a tree. Fortunately, Johnny was wearing his seat belt, and he walked away relatively unscathed. Unfortunately, he had an aneurism two days later, which killed him instantly.
|
Description of clinical outcomes and postoperative utilization of physical therapy services within 4 categories of shoulder surgery.
Retrospective cohort study. To describe the clinical outcomes following outpatient physical therapy for postoperative rehabilitation in 4 categories of shoulder surgery. Furthermore, we sought to determine if differences in outcomes between genders existed. Improving the quality of care for patients following shoulder surgery requires an understanding of the clinical outcomes resulting from current clinical practice. This study included 856 patients (43.7% female; mean +/- SD age, 51.8 +/- 14.2 years) who received outpatient physical therapy following shoulder surgery. Standardized methods for classification of patients to type of shoulder surgery and collection of outcome variables were used. Data were gathered from 57 therapists working in 12 clinics. Patients included had been classified into 1 of 4 surgical categories: repair of a unidirectional instability, rotator cuff repair, rotator cuff repair with a subacromial decompression, or subacromial decompression alone. Descriptive statistics were calculated for baseline characteristics of patients in each surgical category. For all patients, scores on the Disability of the Arm Shoulder and Hand (DASH) questionnaire and a numeric pain rating scale (NPRS) were obtained at the initial and final physical therapy visits, and the change between visits was calculated. Data on number of physical therapy sessions and length of stay (LOS) were collected. For each surgical category, independent-samples t tests were used to determine differences between genders for each initial and final clinical outcome of pain and disability, change scores, utilization of visits, and LOS. The percentage of patients who achieved a minimal clinically important difference (MCID) on the DASH was also determined for each surgical group. For each gender in each surgical category, paired t tests were used to determine if patients achieved significant change in pain and disability. Means for each clinical outcome for the initial and final pain and disability scores, change scores, and the percentage of patients that achieved an MCID are provided. Significant differences were observed between genders for clinical outcomes. In the group treated with unilateral instability repair, women reported significantly greater initial disability than men, and their DASH change scores were significantly greater. In the group that had rotator cuff repairs, women reported significantly greater disability initially and at the final follow-up. In the group that had rotator cuff repairs combined with subacrominal decompression, women reported significantly greater disability initially and greater change in DASH scores. Females also reported greater change in their pain scores than males (P<.05). There were no significant differences between men and women in the subacromial decompression group (P<.05). There were no significant differences between genders for number of physical therapy visits or LOS. Men and women in each surgical category achieved clinically meaningful and statistically significant improvement for pain and disability during treatments (P<.01). Greater than 75% of patients achieved an MCID (15 points) on the DASH score in each surgical category (range, 75.6%-94.5%). Differences were observed between men and women in 4 postoperative surgical categories in each of the clinical outcomes but not for number of physical therapy visits or LOS. Statistically significant and clinically meaningful pain and disability improvements were reported for each gender within each shoulder category. Results from this study may help therapists estimate the prognosis of males and females receiving nonstandardized postoperative physical therapy in 4 different shoulder surgical categories. Therapy, level 2b.
|
[**Singly differential cross sections with exchange for Ps-fragmentation** ]{}\
0.5cm [**Hasi Ray**]{}\
S-407, Flat No. 6, B. P. Township, Kolkata 700094, India
Email: hasi\[email protected]
1.0cm
[**Abstract**]{}: Ps ionization in Ps-atom scattering is of fundamental importance. The singly differential cross sections (SDCS) provides more accurate information to test a theory than integrated or total ionization cross section since the averaging over one parameter is not required. We evaluate the SDCS for Ps-ionization with respect to the longitudinal energy distribution of the break-up positron and electron in Ps-H and Ps-He scattering and compare them with the recently available experimental and theoretical data. 0.5cm [**PACS No.**]{} 36.10.Dr, 34.70.+e, 82.30.Gg\
[**Keywords:**]{} Positronium (Ps), ionization, differential cross section, Coulomb-Born-Oppenheimer approximation, static Coulomb interaction. 0.5cm
Positronium (Ps) is the lightest hydrogen-like exotic atom. It is itself its anti-atom. The charge and mass centers of it coincide. The interesting property is that the mean static Coulomb interaction vanishes when Ps interacts with an atom / molecule. Its polarizability is eight times higher than that of H. Two kinds of it are known as para-Ps and ortho-Ps depending on spin states of positron, $e^+$ and electron, $e^-$. The fragmentation of positronium (Ps) is a process which helps to understand the mechanism of Ps and atom/molecule scattering \[1-13\]. Recently, the experimental group at University College of London (UCL) lead by G. Laricchia has measured \[4-6\] the singly-differential Ps-ionization cross sections with respect to the longitudinal energy distribution of the break-up positron in Ps and He collision which motivated the present study. The number of papers which deal Ps-fragmentation is extremely limited \[2-20\]. Only a very few experimental data \[4-6\] on Ps-ionization in Ps-He scattering is available in the literature. The fragmentation or ionization or break-up of Ps starts only at 6.8 eV.\
We study collision of Ps with atom. The kind of calculation is a bit difficult and challenging due to presence of many charge centers. In such a system of a Ps and an atom, the exchange between the Ps-electron and the atomic-electron is highly important and sensitive at lower incident energies, and it is an effect of fundamental interest. We calculate the singly (energy) differential cross sections for Ps-ionization in Ps-H and Ps-He scattering using the Coulomb-Born-Oppenheimer approximation (CBOA) and the Coulomb-Born approximation (CBA); both the theories were introduced by Ray \[2,3,15-19\] to calculate the integrated cross sections. The differential cross section is more informative than integrated cross section since it relaxes the averaging over a coordinate system e.g. angular or energy distribution. In the present case the averaging over energy distribution of the break-up positron and/or electron is relieved.\
The scattering amplitudes can be expressed in post and prior forms, both will provide the same results if the system wavefunctions are exact \[21\]. We use the post form of the scattering amplitude; in this expression $\langle \Psi_f\mid v_f\mid\Psi_i^+\rangle$ (following conventional notation), the incident channel wave function is treated as a plane wave as in first Born approximation (FBA). Since the projectile is a neutral system, the present plane wave approximation for the incident Ps may not introduce an error. In addition the first order effect due to polarizability is absent in such system. So it is nearly accurate which is evident from the comparison of FBA and the close coupling approximation (CCA) results of our earlier calculation \[22,23\]. Only at very low energies, the FBA and CCA elastic cross sections differ in Ps-H \[22\] and Ps-Li \[23\] systems. The break-up electron is treated as a Coulomb wave. As the incident Ps is a composite system of a positron and an electron, we treat the moving Ps as having a center of mass (c.m.) motion with momenta $\bf k_i$ and $\bf k_f$ in the initial and final channels respectively, and a relative motion of electron with respect to positron; the c.m. motion is represented by a plane wave.\
A few words regarding the target He wave function is useful. The accuracy of the present calculation again depends on the accuracy of the ground state He atomic wavefunction. We used the first kind of wavefunction prescribed by Winter \[24\]. This wave function is not correlated. A correlated wave function for the target atomic He would be more useful for better accuracy, but it complicates our calculation further. It should be a good task to use a correlated wave function to tackle the present problem.\
The singly energy differential cross section (SDCS) for the break-up of Ps in Ps and atom scattering is defined \[10\] as $$\frac{d\sigma}{dE} = \int d\hat{\bf k}_p \int d\hat{\bf k}_e
\frac{d^3\sigma}{d\hat{\bf k_p}d\hat{\bf k}_e dE} \eqno(1)$$\
where ${\bf k}_p$, ${\bf k}_e$ are the momenta of the break-up positron and electron respectively and E is the sum of the kinetic energies of break-up positron and electron after ionization.\
In inelastic collisions, only the energy conservation is true. If $v_p$, $v_e$ represent respectively the speeds (i.e. magnitudes of the velocities) of break-up positron and electron from Ps, $\epsilon_{Ps}$ is the ionization potential of Ps, then the energy conservation relation $$E = E_i - \epsilon_{Ps} = \frac{1}{2}v_p^2 + \frac{1}{2}v_e^2 \eqno(2a)$$ $$= v_f^2 + \frac{1}{4} v^2 \eqno(2b)$$\
should be fulfilled if the incident energy is $E_i$; $v_f$ is the magnitude of the c.m. velocity of fragmented Ps and $v$ is the magnitude of relative velocity of the break-up electron with respect to the break-up positron in the final channel after ionization.\
The momentum transfer ${\bf Q}$ is defined as ${\bf Q} = {\bf k}_i -{\bf k}_f$, so that $$Q^2 = k_i^2 + k_f^2 - 2k_ik_fcos{\theta} \eqno(3)$$ if $\theta$ is the scattering angle and ${\bf k}_i$, ${\bf k}_f$ are initial and final momenta. According to our definition, the SDCS is defined as
$$\frac{d\sigma}{dE_{\bf k}} = \int d\hat{\bf k}_f \int d\hat{\bf k}
\frac{d^3\sigma}{d\hat{\bf k_f}d\hat{\bf k} dE_{\bf k}} \eqno(4a)$$ as $$TDCS = \frac{d^3\sigma}{d\hat{\bf k_f}d\hat{\bf k} dE_{\bf k}} \eqno(4b)$$ $$= \frac{k_f k}{k_i} \mid \{Amplitude\}_{Scattering} \mid ^2 \eqno(4c)$$ Again $${\bf k}_p = {\bf k}_f - \frac{1}{2}{\bf k} \eqno(5a)$$ $${\bf k}_e = {\bf k}_f + \frac{1}{2}{\bf k} \eqno(5b)$$\
which give $d{{\bf k}_p} = d{{\bf k}_f}$ if we make ${\bf k}$ unaltered and $d{{\bf k}_e} = \frac{1}{2} d{{\bf k}}$ if we make ${\bf k}_f$ unaltered. It is obvious that $ dE_{\bf k} = k dk$ and $\int dE_k = \int dE$.\
If the longitudinal energy of break-up positron is $E_{pl}$ and it makes an angle $\theta_p$ with ${\bf k_i}$, then $$E_p = \frac{1}{2}v_p^2 = \frac{E_{pl}}{cos^2{\theta_p}} \eqno(6a)$$
and $$v_e^2 = 2(E_i - \epsilon_{Ps} - \frac{E_{pl}}{cos^2{\theta_p}}) \eqno(6b)$$\
The magnitude of relative velocity (i.e. relative speed) of break-up electron with respect to break-up positron can be defined as, $$v = v_e - v_p \eqno(7a)$$ $$v^2 = v_p^2 + v_e^2 - 2v_pv_e = 4k^2 \eqno(7b)$$\
and $$v_f^2 = E_i - \epsilon_{Ps} - \frac{1}{4}v^2 = \frac{1}{4}k_f^2\eqno(7c)$$\
If the longitudinal energy of break-up electron is $E_{el}$ and it makes an angle $\theta_e$ with ${\bf k_i}$, then $$E_e = \frac{1}{2}v_e^2 = \frac{E_{el}}{cos^2{\theta_e}} \eqno(8a)$$\
and $$v_p^2 = 2(E_i - \epsilon_{Ps} - \frac{E_{el}}{cos^2{\theta_e}})\eqno(8b)$$\
So the singly differential cross sections with respect to the longitudinal energies of the break-up positron and the break-up electron should be defined as $$\frac{d\sigma}{dE_{pl}} = \frac{1}{2} \int d\hat{\bf k}_f \int d\hat{\bf k} (\frac{ TDCS}{cos^2\theta_p}) \eqno(9)$$ $$\frac{d\sigma}{dE_{el}} = \frac{1}{2} \int d\hat{\bf k}_f \int d\hat{\bf k}
(\frac{ TDCS}{cos^2\theta_e}) \eqno(10)$$\
The triply differential cross sections (TDCS) for the break-up of Ps in Ps-H and Ps-He scatterings are defined as $$\frac{d^3\sigma}{d\hat{\bf k_f}d\hat{\bf k}dE_{\bf k}} = \frac{k_f k}{k_i}\{\frac{1}{4}\mid F_k + G_k \mid^2 + \frac{3}{4}\mid F_k - G_k \mid^2 \} \eqno(11a)$$ $$\frac{d^3\sigma}{d\hat{\bf k_f}d\hat{\bf k}dE_{\bf k}} = \frac{k_f k}{k_i}\mid F_{\bf k}^{He} - G_{\bf k}^{He} \mid^2 \eqno(11b)$$\
where $F_k$, $G_k$ represent respectively the direct and exchange matrix elements for Ps-H scattering; $F_{\bf k}^{He}$, $G_{\bf k}^{He}$ represent respectively the direct and exchange matrix elements for Ps-He scattering. These are defined as
$$F_{\bf k}^{He}(\hat{\bf k}_f) = -\frac{1}{\pi}\int e^{-i{\bf k_f.R_1}}\eta_{\bf k}^*(\mbox{\boldmath$\rho$}_1)\Phi_f^*\{{\bf r_2, r_3}\}[V_{He}^F]e^{i{\bf k_i.R_1}}\eta_{1s}(\mbox{\boldmath$\rho$}_1)\Phi_i\{{\bf r_2, r_3}\}d{\bf x}d{\bf r_1}d{\bf r_2}d{\bf r_3} \eqno(12a)$$ $$G_{\bf k}^{He}(\hat{\bf k}_f) = -\frac{1}{\pi}\int e^{-i{\bf k_f.R_2}}\eta_{\bf k}^*(\mbox{\boldmath$\rho$}_2)\Phi_f^*\{{\bf r_1, r_3}\}[V_{He}^G]e^{i{\bf k_i.R_1}}\eta_{1s}(\mbox{\boldmath$\rho$}_1)\Phi_i\{{\bf r_2, r_3}\}d{\bf x}d{\bf r_1}d{\bf r_2}d{\bf r_3} \eqno(12b)$$ with $$V_{He}^F = \frac{Z}{\mid{\bf x}\mid}-\frac{Z}{\mid{\bf r_1}\mid}-\frac{1}{\mid{{\bf x}-{\bf r_2}}\mid}+\frac{1}{\mid{{\bf r_1}-{\bf r_2}}\mid}-\frac{1}{\mid{{\bf x}-{\bf r_3}}\mid}+\frac{1}{\mid{{\bf r_1}-{\bf r_3}}\mid} \eqno(13a)$$ and $$V_{He}^G = \frac{Z}{\mid{\bf x}\mid}-\frac{Z}{\mid{\bf r_2}\mid}-\frac{1}{\mid{{\bf x}-{\bf r_1}}\mid}+\frac{1}{\mid{{\bf r_2}-{\bf r_1}}\mid}-\frac{1}{\mid{{\bf x}-{\bf r_3}}\mid}+\frac{1}{\mid{{\bf r_2}-{\bf r_3}}\mid} \eqno(13b)$$\
with ${\bf R}_j = \frac{1}{2}({\bf x}+{\bf r}_j)$ and $\mbox{\boldmath$\rho$}_j = ({\bf x} - {\bf r}_j)$; j=1,2. Here, ${\bf x}$ is the coordinate of positron in Ps, and ${\bf r}_j$; j = 1 to 3 are those of electrons in Ps and He respectively in the incident channel with respect to the center of mass of the system. Functions $\eta$ and $\Phi$ indicate the wave functions of Ps and He respectively. Subscript ‘$i$‘ identifies the incident channel, whereas ‘$f$‘ represents the final channel. Accordingly ${\bf k}_i$ and ${\bf k}_f$ are the momenta of the projectile in the initial and final channels respectively. Z is the nuclear charge of the target helium atom. The target atomic wave functions are considered at ground states in both the incident and final channels. If we remove the third electron from the Ps-He system which is represented by the position coordinate ${\bf r}_3$, the expressions (12a), (12b), (13a), (13b) should fit to Ps-H system. The continuum Coulomb wave function $\eta_{\bf k}$ is chosen from Ref.\[3\] which is orthogonal to the ground state Ps wave function.\
In figures 1-5, we report the present SDCS results for Ps-H scattering with respect to the longitudinal energy distribution of the break-up positron and electron at the incident energies of Ps e.g. 13 eV, 18 eV, 25 eV, 33 eV, 60 eV. For the Ps-H system, there is no experimental data and no reported theoretical data. The figures 6-11 display the present SDCS results for Ps-He system with respect to the longitudinal energy distribution of break-up positron and electron respectively with the recently available corresponding experimental \[5,6\] and theoretical \[10,11,24\] data at different incident energies. It is to be noted that the area under the SDCS curves for $e^+$ and $e^-$ are equal. So we can get the same values of total cross section $\sigma$ using both the SDCSs and it indicates that we formulate the SDCSs correctly.\
The present singly differential cross sections for Ps-He system at different incident Ps energies with respect to the longitudinal energy distribution of break-up positron are compared with the available experimental and the impulse approximation (IA) data. No experimental data are available for the singly differential cross section with respect to the longitudinal energy distribution of break-up electron for Ps-He system; these are compared only with the recently available IA data of Walters et al. \[10,11\]. However, at the incident enegy of 60 eV, we have only the experimental data for $e^+$-distribution and no other theoretical data for both $e^+$ and $e^-$ distributions; the present results are compared with experimental data and displayed in figure 10. In figure 11, we presented the data at the incident energy = 100 eV; we compare our results with the theoretical data of Starrett et al \[20\]. There are no experimental data at 100 eV.\
From the the comparison of our SDCS data using CBA and CBOA theories for the longitudinal energy distributions of the break-up positron and the break-up electron, one can get a very good idea about the effect of exchange on ionization of Ps in Ps and atom scattering. The exchange effects are stronger at lower incident energies and at the lower energies of the break-up positron and electron. The agreement of the present CBOA data for Ps-He system with the experiment is improving gradually with the increase of the incident energy of the incoming Ps from 13 eV to 60 eV and with the increase of the longitudinal energies of the break-up positron from very close to zero to $E = E_i - \epsilon_{Ps}$. Both the findings are consistent with the existing physics. Our CBA data seem to be more closer to the IA data than our CBOA data.\
In conclusion we have successfully evaluated the SDCSs for Ps-ionization in Ps-H and Ps-He scattering at different incident Ps beam energies using the CBOA and CBA theories for both the positron and electron energy distributions to compare them with the existing experimental \[5,6\] and the theoretical \[20\] data. Our theoretical data are showing better agreement with the experimental data at higher incident energies of the projectile and higher longitudinal energies of the break-up positron and are consistent with the existing physics. The use of a correlated wavefunction for the target helium atom and the coupling effect among various channels are expected to improve the results at lower energies; however that will complicate the calculation.\
Author is thankful to C. S. Unnikrishnan for providing the scope to visit his laboratory at TIFR, Mumbai for three weeks in August 2008 and the facilities to revise the manuscript.\
[**REFERENCES:**]{}
\[1\] H.S.W.Massey and C.B.O.Mohr, Proc. Phys. Soc. [**67**]{} 695 (1954).
\[2\] H.Ray, Euro. Phys. Lett. [**73**]{} 21 (2006).
\[3\] H.Ray, PRAMANA [**66**]{} 415 (2006).
\[4\] S.Armitage, D.E.Leslie, A.J.Garner and G. Laricchia, Phys. Rev. Lett [**89**]{} 173402 (2002).
\[5\] S. Amritage, D. E. Leslie, J. Beale, G. Laricchia, NIMB, [**247**]{} 98 (2006).
\[6\] G. Laricchia at UCL, London (2005-2006) private communication.
\[7\] C.P.Campbell, M.T.McAlinden, F.G.R.S.MacDonald and H.R.J.Walters, Phys. Rev. Lett. [**80**]{} 5097 (1998).
\[8\] J.E.Blackwood, M.T.McAlinden and H.R.J.Walters, Phys. Rev. A [**65**]{}, 032517 (2002).
\[9\] J. E. Blackwood, C.P.Campbell, M.T.McAlinden and H.R.J.Walters, Phys. Rev. A [**60**]{} 4454 (1999).
\[10\] C. Starrett, Mary T. McAlinden and H. R. J. Walters, Phys. Rev. A. [**72**]{} 012508 (2005).
\[11\] H.R.J.Walters, C.Starrett and M.T.McAlinden, NIMB, [**247**]{} 111 (2006).
\[12\] L. Sarkadi, Phys. Rev. A [**68**]{} 032706 (2003).
\[13\] P. K. Biswas and Sadhan K. Adhikari, Phys. Rev. A [**59**]{} 363 (1999).
\[14\] M.T.McAlinden, F.G.R.S.MacDonald and H.R.J.Walters, Can. J. Phys. [**74**]{} 434 (1996).
\[15\] H.Ray, PRAMANA [**63**]{} 1063 (2004).
\[16\] H.Ray, J.Phys.B [**35**]{} 3365 (2002).
\[17\] H.Ray, NIMB [**192**]{} 191 (2002).
\[18\] H.Ray, Phys. Lett. A [**299**]{} 65 (2002).
\[19\] H.Ray, Phys. Lett.A [**252**]{} 316 (1999).
\[20\] C. Starrett and H.R.J.Walters, J. Elec. Spec. [**161**]{} 194 (2007).
\[21\] D.P.Dewangan and J.Eichler, Phys. Rep. [**247**]{} 59 (1994).
\[22\] H.Ray and A.S.Ghosh, J. Phys. B. [**31**]{} 4427 (1998).
\[23\] H. Ray, J. Phys. B [**33**]{} 4285 (2000).
\[24\] T. G. Winter and C. C. Lin, Phys. Rev. A [**12**]{} 434 (1975).\
\
[**Figure 1:**]{} Singly differential Ps-ionization cross sections in Ps-H scattering with respect to the longitudinal energies of the break-up positron: (a) the solid curve using CBOA, (b) the dashed and dotted curve using CBA. Similarly SDCS distributions for the break-up electron: (c) the dotted curve using CBOA, (d) the dashed and small dashed curve using CBA, at the incident energy 13 eV.\
[**Figure 2:**]{} Singly differential Ps-ionization cross sections in Ps-H scattering with respect to the longitudinal energies of the break-up positron: (a) the solid curve using CBOA, (b) the dashed and dotted curve using CBA. Similarly SDCS distributions for the break-up electron: (c) the dotted curve using CBOA, (d) the dashed and small dashed curve using CBA, at the incident energy 18 eV.\
[**Figure 3:**]{} Singly differential Ps-ionization cross sections in Ps-H scattering with respect to the longitudinal energies of the break-up positron: (a) the solid curve using CBOA, (b) the dashed and dotted curve using CBA. Similarly SDCS distributions for the break-up electron: (c) the dotted curve using CBOA, (d) the dashed and small dashed curve using CBA, at the incident energy 25 eV.\
[**Figure 4:**]{} Singly differential Ps-ionization cross sections in Ps-H scattering with respect to the longitudinal energies of the break-up positron: (a) the solid curve using CBOA, (b) the dashed and dotted curve using CBA. Similarly SDCS distributions for the break-up electron: (c) the dotted curve using CBOA, (d) the dashed and small dashed curve using CBA, at the incident energy 33 eV.\
[**Figure 5:**]{} Singly differential Ps-ionization cross sections in Ps-H scattering with respect to the longitudinal energies of the break-up positron: (a) the solid curve using CBOA, (b) the dashed and dotted curve using CBA. Similarly SDCS distributions for the break-up electron: (c) the dotted curve using CBOA, (d) the dashed and small dashed curve using CBA, at the incident energy 60 eV.\
[**Figure 6:**]{} Singly differential Ps-ionization cross sections in Ps-He scattering with respect to the longitudinal energies of break-up positron and electron at the incident energy 13 eV. The solid curve is the present CBOA results for positron and the dotted one for electron. The long-dashed curve is the IA-results of Belfast group \[10\] for positron and short-dashed one are the same for electron. The solid squares are the experimental points \[6\] with error bars. The dashed dotted and dashed small dashed are the CBA data for positron and electron.\
[**Figure 7:**]{} Singly differential Ps-ionization cross sections in Ps-He scattering with respect to the longitudinal energies of break-up positron and electron at the incident energy 18 eV. The solid curve is the present CBOA results for positron and the dotted one for electron. The long-dashed curve is the IA-results of Belfast group \[10\] for positron and short-dashed one are the same for electron. The solid squares are the experimental points \[6\] with error bars. The dashed dotted and dashed small dashed are the CBA data for positron and electron.\
[**Figure 8:**]{} Singly differential Ps-ionization cross sections in Ps-He scattering with respect to the longitudinal energies of break-up positron and electron at the incident energy 25 eV. The solid curve is the present CBOA results for positron and the dotted one for electron. The long-dashed curve is the IA-results of Belfast group \[10\] for positron and short-dashed one are the same for electron. The solid squares are the experimental points \[6\] with error bars. The dashed dotted and dashed small dashed are the CBA data for positron and electron.\
[**Figure 9:**]{} Singly differential Ps-ionization cross sections in Ps-He scattering with respect to the longitudinal energies of break-up positron and electron at the incident energy 33 eV. The solid curve is the present CBOA results for positron and the dotted one for electron. The long-dashed curve is the IA-results of Belfast group \[10\] for positron and short-dashed one are the same for electron. The solid squares are the experimental points \[6\] with error bars. The dashed dotted and dashed small dashed are the CBA data for positron and electron.\
[**Figure 10:**]{} Singly differential Ps-ionization cross sections in Ps-He scattering with respect to the longitudinal energies of break-up positron and electron at the incident energy 60 eV. The solid curve is the present CBOA results for positron and the dotted one for electron. The solid squares are the experimental points \[6\] with error bars. The dashed dotted and dashed small dashed are the CBA data for positron and electron.\
[**Figure 11:**]{} Singly differential Ps-ionization cross sections in Ps-He scattering with respect to the longitudinal energies of break-up positron and electron at the incident energy 100 eV. The solid curve is the present CBOA results for positron and the dotted one for electron. The long-dashed curve is the IA-results of Belfast group \[20\] for positron and short-dashed one are the same for electron. The dashed dotted and dashed small dashed are the CBA data for positron and electron.\
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
{width="17.0cm" height="19.0cm"}
|
Monitoring the condition of the fetus during delivery.
Uterine contractions during delivery increase the resistance to flow in the blood vessels of the placenta and decreases placental blood circulation, possibly subjecting the fetus to hypoxia. Several methods have been developed for monitoring the condition of the fetus during delivery. Cardiotocography is used to monitor the fetus's heart rate and variability in relation to the mother's contractions. A change in cardiotocography recording due to stimulation of the presenting part is an indication of a healthy fetus. ST analysis of fetal ECG depicts the oxygenation of fetal cardiac muscle during delivery. In addition to cardiotocography and ST analysis, analysis of blood gases and lactate determination are used in assessing the condition of the fetus.
|
Universities in SF, KC make bet on World Series
Tools
The chancellors from both UC San Francisco and the University of Missouri-Kansas City have placed a friendly wager on the outcome of the World Series that starts tonight.
UCSF Chancellor Sam Hawgood and UMKC Chancellor Leo Morton put up their wagers Monday to foster friendly competition between San Francisco and Kansas City as the World Series begins between the Giants and Royals. Game 1 is scheduled for 5:07 p.m. today in Kansas City.
Morton has put up a rack of Kansas City barbecued ribs and an album of the Gates BBQ Suite composed and performed by saxophone player Bobby Watson, head of the jazz studies program at the UMKC Conservatory of Music and Dance.
In return, Hawgood replied with a selection of Napa Valley wines, Sonoma artisanal cheeses and a gift basket celebrating the opening of the UCSF Medical Center at Mission Bay on Feb. 1, 2015.
"I'm looking forward to a great series between two teams that have overcome long odds all season long. And I'm really looking forward to that Sonoma cheese," Morton said in a statement.
"I appreciate Chancellor Morton's sentiments, and share them," Hawgood replied in a statement. "I look forward to listening to the Gates BBQ Suite and sharing a rack of celebratory ribs and burnt ends with Madison Bumgarner."
UMKC is a public university serving more than 15,000 undergraduate, graduate and professional students in the Kansas City area.
UCSF is the nation's leading university exclusively focused on health. This year marks the university's 150th anniversary as a medical college.
|
<!DOCTYPE html>
<html>
<head>
<title>Single</title>
<!-- for-mobile-apps -->
<meta name="viewport" content="width=device-width, initial-scale=1">
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<meta name="keywords" content="Seafaring Responsive web template, Bootstrap Web Templates, Flat Web Templates, Android Compatible web template,
Smartphone Compatible web template, free webdesigns for Nokia, Samsung, LG, SonyEricsson, Motorola web design" />
<script type="application/x-javascript"> addEventListener("load", function() { setTimeout(hideURLbar, 0); }, false);
function hideURLbar(){ window.scrollTo(0,1); } </script>
<!-- //for-mobile-apps -->
<link href="css/bootstrap.css" rel="stylesheet" type="text/css" media="all" />
<link href="css/style.css" rel="stylesheet" type="text/css" media="all" />
<!-- js -->
<script src="js/jquery-1.11.1.min.js"></script>
<!-- //js -->
<link href='https://fonts.googleapis.com/css?family=Josefin+Sans:400,100,100italic,300,300italic,400italic,600,600italic,700,700italic' rel='stylesheet' type='text/css'>
<link href='https://fonts.googleapis.com/css?family=Open+Sans:400,300,300italic,400italic,600,600italic,700,700italic,800,800italic' rel='stylesheet' type='text/css'>
</head>
<body>
<!-- header -->
<div class="header">
<div class="search">
<form>
<i class="glyphicon glyphicon-search" aria-hidden="true"></i><input type="text" value="Search Here" onfocus="this.value = '';" onblur="if (this.value == '') {this.value = 'Search Here';}" required="">
</form>
</div>
<div class="logo">
<a href="./index.php">Seafaring <span>A Travel Agency</span></a>
</div>
<div class="logo-right">
<ul>
<li><a href="mailto:[email protected]">[email protected]</a></li>|
<li>Contact Us</li>|
<li>+0297 889 908</li>
</ul>
</div>
<div class="clearfix"> </div>
</div>
<div class="header-nav">
<div class="container">
<nav class="navbar navbar-default">
<!-- Brand and toggle get grouped for better mobile display -->
<div class="navbar-header">
<button type="button" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#bs-example-navbar-collapse-1">
<span class="sr-only">Toggle navigation</span>
<span class="icon-bar"></span>
<span class="icon-bar"></span>
<span class="icon-bar"></span>
</button>
</div>
<!-- Collect the nav links, forms, and other content for toggling -->
<div class="collapse navbar-collapse nav-wil" id="bs-example-navbar-collapse-1">
<nav class="cl-effect-1">
<ul class="nav navbar-nav">
<li><a href="./index.php">Home</a></li>
<li><a href="./about.php">About</a></li>
<li><a href="./codes.php">Short Codes</a></li>
<li><a href="./services.php">Services</a></li>
<li><a href="./gallery.php">Photo Gallery</a></li>
<li><a href="./contact.php">Contact Us</a></li>
</ul>
</nav>
</div><!-- /.navbar-collapse -->
</nav>
</div>
</div>
<!-- //header -->
<!-- banner -->
<div class="banner1">
</div>
<!-- //banner -->
<!-- single -->
<div class="single">
<div class="container">
<ol class="breadcrumb breadco">
<li><a href="./index.php">Home</a></li>
<li class="active">Single</li>
</ol>
<div class="single-page-artical">
<div class="artical-content">
<h3>Lorem Ipsum is simply dummy text</h3>
<img class="img-responsive" src="images/banner.jpg" alt=" " />
<p>Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum.
Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum.
Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum.</p>
</div>
<div class="artical-links">
<ul>
<li><span class="glyphicon glyphicon-calendar" aria-hidden="true"></span>September 15,2015</li>
<li><a href="#"><span class="glyphicon glyphicon-user" aria-hidden="true"></span>admin</a></li>
<li><a href="#"><span class="glyphicon glyphicon-envelope" aria-hidden="true"></span>No comments</a></li>
<li><a href="#"><span class="glyphicon glyphicon-bookmark" aria-hidden="true"></span>View posts</a></li>
<li><span class="glyphicon glyphicon-pencil" aria-hidden="true"></span>permalink</li>
</ul>
</div>
<div class="comment-grid-top">
<h3>Responses</h3>
<div class="comments-top-top">
<div class="top-comment-left">
<a href="#"><img class="img-responsive" src="images/co.png" alt=""></a>
</div>
<div class="top-comment-right">
<ul>
<li><span class="left-at"><a href="#">Admin</a></span></li>
<li><span class="right-at">September 15, 2015 at 10.30am</span></li>
<li><a class="reply" href="#">Reply</a></li>
</ul>
<p>It is a long established fact that a reader will be distracted by the readable content of a page when looking at its layout.The point of using Lorem Ipsum is that it has a more-or-less </p>
</div>
<div class="clearfix"> </div>
</div>
<div class="comments-top-top top-grid-comment">
<div class="top-comment-left">
<a href="#"><img class="img-responsive" src="images/co.png" alt=""></a>
</div>
<div class="top-comment-right">
<ul>
<li><span class="left-at"><a href="#">Admin</a></li>
<li><span class="right-at">September 15, 2015 at 10.30am</span></li>
<li><a class="reply" href="#">Reply</a></li>
</ul>
<p>It is a long established fact that a reader will be distracted by the readable content of a page when looking at its layout.The point of using Lorem Ipsum is that it has a more-or-less </p>
</div>
<div class="clearfix"> </div>
</div>
</div>
<div class="artical-commentbox">
<h3>leave a comment</h3>
<div class="table-form">
<form>
<input type="text" value="Name" onfocus="this.value = '';" onblur="if (this.value == '') {this.value = 'Name';}">
<input type="email" value="Email" onfocus="this.value = '';" onblur="if (this.value == '') {this.value = 'Email';}">
<input type="text" value="Phone number" onfocus="this.value = '';" onblur="if (this.value == '') {this.value = 'Phone number';}">
<textarea value="Message:" onfocus="this.value = '';" onblur="if (this.value == '') {this.value = 'Message';}">Message</textarea>
<input type="submit" value="Send">
</form>
</div>
</div>
</div>
</div>
</div>
<!-- single -->
<!--footer-->
<div class="footer">
<div class="container">
<div class="footer-row">
<div class="col-md-3 footer-grids">
<h4><a href="./index.php">Seafaring</a></h4>
<p><a href="mailto:[email protected]">[email protected]</a></p>
<p>+2 000 222 1111</p>
<ul class="social-icons">
<li><a href="#" class="p"></a></li>
<li><a href="#" class="in"></a></li>
<li><a href="#" class="v"></a></li>
<li><a href="#" class="facebook"></a></li>
</ul>
</div>
<div class="col-md-3 footer-grids">
<h3>Navigation</h3>
<ul>
<li><a href="./index.php">Home</a></li>
<li><a href="./about.php">About us</a></li>
<li><a href="./services.php">Services</a></li>
<li><a href="./codes.php">Typo</a></li>
<li><a href="./contact.php">Contact</a></li>
</ul>
</div>
<div class="col-md-2 footer-grids">
<h3>Support</h3>
<ul>
<li><a href="./gallery.php">Photo Gallery</a></li>
<li><a href="#">Help Center</a></li>
<li><a href="#">Lemollisollis</a></li>
</ul>
</div>
<div class="col-md-4 footer-grids">
<h3>Newsletter</h3>
<p>It was popularised in the 1960s with the release Ipsum. <p>
<form>
<input type="text" class="text" value="Enter Email" onfocus="this.value = '';" onblur="if (this.value == '') {this.value = 'Enter Email';}">
<input type="submit" value="Go">
</form>
</div>
<div class="clearfix"> </div>
</div>
</div>
</div>
<div class="footer-bottom">
<div class="container">
<p>Copyright © 2016.Company name All rights reserved.More Templates <a href="http://www.cssmoban.com/" target="_blank" title="index"></a> - Collect from <a href="http://www.cssmoban.com/" title="网页模板" target="_blank">网页模板</a></p>
</div>
</div>
<!--//footer-->
<!-- for bootstrap working -->
<script src="js/bootstrap.js"> </script>
<!-- //for bootstrap working -->
</body>
</html>
|
Reviews of the Winners of the Best Foreign Film Oscars
|
THE small Polish town of Pacanow has survived wars, revolutions and floods. It is a nondescript place, but it has one advantage over cities renowned for their cathedrals and palaces. Its own claim to fame is indestructible: it is home to Koziolek Matolek, the goat at the middle of the country’s best-known children's comic book. “When I first went to visit Pacanow, it was very depressed, with 40% unemployment,” recalls Waldemar Dabrowski. “I thought, this is crazy, Pacanow is famous to every Pole.” At the time Mr Dabrowski, the head of the Polish National Opera in Warsaw, was the country’s culture minister. It was 2002 and Poland was pushing towards its long-desired entry into the European Union. “I told the city council, ‘We’re in a market economy now; what matters is name recognition. Have the goat work for your prosperity,’” says Mr Dabrowski.
So the council did—and the town is now home to the country’s first fairy-tale museum (pictured). Inspired by the goat’s potential, Mr Dabrowski went to Brussels to put a proposal to the European Commission: the Polish government was going to invest heavily in cultural infrastructure and he wanted the EU to match the Polish funding. The result would be a network of new or rebuilt opera houses, museums, theatres and concert halls that would not only benefit Polish concert-goers, but also the EU. As Mr Dabrowski, who remains Poland’s de facto cultural impresario, put it to Viviane Reding, the culture commissioner at the time: “People with access to culture work better and have a better family life than those who don’t.” Poland, which had seen its relatively small number of concert halls and opera houses decay during decades of communist rule, would provide an excellent opportunity to test the hypothesis.
More than 700 projects duly received 4.7 billion zloty (around €1.2 billion) from the Polish government between 2007 and 2013, including 79 projects as part of the national programme (2.3 billion zloty) and some 650 projects as part of the regional programme (2.4 billion zloty). During the same period, the country got €67 billion from the EU’s structural fund, of which just over €1 billion was for the development of cultural infrastructure and the protection and preservation of heritage.
The investments have generated a remarkable audience boom. Between 2004 and 2013, the number of museum visitors rose from 17.5m to 29.0m, visitors to art galleries from 3.0m to 4.5m and audiences for theatres and concerts from 9.3m to 11.5m. Mr Dabrowski’s plan has borne considerable fruit on a smaller level too. Pacanow’s museum receives 500 visitors a day. Białystok, a city of around 300,000 souls near Poland’s eastern border, has a new opera house and concert hall. In Zakliczyn, a tiny town two hours from Krakow, young musicians attend classes with leading practitioners at the Krzysztof Penderecki European Centre for Music. Mr Penderecki, a famous composer of atonal works, teaches there too.
Despite its sizeable population—some two million in the metropolitan region—Katowice had previously lacked a concert hall. Now it has a new one for the Polish National Radio Symphony Orchestra, as well as an Academy of Music. The Krakow Opera also has a new building, as do the Szczecin Philharmonic, the Academy of Music in Poznan and the Polish Baltic Frédéric Chopin Philharmonic in Gdansk.
“We used to play in a really uncomfortable hall: poor place, poor sound,” says Ewa Strusinska, the music director and principal conductor of the Szczecin Philharmonic. “Our new building...has made an enormous difference both for the players and the audience.” Ms Strusinska points out that the orchestra’s season is now sold out, even though the new building has two halls and thus more seats to fill. “And we’re getting a new audience,” she adds. “It’s easy to tell because people are clapping between the movements.”
Mr Dabrowski is unapologetic about a cultural splurge that will not necessarily cater to all tastes. “A country needs culture in order to grow,” he argues. “Otherwise society is just about fulfilling biological needs. If you create artistic spaces, new talent will emerge.”
|
Zhang X‐G, Zhang T, Li C‐Y, Zhang M‐H, Chen F‐M. CD164 promotes tumor progression and predicts the poor prognosis of bladder cancer. Cancer Med. 2018;7:3763--3772. 10.1002/cam4.1607
Xiao‐Guang Zhang and Tong Zhang are contributed equally to the article.
1. INTRODUCTION {#cam41607-sec-0001}
===============
Bladder cancer (BC) is the ninth most common cancer and the thirteenth deadliest worldwide with 81190 newly diagnosed cases and 17240 deaths estimated in USA, 2018.[1](#cam41607-bib-0001){ref-type="ref"} Most of bladder cancers are derived from urothelial cells, and roughly 75% of patients are nonmuscle invasive bladder cancer (NMIBC) and 25% have muscle invasive (MIBC) or metastatic disease.[2](#cam41607-bib-0002){ref-type="ref"} Despite the continuous development of medical techniques, the diagnostics, treatments, and survivals for bladder cancer have been largely unchanged since the 1990s.[3](#cam41607-bib-0003){ref-type="ref"} Although NMIBC patients with a better prognosis than MIBC, and even through tumors can be successfully identified and removed before they become invasive, BC has a high rate of recurrence and progression.[4](#cam41607-bib-0004){ref-type="ref"} Cystoscopies are the gold standard for diagnosis of BC, but they are expensive and uncomfortable.[5](#cam41607-bib-0005){ref-type="ref"} And they sometimes fail to find types of tumor that have not yet become invasive but are aggressive, such as carcinoma in situ.[6](#cam41607-bib-0006){ref-type="ref"} With the limitations of present diagnosis and treatment, researching into cancer genomics, risk markers, and targeted therapies could hold the key to progress against this malignant disease.
CD164, also known as endolyn or MGC‐24v, is a member of sialomucin family, which is conversed and encoded by CD164 gene located on human chromosome 6q21.[7](#cam41607-bib-0007){ref-type="ref"}, [8](#cam41607-bib-0008){ref-type="ref"} CD164 was first identified in primitive CD34^+^ hemopoietic progenitor cells and bone marrow stromal cells and has been found to be involved in proliferation, migration, and adhesion of these cells.[9](#cam41607-bib-0009){ref-type="ref"}, [10](#cam41607-bib-0010){ref-type="ref"}, [11](#cam41607-bib-0011){ref-type="ref"} By facilitating the adhesion and migration of human CD34^+^ cells to bone marrow stroma, CD164 was proposed to regulate hematopoiesis.[12](#cam41607-bib-0012){ref-type="ref"} In human cancers, CD164 was reported played roles in many different cancers. For instance, CD164 has been reported for the maintenance and progression of human tumors, such as human glioma,[13](#cam41607-bib-0013){ref-type="ref"} lung cancer,[14](#cam41607-bib-0014){ref-type="ref"} ovarian cancer,[15](#cam41607-bib-0015){ref-type="ref"} and prostate cancer.[16](#cam41607-bib-0016){ref-type="ref"} Besides, some microRNAs such as miR‐124 and miR‐219 were found that could suppress the proliferation, migration, and invasion of tumor cells by targeting CD164.[17](#cam41607-bib-0017){ref-type="ref"}, [18](#cam41607-bib-0018){ref-type="ref"} However, the roles of CD164 in BC have not yet been studied and are still unclear.
In this study, we systematically researched the roles of CD164 in BC. The immunohistochemistry was used to investigate the associations between CD164 and clinical outcomes of BC patients. Then, the functions of CD164 in tumor proliferation, migration, and invasion were studied in vivo and in vitro. According to these, we hoped to find an effective marker which may become the potential therapeutic target of BC.
2. MATERIALS AND METHODS {#cam41607-sec-0002}
========================
2.1. Patients and samples {#cam41607-sec-0003}
-------------------------
One hundred and fifteen patients clinically and pathologically diagnosed with urothelial carcinoma of bladder in third central hospital of Tianjin and provincial hospital affiliated to Shandong university were included in our study. Tumor tissues were obtained after the first surgical treatment (TURBt or Cystectomy). The clinical and pathological characters such as ages, genders, pTMN stage, tumor grade, tumor sizes, lymph metastasis, and vascular invasion were record. The tumor stage was classified by 2009 UICC TMN staging and tumor grade was determined according to the 2004 WHO/ISUP classification.[19](#cam41607-bib-0019){ref-type="ref"}, [20](#cam41607-bib-0020){ref-type="ref"} Written informed consents and approval from the institution ethics commission of third central hospital of Tianjin and provincial hospital affiliated to Shandong university were obtained.
2.2. Immunohistochemistry and scoring {#cam41607-sec-0004}
-------------------------------------
Bladder tumor specimens were fixed by 10% v/v formalin solution, and embedded in paraffin. One hundred and fifteen paraffin‐embedded tissues collected from the third central hospital of Tianjin were sliced into 4‐μm sections and baked at 65°C for 30 minutes. Then, the sections were performed with EDTA (pH = 8.0) and 3% H~2~O~2~ in methanol. The tissues sections were cultured with: anti‐CD164 antibodies (rabbit; 1:200; sigma), anti‐CXCR4 antibodies (rabbit; 1:200; sigma) overnight at 4°C in a moist chamber. Then, the second antibody was added and incubated at room temperature for 1 hour. The sections were counterstained using hematoxylin and incubated with streptavidin‐horseradish peroxidase complex. For the results, CD164 cytoplasmic staining was scored by using 4‐point scales (0, no staining; 1+, light staining at high magnification; 2+, intermediate staining; 3+, dark staining of linear membrane at low magnification). Besides, an immunostaining score (*H*‐score) was measured by the multiplication of CD164 and CXCR4 stained cells and the corresponding intensity score.[21](#cam41607-bib-0021){ref-type="ref"} According to the distribution of *H*‐scores, the CD164 and CXCR4 were divided into high and low expression groups, respectively.
2.3. Cell culture {#cam41607-sec-0005}
-----------------
Human urothelial bladder cancer T24 and 5637 cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). According to the instructions, both of T24 and 5637 cells were cultured in RPMI‐1640 medium containing 1% penicillin streptomycin and 10% fetal bovine serum with 5% CO~2~ at 37°C.
2.4. Plasmid construction and Lentiviral transfection {#cam41607-sec-0006}
-----------------------------------------------------
CD164 short hairpin RNA oligonucleotide sequence (shRNA) was used to knock down the expression of CD164 gene. The sequence of CD164 shRNA was as follows: 5′‐TGAGAAAGC TCTCCACTCTGTTCAAGAGACAGAGTGGAGAGCTTTCTCTTTTTTC‐3′. And a scramble shRNA was performed as the negative control. The efficacy of knocking‐down was verified by RT‐qPCR and Western blot. Then, qualified cells were selected for using in later experiments.
2.5. RT‐PCR {#cam41607-sec-0007}
-----------
Total RNA was extracted from tumor tissues and cells using TRIzol reagent (Thermo, American) according to the instructions. RNA was reversely transcripted to cDNA by the cDNA Reverse Transcription Kit (Sangon Biotech, China). Quantitative PCR was performed on a Smart Cycler using SGExcel FastSYBR Mixture (With Low ROX) Plus (Sangon biotech). A comparative threshold cycle (Ct) method, which compares differences in CT values between common control and target RNA, was used to process the real‐time PCR data.[22](#cam41607-bib-0022){ref-type="ref"} The primer sequences of CD164 were as follows: (Forward) 5′‐TGAGCCCTGAACACCAGAGAG‐3′, and (Reverse) 5′‐AAAGCCAGATGAGCGCTTCTA‐3′.
2.6. Western blot {#cam41607-sec-0008}
-----------------
Cells and tissues were lysed in RIPA lysis buffer, and proteins concentrations were measured by using the bicinchoninic acid (BCA) method. Cell/tissue lysates were separated by SDS‐PAGE gels and transferred to PVDF membranes (Thermo, American). Then, the blots were blocked by 5% dry milk and incubated with the primary antibodies: anti‐CD164 (rabbit; 1: 1000 dilution; Cambridge, UK), anti‐β‐actin (mouse; 1:1000 dilution; Cambridge, UK), anti‐Ki67 (rabbit; 1:1000; Cambridge, UK), anti‐PCNA (mouse; 1:500 dilution; Cambridge, UK), anti‐MMP2 (mouse; 1:1000 dilution; Cambridge, UK), and anti‐MMP9 (mouse; 1:1000 dilution; Cambridge, UK) monoclonal antibodies overnight at 4°C. Then, the samples were incubated with the secondary antibody (polyclonal goat anti‐rabbit/mouse, 1:10 000 dilutions, Rockland Immunochemicals Inc, PA) for 1 hour at room temperature and detected by chemiluminescence.
2.7. Colony formation array {#cam41607-sec-0009}
---------------------------
Four hundred cells per well of T24 and 5637 cells were seeded into 60 mm dishes and cultured at 37°C in 5% CO~2~. After 10 days, cells were fixated with 10% formaldehyde for 5 minutes and stained 10‐30 minutes with Giemsa. Finally, the colonies were counted using an optional microscope and the colonies with diameters \>2 mm were counted. The arrays were performed in triplicate.
2.8. MTT array {#cam41607-sec-0010}
--------------
T24 and 5637 cells were seeded into 24‐well plates with a density of 2 × 10^3^ cells/well and 10 μL of 5 mg/mL MTT reagent was added into each well for 4 hours at 37°C. Then, the media were removed, and dimethyl sulfoxide (DMSO, Sigma) was added. The absorbance was measured at 570 nm. The arrays were repeated in triplicate.
2.9. Wound and healing assay {#cam41607-sec-0011}
----------------------------
2 × 10^4^/well of T24 and 5637 cells were seeded in 12‐well plates and grown to a confluence. Then a scratch was created using a sterile 200 μL pipette tip and cells were calculated at 37°C in 5% CO~2~. The distance between the edges of both sides was measured, which represented the ability of cell migration. Three repeated arrays were carried out.
2.10. Transwell array {#cam41607-sec-0012}
---------------------
The transwell membrane with Matrigel Substrate (BD, USA) was used to investigate the invasion of tumor cells. 2 × 10^5^ cells were added into the upper chambers, and the low chambers were filled with the RPMI‐1640 supplemented with 10% FBS. The cells were calculated for 24 hours at 37°C in 5% CO~2~. The cells under the surface of the lower chamber were fixed and stained with 0.1% crystal violet. The number of cells was observed from 5 randomly selected photographs under a microscope (magnification, ×200). The arrays were performed in triplicate.
2.11. Animal study {#cam41607-sec-0013}
------------------
All animal experiments in our study were approved by the Animal Care and Use Committee of the third central hospital of Tianjin. BALB/c nude mice (5‐weeks old) were purchased from Slac Laboratory Animal Co. Ltd. (Shanghai, China). 1 × 10^7^ T24 cells transfected with CD164 shRNA and controls were subcutaneously injected into the right armpits of mice. The growth of tumors was monitored over a 7‐week period, and the tumor volumes were measured. After 49 days, tumors were harvested and mice were euthanized. Besides, to investigated the association between CD164 and metastasis of bladder tumor cells. T24 cells transfected with CD164 shRNA and controls were injected into mice tail vein. The metastatic tumors of lung were detected, after 4 weeks, the mice were euthanized, and tumors were harvested.
2.12. Statistic analysis {#cam41607-sec-0014}
------------------------
The data in this study were analyzed by SPSS.22.0. Quantitative dates were assessed by mean ± SD. According to the variance homogeneity or not, parametric test and nonparametric test were used respectively. Chi‐square tests were used to analyze the associations between the expression of CD164 and the clinicopathological features. Chi‐square tests and correlation analysis (Pearson and Spearman) were performed to analyze the associations between CD164 and CXCR4. Kaplan‐Meier method was performed to estimate the prognosis of patients. For the results, *P *\< .05 for the difference was considered to be significant.
3. RESULTS {#cam41607-sec-0015}
==========
3.1. Association between CD164 and clinical‐pathological features of patients with BC {#cam41607-sec-0016}
-------------------------------------------------------------------------------------
Immunohistochemistry of tumor tissues from 115 patients diagnosed with BC in third central hospital of Tianjin and provincial hospital affiliated to Shandong university was performed to investigated the association between the expression of CD164 and clinical‐pathological characters of patients. Both of the nucleuses and cytoplasm (mainly) of tumor cells were dyed and the typical strong and weak staining of CD164 was shown, while CD164 was negative in the normal bladder tissues (Figure [1](#cam41607-fig-0001){ref-type="fig"}A,B). The results showed that CD164 was significantly associated with distant metastasis and vascular invasion (*P *\< .05). A high level of CD164 was related to the distant metastasis and vascular invasion of BC. However, no associations were found between CD164 and ages, genders, tumor grade, pTMN stage, and lymph node metastasis (Table [1](#cam41607-tbl-0001){ref-type="table"}).
{#cam41607-fig-0001}
######
Relationships of CD164 and clinicopathological characteristics in 115 patients with BC
Feature All n = 115 CD164 expression χ^2^ *P*
----------------------- ------------- ------------------ ------ ----- --
Age (year) 2.184 .139
\<65 46 18 28
≥65 69 18 51
Gender 0.332 .565
Male 99 30 69
Female 16 6 10
Tumor stage 0.208 .648
T2 35 12 23
T3/T4 80 24 56
Tumor grade 1.408 .235
Low 33 13 20
High 82 23 59
Lymph node metastasis 1.669 .196
Yes 35 8 27
No 80 28 52
Recurrence 1.948 .163
Yes 59 15 44
No 56 21 35
Distant metastasis 5.830 .016
Yes 51 10 41
No 64 26 38
Vascular invasion 5.967 .015
Yes 64 14 50
No 51 22 29
John Wiley & Sons, Ltd
3.2. Association between CD164 and prognosis of BC patients {#cam41607-sec-0017}
-----------------------------------------------------------
Kaplan‐Meier method was performed to estimate the association between CD164 and the prognosis of patients. Overall survival (OS) and relapse‐free survivals (RFS) were followed up by cystoscopy in our center with every 3 months during the first year, then every 6 months during the following years. The results found that CD164 was significantly associated with the survivals of patients (Figure [1](#cam41607-fig-0001){ref-type="fig"}C). As was shown, high level of CD164 was suggested to be related to the short PFS and OS (*P *\< .05).
3.3. Stably knocking down CD164 in both T24 and 5637 cell lines {#cam41607-sec-0018}
---------------------------------------------------------------
CD164 shRNA was used to knock down the expression of CD164 gene in both T24 and 5637 cell lines. The expression of CD164 in shRNA and control groups was detected in RT‐qPCR and Western blot. The results found that the expression of CD164 was dramatically decreased in shRNA group compared to controls (*P *\< .05), which indicated that we have effectively knocked down the expression of CD164 in both cell lines (Figure [2](#cam41607-fig-0002){ref-type="fig"}).
{#cam41607-fig-0002}
3.4. Silencing of CD164 inhibited the proliferation of tumor cells by regulating Ki67 and PCNA {#cam41607-sec-0019}
----------------------------------------------------------------------------------------------
Colony formation and MTT arrays were performed to investigate the impact of CD164 on the proliferation of tumor cells. The results exhibited that comparing to controls, silencing of CD164 could inhibit the proliferation of both T24 and 5637 cells (*P *\< .05; Figure [3](#cam41607-fig-0003){ref-type="fig"}A,B). Then, to further explore the mechanism of CD164 in tumor proliferation, some proliferation‐related proteins were identified and detected. The result found that the expressions of Ki67 and proliferating cell nuclear antigen (PCNA) were decreased when we silenced the expression of CD164 (*P *\< .05; Figure [3](#cam41607-fig-0003){ref-type="fig"}C,D). In conclusion, the results revealed that silencing of CD164 could inhibit the proliferation of tumor cells by regulating the expression of proliferation‐related proteins such as Ki67 and PCNA.
{#cam41607-fig-0003}
3.5. Silencing of CD164 inhibited the migration and invasion of tumor cells by regulating MMP2 and MMP9 {#cam41607-sec-0020}
-------------------------------------------------------------------------------------------------------
Wound and healing assay and transwell array were used to investigate the associations of CD164 with migration and invasion of tumor cells. The data showed that by knocking down CD164, the abilities of migration and invasion of tumor cells were decreased (*P *\< .05; Figure [4](#cam41607-fig-0004){ref-type="fig"}A,B). Regarding the mechanism, we examined the expression of proteins that reflected the invasion and migration of tumor cells. By silencing of CD164, the expressions of matrix metalloproteinases‐2 (MMP2) and matrix metalloproteinases‐9 (MMP9) protein were inhibited in our study (*P *\< .05; Figure [4](#cam41607-fig-0004){ref-type="fig"}C,D). Taken together, we suspected that CD164 could promote the migration and invasion of bladder tumor cells through regulating relevant proteins including MMP2 and MMP9.
{#cam41607-fig-0004}
3.6. Knocking down CD164 restrict the growth and metastasis of tumors in mice {#cam41607-sec-0021}
-----------------------------------------------------------------------------
To further demonstrate the roles of CD164 in tumor progression, we researched the influence of CD164 on tumor growth and metastasis in mice. Transfected T24 cells in CD164 shRNA and control groups were injected subcutaneously into the right armpits of mice separately. After 2 weeks, tumor volumes were measured every 7 days. From the growth curve, tumors in CD164 shRNA group were grow slower than controls. After 49 days, tumors were harvested and measured. The results demonstrated that by knocking down CD164, the growth of tumors were restricted obviously in mice (*P *\< .05; Figure [5](#cam41607-fig-0005){ref-type="fig"}A). Besides, T24 cells in 2 groups were injected into mice tail vein to observe the difference of lung metastasis. The results suggested that the metastatic tumors in CD164 shRNA group were obviously smaller than controls (*P *\< .05; Figure [5](#cam41607-fig-0005){ref-type="fig"}B). Western blot and immunohistochemistry were preformed to detect the expression of CD164 in mice tumors. We found CD164 was dramatically decreased in CD164 shRNA group (Figure [5](#cam41607-fig-0005){ref-type="fig"}C,D), which confirmed that an effective and stable knocking‐down of CD164 was built in mice tumors. In summary, our findings demonstrated that silencing of CD164 could restrict the growth and metastasis of tumors in mice.
{#cam41607-fig-0005}
3.7. Co‐expression existed between CD164 and CXCR4 in bladder cancer tissues {#cam41607-sec-0022}
----------------------------------------------------------------------------
As CD164 acted as a CXCR4‐associated sialomucin, the relationship between CD164 and CXCR4 has been researched in many different cancers.[15](#cam41607-bib-0015){ref-type="ref"}, [23](#cam41607-bib-0023){ref-type="ref"} In our study, we used the immunohistochemistry to observe the association between the expression of CD164 and CXCR4 in tumor tissues by uninterrupted slicing. The typical staining was shown (Figure [6](#cam41607-fig-0006){ref-type="fig"}A). The results found that an obvious positive correlation was existed (Figure [6](#cam41607-fig-0006){ref-type="fig"}B). Therefore, we speculated that CD164 possibly played roles in bladder cancer through regulating the expression of CXCR4 and relevant pathways.
{#cam41607-fig-0006}
4. DISCUSSION {#cam41607-sec-0023}
=============
As far as we know, there are no reports mentioned about the roles of CD164 in BC. Our study is the first experiment which systematically researched the associations between CD164 and progression of BC. As we know, BC is a common human carcinoma, although primary tumors can be successfully removed, the tumors recur easily and may progress to muscle‐invasive ones.[24](#cam41607-bib-0024){ref-type="ref"} The traditional standard therapies could restrict the growth and development of tumor. However, they could hardly prevent patients from recurrence and drug resistance.[25](#cam41607-bib-0025){ref-type="ref"} Therefore, researching on novel potential risk markers may provide new directions and progress for the treatment of BC.
CD164, a member of the sialomucin family, was a mucin that contained sialic acid.[26](#cam41607-bib-0026){ref-type="ref"}, [27](#cam41607-bib-0027){ref-type="ref"} As a multifunctional protein, CD164 acted as a surface marker of hematopoietic stem cells, a CXCR4 promoter activity‐enhancing transcription factor, and a stem cell‐specific marker inducer.[9](#cam41607-bib-0009){ref-type="ref"}, [10](#cam41607-bib-0010){ref-type="ref"}, [11](#cam41607-bib-0011){ref-type="ref"} High expression of CD164 was found in several malignant diseases and was associated with clinical outcomes of patients.[13](#cam41607-bib-0013){ref-type="ref"}, [23](#cam41607-bib-0023){ref-type="ref"}, [28](#cam41607-bib-0028){ref-type="ref"}, [29](#cam41607-bib-0029){ref-type="ref"}, [30](#cam41607-bib-0030){ref-type="ref"}, [31](#cam41607-bib-0031){ref-type="ref"} In lung cancer, the positive associations were significantly existed between CD164 expression and tumor size, tumor cell grading, and lymph node involvement.[14](#cam41607-bib-0014){ref-type="ref"} Besides, a high abundance of CD164 protein was significantly correlated with high‐grade of ovarian tumors.[15](#cam41607-bib-0015){ref-type="ref"} In our study, the results of immunohistochemistry from 115 patients showed that high expression of CD164 was associated with clinical‐pathological characters such as distant metastasis and vascular invasion. And high level of CG164 was related to the short OS and RFS of BC patients. All these results implied that CD164 may be a risk marker, which played a role in tumor progression.
Previous studies have revealed that CD164 was involved in tumor progression via the regulation of cell proliferation and apoptosis in several cancers.[13](#cam41607-bib-0013){ref-type="ref"}, [14](#cam41607-bib-0014){ref-type="ref"}, [15](#cam41607-bib-0015){ref-type="ref"}, [23](#cam41607-bib-0023){ref-type="ref"}, [32](#cam41607-bib-0032){ref-type="ref"} In addition, CD164 was implicated in regulating the migration and invasion of lung cancer and medulloblastoma cells.[17](#cam41607-bib-0017){ref-type="ref"}, [18](#cam41607-bib-0018){ref-type="ref"} In vivo, knocking down CD164 could significantly inhibit the tumor growth and metastasis of colon and ovarian cancer in nude mice.[23](#cam41607-bib-0023){ref-type="ref"} Similarly, in our study, silencing of CD164 could significantly inhibit the proliferation, migration, and invasion of tumor cells in vitro. By knocking down CD164, the growth of tumors subcutaneously injected into mice was dramatically restricted. Besides, the lung metastasis of mice in CD164 shRNA group was decreased compared to controls. In summary, the results in our study were consisted with most of previous studies, which revealed that CD164 functioned as a tumor promoter and could promote the progression of tumors in vivo and in vitro.
CXCR4, an upstream molecule of the PI3 kinase/Akt pathway, has been shown to play critical roles in several aspects of tumor progression, such as angiogenesis, metastasis, and survival.[33](#cam41607-bib-0033){ref-type="ref"}, [34](#cam41607-bib-0034){ref-type="ref"}, [35](#cam41607-bib-0035){ref-type="ref"}, [36](#cam41607-bib-0036){ref-type="ref"}, [37](#cam41607-bib-0037){ref-type="ref"} An earlier study suggested that CD164 acted as a component of a CXCR4 complex and regulated the migration of CD133^+^ cells. [38](#cam41607-bib-0038){ref-type="ref"} In recent years, many studies have indicated that CD164 played a role in tumor progression by interacting with CXCR4 and regulating the downstream of CXCR4 pathway.[23](#cam41607-bib-0023){ref-type="ref"} Knocking‐down of CD164 could up‐regulate PTEN and inhibit the activities of PI3K/AKT pathway.[13](#cam41607-bib-0013){ref-type="ref"} Besides, CD164 promoted lung tumor‐initiating cells with stem cell activity and determined tumor growth and drug resistance through Akt/mTOR signaling pathway.[14](#cam41607-bib-0014){ref-type="ref"} Therefore, we suspected that CD164 may also play roles in tumor progression of BC through CXCR4/AKT signaling pathway. More studies in the future were needed to confirm the mechanism of CD164 in BC.
In conclusion, our study was the precedent experiment which systematically researched the roles of STK32C in tumor progression of BC. From the results, we speculated that CD164 was a tumor promoter which could promote the progression of several carcinomas possibly by regulating CXCR4 relevant proteins and activating CXCR4/AKT signaling pathway. The results were needed to be verified, and exact mechanism of the functions of CD164 in BC should be researched and confirmed in the future.
The results of our study showed that CD164 was associated with the poor clinical outcomes of BC patients. Silencing of CD164 could inhibit the proliferation, migration, and invasion of tumor cells. In vivo, knocking down CD164 hindered the growth and metastasis of tumors in mice. In all, our results revealed that CD164, as a tumor promoter, played an essential role in tumor progression, which may become a potential treatment target of BC patients.
COMPLIANCE WITH ETHICAL STANDARDS {#cam41607-sec-0024}
=================================
All applicable international, national, and/or institutional guidelines for the care and use of animals were followed.
CONFLICT OF INTEREST {#cam41607-sec-0025}
====================
None declared.
|
In the field of implantable medical devices, such as cardiac pacemakers, tachyarrhythmia control devices, implantable drug dispensing devices, monitoring devices, and nerve stimulators, it has become common to provide a transceiver system for performing functions such as the remote programming and the telemetering of data out of the implanted device. For example, in such devices, it has become desirable to have the ability to reprogram the device's modes of operation, parameters, and other functions and/or to monitor the performance of such devices, both historically and contemporaneously. Generally, such implantable medical devices are designed to provide two-way telemetry by radio frequency signal transmission between the implanted medical device and a programming head or wand of an external communication device, e.g., external programmer apparatus, to provide for the exchange of coded transmitted information therebetween.
As the complexity of implantable medical devices increases over time, telemetry systems for enabling such implantable devices to communicate with external communication devices, e.g., programmers, has become more important. For example, it is desirable for a user, e.g., a physician, to noninvasively exercise some amount of control over the implantable medical device, e.g., to turn the device on or off after implantation, to adjust various parameters of the implantable medical device after implantation, etc.
Further, as implantable medical devices include more advanced features, it is typically necessary to convey correspondingly more information to the implantable medical device relating to the selection and control of such advanced features. For example, if a pacemaker is selectively operable in various pacing modes, it is desirable that a physician be able to noninvasively select a mode of operation. Further, for example, if a pacemaker is capable of pacing at various rates, or of delivering stimulating pulses of varying energy levels, it is desirable that the physician be able to select, on a patient-by-patient basis, appropriate values for such variable operational parameters.
Not only has the complexity of implantable medical devices led to the need to convey correspondingly more information to the implantable medical device, but it has also become desirable to enable the implanted medical device to communicate information outside of the patient to an external communication device, e.g., programmer. For example, for diagnostic purposes, it is desirable for the implanted device to be able to communicate information regarding its operational status to the physician. Various implantable medical devices are available which can transmit such information to an external communication device, e.g., the transmission of a digitized ECG signal for display, storage, and/or analysis by the external communication device.
As used herein, the term “uplink” and “uplink telemetry” will be used to denote the communications channel for conveying information from the implanted medical device to an external communication device, e.g., a programmer. Conversely, the term “downlink” and “downlink telemetry” will be used to denote the communications channel for conveying information from an external communication device to the implanted medical device.
Various telemetry systems for providing the necessary communication channels between an external communication device and an implanted medical device have been described. For example, typically, telemetry systems are employed in conjunction with an external programmer/processing unit. A programmer for noninvasively programming a cardiac pacemaker is described in the following U.S. patents to Hartlaub, et al., each commonly assigned to the assignee of the present invention: U.S. Pat. No. 4,250,884, entitled “Apparatus for and Method of Programming the Minimum Energy Threshold for Pacing Pulses to be Applied to a Patient's Heart;” U.S. Pat. No. 4,273,132, entitled “Digital Cardiac Pacemaker with Threshold Margin Check;” U.S. Pat. No. 4,273,133, entitled “Programmable Digital Cardiac Pacemaker with Means to Override Effects of Reed Switch Closure;” U.S. Pat. No. 4,233,985, entitled “Multi-Mode Programmable Digital Cardiac Pacemaker;” U.S. Pat. No. 4,253,466, entitled “Temporary and Permanent Programmable Digital Cardiac Pacemaker;” and U.S. Pat. No. 4,401,120, entitled “Digital Cardiac Pacemaker with Program Acceptance Indicator.” Aspects of the programmer that are the subject of the foregoing Hartlaub et al. patents are described in U.S. Pat. No. 4,208,008 to Smith, entitled “Pacing Generator Programming Apparatus Including Error Detection Means,” and in U.S. Pat. No. 4,236,524 to Powell et al., entitled “Program Testing Apparatus.”
Most commonly, telemetry systems for implantable medical devices employ a radio frequency (RF) transmitter and receiver in the implantable medical device, and a corresponding RF transmitter and receiver in the external communication device, e.g., programming unit. Within the implantable medical device, the transmitter and receiver use an antenna for receiving downlink telemetry signals and for radiating RF signals for uplink telemetry. For example, the radiating RF signals may be magnetically coupled through inductive (antenna) coils.
To communicate digital data using RF telemetry, a digital encoding scheme such as described in U.S. Pat. No. 5,127,404 to Wyborny et al., entitled “Improved Telemetry Format,” is used. In particular, for example, in downlink telemetry a pulse interval modulation scheme may be employed wherein the external communication device, e.g., programmer, transmits a series of short RF “bursts” or pulses in which the duration of an interval between successive pulses, e.g., the interval from the trailing edge of one pulse to the trailing edge of the next pulse, encodes the data. For example, a shorter interval may encode a “0” bit while a longer interval may encode a “1” bit.
The external communication devices, e.g., programming devices, typically interface with the implanted medical device through the use of a programming head or paddle. For example, generally, the programming head or paddle is a hand-held unit adapted to be placed on or near the patient's body over the implant site of the patient's implanted medical device. The programming head may effect closure of a reed switch in the implantable medical device using a magnet to initiate a telemetry session. Thereafter, uplink and downlink communication may take place between the implanted medical device's transmitter/receiver and the receiver/transmitter of the external communication device. Other methods of initiating a telemetry session may also be used. For example, a wake-up pulse from an external communication device may be used to wake-up the implanted medical device, which polls its downlink receiver at an appropriate interval.
For programming arrangements, and/or for monitoring arrangements, both uplink and downlink telemetry signal strength vary as a function of programming head positioning relative to the implantable device. In other words, the signal strength varies as a function of the coefficient of coupling between the communication head, e.g., programming head including an antenna configuration, and the implanted device. Therefore, it is important for the programming head to be properly positioned over the patient's implant site so that downlink RF signals can be detected in the implantable medical device and uplink signals can be detected by the programming head of the external communication device. For example, if the programming head is too far away from the implantable medical device, the attenuation of RF signals transmitted across the boundary of the patient's skin may be too great, preventing a telemetry link from being established.
As such, with appropriate feedback to a user, the user can position and reposition the programming head over the implant site until a suitable position is located to a establish a valid communication link between the external communication device and the implanted medical device. Various feedback techniques have been used to indicate to a user when a programming head has been properly located over a patient's implanted medical device to establish a valid telemetry link.
For example, one technique used for determining when the programming head is properly positioned can be characterized as an “open loop” technique in that the determination of the correct head positioning is based solely upon an assessment of whether the uplink signal (i.e., the signal transmitted from the implanted medical device to the external communication device) meets some minimum requirement. In such an open loop verification system, adequate downlink signal strength is not tested. For example, an open loop system for determining the proper positioning of a programming head is described in U.S. Pat. No. 4,531,523 to Anderson, entitled “Digital Gain Control for the Reception of Telemetry Signals from Implanted Medical Devices.”
A communication protocol using handshaking can also be used to verify that a minimum downlink field strength for detection in the implanted medical device exists to signal a physician that correct head positioning has been achieved. However, conventional handshaking protocols do not provide any information useable for optimization of head positioning to ensure an adequate operating margin. In other words, proper programming head positioning may be indicated even though the programming head is actually marginally positioned, such that a very slight shift in positioning (e.g., due to patient motion) results in downlink telemetry failure.
Further, closed loop systems have also been described for providing feedback to a user for positioning of the communication head for attaining a valid communication link with an implanted medical device. For example, in U.S. Pat. No. 5,324,315 to Grevious, entitled “Closed-Loop Downlink Telemetry and Method for Implantable Medical Device,” a specific type of downlink telemetry pulse is transmitted from the external communication device to the implanted medical device. In particular, the downlink pulses are bursts having a linear ramping envelope. The characteristics of the downlink burst envelope are such that the amplitude of the signal as detected by the implanted medical device's receiver, relative to the receiver's detection threshold, can be ascertained by measuring the time that the detected burst exceeds the receiver's detection threshold. This information can be communicated to the external communication device. In response to receipt of such information regarding the relative strength of the detected downlink signals, the external communication device can modulate the peak amplitude of the downlink burst envelopes by modulating the gain of the external communication device transmitter. As such, the external communication device can then ensure an adequate margin over the implanted medical device's detection threshold while at the same time avoiding the transmission of unnecessarily high energy downlink signals. As described therein, the downlink signal strength and/or the uplink signal strength can be used for activation of a telemetry status indication.
Generally, as described in U.S. Pat. No. 5,324,315, the provision of feedback as to the proper positioning of a programming head with respect to an implanted antenna of an implanted medical device includes the use of a position indicator, for example, an audible tone generator and/or a visible indicator such as a light emitting diode (LED). When signal strength and accuracy are confirmed (e.g., with parity checking, error checking codes, and the like), programmer control circuitry will cause the position indicator to indicate that a link has been established. If adequate signal strength and content accuracy cannot be confirmed, the position indicator will so indicate.
Further, U.S. Pat. No. 5,107,833 to Barsness, entitled “Telemetry Gain Adjustment Algorithm and Signal Strength Indication in a Noisy Environment,” describes provision of a signal strength indicator for providing the user with a visual alpha-numeric readout of signal strength during establishment of a telemetry link. The signal strength is derived from an automatic gain control factor of an adjustable gain amplification stage of an external communication device, e.g., the adjustable gain amplification stage of the uplink receiver of a programmer which receives its input signals from an RF programming head having an antenna configuration therein. The gain of the uplink receiver is a function of the strength of the uplink signal. As described therein, with a telemetry session initiated and uplink signal loss occurring for performing telemetry, the automatic gain control algorithms scan through gain levels searching for one, which will result in valid uplink detection. A displayed range of signal strengths correspond to the scaled automatic gain control levels or factors. Since the automatic gain control value is lowest for maximum signal level and highest for minimum signal level, the value is complemented for use as a signal strength indicator to the user. As described therein, various levels of automatic gain control could be used. For example, scaled values of 0-100, or values of 0-9, may be used for display to a user attempting to position the programming head. The signal strength indicator may appear on a screen of a programmer or it could appear on the programming head as a numeric display for the user to view as the user attempts to find an optimum position for the programmer head based on the viewed strength signal indication.
Further, programmer heads available under the trade designation 9766/9766A/9767, available from Medtronic, Inc., assignee of the present invention, provide for a multiple LED array display for providing indication of proper positioning of the programmer head. The array is driven as a function of the uplink signal strength. The signal strength is determined as a function of the gain of the uplink receiver. A certain number of LEDs of the LED array are activated based upon the signal strength. For example, when the head is not at an optimum position, only one LED may be lit. As the programmer head is moved around the site of the implanted medical device, more LEDs may be lit indicating more optimal positions. Further, no LEDs of the array may be lit until valid telemetry can be accomplished, i.e., as determined by a handshake process.
As described above, conventional RF heads incorporate various types of indicators to guide placement of the RF head. For example, the 9766 family of RF heads available from Medtronic Inc., assignee of the present invention, incorporate signal strength indicator LEDs to guide placement of the RF head. Further, other positioning techniques have used numerical displays for indicating the signal strength to a user to guide placement of the RF programmer head. However, in brightly lit rooms, LEDs or visual numerical displays are sometimes difficult to see and/or read. As such, these indicators are inadequate for optimal placement of an RF programmer head.
Further, in some circumstances, implantable medical devices are implanted in various regions of the body, which prohibit the viewing of an RF programmer head as it is placed over the implant site. For example, neurostimulators are sometimes implanted in the hip area. As such, when a programming head of an external communication device is placed for performing telemetry over the implant site, the user of the head may find it difficult to view LEDs on the head.
|
Q:
How do I add another printer to Brother ControlCenter4?
I just installed a second printer on my computer. The first printer was a Brother DCP-7065DN, while the second is a Brother MFC-L2740DW. On opening ControlCenter4, I am not able to see the second model from ControlCenter4. I have installed the drivers available for this printer and I am able to print.
How can I add the second model to ControlCenter4?
A:
If you only installed the printer drivers, you will not be able to use ControlCenter4 with the printer. In order to see the model added to ControlCenter4, visit the Brother site and install the Full Driver & Software Package for your printer model. Doing this will allow you to use ControlCenter4 with the new printer.
|
16PF in screening for appropriateness of mentors.
The utility of the Sixteen Personality Factor Questionnaire, Fifth Edition (16PF) as an indicator of mentor effectiveness was examined. A random sample of the 16PF scores of 74 mentors was drawn from a population of 837 mentors from Big Brothers Big Sisters. Caseworkers rated mentor's effectiveness using a rubric developed for this purpose. The rubric showed good interrater agreement. Caseworkers' ratings of mentor's effectiveness was used to rate mentors systematically as appropriate or inappropriate. The 16PF scores of mentors were compared at an alpha level of .05 for appropriate and inappropriate groups using independent t tests and multivariate analyses of variance, which reflected significant differences between male and female mentors on Factors E and Q3. Significant differences were also found between "appropriate" and "inappropriate" mentors on Factors L and Q4. These differences reflected only moderate effect sizes and lacked practical significance or meaning. The results suggest that, while the 16PF discriminates statistically between "appropriate" and "inappropriate" mentors, in terms of practical significance, the questionnaire is not particularly useful as an initial screening tool.
|
Here are some of my favorite quotes from it (all are direct quotes, re-printed with the author’s permission). She writes beautifully and I get shivers reading her story.
“Now imagine spending three entire years dealing with this, suffering in ways you never imagined possible, every day bringing a new version of misery. Some days you can’t walk without pain. Some days your hands and feet burn all day. Some days a migraine slurs your speech, and makes you feel cross-eyed with distorted limbs, and joints twisted up like a pretzel. Some days you feel electrocuted; other days fatigue leaves you with leaden limbs, a supreme effort required for every move. Some days you’ll experience all of the above, and then some.”
“Your small child will grow into a young adult. Much later, you’ll grieve the time you lost with him while in a sickly fog, struggling to work and maintain a semblance of a life. You’ll find yourself making post-death requests to the universe, just in case there is an afterlife, to please let you come back and spend that time with your child. Please let you immerse yourself in those precious, fleeting moments, and enjoy and love him without the weight of illness and misery and constant worry that overshadows any joy life holds.”
“Then, a miracle will occur: like a phoenix rising from the ashes, little glimmers of your long-lost self will begin to return. You’ll remember who you are beyond this sickly, lost person. You’ll realize that beyond your suffering lies an untouchable spirit that will always exist. That illness cannot break you. It may seem to at times, but it cannot change who you are at your very core, no matter how much pain or suffering your body is experiencing. This thought will comfort you in inexplicable ways.”
“The second gift will be in recognizing the lessons which surviving hardship brought you – lessons about perseverance, inner strength, self-worth, confidence, humility, compassion, and forgiveness – and realizing you wouldn’t trade the growth born from these lessons, even if it meant reliving your health struggle all over again. (Though you will still long to have learned them less painfully, would that have been an option.) You’ll realize that, paradoxically, your isolating, alienating illnesses indirectly revealed your underlying connection to everyone you share the world with. You’ll know that although you wouldn’t consider illness a friend, it has certainly been one of your most powerful teachers.”
“You’ll know that saving even one person from the suffering you endured will be worth the potential disbelief, and even ridicule, that may come your way through the telling of your story. You’ll know that you no longer need anyone else to validate your illnesses, or any of your experiences, for that matter. Because, ultimately, your health ordeal has taught you to stand in your own truth with confidence – no matter what others believe, no matter how they might judge you.”
“We also need to change our response to people living with mystery illnesses our medical establishment does not yet acknowledge or understand how to treat, hopefully with more open-mindedness, curiosity, and compassion instead of judgment and dismissive skepticism. Think about this: didn’t most newly discovered illnesses, at one time, begin with a general lack of understanding and acceptance within the medical world? To act as though today’s medical knowledge base is static and impervious to change via new discoveries is misguided and harmful. But every time people – especially doctors – dismiss patients with a condescending disbelief in their illness, clinging tightly to old paradigms, they are effectively halting further scientific understanding for themselves, and potentially the rest of the world as well. They are also denying vital support, empathy, and care to people who suffer.”
Every word in FLUOROQUINOLONE POISONING: A TALE FROM THE TWILIGHT ZONE touches my soul. It’s a profound and beautifully-written story, and I encourage you all to read it in its entirety (it’s 4 pages long, be sure to scroll through each page) and to share it with loved ones. Thank you, Kristin, for speaking out so eloquently.
|
Goalies are voodoo. It’s always fun to make that statement when we’re talking about the randomness associated with the position, but the truth is, we’re not very good at predicting future performance of the men between the pipes. This becomes a problem when you have to make an important roster decision at the league’s most important (and volatile) position.
The Toronto Maple Leafs find themselves in this situation right now, with the backup goalie spot available and three waiver-eligible candidates: Curtis McElhinney, Garret Sparks and Calvin Pickard. All three have interesting resumes, contrasting styles, and extremely polarized fans, which has led to quite the contentious debate online.
In my attempt to analyze this objectively, I’m going to make a case both for and against each goaltender winning the backup role. Before we get started, I wanted to quickly explain the best metric we have to measure goaltending performance.
How...
|
Q:
Automatic deployment of websites and software to windows 2008 server and IIS
I would like to be able to script / automate the deployment / installation of a number of components to Windows server 2008. This is a single server and not part of a domain. I don't want to pay for this tool(s) if possible.
The kind of actions that i would like to be able to automate:
Required:
Installation of .net framework and a few software packages
Creation of directories
Check out of .Net websites from SVN
Check out of other file assets from SVN
Desired:
- Creation of windows accounts
- Setup of ISS
Anyone familiary with software that might assist me ?
A:
What you're asking for is really an installer framework. AFAIK, there is no free tool that does all of what you want (if there is, I'd like to hear about it). You can, however, do all of this using PowerShell scripts but it isn't completely trivial.
A good starting point, if you're already familiar with PowerShell, would be the Windows Core Management Framework: that tool is designed to do most of what you want, at least at the OS level, and it's written in powershell: you can therefore check the source code to see how various tasks are performed.
Another source you can tap is the script center repository. You will find pretty much all you need in the manner of sample scripts for your other tasks.
Finally, you will need to use SVN's command-line to check out your code. It's rather easy.
That's for the general point of view. In more specific instances, you can use a combination of automated OS deployment tools and continuous deployment tools to achieve the same goal (I suggest you check out the "software" section of the wikipedia article for software to try out).
|
Hurricane Harvey’s unprecedented rains and flooding last month caused a leak from a heavily polluted site along the San Jacinto River east of Houston, according to the US Environmental Protection Agency (EPA).
The so-called San Jacinto River Waste Pits, one of several Superfund sites flooded during the storm, contain cancer-causing waste from a paper mill. Harvey’s rains damaged the protective cap that was supposed to hold in the waste, exposing the “underlying waste material,” the EPA says.
cancer-causing waste from a paper mill
Some of the highly toxic chemicals found include dioxins; they’re known to cause reproductive and developmental problems, damage the immune system, and cause cancer, according to the World Health Organization. A sediment sample at the site showed dioxins at 70,000 ng/kg — orders of magnitude higher than the recommended level at the site, which is 30 ng/kg. That’s already trouble, but it gets worse: Certain types of dioxins can be very hard to dispose of, increasing the risks of contamination. The dioxin in the Superfund site waste doesn’t dissolve easily in water, but it can seep into the surrounding sediments, the EPA says.
Following the storm, several chemical plants in and around Houston suffered leaks and even explosions. Several Superfund sites were also flooded, raising fears that the toxic materials could spread to surrounding areas where people live.
In an investigation of the federal clean-up sites in the area, the Associated Press revealed earlier this month that the San Jacinto River Waste Pits were completely covered with floodwaters. The protective cap damaged during the storm was installed in 2011, but required repairs on at least six occasions because parts of it were displaced or went missing, according to the AP. Environmentalists had warned for years that the 34-acre San Jacinto River Waste Pits, and other sites, could be flooded during storms, spreading dangerous chemicals around the Houston area, the AP says.
After confirming the spill, the EPA directed the parties responsible for the Superfund site to test more sediment samples, “to ensure that the exposed waste material is isolated,” the EPA says. The additional sampling will determine whether the dioxins and other toxic sludge has contaminated surrounding sediments.
|
Riding Them Out: Six Flags to Sell Seven Parks
NEW YORK – Theme-park operator Six Flags Inc., which has been struggling with falling attendance and a large debt load, said Thursday it will sell seven of its parks for $312 million.
Shares of Six Flags (SIX) gained 51 cents, or 9 percent, to $5.94 in morning trading on the New York Stock Exchange after the news.
The sale comes after Six Flags underwent a series of changes in recent years, with Mark Shapiro becoming chief executive of the company in December 2005. His appointment followed a proxy fight led by investor and Washington Redskins owner Daniel Snyder that resulted in the ouster of former CEO Keirian Burke and other executives.
The company said the sale is part of its strategy to reduce debt and enhance its operational and financial flexibility. Combined with the June 2006 sale of land underlying its Houston AstroWorld theme park for $77 million, the sale will result in proceeds of $352 million to be used for debt reduction, according to the company.
The parks are being bought by Jacksonville, Fla.-based park operator PARC 7F-Operations Corp., but PARC will simultaneously sell them to Orlando-based real-estate investment trust CNL Income Properties Inc. CNL will then lease the parks back to PARC.
The seven parks include Six Flags Darien Lake in Buffalo, N.Y.; Six Flags Elitch Gardens in Denver; Frontier City and the White Water Bay water park in Oklahoma City; SplashTown in Houston; Waterworld USA in Concord, Calif.; and Wild Waves and Enchanted Village in Seattle.
While the Darien Lake and Elitch Gardens sites will not longer carry the Six Flags brand under the new ownership, any 2007 season passes purchased at the parks will continue to be honored at all Six Flags branded parks for the 2007 season.
The deal is expected to close in March, subject to customary closing conditions.
Six Flags reported last month that 2006 attendance slipped 14 percent from the previous year. In November, the company said third-quarter earnings fell 16 percent to $159.3 million, or $1.08 per share, below Wall Street's expectations. Revenue in that quarter slid 1 percent to $540.7 million.
|
1}.
0
What is prob of sequence kkn when three letters picked without replacement from {k: 10, n: 1, r: 3, q: 5, e: 1}?
1/76
Three letters picked without replacement from hlxkqkk. Give prob of sequence xkq.
1/70
Two letters picked without replacement from {b: 2, i: 2, g: 10}. Give prob of sequence bb.
1/91
Two letters picked without replacement from {o: 1, s: 4, b: 2, c: 4}. What is prob of sequence bs?
4/55
Calculate prob of sequence bhzb when four letters picked without replacement from hhbbzhb.
3/140
Two letters picked without replacement from reqrrwqrqr. Give prob of sequence ew.
1/90
Calculate prob of sequence ks when two letters picked without replacement from jzeqssk.
1/21
What is prob of sequence lmm when three letters picked without replacement from mllmlllm?
5/56
Calculate prob of sequence lnrr when four letters picked without replacement from {l: 5, z: 6, x: 1, n: 5, r: 2}.
25/46512
What is prob of sequence xxx when three letters picked without replacement from xxx?
1
Three letters picked without replacement from ppxpppxp. Give prob of sequence ppx.
5/28
Four letters picked without replacement from kakkkmmek. Give prob of sequence kkkm.
5/126
What is prob of sequence mjm when three letters picked without replacement from {m: 2, j: 10}?
1/66
Four letters picked without replacement from dkrytrrtrdrny. What is prob of sequence knty?
1/4290
Calculate prob of sequence xx when two letters picked without replacement from {r: 4, k: 8, x: 4}.
1/20
What is prob of sequence xv when two letters picked without replacement from {x: 2, k: 1, y: 2, v: 1}?
1/15
Two letters picked without replacement from {u: 1, r: 5, z: 1, x: 10}. What is prob of sequence zx?
5/136
What is prob of sequence mmi when three letters picked without replacement from {s: 5, m: 4, i: 1, u: 1}?
2/165
Three letters picked without replacement from {u: 3, o: 3, x: 2, r: 1, v: 1, k: 1}. What is prob of sequence vku?
1/330
Calculate prob of sequence of when two letters picked without replacement from {o: 1, k: 1, f: 1, s: 2}.
1/20
Four letters picked without replacement from tcrresg. Give prob of sequence creg.
1/420
Calculate prob of sequence ooo when three letters picked without replacement from {m: 1, o: 6, s: 3, i: 3}.
10/143
Calculate prob of sequence bfbp when four letters picked without replacement from {f: 9, p: 2, b: 5}.
3/364
What is prob of sequence rcrb when four letters picked without replacement from bcccrrrcc?
5/504
Two letters picked without replacement from {i: 2, k: 5}. Give prob of sequence kk.
10/21
Two letters picked without replacement from ooenennooooeooooooo. What is prob of sequence nn?
1/57
Calculate prob of sequence gq when two letters picked without replacement from qgbgqlqqgqd.
3/22
Two letters picked without replacement from {e: 1, p: 1, l: 1, b: 1, q: 2, v: 1}. What is prob of sequence vl?
1/42
Three letters picked without replacement from tqqjt. Give prob of sequence tjt.
1/30
Three letters picked without replacement from {v: 5, r: 2, i: 5}. What is prob of sequence vvv?
1/22
Two letters picked without replacement from izdzdbdzekdziik. What is prob of sequence ze?
2/105
Two letters picked without replacement from {v: 1, h: 3, s: 1}. Give prob of sequence sv.
1/20
Two letters picked without replacement from aaaaaaaaaa. What is prob of sequence aa?
1
What is prob of sequence nlt when three letters picked without replacement from {n: 1, e: 1, t: 1, a: 5, l: 1}?
1/504
Three letters picked without replacement from {g: 5, q: 3, j: 2}. What is prob of sequence jjq?
1/120
Calculate prob of sequence vyk when three letters picked without replacement from ktnykvtiyktytkkkin.
1/272
Three letters picked without replacement from {p: 8, t: 4, o: 1, e: 4, i: 1, x: 2}. What is prob of sequence oxp?
2/855
Two letters picked without replacement from {n: 12, l: 1}. What is prob of sequence nn?
11/13
Calculate prob of sequence hrh when three letters picked without replacement from {r: 1, i: 5, h: 11}.
11/408
Calculate prob of sequence jjj when three letters picked without replacement from jjjjjjjjj.
1
Calculate prob of sequence xxj when three letters picked without replacement from jxjjjxjjjjjxjx.
5/91
Four letters picked without replacement from qqzsgqsq. Give prob of sequence qqsz.
1/70
Two letters picked without replacement from uawwwmnnnaana. Give prob of sequence mw.
1/52
Two letters picked without replacement from {t: 2, h: 5, y: 3, a: 8, s: 2}. Give prob of sequence yy.
3/190
Two letters picked without replacement from {c: 6, l: 1, g: 7}. Give prob of sequence lg.
1/26
What is prob of sequence jp when two letters picked without replacement from jttptjttjjpt?
2/33
What is prob of sequence ppii when four letters picked without replacement from {d: 2, i: 4, p: 4}?
1/35
Calculate prob of sequence fb when two letters picked without replacement from fdkbt.
1/20
What is prob of sequence et when two letters picked without replacement from set?
1/6
Two letters picked without replacement from {k: 3, v: 5, m: 1, t: 1, n: 1, b: 1}. Give prob of sequence nv.
5/132
Three letters picked without replacement from {t: 1, u: 2, g: 1, l: 4, v: 1, c: 3}. Give prob of sequence cvg.
1/440
Three letters picked without replacement from mtmenttvt. What is prob of sequence vmt?
1/63
Calculate prob of sequence wtt when three letters picked without replacement from {f: 2, a: 1, x: 2, m: 3, t: 3, w: 1}.
1/220
Four letters picked without replacement from {p: 3, x: 6, t: 3, n: 3}. What is prob of sequence xxxt?
1/91
Four letters picked without replacement from vvyvalvivtytlvillvv. What is prob of sequence yiil?
1/5814
Four letters picked without replacement from ojcoeoj. What is prob of sequence jeco?
1/140
What is prob of sequence dctt when four letters picked without replacement from {t: 4, d: 1, m: 1, e: 1, c: 2}?
1/126
What is prob of sequence jh when two letters picked without replacement from hjhhahhhhjjhjh?
18/91
Four letters picked without replacement from nwpnpnnp. Give prob of sequence pnpn.
3/70
Four letters picked without replacement from {v: 4, d: 1, o: 2, a: 1, n: 2}. What is prob of sequence adnn?
1/2520
Two letters picked without replacement from mgolp. What is prob of sequence go?
1/20
Calculate prob of sequence irr when three letters picked without replacement from wirccwirrrrrcip.
3/91
Three letters picked without replacement from {b: 1, j: 4, a: 1, s: 4}. What is prob of sequence abs?
1/180
Three letters picked without replacement from {v: 2, a: 1}. Give prob of sequence avv.
1/3
Four letters picked without replacement from diidddddd. What is prob of sequence ddii?
1/36
Two letters picked without replacement from {k: 1, r: 2, q: 1, b: 3}. What is prob of sequence kr?
1/21
Two letters picked without replacement from aucvagc. Give prob of sequence cv.
1/21
What is prob of sequence rccr when four letters picked without replacement from cccrrcrcccccccrcrc?
13/306
What is prob of sequence kg when two letters picked without replacement from {m: 2, k: 1, f: 1, t: 2, g: 1, l: 1}?
1/56
Calculate prob of sequence nnu when three letters picked without replacement from nunn.
1/4
Four letters picked without replacement from jdjffjjjf. Give prob of sequence fjdf.
5/504
Three letters picked without replacement from {i: 1, y: 1, m: 9}. What is prob of sequence mim?
4/55
Calculate prob of sequence yyaq when four letters picked without replacement from jpqyyqqqyaqjqpjy.
3/1820
Two letters picked without replacement from {b: 2, x: 3}. What is prob of sequence xx?
3/10
What is prob of sequence ws when two letters picked without replacement from {w: 2, s: 1, b: 2, x: 1, t: 1}?
1/21
Two letters picked without replacement from {g: 1, d: 12, z: 1, j: 2, w: 2}. What is prob of sequence dj?
4/51
Four letters picked without replacement from kdkczcckdckkvkrc. Give prob of sequence vzcr.
1/8736
Two letters picked without replacement from {x: 1, e: 1, y: 1, w: 5, o: 4}. What is prob of sequence ow?
5/33
Calculate prob of sequence dnsd when four letters picked without replacement from oojsdsndsnsononinnnn.
8/14535
What is prob of sequence aa when two letters picked without replacement from {b: 2, a: 11, y: 1}?
55/91
Calculate prob of sequence xi when two letters picked without replacement from ojxjrx
|
Search This Blog
Teachers Day Quotes poems speech
"It is not God that is worshipped but the authority that claims to speak in His name. Sin becomes disobedience to authority not violation of integrity.
Teachers’ Days are intended to be special days for the appreciation of teachers. Some of them are holidays while others are celebrated during working days.
It is the birthday of the second President of India, academic philosopher Dr. Sarvapalli Radhakrishnan. It is considered a "celebration" day, where teachers and students report to school as usual but the usual activities and classes are replaced by activities of celebration, thanks and remembrance. At some schools on this day, the responsibility of teaching is taken up by the senior students as an appreciation for their teachers. *Sarvapalli Radhakrishnan's
Sarvepalli Radhakrishnan One of the foremost scholars of comparative religion and philosophy, he built a bridge between Eastern and Western thought showing each to be comprehensible within the terms of the other. He introduced Western idealism into Indian philosophy and was the first scholar of importance to provide a comprehensive exegesis of India's religious and philosophical literature to English speaking people. His academic appointments included the King George V Chair of Mental and Moral Science at the University of Calcutta (1921-?) and Spalding Professor of Eastern Religions and Ethics at Oxford University (1936-1952).
He was the first Vice President of India (1952-1962), and the second President of India (1962-1967). His birthday is celebrated in India as Teacher's Day ie on 5th Septemberradhakrishnan, teacher s day, teachers day, dr. radhakrishnan, dr. sarvepalli radhakrishnan
Get link
Facebook
Twitter
Pinterest
Google+
Email
Other Apps
Labels
Comments
Popular posts from this blog
Xilinx is the world's one of largest supplier of programmable logic devices. It has started R & D department in Hyderabad, India. It has broad scope for embedded system programming in device driver in linux.
Before the interview you have to feel the Xilinx form with information containing all academic details, current/previous employer, contacts of employer( to check out info about you), current ctc, expected ctc and expected date of joining, etc.
I appeared two back to back technical interviews.
The first interview was taken by a young man look like just crossed 30's.
He asked me to tell me about myself.
Then he asked my experience.
He checked my expertise in resume.
He asked questions about RTOS, and Linux Device Drivers.What is RTOS ? Define it.How a linux device driver works?How a character driver works?
He looked at my project summaries and started to ask in depth questions about each project.
After that he asked me to write to delete nth node from starting in Singly Linked Li…
The history of the Board of Secondary Education Rajasthan (BSER) is a remarkable panorama of progressive record of the futurological vision for developing a dynamic system of various sub-systems of examinations and highlights of the academic excellence of the last four decades. The BSER took rapid strides for promotion and development of Secondary Education in Rajasthan, spread over 3,42,239 sq. km. and in more than 6000 schools located in 32 districts involving 8.5 lakhs students for Secondary and Senior Secondary Examination in the year 2000.
How to delete the last character in a string?Lets say I have a string "/data/share/" I want to delete the last character from the string ie "/" so that output will be "/data/share"; Here are some methods to do this in C language.one way could be use of strncat() function;char*strncat(char*restricts1, constchar*restricts2, size_tn);The strncat() function appends not more than n characters from s2, and then adds a terminating `\0'.#includeAnother simple way is, say the string variable is str_pThen simply put str_p[(strlen(str_p)-1)] = '\0';And you are done;
|
Organ transplantation's considerable benefit is significantly offset by the complications associated with its required chronic immunosuppressive therapy. Patients are usually on several medications, but calcineurin inhibitors (CNIs) have long formed the centerpiece of most regimens. CNIs effectively prevent rejection, but their use is associated with non-antigen-specific T cell suppression, consequent impaired protective immunity, and numerous non-immune side effects. This year, a CNI alternative has been approved: belatacept, a fusion protein that mediates CD28-B7 costimulation blockade (CoB). Substantial clinical evidence suggests that belatacept can serve as a CNI replacement, avoiding CNI-specific off-target side effects. However, belatacept appears less able to prevent rejection in certain scenarios, and to inhomogenously impair viral immunity, particularly towards the common Epstein - Barr virus. Thus, clinicians now have two distinct approaches to prevent transplant rejection, CNI- and CoB-based immunosuppression, but little data guiding a rational choice between them. This application approaches this highly contemporary dilemma in transplantation, the CNI/belatacept choice and its relationship to the reciprocal complications of rejection and viral infection. We hypothesize that rejection and viral infection are mechanisticall related through a process known as heterologous alloimmunity-alloimmunity matured by prior viral infection-and that the changes in T cell phenotype known to emerge throughout life and influence allo- and viral-immunity can be used to anticipate one's response to CNIs and CoB. We believe these phenotypic changes can be used to develop a biologically plausible, therapeutically relevant, and diagnostically definable means of segregating those patients who will benefit from a belatacept-based regimen from those better served by a CNI-based approach. We explore this hypothesis in three Specific Aims, one observational study in humans to define the extent to which viral infection and rejection relate to kidney transplant recipients' T cell differentiation and exhaustion in the context of CNI- or belatacept-based therapy, and two experimental projects performed using well-defined, clinically relevant, mouse models of transplantation and viral infection to establish the mechanisms determining CNI- and CoB-specific effects on allo- and viral-specific-immunity. The investigative team formed for this study is facile in using observations in transplant patients to inform the conduct of rigorously controlled animal studies, and in the use of novel animal experiments to modify human studies. It is centered in a high volume transplant center that has developed an outstanding infrastructure for the acquisition of well-characterized human samples, and exceptional exposure to patients undergoing CNI- and belatacept-based regimens. Thus, each aim will be conducted cognizant of both the relevant clinical circumstances and mechanistic principles. This study will facilitate development of a unifying paradigm to guide the rational selection of immunosuppressive agents, and facilitate individualized, data-driven, immunological management for transplant patients. PUBLIC HEALTH RELEVANCE: The proposed research is relevant to public health because it aims to conduct mechanistically driven studies to optimize the implementation of immunosuppression in general, and belatacept (costimulation blockade) in particular, as an alternative strategy to prevent rejection following organ transplantation. Proper selection of immunosuppression offers the potential to minimize patient morbidity and mortality, optimize allograft survival, minimize the risk of re-transplantation, and reduce the healthcare costs associated with end stage organ failure.
|
Q:
Beginner text editor
I wrote a simple text editor and I would like to get some critical comments. Below I present only a main part of code. I removed icons, irrelevant functions, etc. I am aware,that JTextArea is not best choice for text editor, however I purposely didn't choose JTextPane because at my level it seems too complicated.
I would be very grateful for a comments on:
code structure - is it a good idea, to put everything in the one class, or it would be better to divide it between couple of classes?
division of tasks between classes - is it good solution to use multiple methods to create different parts of a GUI?
events handling - is it good practice to cumulate Action Listeners of multiple objects under one class? or is it better and more transparent to create one class per action or per group of related actions?
fields - is there too many of them? what is a good alternative for them? getter method?
Any other advice will be appreciated.
import javax.swing.*;
import javax.swing.text.*;
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import java.lang.Object;
public class SimpleTextEditor{
private JFrame frame;
private Action newAction,openAction,saveAction,saveAsAction,boldAction,italicsAction,copyAction,cutAction,pasteAction,printAction,findAction;
private JTextArea mainTextArea;
private JTextField findField,replaceField;
private JFileChooser fileChooser;
private File file;
private int boldCheck,italicsCheck,caseCheck,replaceCheck,keepSearch;
private JComboBox<String>fontTypeList,fontSizeList;
private JButton findNext,replace,findAll,replaceAll,okFind,find,previousFind;
private JDialog findDialog;
private JCheckBox caseSensitive;
private Highlighter highlighter;
public static void main(String[]args){
SimpleTextEditor simpleNote=new SimpleTextEditor();
simpleNote.go();
}
private void go(){
frame=new JFrame();
JPanel background = new JPanel();
frame.getContentPane().add(BorderLayout.CENTER, background);
frame.setTitle("New Document"+"-SimpleTextEditor v.2");
frame.setLocationByPlatform(true);
background.setLayout(new BorderLayout());
createActions();
frame.setJMenuBar(getMenu());
background.add(BorderLayout.CENTER, getTextArea());
background.add(BorderLayout.PAGE_START, getToolBar());
findDialog=getFindAndReplace();
frame.setDefaultCloseOperation(WindowConstants.EXIT_ON_CLOSE);
frame.setSize(800,600);
frame.setVisible(true);
}
private JMenuBar getMenu(){
JMenuBar menuBar=new JMenuBar();
JMenu file=new JMenu("File");
JMenu edit=new JMenu("Edit");
JMenu help=new JMenu("Help");
menuBar.add(file);
menuBar.add(edit);
menuBar.add(help);
JMenuItem newFile=new JMenuItem(newAction);
newFile.setIcon(null);
JMenuItem openFile=new JMenuItem(openAction);
openFile.setIcon(null);
JMenuItem saveFile=new JMenuItem(saveAction);
saveFile.setIcon(null);
JMenuItem saveAsFile=new JMenuItem(saveAsAction);
saveAsFile.setIcon(null);
JMenuItem exit=new JMenuItem("Exit");
exit.addActionListener(new exitListener());
JMenuItem print=new JMenuItem(printAction);
print.setIcon(null);
file.add(newFile);
file.add(openFile);
file.add(saveFile);
file.add(saveAsFile);
file.add(print);
file.add(exit);
JMenuItem findAndReplace=new JMenuItem(findAction);
JMenuItem copy=new JMenuItem(copyAction);
JMenuItem cut=new JMenuItem(cutAction);
JMenuItem paste=new JMenuItem(pasteAction);
edit.add(copy);
edit.add(cut);
edit.add(paste);
edit.add(findAndReplace);
return menuBar;
}
private JScrollPane getTextArea(){
mainTextArea=new JTextArea();
highlighter = mainTextArea.getHighlighter();
Font mainFont=new Font("Ariala",Font.PLAIN,12);
mainTextArea.setFont(mainFont);
mainTextArea.setBorder(BorderFactory.createEmptyBorder(10,10,0,10));
mainTextArea.addMouseListener(new ClickListener());
mainTextArea.setLineWrap(true);
mainTextArea.setWrapStyleWord(true);
JScrollPane textScroll=new JScrollPane(mainTextArea);
textScroll
.setHorizontalScrollBarPolicy(ScrollPaneConstants.HORIZONTAL_SCROLLBAR_AS_NEEDED);
textScroll
.setVerticalScrollBarPolicy(ScrollPaneConstants.VERTICAL_SCROLLBAR_AS_NEEDED);
return textScroll;
}
private JToolBar getToolBar(){
boldCheck=0;
italicsCheck=0;
JToolBar toolBar=new JToolBar();
AbstractButton newTool=new JButton(newAction);
AbstractButton openTool=new JButton(openAction);
AbstractButton saveTool=new JButton(saveAction);
AbstractButton printTool=new JButton(printAction);
AbstractButton bold=new JButton(boldAction);
AbstractButton italics=new JButton(italicsAction);
toolBar.add(newTool);
toolBar.add(openTool);
toolBar.add(saveTool);
toolBar.add(printTool);
toolBar.addSeparator();
toolBar.add(getFontSizeList());
toolBar.add(getFontsList());
toolBar.addSeparator();
toolBar.add(bold);
toolBar.add(italics);
toolBar.setFloatable(false);
return toolBar;
}
private JComboBox<String>getFontsList(){
String fonts[]=GraphicsEnvironment.getLocalGraphicsEnvironment()
.getAvailableFontFamilyNames();
fontTypeList=new JComboBox<String>(fonts);
fontTypeList.addActionListener(new ComboBoxListener());
fontTypeList.setSelectedIndex(6);
fontTypeList.setPreferredSize(new Dimension(280,28));
fontTypeList.setMaximumSize(new Dimension(280,28));
return fontTypeList;
}
private JComboBox<String>getFontSizeList(){
String[]size=new String[95];
for(int i=0;i<95;i++){
size[i]=String.valueOf(i+6);
}
fontSizeList=new JComboBox<String>(size);
fontSizeList.setSelectedIndex(6);
fontSizeList.setPreferredSize(new Dimension(49,28));
fontSizeList.setMaximumSize(new Dimension(49,28));
fontSizeList.addActionListener(new ComboBoxListener());
return fontSizeList;
}
public JDialog getFindAndReplace(){
JDialog findAndReplaceWin=new JDialog(frame,"Find and replace");
JPanel findAndReplacePanel=new JPanel();
findAndReplacePanel.setLayout(new GridLayout(7,1,2,2));
JPanel findPanel1=new JPanel(new GridLayout(1,2));
JPanel findPanel2=new JPanel(new GridLayout(1,2));
JPanel replacePanel=new JPanel(new GridLayout(1,2));
keepSearch=0;
findField=new JTextField("find");
replaceField=new JTextField("replace");
find=new JButton("Find");
find.addActionListener(new FARListener());
findNext=new JButton("Next");
findNext.addActionListener(new FARListener());
previousFind=new JButton("Previous");
previousFind.addActionListener(new FARListener());
findAll=new JButton("Find all");
findAll.addActionListener(new FARListener());
replace=new JButton("Replace");
replace.addActionListener(new FARListener());
replaceAll=new JButton("Replace all");
replaceAll.addActionListener(new FARListener());
caseSensitive=new JCheckBox("Case sensitive");
caseSensitive.setSelected(true);
caseSensitive.addActionListener(new FARListener());
okFind=new JButton("OK");
okFind.addActionListener(new FARListener());
findAndReplacePanel.add(findField);
findPanel1.add(find);
findPanel1.add(findAll);
findPanel2.add(findNext);
findPanel2.add(previousFind);
findAndReplacePanel.add(findPanel1);
findAndReplacePanel.add(findPanel2);
findAndReplacePanel.add(replaceField);
replacePanel.add(replace);
replacePanel.add(replaceAll);
findAndReplacePanel.add(replacePanel);
findAndReplacePanel.add(caseSensitive);
findAndReplacePanel.add(okFind);
findAndReplaceWin.add(findAndReplacePanel);
findAndReplaceWin.pack();
findAndReplaceWin.setLocationRelativeTo(frame);
findAndReplaceWin.setVisible(false);
findAndReplaceWin.setEnabled(false);
return findAndReplaceWin;
}
private void createActions(){
newAction=new MainActions("New",null,"Create new file",
KeyStroke.getKeyStroke(KeyEvent.VK_N,InputEvent.CTRL_MASK));
saveAction=new MainActions("Save",null,
"Save file in existing file",KeyStroke.getKeyStroke(
KeyEvent.VK_S,InputEvent.CTRL_MASK));
openAction=new MainActions("Open",null,"Open file",
KeyStroke.getKeyStroke(KeyEvent.VK_O,InputEvent.CTRL_MASK));
saveAsAction=new MainActions("Save as",null,
"Save in selected file",KeyStroke.getKeyStroke(KeyEvent.VK_A,
InputEvent.CTRL_MASK));
boldAction=new MainActions("Bold",null,"Bold font",
KeyStroke.getKeyStroke(KeyEvent.VK_B,InputEvent.CTRL_MASK));
italicsAction=new MainActions("Italics",null,"Italic font",
KeyStroke.getKeyStroke(KeyEvent.VK_I,InputEvent.CTRL_MASK));
printAction=new MainActions("Print",null,"Print the file",
KeyStroke.getKeyStroke(KeyEvent.VK_K,InputEvent.CTRL_MASK));
copyAction=new MainActions("Copy",null,"Copy the selected text",
KeyStroke.getKeyStroke(KeyEvent.VK_C,InputEvent.CTRL_MASK));
cutAction=new MainActions("Cut",null,"Copy the selected text",
KeyStroke.getKeyStroke(KeyEvent.VK_X,InputEvent.CTRL_MASK));
pasteAction=new MainActions("Paste",null,"Copy the selected text",
KeyStroke.getKeyStroke(KeyEvent.VK_V,InputEvent.CTRL_MASK));
findAction=new MainActions("Find and replace",null,
"Search for and replace input word",KeyStroke.getKeyStroke(
KeyEvent.VK_F,InputEvent.CTRL_MASK));
}
private void save(){
try{
file=fileChooser.getSelectedFile();
BufferedWriter writer=new BufferedWriter(new FileWriter(file));
mainTextArea.write(writer);
writer.close();
frame.setTitle(file.getName()+"-SimpleTextEditor v.2");
}catch(IOException ioException){
ioException.printStackTrace();
}
}
public void find(){
String text;
int endPoint;
int findPoint;
text=mainTextArea.getText();
String searchString=findField.getText();
if(caseCheck==1){
text=text.toLowerCase();
searchString=searchString.toLowerCase();
}
Highlighter.HighlightPainter painter=new DefaultHighlighter.DefaultHighlightPainter(
Color.LIGHT_GRAY);
findPoint=text.indexOf(searchString,keepSearch);
endPoint=findPoint+searchString.length();
if(findPoint!=-1){
try{
highlighter.addHighlight(findPoint,endPoint,painter);
}catch(BadLocationException ex){
ex.printStackTrace();
}
keepSearch=endPoint;
}else{
JOptionPane.showMessageDialog(findDialog,
"\""+findField.getText()+"\""+" not found.",
"Warning!",JOptionPane.WARNING_MESSAGE);
}
}
public void replace(){
String text=mainTextArea.getText();
String findString=findField.getText();
String replaceString=replaceField.getText();
text=text.substring(0,keepSearch-findString.length())
+replaceString+text.substring(keepSearch);
mainTextArea.setText(text);
}
private class MainActions extends AbstractAction{
public MainActions(String name,ImageIcon icon,String desc,KeyStroke key){
super(name,icon);
putValue(SHORT_DESCRIPTION,desc);
putValue(ACCELERATOR_KEY,key);
}
public void actionPerformed(ActionEvent event){
Object source=event.getActionCommand();
if(source.equals("New")){
System.out.println(event.getActionCommand());
mainTextArea.setText("");
file=null;
frame.setTitle("New Document"+"-SimpleTextEditor v.2");
}else if(source.equals("Save")){
if(file==null){
fileChooser=new JFileChooser();
fileChooser.showSaveDialog(frame);
save();
}else{
save();
}
}else if(source.equals("Save as")){
fileChooser=new JFileChooser();
fileChooser.showSaveDialog(frame);
save();
}else if(source.equals("Open")){
try{
mainTextArea.setText("");
fileChooser=new JFileChooser();
fileChooser.showOpenDialog(frame);
file=fileChooser.getSelectedFile();
InputStream inputStream=new FileInputStream(file);
InputStreamReader inputReader=new InputStreamReader(
inputStream,"UTF-8");
BufferedReader reader=new BufferedReader(inputReader);
mainTextArea.read(reader,file);
frame.setTitle(file.getName()+"-SimpleTextEditor v.2");
reader.close();
}catch(IOException ioException){
ioException.printStackTrace();
}
}else if(source.equals("Bold")){
if(boldCheck==0){
mainTextArea.setFont(new Font(mainTextArea.getFont()
.getName(),Font.BOLD,mainTextArea.getFont()
.getSize()));
boldCheck=1;
italicsCheck=0;
}else if(boldCheck==1){
mainTextArea.setFont(new Font(mainTextArea.getFont()
.getName(),Font.PLAIN,mainTextArea.getFont()
.getSize()));
boldCheck=0;
italicsCheck=0;
}
}else if(source.equals("Italics")){
if(italicsCheck==0){
mainTextArea.setFont(new Font(mainTextArea.getFont()
.getName(),Font.ITALIC,mainTextArea.getFont()
.getSize()));
italicsCheck=1;
boldCheck=0;
}else if(italicsCheck==1){
mainTextArea.setFont(new Font(mainTextArea.getFont()
.getName(),Font.PLAIN,mainTextArea.getFont()
.getSize()));
italicsCheck=0;
boldCheck=0;
}
}else if(source.equals("Print")){
try{
mainTextArea.print(null,null,true,null,null,true);
}catch(Exception ex){
ex.printStackTrace();
}
}else if(source.equals("Copy")){
mainTextArea.copy();
}else if(source.equals("Cut")){
mainTextArea.cut();
}else if(source.equals("Paste")){
mainTextArea.paste();
}else if(source.equals("Find and replace")){
if(mainTextArea.getSelectedText()!=null){
findField.setText(mainTextArea.getSelectedText());
}
findDialog.setVisible(true);
findDialog.setEnabled(true);
}
}
}
private class ComboBoxListener implements ActionListener{
public void actionPerformed(ActionEvent event){
Object source=event.getSource();
if(source==fontTypeList){
mainTextArea.setFont(new Font(fontTypeList.getSelectedItem()
.toString(),mainTextArea.getFont().getStyle(),
mainTextArea.getFont().getSize()));
}else if(source==fontSizeList){
mainTextArea.setFont(new Font(mainTextArea.getFont().getName(),
mainTextArea.getFont().getStyle(),Integer
.parseInt(fontSizeList.getSelectedItem()
.toString())));
}
}
}
private class ClickListener extends MouseAdapter{
public void mouseReleased(MouseEvent e){
getPopupMenu(e);
}
private void getPopupMenu(MouseEvent e){
JPopupMenu popupMenu=new JPopupMenu();
JMenuItem copy=new JMenuItem(copyAction);
popupMenu.add(copy);
JMenuItem cut=new JMenuItem(cutAction);
popupMenu.add(cut);
JMenuItem paste=new JMenuItem(pasteAction);
popupMenu.add(paste);
JMenuItem find=new JMenuItem(findAction);
popupMenu.add(find);
if(e.isPopupTrigger()){
popupMenu.show(e.getComponent(),e.getX(),e.getY());
}
}
}
private class exitListener implements ActionListener{
public void actionPerformed(ActionEvent e){
System.exit(0);
}
}
private class FARListener implements ActionListener{
public void actionPerformed(ActionEvent e){
Object source=e.getSource();
if(source==find){
highlighter.removeAllHighlights();
keepSearch=0;
replaceCheck=1;
find();
}else if(source==findNext){
highlighter.removeAllHighlights();
find();
}else if(source==previousFind){
highlighter.removeAllHighlights();
System.out.println(keepSearch);
keepSearch=mainTextArea.getText().lastIndexOf(
findField.getText(),
keepSearch-findField.getText().length()-1);
System.out.println(keepSearch);
find();
}else if(source==findAll){
do{
find();
}while(keepSearch<mainTextArea.getText().lastIndexOf(
findField.getText()));
}else if(source==replace){
if(replaceCheck!=0){
replace();
}
replaceCheck=0;
}else if(source==replaceAll){
keepSearch=0;
do{
find();
replace();
}while(mainTextArea.getText().contains(findField.getText()));
}else if(source==caseSensitive){
if(caseSensitive.isSelected()){
caseCheck=0;
}else{
caseCheck=1;
}
}else if(source==okFind){
findDialog.setVisible(false);
findField.setText("find");
replaceField.setText("replace");
mainTextArea.setCaretPosition(mainTextArea.getText().length());
}
}
}
}
A:
You are asking all the right questions :)
code structure - is it a good idea, to put everything in the one class, or it would be better to divide it between couple of classes?
No, putting everything in one giant class is not a good idea at all. It makes it impossible to reuse part of the code in other projects, it makes it really hard to find the code you are interested in, and it will also make it very hard to add new functionality later on (because you can't just concentrate on the relevant classes; you only have one class, so everything is relevant all the time).
A class should ideally only be responsible for one thing. So you might have a model class, which holds the entered text, and offers methods to manipulate it (such as search something in it, replace, etc). Saving/Loading should also happen in a separate class. And you could separate some gui elements into their own class as well (such as main menu, toolbar, search-and-replace window, etc).
You should also definitely split up your actions class. Give each action it's own class. And never use strings like this for program flow (if you must use your approach, use enums).
division of tasks between classes - is it good solution to use multiple methods to create different parts of a GUI?
Yes, definitely. Methods should - just like classes - really only be responsible for one thing. Ideally, this makes them reusable, and it definitely makes your code easier to read.
events handling - is it good practice to cumulate Action Listeners of multiple objects under one class? or is it better and more transparent to create one class per action or per group of related actions
No, such an accumulation is not very good, as it's really hard to read and maintain.
fields - is there too many of them? what is a good alternative for them? getter method?
Yes, you have way too many fields, which makes your code quite hard to read. If you split your code up into multiple classes, you should already see a reduction in fields. Then, you might also notice that some fields don't actually need to be fields, but could be declared at method levels.
Misc
use more spaces to increase readability (eg around =, ==, etc).
don't declare multiple fields in one line, it makes it easy to overlook a field (and it makes it easy to not realize that way too many fields were added :) ).
don't just print the stacktrace of exceptions, but handle them (maybe your users write something important). For example, if you couldn't save, display a popup box notifying the user of this (and give them the opportunity to copy their work).
|
A Supreme Court decision invalidating a partisan gerrymander is the Holy Grail of voting rights litigation and, just like the Arthurian Grail, has evaded the boldest and the brightest seekers for many years. And yet Tuesday’s oral arguments in Rucho v. Common Cause and Lamone v. Benisek — challenges to two of the most aggressive gerrymanders in the country — offered a glimmer of hope.
Just over a year ago, there appeared to be five justices ready to join an opinion striking Wisconsin’s especially egregious state legislative gerrymander. Instead, Justice Anthony Kennedy chose to take his crucial fifth vote and quite literally go home. With the nomination of archconservative Judge Brett Kavanaugh to fill Kennedy’s seat, an anti-gerrymandering decision appeared further from reach.
On Tuesday, however, Kavanaugh appeared skeptical of one of the primary pillars that conservative justices have used in the past to prop up gerrymandering. That skepticism, combined with some quick thinking by Justice Elena Kagan, may ultimately prove enough to take down gerrymanders in North Carolina and Maryland.
Given the Supreme Court’s history of flirting with an anti-gerrymandering decision and then coyly backing away, no one should assume yet that the court will ultimately hold that the Constitution limits partisan gerrymanders. But Tuesday’s hearing gave something unfamiliar to Americans who, whipsawed by the combination of gerrymandering, Senate malapportionment, and the Electoral College, have come to fear that the United States will descend into an anti-democratic death spiral: Hope.
“Proportional representation”
Tuesday’s duo of cases present both major political parties at their worst.
In Rucho, Republicans drew congressional maps in the swing state of North Carolina that were designed to ensure that the state’s delegation would have 10 Republicans and 3 Democrats. The co-chair of the state’s redistricting committee literally bragged that they settled on this goal because it wasn’t “possible to draw a map with 11 Republicans and 2 Democrats.”
Meanwhile, Benisek involves a Democratic gerrymander in Maryland, executed to ensure that a congressional district that historically was held by a Republican would become a Democratic district. As then-Gov. Martin O’Malley (D) bragged about this gerrymander, the goal was to “put more Democrats and Independents into the Sixth District” in order to ensure “the election of another Democrat.”
Defenders of North Carolina’s gerrymander were represented by Paul Clement, the de facto solicitor general of the Republican Party who often argues Supreme Court cases where the GOP has a great deal at stake. That meant that Clement had to defend a map that consistently produced the same 10 to 3 split in North Carolina’s congressional delegation, even in election years when Democrats won the statewide popular vote. (Currently, North Carolina’s congressional delegation has only nine Republicans. A special election will decide who controls a vacant House seat, after the original result in that election was thrown out thanks to alleged Republican cheating unrelated to the gerrymander.)
Clement’s defense of this map was audacious. He spent much of the oral argument lambasting the very idea that the Constitution requires anything resembling “proportional representation” — that is, any rule which requires a state’s congressional delegation to roughly approximate the actual partisan makeup of the state. It was a bold move, largely because it’s impossible to describe why gerrymandering is bad without speaking in terms of how it produces electoral results that do not resemble the will of the people.
Yet is was also a predictable move by a lawyer tasked with assembling five Republican votes in favor of gerrymandering. More than three decades ago, in a case called Davis v. Bandemer, Justice Sandra Day O’Connor laid out what she believed to be a parade of horribles that will flow from any Supreme Court decision invalidating a partisan gerrymander. “There is simply no clear stopping point,” O’Connor wrote in 1986, “to prevent the gradual evolution of a requirement of roughly proportional representation for every cohesive political group.”
This fear of proportional representation became conservative orthodoxy. Justice Antonin Scalia repeated it in his 2004 plurality opinion in Vieth v. Jubelirer, and the Supreme Court’s most likely votes in favor of gerrymandering — Justice Samuel Alito, Neil Gorsuch, and, to a lesser extent, Chief Justice John Roberts — all seemed sympathetic to Clement’s argument.
Kagan’s quick thinking
The most surprising moment of the morning came shortly before Clement stepped away from the podium. After silently listening to Clement’s argument, Kavanaugh chimed in to suggest that proportional representation provides the courts with a “judicially manageable” standard to assess whether a particular map is gerrymandered.
The search for a “judicially manageable” way to determine which maps count as partisan gerrymanders animated voting rights lawyers for 15 years. Kennedy’s controlling opinion in Vieth refused to strike down the legislative map at issue in that case, but it also offered a seductive promise to future litigants. “If workable standards do emerge to measure” which maps impose too many burdens on the disfavored party, the opinion concluded, then “courts should be prepared to order relief.”
As a parade of five different attorneys took the Supreme Court’s podium, Kavanaugh repeatedly came back to this question of whether the Constitution can be read to forbid egregiously disproportional maps. Kavanaugh’s apparent receptivity to a proportionality standard opens the door to a decision striking down the gerrymanders in Rucho and Benisek.
But mere receptivity may not be enough.
While Kavanaugh kept coming back to the subject of whether the Constitution can be read to mandate roughly proportional representation, Roberts fixated on a closely related question. Rucho, he suggested, is an “extreme case.” But what is a test that future courts can apply in less obvious cases to assess whether a map is an unconstitutional gerrymander? It’s one thing to say that maps must be “roughly proportional,” but how proportional must they be?
One solution to this dilemma is to use a mathematical formula. That was the approach the plaintiffs used in the Wisconsin case the Supreme Court ultimately decided not to decide last year. On Tuesday, Justice Stephen Breyer suggested that, at the very least, maps should be thrown out if a party that gets over 50 percent of the vote is unable to capture more than a third of the legislative seats.
But the most interesting exchange of the two hours of argument came close to the very end, when Justice Kagan floated a non-mathematical test that Kavanaugh and potentially even Roberts appeared open to enshrining in law.
To prevail, Kagan suggested, a plaintiff would not only need to show that a map disadvantaged one party, but also that the legislature intended this result. Proving intent is easy in Rucho and Benisek, thanks to the elected officials who openly bragged about their intentions — but once the Supreme Court announces that intentionally gerrymandering is not allowed, lawmakers will learn to shut their mouths.
After that happens, Kagan continued, a court may still be able to infer an intent to gerrymander when a map is particularly egregious, but the partisan skew of that map would have to be “really dramatic” to justify such an inference.
It’s not a perfect standard — as Kagan noted, the eventual result will be that only the “worst of the worst” maps will be struck down. But it’s something. And it gives the court a way to strike down the maps in Rucho and Benisek without injecting itself into every future redistricting dispute, as Roberts fears.
Will that ultimately be enough to pull Roberts or Kavanaugh into an alliance with the liberal justices? We won’t know the answer to that question until June.
But when the Supreme Court began its session today, Rucho and Benisek appeared certain to end in a 5-4 decision in favor of gerrymandering. Now, it looks like Kagan and Kavanaugh could form an alliance that will produce a very different outcome. They may bring us the Holy Grail.
|
Q:
Opening a file and using the string within
When I open a file (I made myself) I need to use somethings out of the string of text that comes trough. I want to use some parts of the text as coordinates to draw a graph with.
private void openToolStripMenuItem_Click(object sender, EventArgs e)
{
char XgetalEen;
char XgetalTwee;
char YgetalEen;
char Ygetaltwee;
string XgetalSamen = "";
string YgetalSamen = "";
int coordinaatX;
int coordinaatY;
DialogResult lel = MessageBox.Show("Do you want to close this file?", "OPEN", MessageBoxButtons.YesNo, MessageBoxIcon.Question);
if (lel == DialogResult.Yes)
{
Open();
foreach(string s in Gcowde)
{
XgetalEen = s[5];
XgetalTwee = s[6];
YgetalEen = s[8];
Ygetaltwee = s[9];
XgetalSamen += XgetalEen + XgetalTwee;
YgetalSamen += YgetalEen + Ygetaltwee;
if(XgetalTwee==' ')
{
XgetalSamen = "";
XgetalTwee = '0';
XgetalSamen += XgetalTwee + XgetalEen;
YgetalEen = s[7];
Ygetaltwee = s[8];
YgetalSamen = "";
YgetalSamen += YgetalEen + Ygetaltwee;
}
if(Ygetaltwee==' ')
{
Ygetaltwee = '0';
YgetalSamen = "";
YgetalSamen += Ygetaltwee + YgetalEen;
}
MessageBox.Show(XgetalSamen + " " + YgetalSamen);
Int32.TryParse(XgetalSamen, out coordinaatX);
Int32.TryParse(YgetalSamen, out coordinaatY);
currentLocation.X += coordinaatX;
currentLocation.Y += coordinaatY;
Coord.Add(new Point(currentLocation.X, currentLocation.Y));
}
drawerryting();
}
}
public void Open()
{
Gcowde.Clear();
listBox1.Items.Clear();
Coord.Clear();
werkVlak.Clear(Color.Black);
Coord.Add(new Point(pictureBox1.Width / 2, pictureBox1.Height / 2));
drawerryting();
OpenFileDialog openFileDialog1 = new OpenFileDialog();
if (openFileDialog1.ShowDialog() == DialogResult.OK)
{
StreamReader sr = new StreamReader(openFileDialog1.FileName);
string errything = sr.ReadToEnd();
string charAdded = "";
foreach (char s in errything)
{
if (s == '\n')
{
Gcowde.Add(charAdded);
charAdded = "";
}
else
{
charAdded += s;
}
}
foreach (string s in Gcowde)
{
listBox1.Items.Add(s);
}
sr.Close();
}
This is the code how I open the file and get the coordinates out of the string. The string is of this kind L1 G2 X50 Y50. i need to get the 2 50s out of the string.
ps.: the variables are in dutch.
XgetalEen = XnumberOne, XgetalTwee=XnumberTwo,
same goes for Y.
XgetalSamen=XnumberTogether, YgetalSamen=YnumberTogether.
A:
This is a simple example how you could parse the file:
// Read your file using File.ReadAllLines
String[] lines = new[] { "L1 G2 X50 Y50", "L1 G2 X50 Y50" };
foreach (var line in lines)
{
String[] values = line.Split(' ');
string x = values.Where(s => s.StartsWith("X")).First().Replace("X", String.Empty);
int xCoordinate = Convert.ToInt32(x);
}
Don't forget to add all necessary checks and reading of other variables.
|
Hearing impairment and hearing aid usage in Singapore.
To examine the epidemiological and audiological profile, pattern of hearing aid (HA) fitting and usage among HA users in Singapore. Retrospective cross-sectional study. Cohort of 1068 subjects issued with HAs at a tertiary hospital between 2001 and 2013. Mean age was 70 years with 50.8% male. Mean hearing loss (HL) was 63.1 dB and 69.5% had at least moderate-severe HL. Sensorineural HL was present in 66.4% and 69.8% had symmetrical HL. "Behind-the-Ear" HAs were cheaper than "In-Ear" HAs. Standard "Behind-The-Ear" HAs were also cheaper than "Receiver-in-Canal" HAs. Among In-Ear HAs, "In-the-Canal" and "Completely-in-Canal" were more popular than "In-the-Ear" HAs despite costing more. HA was used ≥4 days/week by 85.6% but >7 h per day by only 35.7%. Only 18% received bilateral first HA fitting. In multivariate analysis, younger age and symmetrical HL were predictors of bilateral HA uptake while better Pure-Tone-Audiometry of aided ear and >7 h of daily HA usage were predictors of successive HA fitting. HA users in Singapore were elderly and presented with advanced HL. Bilateral HA adoption and average daily use were low compared to other developed countries. Future research on understanding the suboptimal HA usage should explore patients' motivation, hearing disability, and HA effectiveness.
|
Ford Claims Fuel-Saving Initiatives Adding More Jobs
Ford is claiming that its push towards more fuel efficient technologies is spurring job creation within the company. It has doubled the size of the team working on Ecoboost, turbocharged engines and is adding positions for research and development to investigate future breakthroughs in improving fuel economy.
Ford will convert its Advanced Engineering Center in Dearborn, Michigan, to electric vehicle development and employ 1,000 engineers. Ford also plans to add 12,000 positions in the US by 2015 to build its new, more fuel efficient vehicles.
It plans to bring Ecoboost engines to 11 vehicles by the end of 2012 including a new 1.6l Ecoboost engine that will be in the new Escape and Fusion. The Fusion will also be available as a hybrid and plug-in hybrid later in the year.
“Ford remains absolutely committed to providing a wide range of choices of top fuel economy solutions for our customers – from EcoBoost-powered gasoline vehicles and hybrids to plug-in hybrids and full electrics. To meet growing demand for our fuel-efficient vehicles, we are continuing to invest in new jobs in the U.S. and converting our facilities for further advancements,” said Mark Fields, Ford president of The Americas.
|
Articles of convention and agreement made on the seventeenth day of January, 1837, between the undersigned chiefs and commissioners duly appointed and empowered by the Choctaw tribe of red people, and John McLish, Pitman Colbert, James Brown, and James Perry, delegates of the Chickasaw tribe of Indians, duly authorized by the chiefs and head-men of said people for that purpose, at Doaksville, near Fort Towson, in the Choctaw country.
Article 1. It is agreed by the Choctaws that the Chickasaws shall have the privilege of forming a district within the limits of their country, to be held on the same terms that the Choctaws now hold it, except the right of disposing of it, (which is held in common with the Choctaws and Chickasaws) to be called the Chickasaw district of the Choctaw Nation; to have an equal representation in their general council, and to be placed on an equal footing in every other respect with any of the other districts of said nation, except a voice in the management of the consideration which is given for these rights and privileges; and the Chickasaw people to be entitled to all the rights and privileges of Choctaws, with the exception of participating in the Choctaw annuities and the consideration to be paid for these rights and privileges, and to be subject to the same laws to which the Choctaws are; but the Chickasaws reserve to themselves the sole right and privilege of controlling and managing the residue of their funds as far as is consistent with the late treaty between the said people and the Government of the United States, and of making such regulations and electing such officers for that purpose as they may think proper.
Article 2. The Chickasaw district shall be bounded as follows, viz: beginning on the north bank of Red River, at the mouth of Island Bayou, about eight or ten miles below the mouth of False Wachitta; thence running north along the main channel of said bayou to its source; thence along the dividing ridge between the Wachitta and Low Blue Rivers to the road leading from Fort Gibson to Fort Wachitta; thence along said road to the line dividing Musha-la-tubbee and Push-metahaw districts; thence eastwardly along said district line to the source of Brushy Creek; thence down said creek to where it flows into the Canadian River, ten or twelve miles above the mouth of the south fork of the Canadian; thence west along the main Canadian River to its source, if in the limits of the United States, or to those limits; and thence due south to Red River, and down Red River to the beginning.
Article 3. The Chickasaws agree to pay the Choctaws, as a consideration for these rights and privileges, the sum of five hundred and thirty thousand dollars-thirty thousand of which shall be paid at the time and in the manner that the Choctaw annuity of 1837 is paid, and the remaining five hundred thousand dollars to be invested in some safe and secure stocks, under the direction of the Government of the United States, redeemable within a period of not less than twenty years-and the Government of the United States shall cause the interest arising therefrom to be paid annually to the Choctaws in the following manner: twenty thousand dollars of which to be paid as the present Choctaw annuity is paid, for four years, and the residue to be subject to the control of the general council of the Choctaws; and after the expiration of the four years the whole of said interest to be subject to the entire control of the said council.
Article 4. To provide for the future adjustment of all complaints or dissatisfaction which may arise to interrupt the peace and harmony which have so long and so happily existed between the Choctaws and Chickasaws, it is hereby agreed by the parties that all questions relative to the construction of this agreement shall be referred to the Choctaw agent to be by him decided; reserving, however, to either party, should it feel itself aggrieved thereby, the rights of appealing to the President of the United States, whose decision shall be final and binding. But as considerable time might elapse before the decision of the President could be had in the meantime the decision of the said agent shall be binding.
Article 5. It is hereby declared to be the intention of the parties hereto, that equal rights and privileges shall pertain to both Choctaws and Chickasaws to settle in whatever district they may think proper, and to be eligible to all the different offices of the Choctaw Nation, and to vote on the same terms in whatever district they may settle, except that the Choctaws are not to vote in anywise for officers in relation to the residue of the Chickasaw fund.
In testimony whereof, the parties hereto have hereunto subscribed their names and affixed their seals, at Doaksville, near fort Towson in the Choctaw country, on the day and year first above written.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.